CN115058537A - Kelp breeding method - Google Patents

Kelp breeding method Download PDF

Info

Publication number
CN115058537A
CN115058537A CN202210728265.8A CN202210728265A CN115058537A CN 115058537 A CN115058537 A CN 115058537A CN 202210728265 A CN202210728265 A CN 202210728265A CN 115058537 A CN115058537 A CN 115058537A
Authority
CN
China
Prior art keywords
kelp
heat
resistant
genotype
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210728265.8A
Other languages
Chinese (zh)
Inventor
袁廷柱
宋祖德
王学现
刘凯
李辰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong Academy Of Marine Sciences Qingdao National Marine Science Research Center
Marine Economic Promotion Center Of Changdao Marine Ecological Civilization Comprehensive Experimental Zone
Original Assignee
Shandong Academy Of Marine Sciences Qingdao National Marine Science Research Center
Marine Economic Promotion Center Of Changdao Marine Ecological Civilization Comprehensive Experimental Zone
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong Academy Of Marine Sciences Qingdao National Marine Science Research Center, Marine Economic Promotion Center Of Changdao Marine Ecological Civilization Comprehensive Experimental Zone filed Critical Shandong Academy Of Marine Sciences Qingdao National Marine Science Research Center
Priority to CN202210728265.8A priority Critical patent/CN115058537A/en
Publication of CN115058537A publication Critical patent/CN115058537A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a breeding method of kelp, polymorphism screening is carried out on kelp of heat-resistant strains and non-heat-resistant strains, SSR markers which are linked with the heat resistance of the kelp are determined, and a method for detecting kelp parents with heat-resistant characters is established, so that effective molecular markers are provided for genetic breeding of the kelp. The SSR marker linked with the heat-resistant property of the kelp is obtained by analyzing the amplification products of the heat-resistant kelp strain and the temperature-sensitive kelp strain, and the SSR marker can be used for screening the kelp strain related to heat resistance and screening and identifying hybrid strains.

Description

Kelp breeding method
Technical Field
The invention belongs to the technical field of seaweed genetic breeding, and particularly relates to a kelp breeding method.
Background
Kelp (Laminaria japonica), a large perennial edible algae. The sporophyte is large, brown and flat belt-shaped, and structurally comprises a blade, a handle and a fixer. The fixator is in the shape of a false root, the blades are composed of epidermis, cortex and medulla tissue, and the lower part of the blades is provided with sporangia which have mucus cavities and can secrete slippery substances. The fixer is tree-shaped and branched, is used for attaching to submarine rocks and growing in the sea with lower water temperature.
The kelp is a main object for economic seaweed cultivation, China is also a large country for kelp cultivation, and the cultivation area is about 4.3 kilohm as long as 2016 2 The culture yield is more than 141 ten thousand tons, and the annual output of the kelp accounts for more than sixty percent of the total culture yield of the Chinese algae.
However, the kelp belongs to low-temperature cultivated algae, the harvest period in northern China is concentrated in 5 to 7 months per year, and the kelp stops growing and gradually decays when the water temperature exceeds 20 ℃. And the high-temperature resistant kelp strain effectively prolongs the growth cycle of sporophytes.
At present, the research work of heat-resistant kelp is carried out domestically, for example, yellow sea aquatic product research institutes of China ocean university and China aquatic product science research institute respectively carry out the research of the heat-resistant kelp strain. And some strains (kelp 901) have been actually cultivated.
However, the traditional selective breeding is based on the numerical value of phenotypic characters for breeding, and has the defect of long breeding period. With the development of modern molecular biology technology, molecular marker assisted breeding can overcome the defects that morphological markers adopted in the conventional breeding process are greatly influenced by the environment and are not easy to directly select, and the like, so that the breeding process can be accelerated.
Simple Sequence Repeat (SSR), also known as microsatellite markers, has the advantages of co-dominance, multiple alleles, high variation and the like, is widely distributed in genomes, and is often applied to research such as population genetic analysis, genetic linkage map construction, QTL mapping and the like. Research work related to SSR of kelp has been carried out, but no research related to the association analysis of the heat-resisting property of kelp by using SSR markers is found at present.
Disclosure of Invention
The invention provides a breeding method of heat-resistant kelp, which carries out polymorphism screening on heat-resistant strains and non-heat-resistant strains of kelp, determines SSR markers interlocked with heat resistance of the kelp, and establishes a method for detecting kelp parents with heat-resistant properties, thereby providing effective molecular markers for genetic breeding of the kelp.
The invention firstly provides an SSR marker LJ-SSRm07 linked with the heat-resistant character of kelp, and the nucleotide sequence is as follows:
gtaggcaaaaccatcaacacaacgatttataaaacgacaggacaacaggaaacggccgataaag(ac) n aacgggcgggcgggctggaggcggacgtactcgggaaggtatcacatgtttaggtgtgtaacactaacactctaacgtgttat, respectively; wherein n is a natural number not less than 6;
the invention also provides a primer pair for detecting the SSR markers, wherein the upstream primer sequence of one primer pair is 5'-gtaggcaaaaccatcaacacaacg-3' (SEQ ID NO:1),
the sequence of the downstream primer is 5'-ataacacgttagagtgttagtg-3' (SEQ ID NO: 2);
wherein the upstream primer and/or the downstream primer is/are labeled by fluorescein at the 5' end.
The SSR marker provided by the invention is applied to screening of heat-resistant kelp parents.
The invention also provides a method for screening heat-resistant kelp parents, which is to screen by detecting the genotype marked by LJ-SSRm07 in an individual to be screened;
the method is characterized in that after the primer is used for amplifying the genomic DNA sample of the parent to be screened, the genotype of the amplified product is analyzed.
The genotype of the heat-resistant kelp parent marked by LJ-SSRm07 is 165/177.
The analysis comprises the steps of generating map files of sites by using Genemapper4.0 software, measuring the length and the fluorescence intensity peak value of a PCR amplification product, and obtaining the genotype of each site; determining whether the kelp strain is heat-resistant according to the genotype.
The SSR marker linked with the heat-resistant property of the kelp is obtained by analyzing the amplification products of the heat-resistant kelp strain and the temperature-sensitive kelp strain, and the SSR marker can be used for screening the kelp strain related to heat resistance and screening and identifying hybrid strains.
Drawings
FIG. 1: a PCR electrophoresis detection picture of part of SSR markers,
FIG. 2 is a schematic diagram: the result of capillary electrophoresis of genotype 165/165 is shown,
FIG. 3: the result of capillary electrophoresis of genotype 165/169 is shown,
FIG. 4: the result of capillary electrophoresis of genotype 165/169 is shown,
FIG. 5: genotype 165/177 capillary electrophoresis results.
Detailed Description
The invention searches molecular markers closely related to economic traits and carries out marker-assisted selection, which becomes a research hotspot of current algae genetic breeding.
The present invention will be described in detail below with reference to examples and the accompanying drawings.
Example 1: screening for SSR markers
The SSR locus search analysis is carried out on the kelp gametophyte EST library constructed in China oceanic university by utilizing a MISA tool, and the SSR screening standard is as follows:
the repeated core is SSR locus of two nucleotides, and the repeated times are at least 6 times; the repeated core is SSR locus of trinucleotide, tetranucleotide, pentanucleotide and hexanucleotide, and the repeated times are at least 5 times.
4350 SSR loci are found out, wherein the repetition types of two nucleotides, trinucleotide, tetranucleotide, pentanucleotide and hexanucleotide are 74.10%, 23.70%, 1.20%, 0.06% and 0.04% respectively. Among the single, two, and three nucleotide repeat types, the most numerous repeat motifs are AT, AC, GGA/CAT/TAA, respectively.
50 sites are selected for polymorphism screening, Primer Premier5.0 Primer design software is used for designing detection primers for the EST sequences containing SSR sites, and the objects for amplification detection are a high-temperature-resistant 901 kelp strain preserved in an algae chamber of Shandong province Marine science research institute and a heat-sensitive Rongcheng No. 1 (RC) kelp sample.
The principle of primer design is as follows: the length of the primer sequence is 18-26 bp, the estimated size of an amplification product is 100-400 bp, the G + C content is 40-70%, the annealing temperature is 45-60 ℃, and the difference between the annealing temperature values of the upstream primer and the downstream primer is not more than 2 ℃.
The extension product was subjected to 2.0% agarose gel electrophoresis, and as a result, 38 sites showed polymorphism and 12 sites showed no polymorphism (FIG. 1).
Among the 38 polymorphic sites, 10 sites were selected for genetic diversity analysis. The electrophoresis results showed that 46 alleles were detected in total at 10 sites, with an average allele factor of 4.600, an effective allele factor of 1.054-3.121, an average of 2.007, an observed heterozygosity of 0.0472-0.5724, an average of 0.4103, an expected heterozygosity of 0.0521-0.6121, and an average of 0.059. The PIC values of 7 sites are greater than 0.4, and the PIC values of 3 sites are less than 0.3.
The above results indicate that the genetic polymorphisms of these two breeding lines are relatively low due to long-term artificial selection.
Example 2: SSR marker LJ-SSRm07 and heat resistance correlation analysis
The algae species room of Shandong province oceanic science research institute stores 901 kelp strain (901) with high temperature resistance, Rongfu kelp strain (RF) with high temperature resistance, Rongfu kelp No. 1 kelp (RC) with heat sensitivity, wild kelp (RCW) collected in Rongfu area without high temperature resistance and wild kelp (CDW) collected in Changisland without high temperature resistance. The 901-sea tangle is a new variety obtained by hybridization of Japanese long sea tangle (L.longissima) and early thick line No. one (Laminaria japonica) as female and male parents. The kelp strain has the characteristics of high growth speed, high temperature resistance and decay resistance. The Rongfu kelp strain is a high-temperature-resistant and high-yield kelp variety obtained by carrying out continuous selective breeding after hybrid F1 is obtained by hybridizing female gametophyte clone of Fujian kelp and male gametophyte clone of Yuanzao No. 10 kelp. And Rongcheng No. 1 (RC) kelp is a wild kelp strain which is not bred and has no high temperature resistance. Heat sensitive No. 1 seaweeds (RC), wild seaweeds (RCW) collected in Rongcheng areas and wild seaweeds (CDW) collected in ChangShi and not resistant to high temperature stop growing and decay when the temperature of seawater exceeds 20 ℃; while the high temperature resistant products can grow even when the water temperature exceeds 23-25 ℃.
The amplification detection result shows that the SSR marker LJ-SSRm07 is amplified by an upstream primer with the sequence 5'-gtaggcaaaaccatcaacacaacg-3' and a downstream primer with the sequence 5'-ataacacgttagagtgttagtg-3', and has a specific genotype 165/177 in a high-temperature-resistant strain.
The specific detection process is as follows.
Firstly, extracting the genome DNA of a sample
1. Grinding:
in 5 groups of kelp samples, 5 sporozoites were selected for each group and ground thoroughly to a powder, the grinding was maintained with liquid nitrogen in a mortar, and the powder was transferred to a 50mL centrifuge tube. 12mL of 2% CTAB extract (2% CTAB, 3% PVP) preheated at 60 ℃ and 2.5% beta-mercaptoethanol were added to the mixture, and the mixture was gently and thoroughly mixed. And water bath at 60 deg.C for 60 min.
2. Extraction:
1) to the extract was added chloroform-isoamyl alcohol (24: 1) mix by gentle and thorough inversion for 10min, 12000rpm, and centrifuge for 10 min. The supernatant was aspirated, 10% CTAB (fully preheated at 60 ℃ C.) 0.1 volume fold added to the supernatant, gently mixed for 1min, and subjected to water bath at 60 ℃ for 10 min.
2) An equal volume of phenol-chloroform-isoamyl alcohol (25: 24: 1) gently and thoroughly mixed, and then centrifuged at 12000rpm for 10 min.
3) The supernatant was aspirated, and an equal volume of chloroform-isoamyl alcohol (24: 1) mix lmin gently and thoroughly, then centrifuge at 12000rpm for 10 min. The supernatant was aspirated.
3. And (3) precipitation:
1) to the supernatant was added 2/3 volumes of isopropanol (-20 ℃ pre-cooled) and mixed gently and thoroughly. After 30min standing at-20 ℃, 12000rpm was centrifuged for 5min to precipitate DNA.
2) 1ml of 70% absolute ethanol was added, and the mixture was left at room temperature for 10min, and gently shaken to float the flocs. And (4) washing for 3 times, pouring out the washing buffer solution, then putting the centrifugal tube on an ultra-clean workbench, and airing.
4. Dissolving:
200. mu.l of ultrapure water was added to the DNA precipitate for dissolution. After dissolving, 5-8 mul of RNase is added, and RNA is removed in water bath at 37 ℃ for 30 min.
5. And (3) detection:
DNA integrity and quality was checked by 1% agarose electrophoresis. Quantitatively estimating the DNA concentration by an ultraviolet spectrophotometer and a gel, and estimating the purity of the DNA according to the value of OD260/OD 280; the DNA samples were stored at-20 ℃ until use.
Secondly, PCR amplification and fluorescence detection
Amplification was performed using the extracted DNA as a template, an upstream primer of sequence 5'-gtaggcaaaaccatcaacacaacg-3' and a downstream primer of sequence 5'-ataacacgttagagtgttagtg-3'. The PCR reaction was carried out in a total volume of 25. mu.L, using 20ng of genomic DNA as a template, and using Taq enzyme (Takara) to label fluorescein FAM (blue) at the 5' -end of the forward primer. The PCR reaction conditions were as follows: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 58 ℃ for 30s, 72 ℃ for 20 s; extending for 5min at 72 ℃; storing at 4 ℃.
The PCR products were subjected to automated fluorescence detection using an ABI3730XL (applied biosystems, USA) DNA analyzer.
Thirdly, analyzing and detecting data
The amplification profile file for each sample was generated using genemapper4.0 software to obtain the genotype for each sample (table 1), and four genotypes were co-amplified in the five lines, 165/165 (fig. 2), 165/169 (fig. 3), 169/169 (fig. 4) and 165/177 (fig. 5), respectively.
Table 1: genotype information table of LJ-SSRm07 in five kelp lines
Figure BDA0003711598650000071
Figure BDA0003711598650000081
As can be seen from the results in Table 1, the 177bp amplified fragment did not exist in the non-heat-resistant strain, i.e., the sequence was
gtaggcaaaaccatcaacacaacgatttataaaacgacaggacaacaggaaacggccgataaag(ac) n aacgggcgggcgggctggaggcggacgtactcgggaaggtatcacatgtttaggtgtgtaacactaacactctaacgtgttat, in the non-thermotolerant strains, n is mainly 12 and 14 in number, and there is no case where n is 15.
In the heat-resistant strain, specific fragments with the length of 177bp exist, and can be used as specific molecular markers for screening heat-resistant kelp parents.
On the basis of the findings, 30 strains of the 901 kelp strain and 30 strains of the wild kelp (CDW) which is collected from the long island and does not resist high temperature are subjected to large-sample-size detection. As a result, a 177bp fragment was not present in CDW even in the large sample assay. Whereas in the 901 kelp line, all individuals carried a 177-long fragment, with a genotype of 165/177 in number of 22, 169/177 in number of 5, and 177/177 in number of 3, indicating that in the kelp thermotolerant line, the LJ-SSRm07 genotype was predominantly 165/177.
The results show that the SSR marker screened by the method can be used for screening the kelp parent with high temperature resistance.
Sequence listing
<110> Shandong province's Marine science research institute (Qingdao national ocean science research center) of the general test area for marine ecology civilization in Long island
<120> method for breeding kelp
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gtaggcaaaa ccatcaacac aacg 24
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ataacacgtt agagtgttag tg 22

Claims (10)

1. An SSR marker linked with a kelp heat-resistant character, which is characterized in that the nucleotide sequence of the SSR marker is as follows:
gtaggcaaaaccatcaacacaacgatttataaaacgacaggacaacaggaaacggccgataaag(ac) n aacgggcgggcgggctggaggcggacgtactcgggaaggtatcacatgtttaggtgtgtaacactaacactctaacgtgttat, respectively; wherein n is a natural number not less than 6.
2. A primer pair for detecting the SSR marker of claim 1, wherein the primer pair is used for amplification of a sample comprising (ac) n Fragments of core repeats.
3. The primer pair of claim 2, wherein the sequence of the upstream primer of the primer pair is SEQ ID NO. 1, and the sequence of the downstream primer of the primer pair is SEQ ID NO. 2.
4. The primer pair of claim 3, wherein the upstream primer and/or the downstream primer of the primer pair is labeled with 5' fluorescein.
5. Use of the SSR marker of claim 1 in the screening of thermostable laminaria parents.
6. A method for screening heat-resistant kelp parents by detecting the genotype of the SSR marker according to claim 1 in an individual to be screened.
7. The method of claim 6, wherein the genomic DNA sample is amplified using the primer set of claim 3 or 4, and the genotype of the amplified product is analyzed to screen the amplified product.
8. The method of claim 7, wherein the genotype comprises a 177bp fragment.
9. The method of claim 7, wherein the genotype is 165/177.
10. The method of claim 7, wherein the method comprises generating a map file of the sites by using Genemapper4.0 software, measuring the length of PCR amplification products and the peak value of fluorescence intensity, and obtaining the genotype of each site; determining whether the kelp strain is heat-resistant according to the genotype.
CN202210728265.8A 2022-06-24 2022-06-24 Kelp breeding method Pending CN115058537A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210728265.8A CN115058537A (en) 2022-06-24 2022-06-24 Kelp breeding method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210728265.8A CN115058537A (en) 2022-06-24 2022-06-24 Kelp breeding method

Publications (1)

Publication Number Publication Date
CN115058537A true CN115058537A (en) 2022-09-16

Family

ID=83201883

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210728265.8A Pending CN115058537A (en) 2022-06-24 2022-06-24 Kelp breeding method

Country Status (1)

Country Link
CN (1) CN115058537A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115948577A (en) * 2023-01-09 2023-04-11 山东省渔业发展和资源养护总站 Breeding method of high-temperature-resistant sea cucumbers

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115948577A (en) * 2023-01-09 2023-04-11 山东省渔业发展和资源养护总站 Breeding method of high-temperature-resistant sea cucumbers
CN115948577B (en) * 2023-01-09 2023-08-22 山东省渔业发展和资源养护总站 Breeding method of high-temperature-resistant sea cucumber

Similar Documents

Publication Publication Date Title
CN108893551B (en) Molecular marking method for detecting high oleic acid content of peanuts and application
CN109554486B (en) SNP molecular marker related to grass carp traits and application thereof
CN107058516B (en) Molecular marker of rice grain width gene GW2 and application thereof
CN105925721B (en) For identifying single nucleotide polymorphism site, primer, kit and the application of Peach fruits epidermis coloring character
CN105506162B (en) SNP (single nucleotide polymorphism) marker related to rapid growth of crassostrea gigas as well as identification method and application thereof
CN114410818B (en) Indel molecular marker primer closely linked with wax gourd fruit size and application thereof
CN114736986B (en) SNP molecular marker related detection primer or probe of major QTL locus of oil content character of brassica napus seeds and application
Muzher et al. Genetic identification of some Syrian local apple (Malus sp.) cultivars using molecular markers
CN109609687B (en) KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof
CN111304337A (en) SRAP molecular marker, kit and method for identifying first filial generation of pelteobagrus fulvidraco, pelteobagrus vachelli and hybride and application
CN115058537A (en) Kelp breeding method
KR102586202B1 (en) Primer set for species discrimination of Mizuhopecten yessoensis, Argopecten irradians and Chlamys farreri nipponensis and method of determining species of Mizuhopecten yessoensis, Argopecten irradians and Chlamys farreri nipponensis using the same
KR101749547B1 (en) Method for identifying species of eel using pna probe
CN114891900B (en) Microsatellite marker for garrupa and primer thereof
CN111057784A (en) SSR molecular marker primer related to walnut black spot and application thereof
CN108841983A (en) A kind of SSR primer of sugarcane overall length transcript profile data large-scale development
CN111876477B (en) Molecular marker primer combination for identifying sex characters of holly plants and application thereof
CN110106270B (en) Molecular marker coseparated from melon yellow seed coat and application thereof
Liu et al. Multiplex PCR sets of novel microsatellite loci for iwagaki oyster Crassostrea nippona and their application in parentage assignment
KR20130037512A (en) Dna polymorphism marker for identification of cucumis sativus l
CN109136392B (en) Genetic diversity identification method and reagent for multi-generation meiotic gynogenesis megalobrama amblycephala
CN108588242B (en) SNP locus of crassostrea gigas AHR gene
CN108531621B (en) SNP locus related to rapid growth of crassostrea gigas
CN112342309B (en) SNP molecular marker related to cotton flower basal leaf spot character and application thereof
CN112831570B (en) Black iso-striated lipocarp microsatellite marker locus and general application thereof in fishes of the genus and the near-source genus

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination