CN112575094B - InDel marker for identifying northern subspecies, florida subspecies and hybrids thereof of micropterus salmoides and application thereof - Google Patents
InDel marker for identifying northern subspecies, florida subspecies and hybrids thereof of micropterus salmoides and application thereof Download PDFInfo
- Publication number
- CN112575094B CN112575094B CN202011506211.4A CN202011506211A CN112575094B CN 112575094 B CN112575094 B CN 112575094B CN 202011506211 A CN202011506211 A CN 202011506211A CN 112575094 B CN112575094 B CN 112575094B
- Authority
- CN
- China
- Prior art keywords
- subspecies
- northern
- florida
- length
- indel
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an InDel marker for identifying northern subspecies of micropterus salmoides, florida subspecies and hybrids thereof and application thereof, wherein the InDel molecular marker is positioned at the 8035398-8035480 th position of the 20 th chromosome of the northern subspecies of micropterus salmoides and has an insertion/deletion nucleotide sequence with the length of 82 bp. The InDel molecular marker can identify northern subspecies of micropterus salmoides, florida subspecies and hybrids thereof, and compared with the conventional SNP marker which only can identify northern subspecies of micropterus salmoides and Florida subspecies, the InDel molecular marker has wider application range and better practicability, is not influenced by the development period and environmental factors of micropterus salmoides, and has high accuracy of identification results.
Description
Technical Field
The invention relates to a gene marker, in particular to an InDel marker for identifying northern subspecies of micropterus salmoides, florida subspecies and hybrids thereof and application thereof.
Background
Lateolabrax japonicus (Micropterus salmodels L.), colloquially known as Lateolabrax japonicus, originally produced in fresh water lakes and rivers in North America. At the place of origin, micropterus salmoides comprise two subspecies: one is northern subspecies of Lateolabrax japonicus (M. Salmonedes), which is mainly distributed in the eastern United states, the northeast Mexico and the southeast Canada; the other is the largemides harziliana florida (m. Salmoides floridanus), which is mainly distributed in the south of peninsula florida in the united states. At the end of the 70 s of the 20 th century, taiwan introduced Lateolabrax japonicus from abroad, introduced into Guangdong province after the success of artificial propagation in 1983, and became one of important freshwater aquaculture varieties after more than 30 years of aquaculture industry development. However, the external forms of the two subspecies are very similar, so that the two subspecies are difficult to distinguish from each other in appearance, and in addition, the two subspecies have natural hybridization propagation, so that filial generation can be generated, and the distinguishing and distinguishing difficulty of the micropterus salmoides germplasm is greatly increased. And the accurate identification of northern subspecies, florida subspecies and hybrids thereof of the micropterus salmoides is the key for developing germplasm resource research and crossbreeding of the micropterus salmoides.
Since the classification status and the germplasm source of different micropterus salmoides can not be effectively and accurately distinguished and identified from the external morphology, the identification of the classification status of micropterus salmoides is mostly carried out by means of molecular biology. At present, common research on identification of the northern zander subspecies of the zander mainly focuses on identification of the northern zander subspecies and the Florida subspecies of the zander, such as microsatellite technology and SNP molecular markers. However, the conventional method still has many problems, such as SNP sites in a part of genome sequence of the NCCRP-1 gene of the micropterus salmoides, but the NCCRP-1 gene in hybrids after two subspecies are hybridized in actual measurement has heterozygosis phenomenon, so that the micropterus salmoides hybrids cannot be accurately identified by a PCR product sequencing method, and are difficult to distinguish by agarose gel electrophoresis.
Therefore, it is necessary to develop new molecular markers to accurately identify northern subspecies of micropterus salmoides, florida subspecies and hybrids thereof, and provide reliable bases for germplasm resource preservation, germplasm purification, cross breeding and the like of micropterus salmoides.
Disclosure of Invention
The invention aims to provide an InDel molecular marker;
it is another object of the present invention to provide a primer set;
it is another object of the present invention to provide a detection reagent;
it is another object of the present invention to provide a kit;
another objective of the present invention is to provide a detection method for identifying northern subspecies of Lateolabrax japonicus, florida subspecies and northern subspecies XFlorida hybrid;
the invention also aims to provide the application of the InDel molecular marker in identification of micropterus salmoides;
the invention also aims to provide the application of the InDel molecular marker in breeding of micropterus salmoides;
the invention also aims to provide the application of the detection reagent or the kit in the identification of the micropterus salmoides.
The technical scheme adopted by the invention is as follows:
in a first aspect of the present invention, there is provided:
the InDel molecular marker is positioned at the 8035398-8035480 th site of the northern subspecies 20 of the micropterus salmoides and is an insertion/deletion nucleotide sequence with the length of 82 bp.
The InDel markers have significant differences in the corresponding double-stranded DNA nucleotide sequences in northern sub-species, florida sub-species and hybrids of Lateolabrax micropterus. The double-stranded DNA nucleotide sequences corresponding to the InDel markers in northern subspecies are all insertion sequences with the length of 82 bp; the double-stranded DNA nucleotide sequences corresponding to the InDel markers in the Florida subspecies are deletion sequences with the length of 82 bp; in the hybrid species generated after the hybridization of the InDel marker and the InDel marker, the double-stranded DNA nucleotide sequence corresponding to the InDel marker is an insertion sequence with the length of 82bp and a deletion sequence with the length of 82bp respectively.
Further, the nucleotide sequence of the InDel molecular marker is shown as SEQ ID NO. 1.
Furthermore, the nucleotide sequence of the InDel molecular marker is as follows:
5’-TTTTTCCAAAACAAATGCTCAGTATTGTCTCATTGAAAGTTGTTCTCTTTAACCACTATGCCACAATGTGTACAGCCCCAGA-3’(SEQ ID NO.1)。
compared with SNP markers, the InDel molecular marker is not limited to only identifying northern subspecies of the largemouth bass and the Florida subspecies, can identify northern subspecies of the largemouth bass, the Florida subspecies and hybrids thereof, and has wider application range and higher practicability.
Further, northern subspecies of largemouth bass multiplied by Florida subspecies hybrid comprises northern subspecies multiplied by Florida subspecies and northern subspecies multiplied by Florida subspecies.
In a second aspect of the present invention, there is provided:
the primer group is used for amplifying the InDel molecular marker, and the nucleotide sequence of the primer group is as follows:
an upstream primer Indel-F:5'-CGTGTCAGCTAACTACACCTGA-3' (SEQ ID NO. 2);
downstream primer Indel-R:5'-ATACTGCCCCGCAAAGGAAA-3' (SEQ ID No. 3).
Wherein, the primer group is designed according to the InDel molecular marker nucleotide. The InDel marked characteristic bands related to the identification of the largemouth black bass subspecies amplified by the primer group are one band and have the length of 595bp or 513bp, and the InDel marked characteristic bands related to the largemouth black bass hybrid amplified by the primer group are two bands and have the lengths of 595bp and 513bp respectively.
In a third aspect of the present invention, there is provided:
a detection reagent containing the primer set.
The detection reagent can effectively identify northern subspecies of micropterus salmoides, florida subspecies and hybrids thereof, and has the advantages of accurate detection, simple and quick operation, wider application range and higher practicability.
In a fourth aspect of the present invention, there is provided:
a kit comprising the above reagent.
The kit can effectively identify northern subspecies of micropterus salmoides, florida subspecies and hybrids thereof, and has the advantages of accurate detection, simple and quick operation, wider application range and higher practicability.
Furthermore, the kit also comprises reagents or devices which are conventional in the field, such as a PCR amplification reagent, a buffer solution, a DNA/RNA extraction device and the like, and the reagents or devices can be reasonably replaced by a person skilled in the art according to the actual use requirement.
In a fifth aspect of the present invention, there is provided:
a detection method for identifying northern subspecies, florida subspecies and northern subspecies XFlorida hybrid of largemouth bass comprises the following steps:
extracting DNA of a sample to be detected, amplifying the DNA of the sample to be detected by using the primer group PCR, and judging the type of the sample to be detected according to the amplified band of the amplified product.
Further, the above northern subspecies of the hybrid Florida includes northern subspecies of the male parent Florida
And northern subspecies
X male parent of florida subspecies.
Further, the standard for determining the type of the sample to be detected in the detection method is as follows:
if only the amplified band with the length of 595bp is displayed, the product to be detected is northern subspecies of micropterus salmoides;
if only the amplified band with the length of 513bp is displayed, the product to be detected is a largemouth black bass Florida subspecies;
if two amplification bands with the lengths of 513bp and 595bp are displayed, the product to be detected is a northern subspecies XFlorida hybrid.
Furthermore, the nucleic acid sequence corresponding to the 595bp amplification band is:
5’-CGTGTCAGCTAACTACACCTGAGAGAAGTTCAGAGAAAGGAGGAAATCATTGAATAACAGACTTTACAATGTTTAGCTCTCCTAAAGAAAAAAATCTATTATAGGCATTAATGTGGATGTGTATACACTGCAGTACAGCAGATAAGCAGGTTTTTCCAAAACAAATGCTCAGTATTGTCTCATTGAAAGTTGTTCTCTTTAACCACTATGCCACAAT GTGTACAGCCCCAGAGGCACTAGTAAGCACTGCTGAAAGATGAACACACTTTGAAAAACAAACAAGTCTCTGAGAACAATAAGACGAGTGACACTGTGTGAAACTGTCTTTTGACTTATGACAGCTGCAGCGAAAGACAGGAAAGACAAAAAGGCTGGAAGCAAACCTGGGTCTCTGCAGCAAGGACCCAGCCCTAATGGCACGAGCTATCGGGCGCCCCATAAATAAACATAACTTTATTTTTAGCCTCACTCACATGTAGCCAACTACAATCAATCCACTGATTAAAACTACATAAAAATATTAAAACAACAATTACAAATGATCAATTTTGGCCTACAGCTGTAGTTTCTGCATCTTTCCTTTGCGGGGCAGTAT-3’(SEQ ID NO.4)。
wherein the underlined part is the insertion/deletion nucleotide sequence of 82bp in length.
Furthermore, the nucleic acid sequence corresponding to the amplified band with the length of 513bp is shown as follows:
5’-CGTGTCAGCTAACTACACCTGAGAGAAGTTCAGAGAAAGGAGGAAATCATTGAATAACAGACTTTACAATGTTTAGCTCTCCTAAAGAAAAAAATCTATTATAGGCATTAATGTGGATGTGTATACACTGCAGTACAGCAGATAAGCAGGGGCACTAGTAAGCACTGCTGAAAGATGAACACACTTTGAAAAACAAACAAGTCTCTGAGAACAATAAGACGAGTGACACTGTGTGAAACTGTCTTTTGACTTATGACAGCTGCAGCGAAAGACAGGAAAGACAAAAAGGCTGGAAGCAAACCTGGGTCTCTGCAGCAAGGACCCAGCCCTAATGGCACGAGCTATCGGGCGCCCCATAAATAAACATAACTTTATTTTTAGCCTCACTCACATGTAGCCAACTACAATCAATCCACTGATTAAAACTACATAAAAATATTAAAACAACAATTACAAATGATCAATTTTGGCCTACAGCTGTAGTTTCTGCATCTTTCCTTTGCGGGGCAGTAT-3’(SEQ ID NO.5)。
further, the PCR amplification reaction system is:
| DNA template | 1μL |
| Mix | 10μL |
| Indel-F | 1μL |
| Indel-R | 1μL |
| H 2 O | Make up to 20 mu L |
Where Mix includes Mix premix, any of those used in the art.
The PCR amplification reaction program is as follows: pre-denaturation at 94 ℃ for 5min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 30s, and 35 cycles; extension at 72 ℃ for 10min.
Further, the extraction of the DNA of the sample to be tested includes, but is not limited to, the use of a DNA extraction kit, RNA reverse transcription, or other methods conventional in the art.
In a sixth aspect of the present invention, there is provided:
the application of the InDel molecular marker in identification of micropterus salmoides.
In a seventh aspect of the present invention, there is provided:
the application of the InDel molecular marker in breeding of micropterus salmoides.
In an eighth aspect of the present invention, there is provided:
the detection reagent or the kit is applied to identification of micropterus salmoides.
The beneficial effects of the invention are:
(1) The InDel molecular marker can simultaneously identify northern subspecies of micropterus salmoides, florida subspecies and hybrids thereof, and has wider application range and better practicability compared with the conventional SNP marker which can only identify northern subspecies of micropterus salmoides and Florida subspecies.
(2) The identification method of the northern subspecies of the largemouth bass, the Florida subspecies and the hybrid thereof has the advantages of simple operation, short time, high efficiency and high accuracy of the identification result, and is not influenced by the development period of the largemouth bass and environmental factors.
Drawings
FIG. 1 is a schematic diagram showing the difference between the nucleotide sequences of double-stranded DNA corresponding to the InDel molecular marker of the present invention in northern subspecies of Micropterus salmoides, florida subspecies and hybrids;
FIG. 2 shows the result of identifying the specific amplified PCR products of InDel-F and InDel-R in 5 different populations; wherein A is the result of 1 agarose gel electrophoresis detection of a largemouth black bass population, and comprises 18 pieces (N1-N18) of a YouPerch 1 population (northern sub-population) and 15 pieces (F1-F15) of a Florida sub-population randomly sampled in 2015; b is a group 2 agarose gel electrophoresis detection result which comprises 20 tails (N1-N20) of a 'YouPerch 3' group (northern sub-population) and 15 tails (F1-F15) of a Florida sub-population collected in 2017; c is a colony 3 agarose gel electrophoresis detection result, which comprises 20 tails (N1-N20) of a colony of the non-excellent bass strain (northern sub-colony) and 23 tails (F1-F23) of a Florida sub-colony introduced in 2010; d is a group 4 agarose gel electrophoresis detection result, which comprises 20 (N1-N20) of Taiwan largemouth bass groups (northern sub-populations) and 21 (F1-F20) of Florida sub-populations propagated in 2020; e is the detection result of agarose gel electrophoresis of the population 5, and comprises the 40 tails (ZJ 1-ZJ 40) of the hybrid population propagated in 2020.
Detailed Description
In order to make the objects, technical solutions and technical effects of the present invention more apparent, the present invention will be described in further detail with reference to specific embodiments. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are given by way of illustration only.
The experimental materials and reagents used are, unless otherwise specified, all consumables and reagents which are conventionally available from commercial sources.
Obtaining of InDel molecular marker
According to genome data of the micropterus salmoides, re-sequencing analysis is respectively carried out on northern subspecies and Florida subspecies populations of the micropterus salmoides, and a large number of InDel molecular markers are found between the two subspecies. A part of InDel molecular markers are randomly screened, wherein the information of one InDel molecular marker in the genomes of individuals of northern subspecies and Florida subspecies is shown in table 1 and figure 1.
Table 1 information of InDel molecular markers in this example obtained by screening
Wherein, -represents a deletion and + represents an insertion.
Perch macrostoma identification method based on InDel molecular marker
According to gene isolation and free combination quantification, the corresponding double-stranded DNA nucleotide sequences of the InDel molecular markers in northern sub species of Lateolabrax micropterus XFlorida hybrid in the above examples should include two kinds, namely an insertion nucleotide sequence with the length of 82bp in the northern sub species and a deletion nucleotide sequence with the length of 82bp in the Florida sub species. To verify the InDel molecular markers described in Table 1 in the above examples, the verification was performed experimentally.
(1) Designing a primer group:
primer sets were designed based on the InDel molecular tagged nucleotides described in Table 1 in the examples above.
The nucleotide sequence of the primer group is as follows:
an upstream primer Indel-F:5'-CGTGTCAGCTAACTACACCTGA-3' (SEQ ID NO. 2);
downstream primer Indel-R:5'-ATACTGCCCCGCAAAGGAAA-3' (SEQ ID NO. 3).
(2) PCR amplification
Extracting the DNA of the Lateolabrax japonicus to be identified, carrying out PCR amplification on the DNA of the Lateolabrax japonicus to be identified by using the extracted DNA as a template and adopting the primer groups InDel-F and InDel-R marked by the InDel molecules, carrying out agarose gel electrophoresis detection on an amplification product, and judging the species of the Lateolabrax japonicus to be identified according to an amplification band.
The PCR amplification reaction system comprises:
TABLE 1 PCR amplification reaction System described above
| DNA template | 1μL |
| Mix | 10μL |
| Indel-F | 1μL |
| Indel-R | 1μL |
| H 2 O | Make up to 20 mu L |
The PCR amplification reaction program is as follows: pre-denaturation at 94 ℃ for 5min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 30s, and 35 cycles; extension for 10min at 72 ℃.
If only the amplified band with the length of 595bp is displayed, the product to be detected is northern subspecies of the largemouth bass;
if only the amplified band with the length of 513bp is displayed, the product to be detected is a largemouth black bass Florida subspecies;
if two amplification bands with the lengths of 513bp and 595bp are displayed, the product to be detected is a northern subspecies XFlorida hybrid.
Wherein, the nucleic acid sequence corresponding to the 595bp amplification band is:
5’-CGTGTCAGCTAACTACACCTGAGAGAAGTTCAGAGAAAGGAGGAAATCATTGAATAACAGACTTTACAATGTTTAGCTCTCCTAAAGAAAAAAATCTATTATAGGCATTAATGTGGATGTGTATACACTGCAGTACAGCAGATAAGCAGGTTTTTCCAAAACAAATGCTCAGTATTGTCTCATTGAAAGTTGTTCTCTTTAACCACTATGCCACAAT GTGTACAGCCCCAGAGGCACTAGTAAGCACTGCTGAAAGATGAACACACTTTGAAAAACAAACAAGTCTCTGAGAACAATAAGACGAGTGACACTGTGTGAAACTGTCTTTTGACTTATGACAGCTGCAGCGAAAGACAGGAAAGACAAAAAGGCTGGAAGCAAACCTGGGTCTCTGCAGCAAGGACCCAGCCCTAATGGCACGAGCTATCGGGCGCCCCATAAATAAACATAACTTTATTTTTAGCCTCACTCACATGTAGCCAACTACAATCAATCCACTGATTAAAACTACATAAAAATATTAAAACAACAATTACAAATGATCAATTTTGGCCTACAGCTGTAGTTTCTGCATCTTTCCTTTGCGGGGCAGTAT-3’(SEQ ID NO.4)。
the underlined part indicates the insertion/deletion nucleotide sequence (InDel molecular marker in the above example) having the length of 82 bp.
The nucleic acid sequence corresponding to the amplified band with the length of 513bp is shown as follows:
5’-CGTGTCAGCTAACTACACCTGAGAGAAGTTCAGAGAAAGGAGGAAATCATTGAATAACAGACTTTACAATGTTTAGCTCTCCTAAAGAAAAAAATCTATTATAGGCATTAATGTGGATGTGTATACACTGCAGTACAGCAGATAAGCAGGGGCACTAGTAAGCACTGCTGAAAGATGAACACACTTTGAAAAACAAACAAGTCTCTGAGAACAATAAGACGAGTGACACTGTGTGAAACTGTCTTTTGACTTATGACAGCTGCAGCGAAAGACAGGAAAGACAAAAAGGCTGGAAGCAAACCTGGGTCTCTGCAGCAAGGACCCAGCCCTAATGGCACGAGCTATCGGGCGCCCCATAAATAAACATAACTTTATTTTTAGCCTCACTCACATGTAGCCAACTACAATCAATCCACTGATTAAAACTACATAAAAATATTAAAACAACAATTACAAATGATCAATTTTGGCCTACAGCTGTAGTTTCTGCATCTTTCCTTTGCGGGGCAGTAT-3’(SEQ ID NO.5)。
test for verifying detection effect by the above method
192 samples of micropterus salmoides from 5 groups (the subspecies classification status is determined) are taken as detection objects for identification. Wherein, the population 1 has 33 total tails, including 18 tails of Lateolabrax japonicus 'YouPerch No. 1' belonging to northern subspecies, and 15 tails of Lateolabrax japonicus Florida subspecies collected in 2015; the total number of the population 2 is 35, including 20 of largemouth black bass 'Youhou No. 3' belonging to northern subspecies and 15 of largemouth black bass Florida subspecies collected in 2017; population 3 totaled 43, including 20 of "non-excellent bass line" micropterus salmoides belonging to northern subspecies, 23 of florida subspecies introduced in 2010; the total number of the population 4 is 41, including 20 populations of Lateolabrax micropterus Taiwan belonging to northern subspecies and 21 populations of Florida subspecies bred in 2020; population 5 totaled 40, including 40 of northern subspecies of micropterus salmoides x florida hybrids.
Shearing part of tail fins of the largemouth bass to be detected by using scissors after alcohol disinfection to be about 0.5 multiplied by 0.5cm, and placing the tail fins into absolute ethyl alcohol for normal temperature storage. The fin ray genome DNA is extracted by a marine animal tissue genome DNA extraction kit (Tiangen). The quality of the genomic DNA was checked by electrophoresis on a 1.0% agarose gel and the concentration was determined by UV spectrophotometer (Eppendorf, AG2231 type) and stored at-20 ℃ for future use.
The extracted Lateolabrax japonicus sample is detected by adopting the detection method in the embodiment, and the individual is judged and identified to belong to the northern subspecies of Lateolabrax japonicus, the Florida subspecies or the hybrid thereof according to the length and the number of the bands of the PCR product presented on an agarose gel electrophoresis picture.
The results of the measurements are shown in FIG. 2 and Table 2.
TABLE 2 examination of the above-mentioned methods
The result shows that the identification method in the embodiment has accurate identification result, no error detection condition occurs, and the accuracy reaches 100%. Compared with the conventional SNP marker, the method can accurately identify northern subspecies of the micropterus salmoides, florida subspecies and hybrids thereof only by agarose gel electrophoresis, has accurate and reliable identification result and lower cost, and is suitable for popularization and use.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> Zhujiang aquatic research institute of Chinese aquatic science research institute
Guangdong Liangshi Aquatic Seed Industry Co.,Ltd.
<120> an InDel marker and method for identifying northern subspecies, florida subspecies and hybrids thereof of micropterus salmoides
Applications thereof
<130>
<160> 5
<170> PatentIn version 3.5
<210> 1
<211> 82
<212> DNA
<213> Micropterus Salmodes L
<400> 1
tttttccaaa acaaatgctc agtattgtct cattgaaagt tgttctcttt aaccactatg 60
ccacaatgtg tacagcccca ga 82
<210> 2
<211> 22
<212> DNA
<213> Artificial sequence
<400> 2
cgtgtcagct aactacacct ga 22
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<400> 3
atactgcccc gcaaaggaaa 20
<210> 4
<211> 595
<212> DNA
<213> M. salmoides salmoides
<400> 4
cgtgtcagct aactacacct gagagaagtt cagagaaagg aggaaatcat tgaataacag 60
actttacaat gtttagctct cctaaagaaa aaaatctatt ataggcatta atgtggatgt 120
gtatacactg cagtacagca gataagcagg tttttccaaa acaaatgctc agtattgtct 180
cattgaaagt tgttctcttt aaccactatg ccacaatgtg tacagcccca gaggcactag 240
taagcactgc tgaaagatga acacactttg aaaaacaaac aagtctctga gaacaataag 300
acgagtgaca ctgtgtgaaa ctgtcttttg acttatgaca gctgcagcga aagacaggaa 360
agacaaaaag gctggaagca aacctgggtc tctgcagcaa ggacccagcc ctaatggcac 420
gagctatcgg gcgccccata aataaacata actttatttt tagcctcact cacatgtagc 480
caactacaat caatccactg attaaaacta cataaaaata ttaaaacaac aattacaaat 540
gatcaatttt ggcctacagc tgtagtttct gcatctttcc tttgcggggc agtat 595
<210> 5
<211> 513
<212> DNA
<213> M. salmoides floridanus
<400> 5
cgtgtcagct aactacacct gagagaagtt cagagaaagg aggaaatcat tgaataacag 60
actttacaat gtttagctct cctaaagaaa aaaatctatt ataggcatta atgtggatgt 120
gtatacactg cagtacagca gataagcagg ggcactagta agcactgctg aaagatgaac 180
acactttgaa aaacaaacaa gtctctgaga acaataagac gagtgacact gtgtgaaact 240
gtcttttgac ttatgacagc tgcagcgaaa gacaggaaag acaaaaaggc tggaagcaaa 300
cctgggtctc tgcagcaagg acccagccct aatggcacga gctatcgggc gccccataaa 360
taaacataac tttattttta gcctcactca catgtagcca actacaatca atccactgat 420
taaaactaca taaaaatatt aaaacaacaa ttacaaatga tcaattttgg cctacagctg 480
tagtttctgc atctttcctt tgcggggcag tat 513
Claims (2)
1. A detection method for identifying northern subspecies, florida subspecies and northern subspecies XFlorida hybrid of largemouth bass comprises the following steps:
extracting DNA of a sample to be detected, amplifying the DNA of the sample to be detected by using a primer group PCR, and judging the type of the sample to be detected according to an amplification strip of an amplification product;
wherein the nucleotide sequence of the primer group is as follows:
an upstream primer Indel-F:5'-CGTGTCAGCTAACTACACCTGA-3' (SEQ ID NO. 2);
downstream primer Indel-R:5'-ATACTGCCCCGCAAAGGAAA-3' (SEQ ID NO. 3);
the primer group is used for amplifying InDel molecular markers; the InDel molecular marker is positioned at the 8035398 position of the northern subspecies 20 chromosome of the largemouth bass and is an insertion/deletion nucleotide sequence with the length of 82bp, and the nucleotide sequence is shown as SEQ ID NO. 1;
the corresponding double-stranded DNA nucleotide sequences of the InDel marker in northern subspecies are all insertion sequences with the length of 82 bp; the corresponding double-stranded DNA nucleotide sequences in the Florida subspecies are deletion sequences with the length of 82 bp; the corresponding double-stranded DNA nucleotide sequence in the northern subspecies XFlorida subspecies hybrid is an insertion sequence with the length of 82bp and a deletion sequence with the length of 82bp respectively;
the standard for judging the type of the sample to be detected in the detection method is as follows:
if only the amplified band with the length of 595bp is displayed, the product to be detected is northern subspecies of micropterus salmoides;
if only the amplified band with the length of 513bp is displayed, the product to be detected is largemouth black bass Florida subspecies;
if two amplification bands with the lengths of 513bp and 595bp are displayed, the product to be detected is a northern subspecies XFlorida hybrid;
wherein, the 595bp amplified band is shown as SEQ ID NO. 4;
the 513bp amplified band is shown as SEQ ID NO. 5.
2. The application of the detection reagent or the detection kit in identifying northern subspecies of micropterus salmoides, florida subspecies and northern subspecies XFlorida hybrid;
the detection reagent or the detection kit contains a primer group;
the nucleotide sequence of the primer group is as follows:
an upstream primer Indel-F:5'-CGTGTCAGCTAACTACACCTGA-3' (SEQ ID NO. 2);
downstream primer Indel-R:5'-ATACTGCCCCGCAAAGGAAA-3' (SEQ ID NO. 3);
the primer group is used for amplifying InDel molecular markers; the InDel molecular marker is positioned at the 8035398 position of the northern subspecies 20 chromosome of the largemouth bass and is an insertion/deletion nucleotide sequence with the length of 82bp, and the nucleotide sequence is shown as SEQ ID NO. 1;
the double-stranded DNA nucleotide sequences corresponding to the InDel markers in northern subspecies are all insertion sequences with the length of 82 bp; the corresponding double-stranded DNA nucleotide sequences in the Florida subspecies are deletion sequences with the length of 82 bp; the corresponding double-stranded DNA nucleotide sequences in the northern subspecies XFlorida subspecies hybrid are respectively an insertion sequence with the length of 82bp and a deletion sequence with the length of 82 bp;
the criteria for identifying northern subspecies of micropterus salmoides, florida subspecies and northern subspecies XFlorida hybrids are:
if only the amplified band with the length of 595bp is displayed, the product to be detected is northern subspecies of the largemouth bass;
if only the amplified band with the length of 513bp is displayed, the product to be detected is largemouth black bass Florida subspecies;
if two amplification bands with the lengths of 513bp and 595bp are displayed, the product to be detected is a northern subspecies XFlorida hybrid;
wherein, the 595bp amplified band is shown as SEQ ID NO. 4;
the 513bp amplified band is shown as SEQ ID NO. 5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011506211.4A CN112575094B (en) | 2020-12-18 | 2020-12-18 | InDel marker for identifying northern subspecies, florida subspecies and hybrids thereof of micropterus salmoides and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011506211.4A CN112575094B (en) | 2020-12-18 | 2020-12-18 | InDel marker for identifying northern subspecies, florida subspecies and hybrids thereof of micropterus salmoides and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112575094A CN112575094A (en) | 2021-03-30 |
| CN112575094B true CN112575094B (en) | 2022-11-08 |
Family
ID=75136728
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011506211.4A Active CN112575094B (en) | 2020-12-18 | 2020-12-18 | InDel marker for identifying northern subspecies, florida subspecies and hybrids thereof of micropterus salmoides and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112575094B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113637766A (en) * | 2021-07-30 | 2021-11-12 | 中国水产科学研究院珠江水产研究所 | InDel molecular marker related to genetic sex identification of micropterus salmoides and application thereof |
| CN114717301B (en) * | 2022-04-01 | 2023-08-08 | 集美大学 | Molecular marker for identifying genetic sex of micropterus salmoides and primer pair thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107022647A (en) * | 2017-06-22 | 2017-08-08 | 中国水产科学研究院珠江水产研究所 | A kind of SNP marker related to Micropterus salmoides growth traits and its application |
-
2020
- 2020-12-18 CN CN202011506211.4A patent/CN112575094B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107022647A (en) * | 2017-06-22 | 2017-08-08 | 中国水产科学研究院珠江水产研究所 | A kind of SNP marker related to Micropterus salmoides growth traits and its application |
Non-Patent Citations (2)
| Title |
|---|
| 刘浩等.大口黑鲈ghrelin基因SNPs的筛选及与生长性状关联性分析.《水产学报》.2016,第40卷(第04期),全文. * |
| 蔡磊等.大口黑鲈北方亚种和佛罗里达亚种及其杂交子代的遗传分析.《中国水产科学》.2012,第19卷全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112575094A (en) | 2021-03-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110669836B (en) | Molecular marker for identifying hereditary sex of Oxytropis myriophylla and application thereof | |
| CN107760789B (en) | Genotyping detection kit for parent-child identification and individual identification of yaks | |
| CN112575094B (en) | InDel marker for identifying northern subspecies, florida subspecies and hybrids thereof of micropterus salmoides and application thereof | |
| CN115198023B (en) | Hainan cattle liquid-phase breeding chip and application thereof | |
| TW201936921A (en) | A primer for next generation sequencer and a method for producing the same, a DNA library obtained through the use of a primer for next generation sequencer and a method for producing the same, and a DNA analyzing method using a DNA library | |
| CN109457035B (en) | SSR fluorescence labeling primer for parent-child identification of trachinotus ovatus and application thereof | |
| CN110863056A (en) | Method, reagent and application for accurately typing human DNA | |
| CN112210612B (en) | SSR molecular marker for distinguishing specific geographical population of procambarus clarkii and application of SSR molecular marker | |
| CN114875157B (en) | SNP (Single nucleotide polymorphism) marker related to individual growth traits of pelteobagrus fulvidraco and application | |
| CN116179657A (en) | Primer combination, microsatellite marker combination, multiplex PCR system, method for identifying snakehead, and application of multiplex PCR system | |
| CN114959056A (en) | SSR marker for identifying female procambarus clarkii and application thereof | |
| CN114606335A (en) | Development and application of KASP molecular marker of sugarcane mosaic virus disease resistance gene of corn | |
| JP4982746B2 (en) | Pig parent-child determination method using DNA marker | |
| CN113637766A (en) | InDel molecular marker related to genetic sex identification of micropterus salmoides and application thereof | |
| US20220136043A1 (en) | Systems and methods for separating decoded arrays | |
| TWI686482B (en) | Set of random primers and method for preparing dna library using the same | |
| CN109161605B (en) | Development and application of SNP molecular marker of rice blast resistance gene Pi1 | |
| CN111206104A (en) | Universal primer and method for efficiently and simply obtaining mitochondrial genome of insects in psyllium superfamily and application of universal primer and method | |
| CN116987796B (en) | Molecular marker for utilization rate of pelteobagrus fulvidraco feed and application thereof | |
| CN111607652B (en) | InDel marker associated with growth traits of pinctada martensii, detection primer group and development method | |
| CN114836417B (en) | Development and application of SSR (simple sequence repeat) marker of malus asiatica | |
| EP4289966A1 (en) | Genetic information analysis system and genetic information analysis method | |
| CN108330199B (en) | Hmong pig SNP locus, SNP chip, detection primer combination, detection kit, application of detection kit and germplasm identification method | |
| CN106834517B (en) | SSR (simple sequence repeat) labeled primer group for parent-child identification of parva and application of SSR labeled primer group | |
| CN107043815B (en) | Method and system for STR typing of individuals |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |