CN107164463A

CN107164463A - It is a kind of to be used for the SNP marker of measure and/or genetic improvement pig growth traits

Info

Publication number: CN107164463A
Application number: CN201710288567.7A
Authority: CN
Inventors: 黄路生; 麻骏武; 李景; 彭颂; 钟烈鹏; 周李生; 杨斌
Original assignee: Jiangxi Agricultural University
Current assignee: Jiangxi Agricultural University
Priority date: 2017-04-27
Filing date: 2017-04-27
Publication date: 2017-09-15
Anticipated expiration: 2037-04-27
Also published as: CN107164463B

Abstract

The application be related to it is a kind of be used for determine and/or genetic improvement pig growth traits SNP marker.The SNP marker includes at least one of 14 kinds of SNP markers, respectively the 16806345th site, the 16940077th site, the 17473931st site, the 17013787th site, the 17096014th site, the 17007981st site, the 16916995th site, the 17102194th site, the 17114026th site, the 16682972nd site, the 16765047th site, the 16788727th site, the 16767555th site and the 17472686th site from holding 5 ' on No. 17 chromosomes of the international pig genome of 10.2 versions.

Description

It is a kind of to be used for the SNP marker of measure and/or genetic improvement pig growth traits

Technical field

The application be related to it is a kind of be used for determine and/or genetic improvement pig growth traits SNP marker.

Background technology

Growth traits is the important indicator in pig economic characters, therefore is the important productivity in kind of swine improvement research Shape, it mainly include in hog on hook body length, trunk plagioclase, carcass weight, thoracic dorsal fat thickness, cervical vertebra overall length it is one or more again etc.. Traditional pig breeding method is by pig kind manual measurement and after visually observing, eliminating " unqualified " boar.This traditional breeding method Method has certain effect, but easily eliminates real valuable boar by mistake, and continuity is not strong, no long-term plan.Based on master The genetic improvement methodological science for imitating gene molecule marker is long-acting and economical quick, is the necessary complement to traditional pig breeding.

The long agro-farming history of China and unique cooking culture cause preference of the our people to pork, and it is six to have pig First of poultry, grain pig pacifies saying for the world.In this year, due to the big ups and downs in market, China's live pig breeding stock glides, and pork yield goes out The phenomenon now slightly declined.Therefore by scientific and technical innovation, cultivate improved seeds, improve Swine Production efficiency, promote industrial upgrading It is the only way which must be passed of guarantee pig industry sustainable growth with scientific and technological progress.

It is mostly DLY tri-crossbreeding that current China market, which delivers live pig for sale, but so far, not yet passes science skill Art means identified the major gene resistance and molecular labeling related to its growth traits.

The content of the invention

One of the application provides the SNP marker of a boar, and the SNP marker is included in following 14 kinds of SNP markers extremely Few one kind,

First SNP marker：The 16806345th from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y in site¹, corresponding to SEQ ID NO:The nucleotides Y in the 346th site from holding 5 ' on 1¹, the Y¹Selected from G Or A；

Second SNP marker：The 16940077th from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y in site², corresponding to SEQ ID NO:The nucleotides Y in the 578th site from holding 5 ' on 2², the Y²Selected from C Or T；

3rd SNP marker：The 17473931st from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y in site³, corresponding to SEQ ID NO:The nucleotides Y in the 501st site from holding 5 ' on 3³, the Y³Selected from G Or A；

4th SNP marker：The 17013787th from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y in site⁴, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 4⁴, the Y⁴Selected from C Or T；

5th SNP marker：The 17096014th from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y in site⁵, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 5⁵, the Y⁵Selected from G Or A；

6th SNP marker：The 17007981st from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y in site⁶, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 6⁶, the Y⁶Selected from A Or G；

7th SNP marker：The 16916995th from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y in site⁷, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 7⁷, the Y⁷Selected from C Or T；

8th SNP marker：The 17102194th from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y in site⁸, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 8⁸, the Y⁸Selected from C Or T；

9th SNP marker：The 17114026th from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y in site⁹, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 9⁹, the Y⁹Selected from G Or A；

Tenth SNP marker：The 16682972nd from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y in site¹⁰, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 10¹⁰, the Y¹⁰Choosing From G or C；

11st SNP marker：The from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y in 16765047 sites¹¹, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 11¹¹, The Y¹¹Selected from G or A；

12nd SNP marker：The from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y in 16788727 sites¹², corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 12¹², The Y¹²Selected from G or T；

13rd SNP marker：The from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y in 16767555 sites¹³, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 13¹³, The Y¹³Selected from A or G；

14th SNP marker：The from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y in 17472686 sites¹⁴, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 14¹⁴, The Y¹⁴Selected from G or C.

In a specific embodiment, the SNP marker is selected from the first SNP marker, the second SNP marker, the 3rd SNP marks At least one of note, the 4th SNP marker, the 5th SNP marker, the 6th SNP marker, the 7th SNP marker and the 8th SNP marker.

The two of the application provide a kind of nucleotide sequence, and the nucleotide sequence is to include the SNP as described in one of the application The nucleotide sequence of mark, the nucleotide sequence is selected from least one of DNA sequence dna, cDNA sequence and RNA sequence.The nucleic acid Sequence is located on No. 17 chromosomes of the international pig genome of 10.2 versions.For example, as long as the nucleotide sequence is including described SNP marker, no matter its length is how many bp, such as its length can be 10bp, 15bp, 20bp, 30bp, 50bp, 80bp, 100bp、120bp、150bp、180bp、200bp、250bp、300bp、400bp、500bp、600bp、700bp、800bp、 1000bp, 1200bp, 1500bp, 2000bp etc., are the application nucleotide sequences claimed, but the nucleotides sequence Row are not limited to cited length.In addition, the SNP marker is normally at the centre bit of selected described nucleotide sequence The position at center is put or relativelys close to, for example, in 20bp selected fragment, the general DNA fragmentations in this 20bp of the SNP In 7-14 in a position；In 1500bp DNA fragmentation, the location of described SNP choice is significantly Increase, it can be a position in 100-1400, preferably in 300-1200 a position, more preferably exist A position in 500-700, the purpose so designed is advantageous for more accurately detecting described SNP marker；But, Detection technique it is especially sensitive and/or it is specific it is very strong in the case of, the SNP marker can also be close to the nucleic acid that select One end in the two ends of sequence, even positioned at first or last position.

In a specific embodiment, the nucleotide sequence is selected from SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO: 3、SEQ ID NO:4、SEQ ID NO:5、SEQ ID NO:6、SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO:11、SEQ ID NO:12、SEQ ID NO:13 and SEQ ID NO:At least one of 14.

In a specific embodiment, the nucleotide sequence is selected from SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO: 3、SEQ ID NO:4、SEQ ID NO:5、SEQ ID NO:6、SEQ ID NO:7 and SEQ ID NO:At least one of 8.

The three of the application provide a kind of SNP marker as described in one of the application measure and/or genetic improvement pig Application in growth traits, the growth traits include hog on hook body length, hog on hook plagioclase, hog on hook weight, pig thoracic dorsal fat thickness and At least one of pig cervical vertebra overall length.

In a specific embodiment, the pig is selected from purebred Landrace, purebred Large White, the synthesis containing long white blood lineage System, the breed system containing long white blood lineage, the hybridized pig containing long white blood lineage, the synthesis system containing great Bai blood lineages, contain great Bai blood At least one of the breed system of system, hybridized pig containing great Bai blood lineages.

In one preferably specific embodiment, the pig is selected from purebred Landrace, purebred Large White, duroc and length Hybridized pig, duroc and the hybridized pig of Large White of white pig, and duroc, Landrace and the boar of Large White three hybridization At least one of pig kind.

For long, the longer hog on hook plagioclase of the hog on hook body for obtaining longer, heavier hog on hook weight, thinner pig thoracic dorsal Fat thickness, the growth traits of longer these pigs of pig cervical vertebra overall length, the four of the application methods for providing the genetic improvement of a boar, Methods described includes：The SNP marker as described in one of power the application of the boar in nucleus herds of breeding pigs is determined, and according to described SNP marker makes corresponding selection：

For the first SNP marker, it is AA and GA bases to be selected in the nucleus herds of breeding pigs in the 16806345th site Because of the boar individual of type, the boar individual for GG genotype in the site is eliminated, with the allele A's by the generation raising site Frequency；It is preferred that selecting the boar individual in the 16806345th site for AA genotype in the nucleus herds of breeding pigs, eliminate In boar individual of the site for GA and GG genotype, with the frequency for the allele A that the site is improved by generation；

For the second SNP marker, it is TT and CT bases to be selected in the nucleus herds of breeding pigs in the 16940077th site Because of the boar individual of type, the boar individual for CC genotype in the site is eliminated, with the allele T's by the generation raising site Frequency；It is preferred that selecting the boar individual in the 16940077th site for TT genotype in the nucleus herds of breeding pigs, eliminate In boar individual of the site for CT and CC genotype, with the frequency for the allele T that the site is improved by generation；

It is AA and GA for the 3rd SNP marker, being selected in the nucleus herds of breeding pigs in the 17473931st site The boar individual of genotype, eliminates the boar individual for GG genotype in the site, to improve the allele A in the site by generation Frequency；It is preferred that selecting the boar individual in the 17473931st site for AA genotype in the nucleus herds of breeding pigs, wash in a pan The boar individual for GA and GG genotype in the site is eliminated, with the frequency for the allele A that the site is improved by generation；

For the 4th SNP marker, it is TT and CT bases to be selected in the nucleus herds of breeding pigs in the 17013787th site Because of the boar individual of type, the boar individual for CC genotype in the site is eliminated, with the allele T's by the generation raising site Frequency；It is preferred that selecting the boar individual in the 17013787th site for TT genotype in the nucleus herds of breeding pigs, eliminate In boar individual of the site for CT and CC genotype, with the frequency for the allele T that the site is improved by generation；

For the 5th SNP marker, it is AA and GA bases to be selected in the nucleus herds of breeding pigs in the 17096014th site Because of the boar individual of type, the boar individual for GG genotype in the site is eliminated, with the allele A's by the generation raising site Frequency；It is preferred that selecting the boar individual in the 17096014th site for AA genotype in the nucleus herds of breeding pigs, eliminate In boar individual of the site for GA and GG genotype, with the frequency for the allele A that the site is improved by generation；

For the 6th SNP marker, it is GG and GA bases to be selected in the nucleus herds of breeding pigs in the 17007981st site Because of the boar individual of type, the boar individual for AA genotype in the site is eliminated, with the allele G's by the generation raising site Frequency；It is preferred that selecting the boar individual in the 17007981st site for GG genotype in the nucleus herds of breeding pigs, eliminate In boar individual of the site for GA and AA genotype, with the frequency for the allele G that the site is improved by generation；

For the 7th SNP marker, it is TT and CT bases to be selected in the nucleus herds of breeding pigs in the 16916995th site Because of the boar individual of type, the boar individual for CC genotype in the site is eliminated, with the allele T's by the generation raising site Frequency；It is preferred that selecting the boar individual in the 16916995th site for TT genotype in the nucleus herds of breeding pigs, eliminate In boar individual of the site for CT and CC genotype, with the frequency for the allele T that the site is improved by generation；

For the 8th SNP marker, it is TT and CT bases to be selected in the nucleus herds of breeding pigs in the 17102194th site Because of the boar individual of type, the boar individual for CC genotype in the site is eliminated, with the allele T's by the generation raising site Frequency；It is preferred that selecting the boar individual in the 17102194th site for TT genotype in the nucleus herds of breeding pigs, eliminate In boar individual of the site for CT and CC genotype, with the frequency for the allele T that the site is improved by generation；

For the 9th SNP marker, it is AA and GA bases to be selected in the nucleus herds of breeding pigs in the 17114026th site Because of the boar individual of type, the boar individual for GG genotype in the site is eliminated, with the allele A's by the generation raising site Frequency；It is preferred that selecting the boar individual in the 17114026th site for AA genotype in the nucleus herds of breeding pigs, eliminate In boar individual of the site for GA and GG genotype, with the frequency for the allele A that the site is improved by generation；

For the tenth SNP marker, it is CC and GC bases to be selected in the nucleus herds of breeding pigs in the 16682972nd site Because of the boar individual of type, the boar individual for GG genotype in the site is eliminated, with the allele C by the generation raising site Frequency；It is preferred that selecting the boar individual in the 16682972nd site for CC genotype in the nucleus herds of breeding pigs, eliminate In boar individual of the site for GC and GG genotype, with the frequency for the allele C that the site is improved by generation；

For the 11st SNP marker, it is AA and GA to be selected in the nucleus herds of breeding pigs in the 16765047th site The boar individual of genotype, eliminates the boar individual for GG genotype in the site, to improve the allele A in the site by generation Frequency；It is preferred that selecting the boar individual in the 16765047th site for AA genotype in the nucleus herds of breeding pigs, wash in a pan The boar individual for GA and GG genotype in the site is eliminated, with the frequency for the allele A that the site is improved by generation；

For the 12nd SNP marker, it is TT and GT to be selected in the nucleus herds of breeding pigs in the 16788727th site The boar individual of genotype, eliminates the boar individual for GG genotype in the site, to improve the allele T in the site by generation Frequency；It is preferred that selecting the boar individual in the 16788727th site for TT genotype in the nucleus herds of breeding pigs, wash in a pan The boar individual for GT and GG genotype in the site is eliminated, with the frequency for the allele T that the site is improved by generation；

For the 13rd SNP marker, it is GG and GA to be selected in the nucleus herds of breeding pigs in the 16767555th site The boar individual of genotype, eliminates the boar individual for AA genotype in the site, to improve the allele G in the site by generation Frequency；It is preferred that selecting the boar individual in the 16767555th site for GG genotype in the nucleus herds of breeding pigs, wash in a pan The boar individual for GA and AA genotype in the site is eliminated, with the frequency for the allele G that the site is improved by generation；

For the 14th SNP marker, it is CC and GC to be selected in the nucleus herds of breeding pigs in the 17472686th site The boar individual of genotype, eliminates the boar individual for GG genotype in the site, to improve the allele C in the site by generation Frequency；It is preferred that selecting the boar individual in the 17472686th site for CC genotype in the nucleus herds of breeding pigs, wash in a pan The boar individual for GC and GG genotype in the site is eliminated, with the frequency for the allele C that the site is improved by generation.

In a specific embodiment, determined using the nucleotide sequence of the boar is analyzed the boar such as the application One of described in SNP marker, wherein the nucleotide sequence is selected from nucleotide sequence as described in the two of the application.Wherein, institute is analyzed Stating the specific method of nucleotide sequence is included in PCR-RFLP and PCR- sequencings and the method as described above for detecting SNP extremely Few one kind.

In addition, conventional detection SNP method has：1) hybridizing method is based on, it, which is at least divided into, a) utilizes △ Tm methods, b) miscellaneous Accompany each other the method for fluorescence probe；2) method based on enzyme, it is at least divided into a) archaeal dna polymerase method, for example, entered using archaeal dna polymerase Performing PCR is expanded, and b) connects enzyme process, c) restriction enzyme enzyme process, d) excision enzyme FEN methods, e) RNase H methods；3) electrophoresis, it is extremely It is divided into SSCP single-strand conformation polymorphisms and DGGE/TGGE denaturing gradient gel electrophoresises less；4) direct sequencing.

