CN110669836B - Molecular marker for identifying hereditary sex of Oxytropis myriophylla and application thereof - Google Patents
Molecular marker for identifying hereditary sex of Oxytropis myriophylla and application thereof Download PDFInfo
- Publication number
- CN110669836B CN110669836B CN201911116241.1A CN201911116241A CN110669836B CN 110669836 B CN110669836 B CN 110669836B CN 201911116241 A CN201911116241 A CN 201911116241A CN 110669836 B CN110669836 B CN 110669836B
- Authority
- CN
- China
- Prior art keywords
- detected
- seq
- fish
- molecular marker
- nucleotide sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker for identifying the genetic sex of a sea buckthorn juvenile fish and application thereof. The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1; the individual with the deletion of the nucleotide sequence shown in SEQ ID NO. 1 is a genetic male echinocandis. During detection, PCR amplification is carried out by using SEQ ID NO 2 and 3 as primers, and when the amplification fragments are 460bp and 392bp, the to-be-detected echinacea purpurea juvenile fish has a gene which lacks a nucleotide sequence shown by SEQ ID NO 1 and is a genetic male echinacea juvenile fish; when only 460bp amplified fragment exists, the echinacea purpurea does not have the gene of the nucleotide sequence shown by the deletion SEQ ID NO. 1, and is a genetic female echinacea purpurea. The method is suitable for the gonad differentiation of the Mylopharyngodon Piceus.
Description
Technical Field
The invention relates to a fish genetic sex identification and sex control technology in the technical field of aquatic organisms, in particular to a molecular marker for identifying the genetic sex of acanthocephalus spinosus and application thereof.
Background
The mechanism of sex determination is one of the hot spots in the study of fish biology. Fish, as a lower vertebrate, has a wide variety of sex determination patterns, and is an ideal pattern system for studying sex determination and evolution of vertebrates. Knowledge of their sex determination mechanism can improve sex control and reproductive control techniques. In addition, the sex of fish is also closely related to its reproduction and many important economic traits, and thus sex control has received a great deal of attention in aquaculture.
With the development of molecular biology technology, various types of DNA molecular markers have been developed, including (1) Restriction Fragment Length Polymorphism (RFLP); (2) randomly Amplifying Polymorphic DNA (RAPD); (3 Amplified Fragment Length Polymorphism (AFLP); (4) microsatellite marker(s); (5) Single Nucleotide Polymorphism (SNP); Using the above molecular marker technology, sex-specific molecular markers have been developed for many species, but different species differ in their genomic sequence structure, and sex-specific molecular markers for one species cannot generally be used for identification of the genetic sex of other species.
The juvenile sea fish (Collichthys lucidus) belongs to Perciformes, the family Shikojidae, the genus Meristotheca, and is mainly distributed in the western Pacific region, including the West coast of China, Korean peninsula, Japan, Philippines coastline, etc., and is an important marine fish widely eaten in Asian coastal regions. The body size of the echinocandis punctatus has a male-female state, the female individual is larger than the male individual, and the sex control related technology has commercial application potential. Molecular markers of gender are important tools for developing techniques for sex control. However, no report has been found at home and abroad on molecular markers that can identify and characterize the genetic sex of the juvenile sea buckthorn.
Disclosure of Invention
The invention aims to provide a molecular marker for identifying the genetic sex of the echinocandis.
In order to achieve the aim, the invention provides a molecular marker related to the genetic sex of the sea buckthorn juvenile fish, which is characterized in that the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1; the individual with the deletion of the nucleotide sequence shown in SEQ ID NO. 1 is a genetic male echinocandis.
The invention also provides a primer pair for detecting the molecular marker, which is characterized by having a nucleotide sequence shown in SEQ ID NO. 2-3.
Further, the primer is utilized to carry out PCR amplification on the genome DNA of the Oxytropis myriophylla to be detected with SEQ ID NO. 2-3, the length of the amplified fragment is detected,
when an amplification product appears and the amplification fragment is 460bp, the to-be-detected acanthocephalus spinosus does not have a gene lacking the nucleotide sequence shown by SEQ ID NO. 1, and is a hereditary female acanthocephalus spinosus;
when an amplification product appears and the amplification fragment is 460bp and 392bp, the to-be-detected echinoderm piscis has a gene which is deleted of the nucleotide sequence shown by SEQ ID NO. 1 and is a genetic male echinoderm piscis.
Also provides a kit for detecting the molecular marker, which is characterized by comprising the primer pair.
The molecular marker, the primer pair and the kit are also protected, and the application of the kit in breeding of the myriophyllum echinocandis is realized.
The method for identifying the sex of the juvenile fish of the echinacea is characterized in that the molecular marker is detected on the juvenile fish of the echinacea to be detected so as to determine the genetic sex of the juvenile fish of the echinacea to be detected.
Further, the method comprises:
carrying out PCR amplification on the genomic DNA of the echinacea juvenile fish to be detected by using the primer pair or the kit;
detecting the length of the amplified fragment, and
determining the genetic sex of the echinacea purpurea fish to be detected based on the length of the extension fragment,
wherein, when the amplified fragment is 460bp and 392bp, the acanthocephalus spinosus to be detected has a gene which lacks the nucleotide sequence shown by SEQ ID NO. 1 and is a genetic male acanthocephalus spinosus; when only 460bp amplified fragment exists, the to-be-detected echinacea juvenile fish does not have the gene of the nucleotide sequence shown by the deleted SEQ ID NO. 1, and is the hereditary female echinacea juvenile fish.
Further, the length of the amplified fragment is detected by gel electrophoresis, preferably agarose gel electrophoresis or polyacrylamide gel electrophoresis.
Also provides an assistant breeding method of the acanthocephalus spinosus, which is characterized by comprising the following steps:
by the method, the molecular marker is detected so as to determine the genetic sex of the to-be-detected echinacea juvenile fish.
The applicant of the invention compares the sequence of the genome difference of the female and male Oxytropis myriophylla (see figure 3), and the analysis shows that SEQ ID NO. 1 is a molecular marker related to the sex of Oxytropis myriophylla. The molecular marker nucleotide sequence is shown as follows (SEQ ID NO: 1):
5‘-TCACACATAGCTGAGACATGGCGATGCAACAACAACCCAGTGATGTTTTCATGTTTTGTATCGACTTT-3’
the invention provides a primer pair for identifying sex of a sea buckthorn juvenile fish, which comprises the following sequence pairs:
and (3) primer F: 5 'GGATCTTAAACTGTGTGCTCCATTC-3'; 2, SEQ ID NO;
and (3) primer R: 5'-CAATACTGACCTGCTGATGTGTAAT-3', respectively; 3, SEQ ID NO.
The invention also provides a molecular marker method for identifying sex of the sea buckthorn juvenile fish, which takes genome DNA of the sea buckthorn juvenile fish to be identified as a template, utilizes the primer to carry out PCR amplification and judges according to an amplification product.
The above method, the PCR amplification, comprises the following steps: ddH 2 O13.4. mu.l; 10 × Buffer 2 μ L; dNTP (2.5mM) 1.6. mu.L; primer F (10mM) 0.4. mu.L; primer R (10mM) 0.4. mu.L; 0.2 mu L of Taq enzyme; DNA template (30 ng/. mu.L) 2. mu.L; the total volume was 20. mu.L. The PCR amplification method comprises the following steps: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 56.4 ℃ for 30s, and 72 ℃ for 30 s; 10mm at 72 ℃. The method for extracting the genome DNA of the echinocandis japonicus and the mermaid to be identified comprises the following steps: by phenol chloroform method. The method further comprises the steps of detecting an amplification product through 3% agarose gel electrophoresis of a PCR amplification product, determining an electrophoresis strip of the PCR amplification product of the echinocandis japonicus to be identified, and if the amplification product of the echinocandis japonicus to be identified is 460bp, determining that the genetic sex of the echinocandis japonicus to be identified is female; if two amplification products of the juvenile fish of the echinacea to be identified are 392bp and 460bp respectively, the genetic sex of the juvenile fish of the echinacea to be identified is male.
The invention provides a PCR-based sex determination molecular marker for the juvenile fish of the echinacea, which has the advantages of small damage to the fish body, applicability to the whole life history, wider applicable material range and the like. The concrete expression is as follows:
1) the damage to the fish body is small: compared with the currently used gonad dissection examination method, the method provided by the invention does not need to kill experimental objects, and is particularly suitable for objects needing to be kept alive;
2) applicable to the whole life history: compared with the currently used method for anatomically inspecting the gonads, the method disclosed by the invention is not only suitable for the living stage with clear gonad differentiation, but also suitable for the early stage with undeveloped or differentiated gonads;
3) the applicable material range is wider: compared with the current gonad dissection examination method, the method of the invention can not only identify the sex of the fish body, but also be used for some special materials, such as research on supermale, sperm and BAC clone.
Drawings
FIG. 1 is a graph of the results of genome-wide correlation analysis of re-sequenced data;
FIG. 2 is a partial genome re-sequencing sequence alignment diagram of a Mylopharyngodon piceus disclosed in the present invention;
FIG. 3 is a sequence diagram of the primer F and the primer R for verifying the genomic difference sequence design of a single Meadowrus echinocandis disclosed in the present invention;
FIG. 4 is an electrophoretogram obtained by verifying a genome difference sequence of a female and male Mylopharyngodon piceus by using a primer F and a primer R in the invention.
Detailed Description
Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to the same or similar elements or elements having the same or similar function throughout. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention. The examples do not specify particular techniques or conditions, and are performed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
Example 1:
the applicant of the invention takes the spinocereus caught in all three australia, ningde city, Fujian province, China as a sample, constructs genome re-sequencing data of 12 groups of the spinocereus, and uses the re-sequencing data to perform whole genome correlation analysis (figure 1) to show that sex-significant related regions are positioned on chromosomes 1, 2, 6, 7, 8, 11, 14, 17 and 22. Among them, chromosome 1 and chromosome 7 have the most significant sites of association, and are concentrated in the terminal region near chromosome 7 and in the anterior region of chromosome 1. Further performing male-female deep comparative analysis on genome re-sequencing data (figure 2), finally finding a specific deletion of a sequence in male echinacea juvenile fish in a sex-significant related region of chromosome 7, and finally screening that the specific deletion sequence in the male echinacea juvenile fish is shown as SEQ ID NO:1 (figure 3).
In FIG. 2: the female-1 represents the female No. 1 sample, the male-1 represents the male No. 1 sample, the mixed female-1 represents the female mixed pool No. 1 sample, the mixed male-1 represents the male mixed pool No. 1 sample, and the rest numbers are repeated.
The sex determination system of the sea buckthorn baby fish is X 1 X 1 X 2 X 2 /X 1 X 2 Y, female is X 1 X 1 X 2 X 2 Male is X 1 X 2 And Y. By performing alignment analysis on 8 groups of gynoecial echinocandis mermaid whole genome re-sequencing data, the result shows that 68bp deletion exists in the sequence from the male fish (figure 2). In view of the male fish X 1 X 2 The sequence of (A) is identical to that of female fish X 1 X 2 And the fragment is deleted only in male fish and not in female fish, it is presumed that the deleted fragment may exist on the Y chromosome. For this purpose, the inventors designed primers F and R based on the sequences at both ends (FIG. 3).
Example 2
The primer pair is utilized to carry out PCR amplification on the genome DNA of the male and female echinocandis juvenile fish determined by anatomical examination, and the accuracy and specificity of the method are verified by agarose gel electrophoresis map comparison. The method comprises the following specific steps:
taking 11 tails of adult fish of Chinemys spinosus identified by anatomical examination and male, shearing part of fin strip of Chinemys spinosus, and placing into alcohol solution for preserving at-20 deg.C for extracting genome; extracting genome DNA by adopting a phenol chloroform method, and uniformly diluting the obtained genome DNA to 30 ng/mu L as a template for later use;
and (3) primer F: 5 'GGATCTTAAACTGTGTGCTCCATTC 3'; 2, SEQ ID NO;
and (3) primer R: 5 'CAATACTGACCTGCTGATGTGTAAT 3'; 3, SEQ ID NO.
The primer is used for carrying out PCR amplification reaction system, the total reaction volume is 20 mu L, and the specific reaction system is ddH 2 O13.4 μ L; 10 × Buffer 2 μ L; dNTP (2.5mM) 1.6. mu.L; primer F (10mM) 0.4. mu.L; primer R (10mM) 0.4. mu.L; 0.2 mu L of Taq enzyme; DNA template (30 ng/. mu.L) 2. mu.L. The PCR amplification procedure was: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 56.4 ℃ for 30s, and extension at 72 ℃ for 30 s; after 30 cycles, extension was followed for 10min at 72 ℃.
The amplified product was detected by agarose gel electrophoresis at a concentration of 3% for about 1h, at a voltage of 130v and a current of 115 mA. And after the electrophoresis is finished, imaging processing is carried out, and the strips of the picture are analyzed.
The electrophoresis result (as shown in FIG. 4) shows that a strip of 460bp appears in all female spiny head mermaid; while the male acanthocephalus spiny comes in two bands, one is 460bp and the other is 392 bp. The result is 100% in accordance with the expected requirement. Consistent with the sex confirmed by anatomical observations. Therefore, the primer of the invention can accurately identify the sex of the spinosad.
Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made in the above embodiments by those of ordinary skill in the art without departing from the principle and spirit of the present invention.
SEQUENCE LISTING
<110> college university
<120> molecular marker for identifying hereditary sex of Oxytropis myriophylla and application thereof
<130> JMDXC-19030-CNI
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 68
<212> DNA
<213> Echinops lucidus (Collichthys lucidus)
<400> 1
tcacacatag ctgagacatg gcgatgcaac aacaacccag tgatgttttc atgttttgta 60
tcgacttt 68
<210> 2
<211> 25
<212> DNA
<213> Artificial Synthesis
<400> 2
ggatcttaaa ctgtgtgctc cattc 25
<210> 3
<211> 25
<212> DNA
<213> Artificial Synthesis
<400> 3
caatactgac ctgctgatgt gtaat 25
Claims (10)
1. A molecular marker related to the genetic sex of the sea buckthorn juvenile fish is characterized in that the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1; the individual with the deletion of the nucleotide sequence shown in SEQ ID NO. 1 is a genetic male echinocandis.
2. A primer pair for detecting the molecular marker of claim 1, wherein the primer pair has a nucleotide sequence shown as SEQ ID NO. 2-3.
3. The primer pair of claim 2, wherein the primer pair SEQ ID NO 2-3 is used for PCR amplification of the genomic DNA of the Scopus spinosus to be detected, and the length of the amplified fragment is detected;
when an amplification product appears and the amplification fragment is 460bp, the echinocandis japonicus fish to be detected does not have a gene lacking the nucleotide sequence shown by SEQ ID NO. 1 and is a genetic female echinocandis japonicus fish;
when an amplification product appears and the amplification fragments are 460bp and 392bp, the to-be-detected echinoderm fish has a gene lacking the nucleotide sequence shown by SEQ ID NO. 1 and is a genetic male echinoderm fish.
4. A kit for detecting the molecular marker of claim 1, comprising the primer set of claim 2 or 3.
5. Use of the molecular marker of claim 1, the primer pair of claim 2 or 3, or the kit of claim 4 for breeding of Scophytus spinosus.
6. A method for identifying sex of a young fish of echinacea, characterized in that the molecular marker of claim 1 is detected on the young fish of echinacea to be detected, so as to determine the genetic sex of the young fish of echinacea to be detected.
7. The method of claim 6, wherein the method comprises:
performing PCR amplification on genomic DNA of the to-be-detected echinocandis fragrans by using the primer pair of claim 2 or 3 and the kit of claim 4;
detecting the length of the amplified fragment, and
determining the genetic sex of the to-be-detected Chinemys spinosus based on the length of the extension segment,
wherein, when the amplified fragment is 460bp and 392bp, the acanthocephalus spinosus to be detected has a gene which lacks the nucleotide sequence shown by SEQ ID NO. 1 and is a genetic male acanthocephalus spinosus; when only 460bp amplified fragment exists, the to-be-detected echinacea juvenile fish does not have the gene of the nucleotide sequence shown by the deleted SEQ ID NO. 1, and is the hereditary female echinacea juvenile fish.
8. The method of claim 7, wherein the length of the amplified fragment is detected by gel electrophoresis.
9. The method of claim 7, wherein the gel electrophoresis is agarose gel electrophoresis or polyacrylamide gel electrophoresis.
10. An assistant breeding method for the acanthocephalus spinosus, which is characterized by comprising the following steps:
detecting the molecular marker of claim 1 by the method of any one of claims 6 to 8, in order to determine the genetic sex of the echinacea fish to be tested.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911116241.1A CN110669836B (en) | 2019-11-15 | 2019-11-15 | Molecular marker for identifying hereditary sex of Oxytropis myriophylla and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911116241.1A CN110669836B (en) | 2019-11-15 | 2019-11-15 | Molecular marker for identifying hereditary sex of Oxytropis myriophylla and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110669836A CN110669836A (en) | 2020-01-10 |
| CN110669836B true CN110669836B (en) | 2022-09-23 |
Family
ID=69087370
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911116241.1A Active CN110669836B (en) | 2019-11-15 | 2019-11-15 | Molecular marker for identifying hereditary sex of Oxytropis myriophylla and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110669836B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110964798B (en) * | 2020-03-05 | 2023-07-07 | 东北农业大学 | Method for identifying genetic sex of rana chensinensis by using TRAP molecular marker technology |
| CN111748639A (en) * | 2020-08-07 | 2020-10-09 | 集美大学 | Molecular marker for identifying sex of haliotis discus hannai and application thereof |
| CN113215279A (en) * | 2021-06-08 | 2021-08-06 | 集美大学 | Molecular marker for identifying sex of haliotis discus hannai and primers thereof |
| CN113215280B (en) * | 2021-06-08 | 2022-09-23 | 集美大学 | Genetic sex molecular marker and primer universal for identifying south-north population of echinocandis japonicus and application thereof |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086167B (en) * | 2016-06-07 | 2019-06-28 | 江苏省海洋水产研究所 | The primer sequence and method of a kind of Rapid identification Larimichthys crocea, little yellow croaker and Collichthys lucidus |
| CN107326077B (en) * | 2017-07-14 | 2020-02-21 | 集美大学 | Molecular marker for identifying genetic sex of spotted maigre and application thereof |
| CN107236814B (en) * | 2017-07-14 | 2020-02-28 | 集美大学 | Molecular marker for identifying large yellow croaker genetic sex and application thereof |
| JP7007710B2 (en) * | 2017-11-15 | 2022-01-25 | 国立研究開発法人水産研究・教育機構 | Bluefin tuna hereditary sex marker and hereditary sex discrimination method |
| CN108192963B (en) * | 2018-03-14 | 2021-02-05 | 广东海洋大学 | Specific molecular marker for accurately identifying genetic sex of scatophagus argus and primer thereof |
-
2019
- 2019-11-15 CN CN201911116241.1A patent/CN110669836B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN110669836A (en) | 2020-01-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110669836B (en) | Molecular marker for identifying hereditary sex of Oxytropis myriophylla and application thereof | |
| CN107326077B (en) | Molecular marker for identifying genetic sex of spotted maigre and application thereof | |
| CN107236814B (en) | Molecular marker for identifying large yellow croaker genetic sex and application thereof | |
| CN108192963B (en) | Specific molecular marker for accurately identifying genetic sex of scatophagus argus and primer thereof | |
| CN106811540B (en) | Microsatellite marker and specific primer for identifying male and female individuals of Pseudobagrus ussuriensis and application of microsatellite marker and specific primer | |
| JP2021061826A (en) | Combination of female scallop-specific molecule markers and application thereof | |
| CN114686597A (en) | SNP molecular marker for sex identification of salangid and application thereof | |
| JP6877680B2 (en) | Method for identifying Lycodon rufozonus with growth genetic traits | |
| CN109182546B (en) | SSR fluorescence labeling primer for paternity test of pangolin scales and application thereof | |
| CN112575094B (en) | InDel marker for identifying northern subspecies, florida subspecies and hybrids thereof of micropterus salmoides and application thereof | |
| CN113637765A (en) | Molecular marker for identifying genetic sex of micropterus salmoides and application | |
| CN110042168B (en) | Primer pair, kit and method for distinguishing brachymystax lenok from hucho taimen | |
| CN111073983B (en) | SNP marker related to identification of northern subspecies and Florida subspecies of largemouth bass and application thereof | |
| CN113774122A (en) | Molecular marker, primer, kit and application for identifying genetic sex of yellow river carp | |
| KR20160121931A (en) | Gene composition for parentage testing in hanwoo | |
| JP2019062815A (en) | Primer set for amplifying fragment of insect-derived dna, and method for identifying insect type using the same | |
| CN114959056A (en) | SSR marker for identifying female procambarus clarkii and application thereof | |
| CN113215280B (en) | Genetic sex molecular marker and primer universal for identifying south-north population of echinocandis japonicus and application thereof | |
| JP2005514074A (en) | Proof of fish origin based on nucleic acid pattern recognition | |
| KR101508689B1 (en) | Markers for origin discrimination of the northern mauxia shrimp(Acetes chinensis) | |
| CN111748639A (en) | Molecular marker for identifying sex of haliotis discus hannai and application thereof | |
| CN107988386B (en) | SSR fluorescence labeling primer for paternity test of siniperca chuatsi and application | |
| JP2009219451A (en) | Method for individual identification and method for parentage test of cattle using single nucleotide polymorphism | |
| EP3221471B1 (en) | Method for predicting increased resistance of a rainbow trout to infectious pancreatic necrosis (ipn) | |
| KR101740634B1 (en) | Gene composition for parentage testing in wagyu |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |