KR101514431B1

KR101514431B1 - Single Nucleotide Polymorphic DNA markers for discriminating habitat of the albino swamp eel, Monopterus albus and a method using the same

Info

Publication number: KR101514431B1
Application number: KR1020140166240A
Authority: KR
Inventors: 안혜숙; 임상구; 황형규; 박중연; 안철민
Original assignee: 대한민국
Priority date: 2014-11-26
Filing date: 2014-11-26
Publication date: 2015-04-28

Abstract

The present invention provides a single nucleotide polymorphism DNA marker selected within an albino swamp eel mitochondrial 16S rDNA nucleotide sequence represented by sequence number 3 and a method for discriminating a native species of an albino swamp eel using the same to discriminate the country of origin of an albino swamp eel. The method using the single nucleotide polymorphism genetic marker for discriminating a native species of an albino swamp eel provides the method to discriminate the country of origin of the albino swamp eel including the steps of: amplifying DNA; electrophoresing; and analyzing a band pattern of DNA fragments.

Description

Description: TECHNICAL FIELD [0001] The present invention relates to a single nucleotide polymorphic DNA marker and a method for identifying the polymorphic DNA marker,

The present invention relates to a genetic marker for discriminating the origin of freshwater fish and a method of using the same. More particularly, the present invention relates to a single nucleotide polymorphic gene marker for discriminating the origin of a dragonfly, and a method for determining the origin of a dragonfly using the same.

Monopterus albus is a conical head with a sharp tip and swollen. The dorsal fin and pectoral fin are absent, and the dorsal fin is very low and has membrane quality. It starts at the top of the anus and is connected to the tail. The anal fin is not clear, and it is about half of the dorsal fin. The body is interspersed with a round brown dot on a tan background, and has a dark gray-colored board on the white background. The lateral stripe is in the middle of the side and has no scales. Male is bigger than female, and body length exceeds 40cm. The dung back is a muddy rice field or a lake, and only the mouthed water comes out and breathes air. As they grow, their sex changes from female to male. It is also an economical freshwater fish which is widely used for medicinal purposes. It lives in the southwestern part of Korea and in the paddy fields, ditches and ditches in the southeastern part. It is distributed throughout Southeast Asia including Japan and Indonesia. In Korea, there is indiscriminate resource over-exploitation due to the fact that it has a special effect on the enrichment system, and the population is drastically reduced due to agricultural land maintenance projects of paddy fields and ditches and use of pesticides. However, recently foreign countries including Bangladesh and Southeast Asia It is a fact that they are selling, importing and selling. Bangladesh is one of the most likely to report low-income imports, and its price is only about 59% of domestic production. However, since it is the same species, it can not be distinguished from native species in the naked eye. Daguruhi is a cultured fish species in foreign countries, and its nutritional value and economic value are very high. Therefore, there is a desperate need to genetically distinguish between the indigenous species that can not be distinguished by the naked eye and the imported species from Bangladesh.

Regarding the molecular marker for discriminating the origin of a fish, Korean Patent Laid-Open Publication No. 2013-0055368, Korean Patent No. 1412046, Korean Patent No. 1412058, On the discrimination method of the origin of an aegy using the polynucleotide for discriminating the origin of an aegy, Korean Patent Laid-Open Publication No. 2014-0071059 on polynucleotides useful for discrimination of corn and varieties, and Korean Patent No. 1380779 on identification method using the same for the identification of origin of loach and the like are reported .

However, there are no molecular markers and methods for distinguishing the native species.

It is an object of the present invention to provide a genetic marker for discriminating the origin of a hangover and a method of determining a country of origin using the genetic marker. However, these problems are exemplary and do not limit the scope of the present invention.

According to one aspect of the present invention there is provided a polynucleotide for determining Monopterus albus origin or a polynucleotide complementary thereto selected from the group consisting of the following polynucleotides:

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the third base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and containing a single base polymorphism (SNP) site in which the fourth base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site wherein the 5 < th > base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single nucleotide polymorphism (SNP) region in which the sixth nucleotide of SEQ ID NO: 3 is A or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single nucleotide polymorphism (SNP) site in which the eighth nucleotide of SEQ ID NO: 3 is A or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single nucleotide polymorphism (SNP) region in which the 14th nucleotide of SEQ ID NO: 3 is A or G;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and containing a single base polymorphism (SNP) site in which the 19 < th >

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 20 < th >

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 21st base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 22nd base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 31st base of SEQ ID NO: 3 is T or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site wherein the 40 < th > base of SEQ ID NO: 3 is A or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single nucleotide polymorphism (SNP) region in which the 41st base of SEQ ID NO: 3 is A or G;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 62nd base of SEQ ID NO: 3 is G or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 80 < th >

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) region wherein the 126th base of SEQ ID NO: 3 is G or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single nucleotide polymorphism (SNP) region in which the 143th nucleotide of SEQ ID NO: 3 is T or C;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site wherein the 145th base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 148th base of SEQ ID NO: 3 is C or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) region wherein the 156th base of SEQ ID NO: 3 is G or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 187th base of SEQ ID NO: 3 is A or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 191st base of SEQ ID NO: 3 is A or C;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site wherein the 225th base of SEQ ID NO: 3 is A or G;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 230 base of SEQ ID NO: 3 is G or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 231st base of SEQ ID NO: 3 is G or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 235st base of SEQ ID NO: 3 is A or G;

A polynucleotide selected from a polynucleotide having a nucleotide sequence of SEQ ID NO: 3 and having a deletion of the 241 base of SEQ ID NO: 3 or a single base polymorphism (SNP) site of A or G, Nucleotides;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single nucleotide polymorphism (SNP) region in which the 242 < th >

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 245th base of SEQ ID NO: 3 is A or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 249th base of SEQ ID NO: 3 is A or C;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site wherein the 250th base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 251st base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single nucleotide polymorphism (SNP) region in which the 252nd nucleotide of SEQ ID NO: 3 is C or G;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 253rd base of SEQ ID NO: 3 is A or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 259th base of SEQ ID NO: 3 is deleted or is A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and containing a single nucleotide polymorphism (SNP) site in which the 260th nucleotide of SEQ ID NO: 3 is deleted or C;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 265th base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 267th base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 268th base of SEQ ID NO: 3 is G or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 275th base of SEQ ID NO: 3 is A or G;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single nucleotide polymorphism (SNP) region in which the 278th nucleotide of SEQ ID NO: 3 is T or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) region in which the 279th nucleotide of SEQ ID NO: 3 is G or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single nucleotide polymorphism (SNP) site in which the 281st base of SEQ ID NO: 3 is A or C;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 287th base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single nucleotide polymorphism (SNP) region in which the 289th base of SEQ ID NO: 3 is T or C;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 290th base of SEQ ID NO: 3 is A or C;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 291st base of SEQ ID NO: 3 is A or C;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 293rd base of SEQ ID NO: 3 is A or G;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 315st base of SEQ ID NO: 3 is A or G;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 317th base of SEQ ID NO: 3 is G or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) region in which the 318th base of SEQ ID NO: 3 is T or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 321st base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 325th base of SEQ ID NO: 3 is C or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 329th base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 331st base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 333rd base of SEQ ID NO: 3 is A or C;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single nucleotide polymorphism (SNP) site in which the 334th nucleotide of SEQ ID NO: 3 is A or C;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site wherein the 340 base of SEQ ID NO: 3 is A or G;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 362nd nucleotide of SEQ ID NO: 3 is T or C;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 368th base of SEQ ID NO: 3 is A or G;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 382nd nucleotide of SEQ ID NO: 3 is T or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 384th base of SEQ ID NO: 3 is A or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 385th base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 390st base of SEQ ID NO: 3 is A or C;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site wherein the 395th base of SEQ ID NO: 3 is G or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single nucleotide polymorphism (SNP) region wherein the 404th nucleotide of SEQ ID NO: 3 is G or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 405th base of SEQ ID NO: 3 is A or G;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 406th base of SEQ ID NO: 3 is T or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 411 base of SEQ ID NO: 3 is C or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and containing a single base polymorphism (SNP) site in which the 418th base of SEQ ID NO: 3 is deleted or C;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 423rd base of SEQ ID NO: 3 is A or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 424th base of SEQ ID NO: 3 is A or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) region wherein the 430th base of SEQ ID NO: 3 is C or A;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 465th base of SEQ ID NO: 3 is A or T;

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 473rd base of SEQ ID NO: 3 is A or G; And

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and containing a single base polymorphism (SNP) site in which the 515st base of SEQ ID NO: 3 is C or A.

According to another aspect of the present invention, there is provided a kit for determining the hangover origin, which comprises the polynucleotide or a pair of primers capable of specifically amplifying the polynucleotide.

According to another aspect of the present invention, there is provided a DNA extraction method comprising: a total DNA extraction step of extracting total DNA from a hind paw; An amplification step of amplifying the polynucleotide comprising a single nucleotide polymorphism (SNP) as a primer pair capable of specifically amplifying the polynucleotide of claim 1 as a template, using the extracted total DNA as a template; And identifying a genotype of the polynucleotide.

According to another aspect of the present invention, there is provided an amplification-confirmation primer set capable of amplifying a dinosaur mitochondrial 16S rDNA represented by SEQ ID NO: 3 irrespective of origin; And 3 or 4, 5, 6, 8, 14, 19, 20, 21, 22, 31, 40, 41, or 42 of SEQ ID NO: 3, or a complementary nucleic acid sequence thereof selected from SEQ ID NO: 250, 251, 252, 253, 259, 265, 267, 268, 275, 278, 279, 281, 287, 289, 290, 291, 293, 315, 317, 318, 321, 325, 329, 331, 333, 334, 340, 362, 368, 382, 384, 390, Specific primer comprising a continuous length of 15 to 50 nt comprising 3'-terminal 411, 418, 423, 424, 430, 465, 473, 515 base or its corresponding complementary base , A multiplex PCR kit for determination of hangover origin is provided.

According to another aspect of the present invention, there is provided a DNA amplification step of amplifying a total DNA separated from a waist with a multiplex PCR kit for determining the hangover waist origin; An electrophoresis step of electrophoresing the amplified DNA fragment; And analyzing a band pattern of the electrophorpted DNA fragment.

According to the embodiment of the present invention described above, it is possible to accurately identify the country of origin of the hangover, thereby contributing to restoration of the ecosystem of the hangar, and to prevent ecosystem disturbance through indiscriminate discharge . Of course, the scope of the present invention is not limited by these effects.

Figure 1 is a nucleic acid sequence of the mitochondrial 16S rDNA of the hangover of Bangladesh acid and native species amplified according to one embodiment of the present invention. 16S rDNA, DR_B2_R, and DR_K5_R represent PCR primer sites used for the origin-specific DNA amplification.
FIG. 2 is a DNA electrophoresis image showing the result of performing multiplex PCR on the hind limbs of Bangladesh acid and native species with a primer set according to an embodiment of the present invention.

Definition of Terms:

As used herein, "single-nucleotide polymorphism" (SNP) refers to a change in the base position of a locus between alleles within a population or within an individual.

As used herein, the term "haplotype" refers to a specific combination of alleles (or DNA sequences) at adjacent flanking positions on a chromosome, where haplotypes differ between individuals or between alleles Many are used for population genetics analysis.

As used herein, "allele-specific PCR" is a PCR carried out with the base at which the SNP is generated as the 3'-terminal of the primer. When the template DNA and the 3'-terminal of the primer are exactly complementary to each other, PCR is not performed if correct complementary binding does not occur due to SNP, and thus it is possible to confirm the base type of the corresponding SNP region by amplification of the PCR product.

DETAILED DESCRIPTION OF THE INVENTION [

According to one aspect of the present invention there is provided a polynucleotide for determining the hangover origin or a polynucleotide complementary thereto selected from the group consisting of the following polynucleotides:

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and containing a single base polymorphism (SNP) site in which the 242 < th >

A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site wherein the 515st base of SEQ ID NO: 3 is C or A.

According to another aspect of the present invention, there is provided a kit for determining the hangover origin, which comprises the polynucleotide or a pair of primers capable of specifically amplifying the polynucleotide. The kit may be a kit provided with a microarray containing the polynucleotide.

The step of confirming the genotype of the polynucleotide may include sequencing of genes, hybridization analysis using an allele-specific microarray, allele-specific PCR, capillary electrophoresis, single-strand conformation polymorphism (SSCP), DGGE such as denaturation gradient gel electrophoresis, denaturing HLPC, mass spectrometry, and restriction fragment length polymorphism analysis (RFLP).

In the above multiplex PCR kit, the amplification confirmation primer set may be a primer pair composed of the nucleic acid sequences of SEQ ID NOS: 6 and 7, respectively.

In the multiplex PCR kit, the origin-specific primer may be a primer consisting of the nucleic acid sequence of SEQ ID NO: 8 or 9.

In the multiplex PCR kit, the primer consisting of the nucleic acid sequence of SEQ ID NO: 8 may be a specific primer of Bangladesh Dagger waist.

In the multiplex PCR kit, the primer consisting of the nucleic acid sequence of SEQ ID NO: 9 may be a Korean hangover specific primer.

Hereinafter, the present invention will be described in more detail by way of examples. It should be understood, however, that the invention is not limited to the disclosed embodiments, but may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, Is provided to fully inform the user.

Example 1: Preparation of experimental sample and DNA

The native species used in the present invention was sampled in May 2014 at the origin of the Youngsan River in Haenam and directly imported from Bangladesh. Each sample was fixed with 100% ethanol and transferred to the laboratory for DNA extraction. Total DNA was separated from each sample using a MagExtractor MFX-6100 automated DNA extraction system (Toyobo, Osaka, Japan). The extracted genomic DNA was quantified using a Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific, USA) and stored at -20 ° C.

Example 2: 16S rRNA gene analysis

Mitochondrial 16S rRNA gene analysis was performed from the DNA isolated according to one embodiment of the present invention. Specifically, the target DNA was annealed using a 16S rRNA 16Sar universal forward primer (5'-CCGGTCTGAACTCAGATCACGT-3 ', SEQ ID NO: 1) and a 16Sbr universal reverse primer (5'-CGCCTGTTTATCAAAAACAT-3', SEQ ID NO: 2) ) At 60 < 0 > C (Palumbi, Molecular Systematics. , 205-247, 1996). PCR was performed using 0.2 units of DNA polymerase (TNT Research, Korea), 200 μM of each dNTP, 1 μL of 10 × PCR buffer, 10 pmol of each primer and 10-20 ng of DNA in a volume of 10 μL Was performed using a gene amplifier (PTC-2040; Bio-Rad, Hercules, USA). The PCR amplification was maintained at 95 ° C for 11 min in the initial denaturation step and then the denaturation step consisted of denaturation at 94 ° C for 1 min, annealing at 60 ° C for 1 min and extension at 72 ° C for 1 min 35 cycles and the last expansion step was maintained at 72 DEG C for 5 minutes. The PCR fragments obtained through the above steps were purified using AMPure ™ magnetic beads (Agencourt Bioscience, USA) according to the manufacturer's instructions, and about 8-20 ng of the purified product was used as a template in the ABI Big Dye ^™ Terminator v. Sequence analysis was performed using the 3.1 Cycle Sequencing Kit (Applied Biosystems, USA). A total of 625 bp sequences were identified from a total of 100 individuals in a total of 100 individuals in the indigenous species and the Bangladesh species in the waist circumference, and the locus-specific SNP 73 region (FIG. 1, Table 1). In addition, it was confirmed that four bases (base positions 242, 243, 260 and 261) were deleted in the bangledesic acid hangers. As a result of analysis, it was found that Hap1 to Hap22 derived from Bangladesh habitat (Hap1 to Hap22) were very highly homologous, and also there was a very high homology between Hap23 and Hap35 from Yeongsan River . This indicates that there is a genetic difference between Bangladesh sidewalk and domestic sidewalk sidewalk. Specifically, 88.32% homology was observed between the most frequent monoclasts of the Youngsan River and the most frequent monoclasts of Bangladesh. On the other hand, in case of Hap12 of Bangladesh mountain ducklings, the genotype of Bangladesh ducklings is similar to that of domesticated domestic ducklings, . Therefore, in case of Hap12, it was excluded from the selection of SNP for discrimination between domestic and Bangladesh hangover. From the above results, it can be seen that the main monoclasts and the specific SNP sites of origin included therein can be used as genetic markers for discrimination of origin of the hangover. Among the polymorphic sites in Table 1 below, the yellow background indicates a region-specific SNP or base deletion site.

The native species and the Bangladesh mountain goat's waist 16S rDNA sequence Bangladesh Mountain Dumbbell
Base sequence CGCCTGTTTACCAAAAACAT CGCCTCTTGCAAACCCAAAATATAAGAGGTCCCGCCTGCCCTGTGACACAAATTTAACGGCCGCGGTATCCTGACCGTGCAAAGGTAGCGCAATCACTTGTCTTTTAATTGAAGACCTGTATGAATGGCATAACGAGGGCTTAACTGTCTCCTTTCTACAGTCAATGAAATTGATCTCCCCGTGCAGAAGCGGGGATAACAACATAAGACGAGAAGACCCTGTGGAGCTTTAGACACTATGGGCAACCCATACAAAC ACCCACATAAAAGACACGAACC AAATGTGAACCTGCCTTAATATCTTCGGTTGGGGCGACCATGGAGTAACAAACAACCTCCAAGCGGAATAGGAATACTTTTTCCCAAAATTAAGAAATACAACTCAAAATAACAGAAATTCTGACCAAATGATCCGGTAACACCGATCAACGAACCAAGTTACCCCAGGGATAACAGCGCAATCCCCTTTTAGAGCCCGTATCGACAAGGGGGTTTACGACCTCGATGTTGGATCAGGACACCCTAATGGTGCAGCCGCTATTAAAGGTTGTTTTGTTCAACGATTAAAGTCCTACGTGATCTGAGTTT SEQ ID NO: 4 16SAR (F: CGCCTGTTTACCAAAAACAT) and
BMaR (R: ACCCACATAAAAGACACGAACC): 299 bp SEQ ID NO: 6 and SEQ ID NO: 8 Native species
Hungry waist
Base sequence CGCCTGTTTACCAAAAACAT CACCTCCTGCAAATTTTATATATAGGAGGCATTGCCTGCCCAGTGACACATGTTTAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGTAATCACTTGTCTTTTAATTGAAGACCTGTATGAATGGCATAACGAAGGCTTAACTGTCTCCTCTTTAAAGTCAATAAAATTGATCTCCCCGTGCAGAAGCGGGGATTACACCATAAGACGAGAAGACCCTGTGGAGCTTTAGACGCTAAAGCAGCCCATGAACTAACCTTGTCATAAACAAGTTATTAACCAGTGAAACCCTGCTTCCCTGTCTTCGGTTGGGGCGACCAGGAGAAACTAAAAAACTCTCCCGAGGAGTAGGAAGACTCTTCCCAAAACCAAGAGCCACACCTCTAATAATTAGAACTTCTAACC ATAATAGACCCGGAATACCCG ATCTTCGAACAAAGTTACCCCAGGGATAACAGCGCAATCCCCTTTTAGAGCCCGTATCGACAAGGGGGTTTACGACCTCGATGTTGGATCAGGACACCCTAATGGTGCAGCCGCTATTAAAGGTTGTTTTGTTCAACGATTAAAGTCCTACGTGATCTGAGTTT SEQ ID NO: 5 16SAR (F: GCCTGTTTACCAAAAACAT) and
KMaR (R: ATAATAGACCCGGAATACCCG): 447 bp SEQ ID NO: 6 and SEQ ID NO: 9

Example 3: Allele-specific PCR

In accordance with one embodiment of the present invention, an allele-specific PCR was performed by devising a primer specific to the source specific primary diploid and its SNP site.

Specifically, an allele-specific primer was designed around the haplotype most frequently observed for each country of origin after identification of SNP (single nucleotide polymorphism) in a partially amplified 16S rRNA gene. A number of different primers have been developed and subjected to basic tests. Two sets of multi-plex PCR primers have been developed (Table 1). The multiplex PCR was carried out using 0.25 units of DNA polymerase (TNT Research, Anyang-si, Korea), 200 μM of each dNTP, 1 μL of 10 × PCR buffer, 0.2 μl of each primer (16 SAR 0.2 μl, DR_B2_R 0.2 μl, DR_K5_R (PTC-2040; Bio-Rad, Hercules, USA) in a volume of 10-μL supplemented with 10-20 ng of DNA. The multiplex PCR conditions consisted of an initial denaturation step at 95 ° C and a first denaturation step at 94 ° C for 01:00, 60 ° C for 1:00 and 72 ° C for 1:00, and the last expansion step was held at 72 ° C for 5 minutes.

However, the above-mentioned specific region-specific primers are merely illustrative, and allele-specific primers utilizing various acid-specific SNPs or acid-specific deletions or addition bases shown in Table 1 as the 3'- When used, results similar to those described above can be obtained.

The primer pairs shown in SEQ ID NOs: 6 and 8 amplified a product of 299 bp at the waist of the Bangladesh hangover with the universal 16Sbr forward and BMaR reverse primers, and the primer pairs of SEQ ID NOS: 6 and 9 amplified a product of 447 bp at the local loop waist Respectively. The PCR reaction products were visualized on 2% agarose gel (Table 2, Figure 2).

Primer information used in multiplex PCR reaction primer Nucleic acid sequence Length Coupling temperature ℃ SEQ ID NO: 16SAR 5'-CGCCTGTTTATCAAAAACAT-3 ' 20 60

6 16SBR 5'-TCCGGTCTGAACTCAGATCACG-3 ' 22 7 BMaR 5'-GGTTCGTGTCTTTTATGTGGGT-3 ' 22 8 KMaR 5'-CGGGTATTCCGGGTCTATTAT-3 ' 21 9

Therefore, it was possible to identify the hangover habitat using multiplex PCR, which was carried out with all-purpose primer set, BMaR, which is a specific reverse primer for Bangladesh acid, and KMaR, a native species specific reverse primer.

Although the present invention has been described with reference to the above embodiments, it is to be understood that various changes and modifications may be suggested to those skilled in the art without departing from the scope of the present invention. Accordingly, the true scope of the present invention should be determined by the technical idea of the appended claims.

<110> Republic of Korea represented by National Fisheries Research & Development Institute <120> Single nucleotide polymorphic DNA markers for discriminating habitat of the albino swamp eel, Fluta alba and a method using the same <130> PD14-5134 <160> 9 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> 16S rRNA 16Sar-F <400> 1 ccggtctgaa ctcagatcac gt 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16S rRNA 16Sar-R <400> 2 cgcctgttta tcaaaaacat 20 <210> 3 <211> 591 <212> DNA <213> Monopterus albus <400> 3 aayyywawat atargaggym yygcctgmcc wgtgayacaw dtttaacggc cgdggtatcc 60 trwccgtgca aaggtagmgy aatsactwgt cttttawwtg aagacmtgta tgaatggcat 120 aacgarggct taactgtctc mtytytamag tcaatraaaw tgatctcccc gtgcagaagc 180 ggggatwaca mcataakacg agaagwccck gtggagckyt agacrstatr rgcrrcccat 240 radcwaacmy yswyatwaac aagwyaykaw ccaarwgwra mcctgsytym mtrthttygg 300 ttkgggskrc cakgrrrwam yaaamaacyy ycmmrvggar twgraakayt yytyycmaaa 360 ayymagarmh wcmmctbdwa wwawyaraam wtykraccmw mwtrrhmyvk baaywcccga 420 tcwwmraamm aagktwyyyc agggawaaca gsgcaatccc ctttwagarc ccrtatcgmc 480 cgctattaaa 540 ggttgttttg ttcaacgatt aaagtcctac gtgatctgag tttagaccgg a 591 <210> 4 <211> 608 <212> DNA <213> Monopterus albus <400> 4 cgcctgttta ccaaaaacat cgcctcttgc aaacccaaaa tataagaggt cccgcctgcc 60 ctgtgacaca aatttaacgg ccgcggtatc ctgaccgtgc aaaggtagcg caatcacttg 120 tcttttaatt gaagacctgt atgaatggca taacgagggc ttaactgtct cctttctaca 180 gtcaatgaaa ttgatctccc cgtgcagaag cggggataac aacataagac gagaagaccc 240 tgtggagctt tagacactat gggcaaccca tacaaacacc cacataaaag acacgaacca 300 aatgtgaacc tgccttaata tcttcggttg gggcgaccat ggagtaacaa acaacctcca 360 agcggaatag gaatactttt tcccaaaatt aagaaataca actcaaaata acagaaattc 420 tgaccaaatg atccggtaac accgatcaac gaaccaagtt accccaggga taacagcgca 480 atcccctttt agagcccgta tcgacaaggg ggtttacgac ctcgatgttg gatcaggaca 540 ccctaatggt gcagccgcta ttaaaggttg ttttgttcaa cgattaaagt cctacgtgat 600 ctgagttt 608 <210> 5 <211> 611 <212> DNA <213> Monopterus albus <400> 5 cgcctgttta ccaaaaacat cacctcctgc aaattttata tataggaggc attgcctgcc 60 cagtgacaca tgtttaacgg ccgcggtatc ctaaccgtgc aaaggtagcg taatcacttg 120 tcttttaatt gaagacctgt atgaatggca taacgaaggc ttaactgtct cctctttaaa 180 gtcaataaaa ttgatctccc cgtgcagaag cggggattac accataagac gagaagaccc 240 tgtggagctt tagacgctaa agcagcccat gaactaacct tgtcataaac aagttattaa 300 ccagtgaaac cctgcttccc tgtcttcggt tggggcgacc aggagaaact aaaaaactct 360 cccgaggagt aggaagactc ttcccaaaac caagagccac acctctaata attagaactt 420 ctaaccataa tagacccgga atacccgatc ttcgaacaaa gttaccccag ggataacagc 480 gcaatcccct tttagagccc gtatcgacaa gggggtttac gacctcgatg ttggatcagg 540 acaccctaat ggtgcagccg ctattaaagg ttgttttgtt caacgattaa agtcctacgt 600 gatctgagtt t 611 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16SAR <400> 6 cgcctgttta tcaaaaacat 20 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 16SBR <400> 7 tccggtctga actcagatca cg 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BMaR <400> 8 ggttcgtgtc ttttatgtgg gt 22 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> KMaR <400> 9 cgggtattcc gggtctatta t 21

Claims

A polynucleotide for determining Monopterus albus origin selected from the group consisting of the following polynucleotides or polynucleotides complementary thereto:
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the third base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and containing a single base polymorphism (SNP) site in which the fourth base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site wherein the 5 < th > base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single nucleotide polymorphism (SNP) region in which the sixth nucleotide of SEQ ID NO: 3 is A or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single nucleotide polymorphism (SNP) site in which the eighth nucleotide of SEQ ID NO: 3 is A or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single nucleotide polymorphism (SNP) region in which the 14th nucleotide of SEQ ID NO: 3 is A or G;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and containing a single base polymorphism (SNP) site in which the 19 < th >
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 20 < th >
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 21st base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 22nd base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 31st base of SEQ ID NO: 3 is T or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site wherein the 40 < th > base of SEQ ID NO: 3 is A or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single nucleotide polymorphism (SNP) region in which the 41st base of SEQ ID NO: 3 is A or G;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 62nd base of SEQ ID NO: 3 is G or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 80 < th >
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) region wherein the 126th base of SEQ ID NO: 3 is G or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single nucleotide polymorphism (SNP) region in which the 143th nucleotide of SEQ ID NO: 3 is T or C;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site wherein the 145th base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 148th base of SEQ ID NO: 3 is C or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) region wherein the 156th base of SEQ ID NO: 3 is G or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 187th base of SEQ ID NO: 3 is A or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 191st base of SEQ ID NO: 3 is A or C;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site wherein the 225th base of SEQ ID NO: 3 is A or G;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 230 base of SEQ ID NO: 3 is G or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 231st base of SEQ ID NO: 3 is G or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 235st base of SEQ ID NO: 3 is A or G;
A polynucleotide selected from a polynucleotide having a nucleotide sequence of SEQ ID NO: 3 and having a deletion of the 241 base of SEQ ID NO: 3 or a single base polymorphism (SNP) site of A or G, Nucleotides;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and containing a single base polymorphism (SNP) site in which the 242 < th >
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 245th base of SEQ ID NO: 3 is A or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 249th base of SEQ ID NO: 3 is A or C;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site wherein the 250th base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 251st base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single nucleotide polymorphism (SNP) region in which the 252nd nucleotide of SEQ ID NO: 3 is C or G;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 253rd base of SEQ ID NO: 3 is A or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 259th base of SEQ ID NO: 3 is deleted or is A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and containing a single nucleotide polymorphism (SNP) site in which the 260th nucleotide of SEQ ID NO: 3 is deleted or C;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 265th base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 267th base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 268th base of SEQ ID NO: 3 is G or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 275th base of SEQ ID NO: 3 is A or G;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single nucleotide polymorphism (SNP) region in which the 278th nucleotide of SEQ ID NO: 3 is T or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) region in which the 279th nucleotide of SEQ ID NO: 3 is G or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 281st base of SEQ ID NO: 3 is A or C;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 287th base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single nucleotide polymorphism (SNP) region in which the 289th base of SEQ ID NO: 3 is T or C;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 290th base of SEQ ID NO: 3 is A or C;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 291st base of SEQ ID NO: 3 is A or C;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 293rd base of SEQ ID NO: 3 is A or G;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 315st base of SEQ ID NO: 3 is A or G;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 317th base of SEQ ID NO: 3 is G or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) region in which the 318th base of SEQ ID NO: 3 is T or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 321st base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 325th base of SEQ ID NO: 3 is C or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 329th base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 331st base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 333rd base of SEQ ID NO: 3 is A or C;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single nucleotide polymorphism (SNP) site in which the 334th nucleotide of SEQ ID NO: 3 is A or C;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site wherein the 340 base of SEQ ID NO: 3 is A or G;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 362nd nucleotide of SEQ ID NO: 3 is T or C;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 368th base of SEQ ID NO: 3 is A or G;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 382nd nucleotide of SEQ ID NO: 3 is T or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 384th base of SEQ ID NO: 3 is A or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 385th base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 390st base of SEQ ID NO: 3 is A or C;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site wherein the 395th base of SEQ ID NO: 3 is G or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single nucleotide polymorphism (SNP) region wherein the 404th nucleotide of SEQ ID NO: 3 is G or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 405th base of SEQ ID NO: 3 is A or G;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 406th base of SEQ ID NO: 3 is T or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 411 base of SEQ ID NO: 3 is C or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and containing a single base polymorphism (SNP) site in which the 418th base of SEQ ID NO: 3 is deleted or C;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site in which the 423rd base of SEQ ID NO: 3 is A or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 424th base of SEQ ID NO: 3 is A or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) region wherein the 430th base of SEQ ID NO: 3 is C or A;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 465th base of SEQ ID NO: 3 is A or T;
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleotide sequence of SEQ ID NO: 3 and including a single base polymorphism (SNP) site in which the 473rd base of SEQ ID NO: 3 is A or G; And
A polynucleotide consisting of 10 to 100 consecutive nucleotides selected from polynucleotides having the nucleic acid sequence of SEQ ID NO: 3 and comprising a single base polymorphism (SNP) site wherein the 515st base of SEQ ID NO: 3 is C or A.

A kit for determining the origin of a hangover locus comprising the polynucleotide of claim 1 or a pair of primers capable of specifically amplifying the polynucleotide.

A total DNA extraction step of extracting total DNA from the hind paw;
An amplification step of amplifying the polynucleotide comprising a single nucleotide polymorphism (SNP) as a primer pair capable of specifically amplifying the polynucleotide of claim 1 as a template, using the extracted total DNA as a template; And
Identifying the genotype of the polynucleotide. &Lt; RTI ID = 0.0 > 8. < / RTI >

The method of claim 3,
The step of confirming the genotype of the polynucleotide may include sequencing of genes, hybridization analysis using an allele-specific microarray, allele-specific PCR, capillary electrophoresis, single-strand conformation polymorphism (SSCP), DGGE wherein the method is performed by a method selected from the group consisting of denaturation gradient gel electrophoresis, denaturing HLPC, mass spectrometry and restriction fragment length polymorphism analysis (RFLP).

A primer set for amplification confirmation capable of amplifying the insect mitochondrial 16S rDNA of SEQ ID NO: 3 irrespective of origin; And
3, 4, 5, 6, 8, 14, 19, 20, 21, 22, 31, 40, 41, 62 of SEQ ID NO: 3 or a complementary nucleic acid sequence thereof selected from SEQ ID NO: , 80, 126, 143, 145, 148, 156, 187, 191, 225, 230, 231, 241, 242, 245, 249, 250, 251, 252, 253, 259, 265, 267, 268, 275, 278 , 279, 281, 287, 289, 290, 291, 293, 315, 317, 318, 321, 325, 329, 331, 333, 334, 340, 362, 368, 382, 384, 390, Specific primer comprising a continuous length of 15 to 50 nt comprising 3'-terminal, 418, 423, 424, 430, 465, 473, 515 base or a corresponding complementary base thereof. Multiplex PCR kit for determining the origin of hangover.

6. The method of claim 5,
Wherein the amplification confirmation primer set is a primer pair each consisting of the nucleic acid sequences of SEQ ID NOS: 6 and 7, respectively.

6. The method of claim 5,
Wherein the origin-specific primer is a primer consisting of the nucleic acid sequence of SEQ ID NO: 8 or 9. < Desc / Clms Page number 24 >

8. The method of claim 7,
Wherein the primer consisting of the nucleic acid sequence of SEQ ID NO: 8 is a Bangladesh bean specific primer.

8. The method of claim 7,
The primer consisting of the nucleic acid sequence of SEQ ID NO: 9 is a Korean hangover specific primer, and is a multiplex PCR kit for determining the origin of hangover.

A DNA amplification step of amplifying the total DNA separated from the hind paw with the multiplex PCR kit for determining the hangover waist origin of claim 5;
An electrophoresis step of electrophoresing the amplified DNA fragment; And
And analyzing a band pattern of said electrophoretic DNA fragments.