The five of the application provide a kind of good and bad method of growth traits for determining pig, and methods described includes：It is determined that described The SNP marker as described in one of the application of pig, and determine according to the SNP marker growth traits of the pig：

For the first SNP marker, it is better than in the 16806345th site for the growth traits of the pig of AA and GA genotype The growth traits of the pig of GG genotype；

For the second SNP marker, it is better than in the 16940077th site for the growth traits of the pig of TT and CT genotype The growth traits of the pig of CC genotype；

It is excellent for the growth traits of the pig of AA and GA genotype in the 17473931st site for the 3rd SNP marker In the growth traits of the pig of GG genotype；

For the 4th SNP marker, it is better than in the 17013787th site for the growth traits of the pig of TT and CT genotype The growth traits of the pig of CC genotype；

For the 5th SNP marker, it is better than in the 17096014th site for the growth traits of the pig of AA and GA genotype The growth traits of the pig of GG genotype；

For the 6th SNP marker, it is better than in the 17007981st site for the growth traits of the pig of GG and GA genotype The growth traits of the pig of AA genotype；

For the 7th SNP marker, it is better than in the 16916995th site for the growth traits of the pig of TT and CT genotype The growth traits of the pig of CC genotype；

For the 8th SNP marker, it is better than in the 17102194th site for the growth traits of the pig of TT and CT genotype The growth traits of the pig of CC genotype；

For the 9th SNP marker, it is better than in the 17114026th site for the growth traits of the pig of GG and GA genotype The growth traits of the pig of AA genotype；

For the tenth SNP marker, it is better than in the 16682972nd site for the growth traits of the pig of GG and GC genotype The growth traits of the pig of CC genotype；

It is excellent for the growth traits of the pig of GG and GA genotype in the 16765047th site for the 11st SNP marker In the growth traits of the pig of AA genotype；

It is excellent for the growth traits of the pig of GG and GT genotype in the 16788727th site for the 12nd SNP marker In the growth traits of the pig of TT genotype；

It is excellent for the growth traits of the pig of GG and GA genotype in the 16767555th site for the 13rd SNP marker In the growth traits of the pig of AA genotype；

It is excellent for the growth traits of the pig of GG and GC genotype in the 17472686th site for the 14th SNP marker In the growth traits of the pig of CC genotype；

The growth traits includes hog on hook body length, hog on hook plagioclase, hog on hook weight, pig thoracic dorsal fat thickness and pig cervical vertebra overall length At least one of, and long hog on hook body length is long better than short hog on hook body, long hog on hook plagioclase is better than short hog on hook Plagioclase, the hog on hook of weight is better than light hog on hook weight again, and thin pig thoracic dorsal fat thickness is better than thick pig thoracic dorsal fat thickness, long pig cervical vertebra Overall length is better than short pig cervical vertebra overall length.

In one preferably specific embodiment, determined using the nucleotide sequence of the pig is analyzed the pig such as this Shen SNP marker described in one of please, wherein the nucleotide sequence is selected from the nucleotide sequence as described in the two of the application.

The beneficial effect of the application：

14 SNP marker close linkages of the application, particularly the first SNP marker, the second SNP marker, the 3rd SNP marks The close linkage degree of note, the 4th SNP marker, the 5th SNP marker, the 6th SNP marker, the 7th SNP marker and the 8th SNP marker Higher, linkage degree (r2) reaches 0.6.And the SNP marker of these close linkages is oblique with including hog on hook body length, hog on hook Growth traits including long, hog on hook weight, pig thoracic dorsal fat thickness and pig cervical vertebra overall length is closely related, therefore can be 14 by this At least one in SNP marker is carried out to detect the index of correlation of pig, or by least one in this 14 SNP markers Genetic improvement.

Brief description of the drawings

Fig. 1 shows DLY market pig 60KGWAS analysis result figures.

Fig. 2 shows 196 SNP site correlation analysis results in QTL regions.

The conspicuousness SNP that Fig. 3 is shown and the analysis result of periphery SNPs linkage disequilibriums degree (LD).

Embodiment

Form below by way of preferred embodiment is described in further detail again to the above of the application, but not Constitute the limitation to the application.

DLY market pig in the application refer to Landrace to be male parent with Large White be sow after hybridization of female parent again with The offspring of Duroc boars hybridization.

1st, the scanning of pig full-length genome 60K SNP chips, Quality Control and sentence type

From the one fritter ear tissue sample of each individual collection in first above-mentioned DLY colony, with standard phenol chloroform side Method extracts genomic DNA, and DNA is dissolved in TE buffer solutions.Quality is detected with Nanodrop-ND1000 spectrophotometers, is made Its A260/280 ratio is in 1.8-2.0, and A260/230 ratios are in 1.7-1.9 or so.The concentration of standard compliant DNA sample is dilute Release to 50ng/ μ l, using Illumina Infinium SNP parting platforms, order Porcine SNP60DNA Analysis Kit chips, carry out chip hybridization according to Illumina Infinium SNP operation instruction and normal process and are scanned with result, Genotype data is read by GenomeStudio softwares.Quality control is carried out to the genotype data of acquisition with PLINK v1.07 System, rejects recall rate<97%, secondary gene frequency (minor allele frequency, MAF)<0.01, exclude recall rate <90%th, family Mendel error rate is higher than 0.1 individual, finally has 46351 SNP and 610 individuals to be used for data analysis.

2nd, full-length genome association (GWAS) analysis

Using the mixed linear model in R software kits GenABEL, first 610 miscellaneous colonies of DLY ternary are utilized 60K SNP markers genotype data and trunk phenotypic data carry out GWAS analyses, and expression formula is as follows：Y=μ+Xb+Kw+Sc+Za+ e.Wherein, y represents phenotypic number vector, and μ represents population mean, and X is fixed effect oriental matrix, and b represents consolidating for batch and sex Determine effect, vectorial K is covariant oriental matrix, and w is individual slaughter weight covariant, and S is SNP genotype oriental matrixs, and c is inspection SNP additive effect is surveyed, Z is stochastic effects incidence matrix, and a, which is represented, obeys the random additive genetic effect vectors of a~N (0, G σ α 2) (wherein G is affiliation matrix, and σ α 2 are additive genetic variance), e is residual error.The conspicuousness of whole-genome association result Threshold value is determined with Bonferroni methods.

3rd, 60K GWAS analysis results

GWAS results show exist on No. 17 chromosomes of pig and the DLY commodity hog on hook SNP positions that directly length is significantly associated Point rs16767555 (Fig. 1).This site corresponds on international pig genome reference sequences (10.2 version) No. 17 chromosomes 16767555bp, and find that GG genotype individuals are more straight long (table 1) than many 2cm of AA type individual trunk on the site.

The influential effect that table 1.SNP rs16767555 directly grow to first DLY hog on hook

4th, target area high density SNP marker association analysis (QTL finely positionings)

Because pig 60K chip marks density is more sparse, in order to further reduce QTL confidential intervals and search influence Du's length The cause and effect mutational site of big commodity hog on hook length or with its strong chain SNP site, applicant is in GWAS peaks rs16767555 1Mb around 60 pigs of sequence are resurveyed according to this laboratory and the online disclosed sequencing data that weighs selects institute in this QTL region There is SNPs, select has separation again in Large White and Landrace, the SNPs for not having separation in Duroc is finally added altogether Nearly 200 SNP sites carry out finely positioning, and mark averag density reaches 1 SNP/2kb.Choose 500 phenotypes more extreme DLY individual carries out Genotyping.Analysis is associated by being left 196 sites after quality inspection.

As a result it is：(1) as shown in Figure 2,81 SNP sites are had significance degree is associated with carcass length more than P<2.77E- 05.(2) most strong association site is rs16806345, and its P value is 5.22E-23, and its favorable allels A increases nearly 4.2cm trunks Straight long, A gene frequencies are only 22.19% (table 2), while its P value most associates by force site than what above-mentioned 60K GWAS had found Rs16767555 (3.2E-17) significantly, is higher by 6, the rs16767555 sites order of magnitude.(3) AG on rs16806345 sites Genotype individuals trunk plagioclase long 4.28cm individual compared with GG types, carcass weight increases nearly 7.0kg, and the thickness of backfat reduces 0.28cm, cervical vertebra Overall length increase 1.3cm (table 2), therefore the marker site has great Breeding value.

The influential effect of DLY pig growth traits extreme to phenotype table 2.SNP rs16806345

5th, linkage disequilibrium (LD) is analyzed

Haplotype frame is built using Haploview version4.1 analysis softwares, conspicuousness SNP and periphery SNPs is connected The uneven degree (LD) of lock is analyzed.As a result Fig. 3 is seen.

Embodiment 2

The present embodiment in order to verify that the association conspicuousness degree that is obtained in embodiment 1 arranges the effect of the SNP marker of first 14, They are expanded in 1847 DLY market pig colonies of total and carries out genetic test.Although this 1847 individuals come from not The result of same time, the colony on different pig farms, but its association analysis finds that rs16806345 reaches with the long relevance of body (P values) 3.082E-23；Even if rs17472686 sites, 2.45E-12 (table 3) is also reached with the long relevance of body (P values).In biometrics Learn in meaning, when the relevance of SNP site and phenotype reaches 1 × 10^-5, it is believed that there is correlation with phenotype in the site, it is seen then that this As a result show that the relevance of 14, rs16806345 sites etc. SNP marker and hog on hook length is extremely notable, and for example The trunk that the favorable allels A in rs16806345 sites can increase about 2.41cm is directly long, and its frequency in DLY pig is only For 18.28% (table 4), therefore with very big seed selection space.

Embodiment 3

By taking the detection in rs16806345 sites as an example, one in the SNP marker of 14 close linkages in embodiment 2 is assessed The correlation of the individual growth traits with pig.

Applicant detects rs16806345 sites in long separate condition in vain and in the purebred pig of great Bai business and assesses it again Influence to their body length, so that the growth traits molecule seed selection for the two kinds provides theoretical and technical support.

With rs16806345 locus specificity detection probe (sequences：FAM-TAGTACACAGTGGCCCCACTTC-MGB, VIC-TAGTACACAGTAGCCCCACTTC-MGB) great Bai and 163 purebred to the 297 purebred white sample of length carries out Genotyping After detection, it is found that the frequency of the site favorable allels in great Bai is only 9.9%, but phenotype is still reached to gene associations To extremely significantly (P=0.00164, table 5)；And 63.8% is reached in long white middle favorable allels frequency, its genotype and phenotype Also in extremely aobvious association (P=0.00341), and favorable allels have the effect (table 6) for improving 1.27cm live body body length.This knot Fruit demonstrates the rs16806345 marker sites has obvious effect to great Bai and long white body length, it is adaptable to the two kinds and The long seed selection of body of pig kind containing their blood relationships.

The most significant 14 SNP site information of the association analysis of table 3.

The influential effect that table 4.SNP rs16806345 directly grow to all DLY hogs on hook

Influential effects of the table 5.SNP rs16806345 to the purebred pig live body body length of great Bai

Influential effects of the table 6.SNP rs16806345 to long white purebred pig live body body length

Although the application is described with reference to its preferably embodiment, those skilled in the art It should be appreciated that in the case of the real spirit and scope without departing from the application, the various changes that can be carried out.For example, can It is variously changed to adapt to specific situation, material, material compositions or method with the main body to the application, spirit and scope Step.All these changes are included in the range of the bright claim of the application.And utilize the technology of the disclosure above Content makes a little variation or modification is equal to equivalence enforcement case, belongs in the range of technical scheme.

LHA1760162 nucleotides sequence lists

<110>Agricultural University Of Jiangxi

<120>It is a kind of to be used for the SNP marker of measure and/or genetic improvement pig growth traits

<130> LHA1760162

<160> 14

<170> PatentIn version 3.5

<210> 1

<211> 846

<212> DNA

<213>Pig（Sus Scrofa）

<400> 1

TACACTGTGACTTTCAGGGCAAGGGTGGCAAACTGTCTTCTTGCATTGGGGTTTGATTGATAGACGGCATGAG

CCAGGCTAATTAAGGAGGAGCCTGGGATAAGGGGCCTCCAACACCCAGAGCAGCAGATGTTTCTCACCCCAGG

ACTCCTGTAATGCCTGCTGTGGAACCCCCAAGATTCCAGGAGATTGGCTTCTTCTGGGAAGGCTTGTCATGGC

AGCAGCATGTTGGGCCAGAATCCATGACCCCTGAGGCTCAGTGCATCTCAGCCCAGCCTTTCCCTGACCTCCA

TCAGGACTCACACTTACTCTCCACATGCAGCCACAACCACAGTAGTACACAGTY1GCCCCACTTCACCTACAC

ATACATCAGGCCTGGCCCTGGTCCTGAGTGTCCTGTGTGATGTTCAAAGAGGAGAACATTCCCTGATGGAGGG

GTTTGGGCGAAGAGGCCAGCTACCTATGGCCGGGTACTGGCAGTGGGACTGGGTTAAAGGAGGGAGCAATGTG

CCGAGGCTGTTCGTTGGGGTAAAGGCCCCAGGAGTAGGTAGTGGTGGTCTCAGGGACAAATCTGACTCAGGTT

CAAGCTGCCAGGGGAAATACCTGACCGGGAAGATGTTAGTGAGCTCTTGGGTCTTTTTGTGAGTGTGGATGTG

TATGTATGTTTGCATGTGTTTATTTCCTTTCTAAATCTTACTTTGTGGAGTGCACTAAATTGGCTAGCCCTAG

CTTTCTGGATGGCAGTGTTCAGGATGGGTAGCCCAGGACCATCTTGCCTTAAGACCAGCTGTAGCCTGTATAC

TCCTTGGTATACAGCGGAATCCCTTATCTGTGGCTTTGCTTTCT；

<210> 2

<211> 1201

<212> DNA

<213>Pig（Sus Scrofa）

<400> 2

AACATGGTGCCTTGTTTTCAGATGAGGAAACCGAGGCACAGAGTCATGAAGTCTTTGCCTTTGTTTCCTCATC

TGTAAACAAGGCTGATCAATGAAGAAATAGATGTTCACACCCACAGTTGCCTGACTCCAAACCCCCTTTCTCC

CTCCACCAGTACTGTTGATATATTTCAGAAAGTAGATTTCAGAATTTCTAAGCCAAGCATATATAGATTCAAA

AAGACCCACAGTGATTCTGAACCAACTCCTAATCCAGAACATGCCCAATTGTTTGGTTGCTTTTTTTTTTTTT

TTTCCTCCCCTTGACCAACAAAAAAACCACCCAATAAATGACAAAGGTGCTTTAGTCCAGTGAAAAAACACTG

GAGTGTGAATTTGGAAAGTTGGGTCTGCTCTGCTACTGATAACAGTCATTTTTAGGCAAATGACTAAACATAT

GTCCTTCACTCAATAAATATTCACTTATTAAGCCAAAACTCAGTAATAATTGCAATGTTGTAGGCTTCTTACA

GATGGAAGTATTTATAAACCATGCTCTCCACTCATATGTTACCCACGGTCTAGTGATGAACCCAGAY2ATATA

AACATGCTTGACATTCATAATGATGACAAAATTCCTATAAGGGGTTTAGTTCCAAAAGCTCTTGCGTCTACCT

GGATGGTCATAGAAGTCAGGAAAGCTTCACCAAGCAACGAGAGGATTAAAGTTTGCCAGGTTGATATGTAGAA

GCAGAAGGGAAATTCCAGGATGAGAGAACAATATATGCAAAGACATGAAGTCTTGTTCATAGACTTGAATGTC

TTGACAGAGTTGAATCATAAAGGACACAGAATTGGGCATTAGTAGCTGCAAACTATTCCATTTAGAATGGATA

AGCAATGAGGTCCTGCTGTGTAGCACAGGGAACCATATCTAATCTCCTGGGATAGACCATGATGAAAGAGAAT

ATTAAAAAGAATGTATTTATGTATGACTGAGTCACTTTGCTGTATATCAGAGACTGGTACAACATTGTAAATC

GACTATACTTTAATAAGAAAAAAATGATCTTAAAAAAAAAAAAAAGGACATGTCATGCCATGCTTAAGAGTTT

GAACATTCTGGAGTTCCTGTTCTGTCTCTGCAGATTACTAACGAGTCTAGTATCCATGAGGATGTGGGTTTGA

TCCCTGGCCCTGCTCAGTGGGTTAAGGATTCAGC；

<210>3

<211> 1001

<212> DNA

<213>Pig（Sus Scrofa）

<400> 3

ATATTTTGTGAAGAGTAAAGTCTCAGTTTGTTTAGAACTGCATTTCAGTTCACTCAAGTCAGTCCTGATGTAT

GCCTGCTGTCCCTGTGTAATTATAGCAGCAATTCCTCTTACTCTCAAAAGTTTCTGGTTTAAAGGATAACTTA

TAGAGCTACCTTACTAATGAGGAAAAGAAACATTCAGTTTTGAAAGTGCTGCACAGATTTTTTGTTTGTTTGT

TTGTTTTTGCTTTCTCAGGGCCACACCTGCAGCATATGGAAATTCCCAGGCCAGGAGCTGAATTGGAGCTGCA

GCTGCAGAGTTATTCGTGATTTTAGATGAGTCAAATCCTTAGCTTTTTGGGCCTACACCACAGCCACAGTAAC

ACAGGATCCACCCACATCTGCAACCTATACCACAGATCATGGCAATGCCATATCCTTAACCCACTGGGCAAGG

CCAGGGATTAAATCCACATCTTCAAGGAAACTAGTTAGATTTGCGACCCTCTGAGACACAACY3GGAACTCCC

TGCACAAGTTTTTAACCAGATCAAACTAAGTTAATGGCAGAGTTTATAGATAAACCCTTCTAACTTCCAAACT

AGGAATAAATGTATTATATTGAAGTTATTCATGATTTTAGATGAGTCAAATAAGTACAAAAATCCTTAGCTTT

TTTGGTGAAGCAGTGCATGCTCTATGATGCTTAGCCATGCTCTCACTTTGAGAACCTCTGTGTTCACCGAGTG

TTAAAGTGAAGATAGAGGCTTGACAGTGCACCTTCCTCAGCTGCAAGCATTCACTTTTTCTTCTCAATATATA

ATTGACTTTATATATGTTGGAGTTTTGTCACAGTGAAAACTAGAAGTGGAGTGGAGAATTAATTTGAAATACA

ACATTCACAGACGAAGGTAGGGTGATGTAGGGTTAGGGTTGGTCACTTTTCCCACTCTTAGATAACAAAACTG

GAAGATTACCCAGTTGGAAGGGAGAAATTGCCTCTCAACTTCTGCCTGCAAAC；

<210> 4

<211> 601

<212> DNA

<213>Pig（Sus Scrofa）

<400> 4

ATCTATAGGTAACACCTTTTGATGGCAGAACTAGAGTAGGACCAGGAACAGAAATGAGATTTTTTTTTTAATG

TGGGCAGAATTGAGAAGTGAACCTGGAAAGAGGCTTGAGTAGCCTTGAAGAGTACTCAATGGTCTTGATATGT

GTTCATCTTTTCCAGAATGTAAGGCAACTCAAAAGCAGTTTGTTTGTTTGTTCTGTCCATCAGACTAGAAAAT

GGAACAGAGTGAGCACTGGACCAATGAAGTGAGGCCAAGTCATACAGAGATTCACAGAGAAGCTGGTGCCCAC

CATCAGGGY4CAATGTCAACGTGAGTCCCCAGGCTGGTTTACTGTAGTAGATGAAATTTGGGTTTTGAGGTAC

TAATTCAGCATGCCTTTTTTCCTCTCCTGGTTTAAATCAATGGAGAACAAATCCAAATGACAAGATAAGAATT

TGATCTGGTATCAGAGTTTTGATCTCCAGATAGAGGATCTATGGTATGTTTCGTCTAAGGAAGAGGTGGCTGG

GGCCTGAAGGCAAAGTGGAGCTGCTAGCTTGTTCCTTCACATCCTCATCTAGAACATGCCTACAGGAAGGCCT

AGGTTTGTGGAGCAGGCA；

<210> 5

<211> 601

<212> DNA

<213>Pig（Sus Scrofa）

<400> 5

TTAGATGTTCCAGCACTTAATTCCCACTGTGACAGTGACTCATGGGATGATTCGGGTACATCAGTTTGGTGTT

CCCAACTCAGTTTCCTAAACTCTGAGATAGGACTGCCCTGTTGACTCAACCCATTGCTTGGGGTGAAGGAGGT

TACAAAAAGGAAGAGCACCATGTCCCACAGGGGCATTGGAACTTCTTGTCCAATGGCTTCCTGGGCCTGGTCA

CGCTTCTTCTCCAGGATGATAAAGCCCATTGTTATACCATCCCCTGTTGGAGACTTTCTCATAAAGAGAGAAC

ACATGTTGY5GTCCTAGGAGATACAGTGAGTCAGAGGAGATTAAAAAGTCCTCAGGACCGCTCATGACTTTTC

TGAAGGTGTCCACTGACTCACCAAAGCCCTTACATCTGGAAGGAGTTTACAAGTTGAAAATACTATTAGGCAT

AAAACTTGGCCTCCTCAAAGATGTTGATAGGTGATGTCATCTGCAAATCAGCCATTTCACCTGTAGGAATCCT

TTTCCCCACAATCAGAATTCGTATAAAGAGACTGGTCCAAGATGGCCTTTAGGAGATCAAGTGAATCCTGGGG

GATCCTGAGATAGACCTA；

<210> 6

<211> 601

<212> DNA

<213>Pig（Sus Scrofa）

<400> 6

GATCACCATACGAAATACGTTGGCTATCATACATCGACCATTTGCTTTTTTGGCTTCTCTAGTCCTTGTAAAT

AGGTTCAGCTTTATTTTCCCTATTAAACAGGTGTTTTCAGGTATCTGAATGCTATGGTTTGAATTGTGTACTA

AAAAAAGCTATGTTGAAATCCTAATCCCCAAACCTCAGAAGGTGACTTTATTTGGAAATAGGGTCTTTGCAGA

TGTTGTTAAGAAGAAGTCATACTGGAGTAATCTTGGCCCTTAACCCAATATGATTTGTGTCCTTAAAAGAAGA

GAAGAGGTY6CAACTACTATGGAAAATAATATGGAGGTTCCTCAGAAAATGGAATATAGACTACCATATGATC

ACACTCCTGGGCATCTATCCAGATAAAACTACAATTCAAAAAGATTCACACACCCCTATGTTCATAGCAACAC

TATTCACAATATCCAATACATGGAAACAACCTAAATGCCCATTGATGGATGAATGGATTAAGAAGATGCAATA

TGCATACATATACATACATATATATATATATATGTGTGTGTGTATATATGTATATATGTATATATTCACCCCT

ATGGGTTTCAGAGGGACT；

<210> 7

<211> 601

<212> DNA

<213>Pig（Sus Scrofa）

<400> 7

CAACCTCAGTCAGCTTCAGTTGGCTTCAATGAGTTGATAAGCTCTGGTAAATACATCTCACCTAAACAGTTCT

TGCTATGGAAGATAAAGCAGAGAAGGGAGGAAAAGGTGCCAAGGTGCTTAGATTTGGAGCAGAGTATACCCCA

CACATGCCAGTCAATCAGTTTGGCTCATCTCTCCTAGCATTCCATTCTACTGACTGTCTCCCACGGATCCAGT

GGGGTTTTCACACATTAACCCAATTTGTAAGCTTGGGAGTTTCCCATGAAAACTCCCTGAGCACAGGTCAGAG

GTAGAAGCY7GAGAATATTTGTATGATCTTTCTTGGTATGGCTCTTTCTTGGTACTGGTAACTAAAGTTACCA

GGCACAGCCTCTGATGAAACAACCGTGCTATGGTCACAGAACCTTGGCTGATGTATGTGGATGGAGCAATTCA

GACATTTCACGTTAGAGTTTGTGGCCCCAGGAGCATGTTCTTAATTGAAAACATTATTGTCAACGTCTCTAAT

TCATATCACAACTTTCTTAGGAATAACTGAAAGGATCACTCATAAAAATATTATTACTGAAAGAAATGGAGAT

AATCTTGTCTAATCCCTT；

<210> 8

<211> 601

<212> DNA

<213>Pig（Sus Scrofa）

<400> 8

CTTTAAAAAAAAGAAGAACCAGGCTGGTGACCTAAGCCTTTCCTGTGGAATATCATGGGTGTTTTATATATGA

CATGGAAAGCTAATAAAGTTGACATGTTTGAAAACATTCTCTGATTCTACTTATGCAGTTCTGGGTTCAATAA

ATAGGTATCATGTTTGTTTTCTGTACTACATGTAAAGGTAATAAGTAAATTGATATTTTTGAAAACACTCTGA

TTACACATTCATGTTTTCAATAAACAGGCATTCAAGCTCTCAAGGAGATAAGCCTTATGCTGAACACTCTGTT

ACATGAAGY8GAAATAGGACTGCTTCTGCCTCTAGGAGATACCATAACCCAGTACAACTCTAACTTGTGGAAG

TGGAAGCTCTCCATCCTTTCTGAGCTGGCCAAGAAGGATGATGGAGACAGTAAGTAAATGGAGTTTGGAAAAG

CAAGCTGTACAAAGGGTCCAGACGTGTGGGCACAGGAGGGGCTGGGGGACAACCCAACGTGCGAAGAGAACAG

AATTTATTAGAAGTCAAGGTAACAAGAGGCTATTTGAGGCCGCCCATTCCATCTACCATGTGCTAATATTATG

ACAGTAATGATTCATCTG；

<210> 9

<211> 601

<212> DNA

<213>Pig（Sus Scrofa）

<400> 9

AGAAAAATCTTAGAGCTACAACAATAATGTAATTTTTTGTCCAAATCAGGACACTTCTGAGAGCAAAATGGAG

TTTTATTAGTAATAACATCCAGGAAAACATGTCATTCTTTGCTTTCTAAAGCCCAGATATTGTTGAGGAAACA

AAGCGATATATATACCTGTAAATTTTCAGCATTGATAAAATGAGACATCTATATTTTGATGGTTAACATGCAT

GTTAGAAACAAAAAGATTTTGATAATATCATCACTTTATCTGTTTCCTTTATCTTCAAAGTGCCTTTTTGCTG

CAAGTAACY9ATAGTCAGAGACTGCGTAGGAAACAGAATTTCTCTAGAAAGCATTTAACTGAAAAGAAATAAT

ATGGGGTTATGCACAGATATGTGAGTAGAAGTTTTTAAAAATTTACATGTATATATATGCATGCATCTTTATA

GATATCACCTTATATGTTCGTTTTATTATATATACATATATGTATGTATATAAACATATATTGATAACATGCT

TTTAATGAAGAGACTTCACTTTTTGGAGCCGTCTTAGGCTTACAGAAATAATGCAAAAGTATAGAGACTTCCC

ATATACCTCCTCTACCT；

<210> 10

<211> 601

<212> DNA

<213>Pig（Sus Scrofa）

<400> 10

CAGCCAGCCTTCAAGGGAAGCAATTGATCACAACCTGTCATCTTTAAAGGCCAGAAGAATGCAAAATAAACAC

TTGGGATTAGTGTACTAAATATGGTTCATCAGTCTTCAGCTCTGCCCTCTGATAATTCATCTATCTCATTTAT

TTTAATGCTTTATCATGTATCTCCCCAGCTCTGTAATTAGCCTTTCAGGTATTCTCTTTTTCTTCCTGCCTTT

GAAATGGTGTGTGGTGAGATTCTACAAGGAGAGGATATTATTACCATCCCTTACAAAAGAAGCAACTCCTGCA

ATAATTCTY10TTTTATAGCTTACGTGCTGGAATTCTTGCTGAAACTTAGAGGGTGTGTTAAAGTGGTTTAAC

GAAAAAGTCTTAGCAAATTTACCTGTTCTTTTAAATGGAGAGTTTAGTTTGGCTATAGATTAACTGTTTGATT

TTATAGGAGGAGTCTGGATTTAGGCTCATTAAGCCCCAAATGCTGGTTTTGATTTTTTTAAAAACCTAATGTA

CCAAAGTTGGCTTCCGAATTAAAGTCATTAAAGACTCACATTTTATTGATTTGTTTCTGAGTGAAGAGTTAAT

TTTTACTTGCCTAAAAAGA；

<210> 11

<211> 601

<212> DNA

<213>Pig（Sus Scrofa）

<400> 11

CAGCAGTGACAATGCTAGATCCTTAACCTGCTGAGCCACTCCTTAAATGCTCCCTAATAAGGATTCTTGAAAG

TTACCTTAAGCAGGAAAGTGACATGATAAAGTTATATTTAATTGGCAACTGATTATAGAATGGAATAACGGAG

GACTGTCTAAAGCAAGATCAACTGCAGGTCATACAAACAAGACCTTACAAGAGTCTGACCTATATATACTACA

GCATGTATGGAAGAAAAGAGACACACAGAGAGAGTTAAGGAGAGAATAGTTCACAGTTCTGCCTTACTAAAAG

TATATGATY11GGAGAAAAAAAGTAGTAGAAAGAATTACAGGTAACTATGTTGAGTTGAACTGATTTTAGCAA

GAAAAGATAACTTCGTTTCAATAAAAAAACCAAAATGTCCTTTTGCAAACAGTAGTGAAAAATACTTTTTTTT

TTTTTTTTGTCTTTTTAGTGCCATATCTGTGGCATATGGAGGTTCCCGTGCTATGGATTGAATTGGAGCTGAT

GCCAGATCCAAGCCATGTTTGTGACCTACACCCAGCTCATGGCAATGCTGGATCCTTAACACACTGAGCGAGG

TCAGGGTTGGAACCTGCAT；

<210> 12

<211> 601

<212> DNA

<213>Pig（Sus Scrofa）

<400> 12

TAGACTAGAATCTTTTGCTTCCACTTTCAATGATCTATATTTTGATCATAGCGTGTCTCCCAAATTTTCATGT

AGATAACTCTTTACAGCCTTAAATTAAAACTAGTCTTTATTATTATGATTCAGAAGTATATAAATTAAAAATA

CCTACTCTCAAGTGCCTGTTGGCCATCTGTATATCTTCTTTGAAGAAATGTTTACTCAGGTTTCTTGCCCATT

TTTCAATTAGGTTCTTGGGTTTTTTTGCTCTTGAGTTGTATAAGTTGTGTGTATATTTTAGAGATTAAGCTCT

TGTCAGTTY12CATCTTTTGAAACTATTTTTTCCCATTCTGTAGGTTGTCTTTTTTTTTTTTTTTTTTTAAAG

GGTTTCCTTTGCTATGCAAAAGCTTGTCAGTTAGAAAAGAAACTCATGGACTTGGAGTACAGACCCATAGTTG

CCAAGGAGGTAGGGGGAGGGCATGGGATGGACTGGGAGTTTGGCGTTAATTGATGTAGACTATAGCATTTGGA

GTGGATAAGCAATGAGATCCTGCTGTATAGCACAGGGAATTGTATCTTGTCACTTATGATGGAACATGATGGA

GGATAATGTGAGAAAAAGA；

<210> 13

<211> 601

<212> DNA

<213>Pig（Sus Scrofa）

<400> 13

AATAAGTGTTTATTTATCACCAATTCTCTTCTAGGATTAGTGTTAGCCACAGTGGTAGAAATAGTTACGGTCC

CGCCCTCACATGACTAGCAATGAGAGATGCAACTAGAAGAAAGCCACACAATTACAAATTGAGTTGGGCACAA

TAAAGCAGGCTAAAATAAAACTTCTGCAAAAGATATTAGTGATATTCTGACTTAGGTTGGGGATGGTGGGGGA

GGTAGTAGAAAAAAGCTTCCTGAAAAGGCAACATTTCAGCTGACACCTTCATGATGAGTAGGGAACAGCTAAG

GAAAGAGTY13AAAGTAGGAGTGTTCTAGCAAAGGGCAGACTCGGTATGTCCAAAAGCTTGCTGTGCTAAGGA

ATTGGAGGAGCTTTAGGACATACACAACTTGTGCTTGTATCTAGGGAATGGAAGTAGACAATAGCATAGGCTA

AAATATCTATGTTAATTATTTCTCTAAAATGTGAAGATTTGCACTATTTGGGGGTAACTACCCTTAGACATAC

AACATCCTCTTGTTCTATTCTTTCCTTTCTTGTTATTAAAACACAGAAGTTATACATAATATCTTGAATAATT

TTTCCCACTTCTTCACTAC；

<210> 14

<211> 600

<212> DNA

<213>Pig（Sus Scrofa）

<400> 14

GCATATGGAGGTTCCCAGGCTAGGGGTCCAATCGGAGCTGTAGCCACTGGCCTACGCCAGAGCCACAGCAATG

CAGGATCCGAGTTGCATCTGCGACCCACACCATAGCTCATGGCAAGGCCGGATCCTCAACCCACTGAGCAAAG

CCAGGGATGGAACCTGCAACCTCATGGTTGCTAGTCGGATTCGTTAACCACTGCACCACGATGGGAACTCCGT

GGCTTAATTTTCTTTGTGGGAGTCAGGTGGGGGAATTTTTAGTAGAAATTTTCTAGTCCATTGAAATTTTTGA

ATAAGGGTY14AAAACCCTTGAGCACACCAATACAAATACTTTTCAAGATATCACATAACATTTGCTTTAGGG

AAAACAAAAATATAAAACTCTCTAATGAATGAATCACCAACACAACACTCTTACACCAAAAGTTTCTCTTTGC

TATTTCTTTTTTCTTCTTCTTTTTTTTGGGGGGTGCGGGGGGGCCACATCCTCGGCATATGGAAGTTCCCAGG

CTAGGGGTCAAATCAGAGCTGCAGCTGCTGGCCACAACCACAGCCATAGCAACTCCGGACCCAAGACACATCT

GCACCCTACACCACAGCT。

Claims

1. the SNP marker of a boar, the SNP marker includes at least one of following 14 kinds of SNP markers,

First SNP marker：The 16806345th site from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome Nucleotides Y¹, corresponding to SEQ ID NO:The nucleotides Y in the 346th site from holding 5 ' on 1¹, the Y¹Selected from G or A；

Second SNP marker：The 16940077th site from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome Nucleotides Y², corresponding to SEQ ID NO:The nucleotides Y in the 578th site from holding 5 ' on 2², the Y²Selected from C or T；

3rd SNP marker：The 17473931st site from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome Nucleotides Y³, corresponding to SEQ ID NO:The nucleotides Y in the 501st site from holding 5 ' on 3³, the Y³Selected from G or A；

4th SNP marker：The 17013787th site from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome Nucleotides Y⁴, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 4⁴, the Y⁴Selected from C or T；

5th SNP marker：The 17096014th site from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome Nucleotides Y⁵, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 5⁵, the Y⁵Selected from G or A；

6th SNP marker：The 17007981st site from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome Nucleotides Y⁶, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 6⁶, the Y⁶Selected from A or G；

7th SNP marker：The 16916995th site from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome Nucleotides Y⁷, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 7⁷, the Y⁷Selected from C or T；

8th SNP marker：The 17102194th site from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome Nucleotides Y⁸, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 8⁸, the Y⁸Selected from C or T；

9th SNP marker：The 17114026th site from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome Nucleotides Y⁹, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 9⁹, the Y⁹Selected from G or A；

Tenth SNP marker：The 16682972nd site from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome Nucleotides Y¹⁰, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 10¹⁰, the Y¹⁰Selected from G or C；

11st SNP marker：The 16765047th from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y of point¹¹, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 11¹¹, the Y¹¹Selected from G Or A；

12nd SNP marker：The 16788727th from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y of point¹², corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 12¹², the Y¹²Selected from G Or T；

13rd SNP marker：The 16767555th from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y of point¹³, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 13¹³, the Y¹³Selected from A Or G；

14th SNP marker：The 17472686th from holding 5 ' on No. 17 chromosomes of 10.2 versions world pig genome The nucleotides Y of point¹⁴, corresponding to SEQ ID NO:The nucleotides Y in the 301st site from holding 5 ' on 14¹⁴, the Y¹⁴Selected from G Or C.

2. SNP marker according to claim 1, it is characterised in that the SNP marker is selected from the first SNP marker, second SNP marker, the 3rd SNP marker, the 4th SNP marker, the 5th SNP marker, the 6th SNP marker, the 7th SNP marker and the 8th SNP At least one of mark.

3. a kind of nucleotide sequence, the nucleotide sequence is the nucleotide sequence for including SNP marker as claimed in claim 1 or 2, institute State nucleotide sequence and be selected from least one of DNA sequence dna, cDNA sequence and RNA sequence.

4. nucleotide sequence according to claim 3, it is characterised in that the nucleotide sequence is selected from SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:5、SEQ ID NO:6、SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO:11、SEQ ID NO:12、SEQ ID NO:13 and SEQ ID NO:At least one of 14.

5. nucleotide sequence according to claim 4, it is characterised in that the nucleotide sequence is selected from SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:5、SEQ ID NO:6、SEQ ID NO:7 and SEQ ID NO:At least one of 8.

6. application of the SNP marker as claimed in claim 1 or 2 in measure and/or the growth traits of genetic improvement pig, described Growth traits includes at least one in hog on hook body length, hog on hook plagioclase, hog on hook weight, pig thoracic dorsal fat thickness and pig cervical vertebra overall length Kind.

7. application according to claim 6, it is characterised in that the pig is selected from purebred Landrace, purebred Large White, contained The synthesis system of long white blood lineage, the breed system containing long white blood lineage, the hybridized pig containing long white blood lineage, the synthesis containing great Bai blood lineages At least one of system, the breed system containing great Bai blood lineages, the hybridized pig containing great Bai blood lineages；

It is preferred that the pig is selected from purebred Landrace, purebred Large White, the hybridized pig of duroc and Landrace, duroc and big The hybridized pig of white pig, and the hybridized pig kind of duroc, Landrace and the boar of Large White three at least one.

8. the method for the genetic improvement of a boar, methods described includes：Determine boar in nucleus herds of breeding pigs such as claim 1 Or the SNP marker described in 2, and corresponding selection is made according to the SNP marker：

For the first SNP marker, it is AA and GA genotype to be selected in the nucleus herds of breeding pigs in the 16806345th site Boar individual, eliminate the site for GG genotype boar individual, with by generation improve the site allele A frequency Rate；It is preferred that selecting the boar individual in the 16806345th site for AA genotype in the nucleus herds of breeding pigs, eliminate The site is individual for the boar of GA and GG genotype, with the frequency for the allele A that the site is improved by generation；

For the second SNP marker, it is TT and CT genotype to be selected in the nucleus herds of breeding pigs in the 16940077th site Boar individual, eliminate the site for CC genotype boar individual, with by generation improve the site allele T frequency Rate；It is preferred that selecting the boar individual in the 16940077th site for TT genotype in the nucleus herds of breeding pigs, eliminate The site is individual for the boar of CT and CC genotype, with the frequency for the allele T that the site is improved by generation；

It is AA and GA genes for the 3rd SNP marker, being selected in the nucleus herds of breeding pigs in the 17473931st site The boar individual of type, eliminates the boar individual for GG genotype in the site, with the frequency for the allele A that the site is improved by generation Rate；It is preferred that selecting the boar individual in the 17473931st site for AA genotype in the nucleus herds of breeding pigs, eliminate The site is individual for the boar of GA and GG genotype, with the frequency for the allele A that the site is improved by generation；

For the 4th SNP marker, it is TT and CT genotype to be selected in the nucleus herds of breeding pigs in the 17013787th site Boar individual, eliminate the site for CC genotype boar individual, with by generation improve the site allele T frequency Rate；It is preferred that selecting the boar individual in the 17013787th site for TT genotype in the nucleus herds of breeding pigs, eliminate The site is individual for the boar of CT and CC genotype, with the frequency for the allele T that the site is improved by generation；

For the 5th SNP marker, it is AA and GA genotype to be selected in the nucleus herds of breeding pigs in the 17096014th site Boar individual, eliminate the site for GG genotype boar individual, with by generation improve the site allele A frequency Rate；It is preferred that selecting the boar individual in the 17096014th site for AA genotype in the nucleus herds of breeding pigs, eliminate The site is individual for the boar of GA and GG genotype, with the frequency for the allele A that the site is improved by generation；

For the 6th SNP marker, it is GG and GA genotype to be selected in the nucleus herds of breeding pigs in the 17007981st site Boar individual, eliminate the site for AA genotype boar individual, with by generation improve the site allele G frequency Rate；It is preferred that selecting the boar individual in the 17007981st site for GG genotype in the nucleus herds of breeding pigs, eliminate The site is individual for the boar of GA and AA genotype, with the frequency for the allele G that the site is improved by generation；

For the 7th SNP marker, it is TT and CT genotype to be selected in the nucleus herds of breeding pigs in the 16916995th site Boar individual, eliminate the site for CC genotype boar individual, with by generation improve the site allele T frequency Rate；It is preferred that selecting the boar individual in the 16916995th site for TT genotype in the nucleus herds of breeding pigs, eliminate The site is individual for the boar of CT and CC genotype, with the frequency for the allele T that the site is improved by generation；

For the 8th SNP marker, it is TT and CT genotype to be selected in the nucleus herds of breeding pigs in the 17102194th site Boar individual, eliminate the site for CC genotype boar individual, with by generation improve the site allele T frequency Rate；It is preferred that selecting the boar individual in the 17102194th site for TT genotype in the nucleus herds of breeding pigs, eliminate The site is individual for the boar of CT and CC genotype, with the frequency for the allele T that the site is improved by generation；

For the 9th SNP marker, it is AA and GA genotype to be selected in the nucleus herds of breeding pigs in the 17114026th site Boar individual, eliminate the site for GG genotype boar individual, with by generation improve the site allele A frequency Rate；It is preferred that selecting the boar individual in the 17114026th site for AA genotype in the nucleus herds of breeding pigs, eliminate The site is individual for the boar of GA and GG genotype, with the frequency for the allele A that the site is improved by generation；

For the tenth SNP marker, it is CC and GC genotype to be selected in the nucleus herds of breeding pigs in the 16682972nd site Boar individual, eliminate the site for GG genotype boar individual, with by generation improve the site allele C frequency Rate；It is preferred that selecting the boar individual in the 16682972nd site for CC genotype in the nucleus herds of breeding pigs, eliminate The site is individual for the boar of GC and GG genotype, with the frequency for the allele C that the site is improved by generation；

For the 11st SNP marker, it is AA and GA genes to be selected in the nucleus herds of breeding pigs in the 16765047th site The boar individual of type, eliminates the boar individual for GG genotype in the site, with the frequency for the allele A that the site is improved by generation Rate；It is preferred that selecting the boar individual in the 16765047th site for AA genotype in the nucleus herds of breeding pigs, eliminate The site is individual for the boar of GA and GG genotype, with the frequency for the allele A that the site is improved by generation；

For the 12nd SNP marker, it is TT and GT genes to be selected in the nucleus herds of breeding pigs in the 16788727th site The boar individual of type, eliminates the boar individual for GG genotype in the site, with the frequency for the allele T that the site is improved by generation Rate；It is preferred that selecting the boar individual in the 16788727th site for TT genotype in the nucleus herds of breeding pigs, eliminate The site is individual for the boar of GT and GG genotype, with the frequency for the allele T that the site is improved by generation；

For the 13rd SNP marker, it is GG and GA genes to be selected in the nucleus herds of breeding pigs in the 16767555th site The boar individual of type, eliminates the boar individual for AA genotype in the site, with the frequency for the allele G that the site is improved by generation Rate；It is preferred that selecting the boar individual in the 16767555th site for GG genotype in the nucleus herds of breeding pigs, eliminate The site is individual for the boar of GA and AA genotype, with the frequency for the allele G that the site is improved by generation；

For the 14th SNP marker, it is CC and GC genes to be selected in the nucleus herds of breeding pigs in the 17472686th site The boar individual of type, eliminates the boar individual for GG genotype in the site, with the frequency for the allele C that the site is improved by generation Rate；It is preferred that selecting the boar individual in the 17472686th site for CC genotype in the nucleus herds of breeding pigs, eliminate The site is individual for the boar of GC and GG genotype, with the frequency for the allele C that the site is improved by generation.

9. method according to claim 8, it is characterised in that determined using the nucleotide sequence of the boar is analyzed described The SNP marker as claimed in claim 1 or 2 of boar, wherein nucleotide sequence any one in such as claim 3-5 Described nucleotide sequence.

10. a kind of good and bad method of growth traits for determining pig, methods described includes：Determine the pig such as claim 1 or 2 Described SNP marker, and determine according to the SNP marker growth traits of the pig：

For the first SNP marker, GG bases are better than for the growth traits of the pig of AA and GA genotype in the 16806345th site Because of the growth traits of the pig of type；

For the second SNP marker, CC bases are better than for the growth traits of the pig of TT and CT genotype in the 16940077th site Because of the growth traits of the pig of type；

For the 3rd SNP marker, GG is better than for the growth traits of the pig of AA and GA genotype in the 17473931st site The growth traits of the pig of genotype；

For the 4th SNP marker, CC bases are better than for the growth traits of the pig of TT and CT genotype in the 17013787th site Because of the growth traits of the pig of type；

For the 5th SNP marker, GG bases are better than for the growth traits of the pig of AA and GA genotype in the 17096014th site Because of the growth traits of the pig of type；

For the 6th SNP marker, AA bases are better than for the growth traits of the pig of GG and GA genotype in the 17007981st site Because of the growth traits of the pig of type；

For the 7th SNP marker, CC bases are better than for the growth traits of the pig of TT and CT genotype in the 16916995th site Because of the growth traits of the pig of type；

For the 8th SNP marker, CC bases are better than for the growth traits of the pig of TT and CT genotype in the 17102194th site Because of the growth traits of the pig of type；

For the 9th SNP marker, AA bases are better than for the growth traits of the pig of GG and GA genotype in the 17114026th site Because of the growth traits of the pig of type；

For the tenth SNP marker, CC bases are better than for the growth traits of the pig of GG and GC genotype in the 16682972nd site Because of the growth traits of the pig of type；

For the 11st SNP marker, AA is better than for the growth traits of the pig of GG and GA genotype in the 16765047th site The growth traits of the pig of genotype；

For the 12nd SNP marker, TT is better than for the growth traits of the pig of GG and GT genotype in the 16788727th site The growth traits of the pig of genotype；

For the 13rd SNP marker, AA is better than for the growth traits of the pig of GG and GA genotype in the 16767555th site The growth traits of the pig of genotype；

For the 14th SNP marker, CC is better than for the growth traits of the pig of GG and GC genotype in the 17472686th site The growth traits of the pig of genotype；

The growth traits is included in hog on hook body length, hog on hook plagioclase, hog on hook weight, pig thoracic dorsal fat thickness and pig cervical vertebra overall length At least one, and long hog on hook body length is long better than short hog on hook body, long hog on hook plagioclase is better than short hog on hook plagioclase, The hog on hook of weight is better than light hog on hook weight again, and thin pig thoracic dorsal fat thickness is better than thick pig thoracic dorsal fat thickness, long pig cervical vertebra overall length Better than short pig cervical vertebra overall length；

The SNP marker as claimed in claim 1 or 2 of the pig is determined preferably by the nucleotide sequence of the pig is analyzed, its Described in nucleotide sequence selected from the nucleotide sequence as described in any one in claim 3-5.