CN116769927B - Introgression gene, primer, method and application for identifying silver carp in Changfeng - Google Patents
Introgression gene, primer, method and application for identifying silver carp in Changfeng Download PDFInfo
- Publication number
- CN116769927B CN116769927B CN202310733161.0A CN202310733161A CN116769927B CN 116769927 B CN116769927 B CN 116769927B CN 202310733161 A CN202310733161 A CN 202310733161A CN 116769927 B CN116769927 B CN 116769927B
- Authority
- CN
- China
- Prior art keywords
- silver carp
- changfeng
- primer
- carp
- introgression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241000252234 Hypophthalmichthys nobilis Species 0.000 title claims abstract description 85
- 238000000034 method Methods 0.000 title claims abstract description 26
- 108090000623 proteins and genes Proteins 0.000 title abstract description 25
- 238000012408 PCR amplification Methods 0.000 claims abstract description 5
- 238000006243 chemical reaction Methods 0.000 claims description 11
- 238000001502 gel electrophoresis Methods 0.000 claims description 11
- 239000003153 chemical reaction reagent Substances 0.000 claims description 7
- 239000007795 chemical reaction product Substances 0.000 claims description 5
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 claims description 3
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 claims description 3
- 239000008223 sterile water Substances 0.000 claims description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 2
- 108020004414 DNA Proteins 0.000 abstract description 30
- 238000001962 electrophoresis Methods 0.000 abstract description 11
- 102000053602 DNA Human genes 0.000 abstract description 9
- 238000001514 detection method Methods 0.000 abstract description 6
- 238000011161 development Methods 0.000 abstract description 3
- 108700026220 vif Genes Proteins 0.000 abstract description 2
- 241000252233 Cyprinus carpio Species 0.000 description 14
- 101150014408 MINDY3 gene Proteins 0.000 description 14
- 101100005010 Mus musculus Ca8 gene Proteins 0.000 description 14
- 101150111716 ankrd1 gene Proteins 0.000 description 14
- 239000000047 product Substances 0.000 description 6
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 5
- 241000251468 Actinopterygii Species 0.000 description 3
- 239000012634 fragment Substances 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 239000006228 supernatant Substances 0.000 description 3
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 2
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- BQCADISMDOOEFD-UHFFFAOYSA-N Silver Chemical compound [Ag] BQCADISMDOOEFD-UHFFFAOYSA-N 0.000 description 2
- 239000011543 agarose gel Substances 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 239000013505 freshwater Substances 0.000 description 2
- 238000001764 infiltration Methods 0.000 description 2
- 230000008595 infiltration Effects 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 230000001568 sexual effect Effects 0.000 description 2
- 229910052709 silver Inorganic materials 0.000 description 2
- 239000004332 silver Substances 0.000 description 2
- 241000195493 Cryptophyta Species 0.000 description 1
- 241000252210 Cyprinidae Species 0.000 description 1
- 108010017826 DNA Polymerase I Proteins 0.000 description 1
- 102000004594 DNA Polymerase I Human genes 0.000 description 1
- 108010063113 DNA Polymerase II Proteins 0.000 description 1
- 102000010567 DNA Polymerase II Human genes 0.000 description 1
- 108010071146 DNA Polymerase III Proteins 0.000 description 1
- 102000007528 DNA Polymerase III Human genes 0.000 description 1
- 108010001132 DNA Polymerase beta Proteins 0.000 description 1
- 102000001996 DNA Polymerase beta Human genes 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 108010067770 Endopeptidase K Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 241000720946 Hypophthalmichthys molitrix Species 0.000 description 1
- 206010021143 Hypoxia Diseases 0.000 description 1
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 1
- 241000269319 Squalius cephalus Species 0.000 description 1
- 108010006785 Taq Polymerase Proteins 0.000 description 1
- 239000002250 absorbent Substances 0.000 description 1
- 230000002745 absorbent Effects 0.000 description 1
- 230000004913 activation Effects 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 230000015556 catabolic process Effects 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- 238000006731 degradation reaction Methods 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 239000003797 essential amino acid Substances 0.000 description 1
- 235000020776 essential amino acid Nutrition 0.000 description 1
- 235000019441 ethanol Nutrition 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 235000013305 food Nutrition 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 230000007954 hypoxia Effects 0.000 description 1
- 238000003384 imaging method Methods 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 239000010956 nickel silver Substances 0.000 description 1
- 239000002773 nucleotide Substances 0.000 description 1
- 125000003729 nucleotide group Chemical group 0.000 description 1
- 235000016709 nutrition Nutrition 0.000 description 1
- 230000035515 penetration Effects 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 101710197907 rDNA transcriptional regulator pol5 Proteins 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 229910021642 ultra pure water Inorganic materials 0.000 description 1
- 239000012498 ultrapure water Substances 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application relates to the technical field of silver carp, in particular to an introgression gene, a primer, a method and application for identifying silver carp. The introgression gene is shown as SEQ ID NO.1, and the primer is shown as SEQ ID NO. 2-3. And designing a primer for the DNA molecule, performing PCR amplification, performing electrophoresis detection on an amplified product, and determining whether the amplified product is the Changfeng silver carp according to whether the electrophoresis band is a 620bp band. The DNA molecule, the primer, the kit, the method and the application can provide support for molecular identification of the Changfeng silver carp, provide powerful guarantee for seed counterfeiting and healthy development of seed industry, and have the advantages of simple and easy method, convenient operation and high identification success rate.
Description
Technical Field
The application relates to the technical field of silver carp, in particular to an introgression gene, a primer, a method and application for identifying silver carp.
Background
Chub (silver carp)Hypophthalmichthys molitrix) Is an important economic freshwater fish in China, and is also a common non-classical biological operation technology directly used in ChinaFilter feeding fish with blue algae as food. Meanwhile, the nutritional value is higher, the content of essential amino acids is slightly higher than that of carp, the content of EPA and DHA is also higher than that of bighead carp, and the bighead carp is deeply favored by vast farmers and consumers for a long time. The total yield of 2021 cultivation reaches 383.7 ten thousand tons, and the second place of all freshwater cultivation varieties is important in industrial status.
Under the influence of a plurality of factors, the conditions of rapid reduction of natural resources, serious degradation of excellent properties and the like of wild silver carps in Yangtze river basin exist, through years of research by the national institute of aquatic products of China aquatic science research, a mature heterogeneous artificial gynogenesis technical system of silver carps is established, genetically inactivated carp sperms are used as an activation source, female individuals of the sexual maturity of the silver carps in Yangtze river are used as female parents, and a continuous two-generation gynogenesis silver carp sexual maturity population is successfully obtained. And then, a small number of male individuals existing in the gynogenesis second-generation silver carp are utilized to establish a gynogenesis silver carp breeding line for sustainable reproduction offspring, and a new silver carp variety which grows fast and is resistant to hypoxia, namely, the Changfeng silver carp, is cultivated. The method is formally approved by the national primary breed approval committee in 2010, is the first artificial cultivation of the 'four big fishes' in China, has been popularized to 27 provinces (markets and regions) in China at present, has accumulated the popularization area to more than 2000 ten thousand mu, and generates good economic, social and ecological benefits.
In the practical process, the identification of the Changfeng silver carp is particularly important, and the identification accuracy can be provided by providing a molecular biology identification means.
Disclosure of Invention
In view of the above, the embodiments of the present application provide an introgression gene, primer, method and application for identifying the Changfeng silver carp.
The embodiment of the application provides an introgression gene for identifying the silver carp, which is shown as SEQ ID NO. 1.
The embodiment of the application provides a primer pair for identifying an introgression gene in Changfeng silver carp, wherein the introgression gene is derived from a carp genome, and the primer pair comprises DNA molecules shown as SEQ ID NO. 2-3.
The embodiment of the application provides a kit for identifying introgression genes in the Changfeng silver carp, which comprises the primer pair and reagents required for PCR.
The embodiment of the application provides a method for detecting whether a silver carp contains an introgression gene, which comprises the following steps:
obtaining a DNA sample of the silver carp to be detected;
taking the DNA as a template, adopting the primer pair to carry out PCR reaction or adopting the kit to carry out PCR reaction;
detecting the PCR reaction product to carry out gel electrophoresis, and confirming whether the DNA sample corresponding to the silver carp contains the introgression gene according to the gel electrophoresis band.
The embodiment of the application provides a method for identifying a Changfeng silver carp and an ordinary silver carp, which comprises the following steps:
obtaining a DNA sample to be detected, wherein the DNA sample to be detected is from at least one of the Changfeng silver carp and the ordinary silver carp;
taking the DNA as a template, adopting the primer pair to carry out PCR reaction or adopting the kit to carry out PCR reaction;
the resulting PCR reaction product is detected for gel electrophoresis, and the origin of the DNA sample is confirmed from the bands of the gel electrophoresis.
The embodiment of the application provides application of the DNA molecule, the primer pair or the kit in the detection of the infiltration gene of the Changfeng silver carp and the identification of the Changfeng silver carp, the ordinary silver carp and the carp.
Compared with the prior art, the application has at least one of the following beneficial effects:
the application provides a DNA molecule capable of effectively identifying the silver carp, which is characterized in that primers are designed for the DNA molecule and PCR amplification is carried out, the amplified product is subjected to electrophoresis detection, and whether the amplified product is the silver carp can be determined according to whether the electrophoresis band is a 620bp band. Therefore, not only can the silver carp be effectively identified, but also whether the DNA sample of the silver carp contains the introgression genes can be judged, and the silver carp, the ordinary silver carp and the carp can be effectively distinguished. The introgression gene, the primer, the method and the application for identifying the Changfeng silver carp can provide support for molecular identification of the Changfeng silver carp, provide powerful guarantee for seed counterfeiting and seed healthy development, and have the advantages of simplicity, easiness in implementation, convenience in operation and high identification success rate.
Drawings
FIG. 1 is a diagram of electrophoresis results provided in the examples of the present application; the Changfeng silver carp is recorded asHypophthalmichthys molitrix Changfeng variety (CF), commonly known as silver carpHypophthalmichthys molitrix(HM), carp is marked asCyprinus carpio（CC）。
Detailed Description
In order to make the objects, technical solutions and advantages of the present application more apparent, the present application will be further described in detail with reference to examples. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the present application. Reagents not specifically and individually described in this application are all conventional reagents and are commercially available; methods which are not specifically described in detail are all routine experimental methods and are known from the prior art.
It should be noted that, the terms "first," "second," and the like in the description and the claims of the present invention and the above drawings are used for distinguishing similar objects, and are not necessarily used for describing a particular sequence or order, nor do they substantially limit the technical features that follow. It is to be understood that the data so used may be interchanged where appropriate such that the embodiments of the invention described herein may be implemented in sequences other than those illustrated or otherwise described herein. Furthermore, the terms "comprises," "comprising," and "having," and any variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, system, article, or apparatus that comprises a list of steps or elements is not necessarily limited to those steps or elements expressly listed but may include other steps or elements not expressly listed or inherent to such process, method, article, or apparatus.
For a better understanding of the present invention, and not to limit its scope, all numbers expressing quantities, percentages, and other values used in the present application are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated otherwise, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. Each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
In order to establish a method for rapidly identifying the silver carp, the inventor of the application utilizes a section of specific nucleotide sequence (shown as SEQ ID NO. 1) in the silver carp to carry out primer design, carries out PCR amplification, carries out electrophoresis detection on an amplified product, and can determine whether the amplified product is the silver carp according to whether an electrophoresis band is a 620bp band or not. Therefore, not only can the silver carp be effectively identified, but also whether the DNA sample of the silver carp contains the introgression genes can be judged, and the silver carp, the ordinary silver carp and the carp can be effectively distinguished. The introgression gene, the primer, the method and the application for identifying the Changfeng silver carp can provide support for molecular identification of the Changfeng silver carp, provide powerful guarantee for seed counterfeiting and seed healthy development, and have the advantages of simplicity, easiness in implementation, convenience in operation and high identification success rate.
The embodiment of the application provides a DNA molecule for identifying the long-spotted silver carp, wherein the DNA molecule is shown as SEQ ID NO. 1.
The embodiment of the application provides a primer pair for identifying an introgression gene in Changfeng silver carp, wherein the introgression gene is derived from a carp genome, and the primer pair comprises DNA molecules shown as SEQ ID NO. 2-3.
The embodiment of the application provides a kit for identifying introgression genes in the Changfeng silver carp, which comprises the primer pair and reagents required for PCR.
In some embodiments, the reagents required to perform PCR include DNA polymerase, mg 2+ One or more of dNTPs, PCR Buffer, and sterile water. Wherein the DNA polymerase is selected from the group consisting of DNA polymerase I, DNA polymerase II, DNA polymerase III, DNA polymerase IV and DNA polymerase V, such as Taq polymerase or rTap enzyme.
The embodiment of the application provides a method for detecting whether a silver carp contains an introgression gene, which comprises the following steps:
obtaining a DNA sample of the silver carp to be detected;
taking the DNA as a template, adopting the primer pair to carry out PCR reaction or adopting the kit to carry out PCR reaction;
detecting the PCR reaction product to carry out gel electrophoresis, and confirming whether the DNA sample corresponding to the silver carp contains the introgression gene according to the gel electrophoresis band.
The embodiment of the application provides a method for identifying a Changfeng silver carp and an ordinary silver carp, which comprises the following steps:
obtaining a DNA sample to be detected, wherein the DNA sample to be detected is from at least one of silver carps, silver carps and carps;
taking the DNA as a template, adopting the primer pair to carry out PCR reaction or adopting the kit to carry out PCR reaction;
the resulting PCR reaction product is detected for gel electrophoresis, and the origin of the DNA sample is confirmed from the bands of the gel electrophoresis.
The embodiment of the application provides application of the DNA molecule, the primer pair or the kit in the detection of the infiltration gene of the Changfeng silver carp and the identification of the Changfeng silver carp, the ordinary silver carp and the carp.
In some embodiments, a method for identifying a silver carp from a plain silver carp is provided, including:
1. collection of authentication samples
Collecting fin sample of individual silver carp, common silver carp and carp, and storing in absolute ethanol, wherein silver carp is marked asHypophthalmichthys molitrix Changfeng variety (CF) provides an academic name (i.e., latin's name), commonly known as silver carpHypophthalmichthys molitrix(HM), carp is marked asCyprinus carpio(CC), brought back to the laboratory.
2. Genomic DNA extraction
(1) About 0.5g of fin tissue is taken, absolute ethyl alcohol on the surface of the tissue is repeatedly washed by ultrapure water, and the tissue is fully sheared and then placed into a centrifuge tube with the volume of 1.5 mL.
(2) And adding 10-15 mu L of proteinase K and 500 mu L of HOM buffer into the centrifuge tube, and digesting for 4-6 hours at the temperature of 55 ℃.
(3) 500. Mu.L of 4.5M NaCL solution and 300. Mu.L of chloroform were added, and after thoroughly mixing for 20min, the mixture was centrifuged at 13000rpm for 10min.
(4) The supernatant was transferred to another sterilized fresh tube, 600. Mu.L of anhydrous isopropanol was added, shaken well for 20min, and centrifuged at 13000rpm for 10min.
(5) The supernatant was discarded, 500. Mu.L of 75% ethanol was added, and the mixture was digested at 55℃for 5 minutes, followed by centrifugation at 13000rpm for 5 minutes.
(6) The supernatant was discarded, and the tube was inverted on absorbent paper and dried naturally at room temperature.
(7) 100. Mu.L of sterilized double distilled water was added to dissolve DNA at 4℃overnight.
(8) DNA detection was performed on a 1% agarose gel and stored at-20℃until use.
3. Amplification of introgressed gene-specific fragments in Changfeng silver carp
(1) Primer information
ZMYM1F: GCGATCGAAGACAGAGCTTC as shown in SEQ ID NO.2
ZMYM1R: GTGCTGCAGTGTCCAGGCA as shown in SEQ ID NO.3
(2) PCR reaction system
TABLE 1
| System components | Volume of |
| 2×PCR buffer mix | 25 μL |
| Upstream primer (10. Mu.M) | 1.5 μL |
| Downstream primer (10. Mu.M) | 1.5 μL |
| DNA template (100 ng/. Mu.l) | 1 μL |
| ddH 2 O | 21 μL |
| Total system | 50 μL |
(3) PCR reaction procedure
95. Pre-denaturation at 3 min at C, 32 cycles (denaturation at 95℃for 15 s, annealing at 58℃for 15 s, extension at 72℃for 15 s), extension at 72℃for 5min, and storage at 16 ℃.
4. Electrophoresis of penetration gene specific fragments of Changfeng silver carp
After amplification, 5. Mu.L of PCR amplification product was taken, loaded on 1.5-2.0% agarose gel, and the leftmost sample was applied to DL2000 marker, 120V voltage, and the power was turned off for 30 min for electrophoresis, and then the observation of the electrophoresis results was performed with a gel imaging system.
5. Screening and identifying genes of introgression in Changfeng silver carp, ordinary silver carp and carp
As shown in the electrophoresis result 1, a 620bp obvious band (shown as SEQ ID NO. 1) appears in the Changfeng silver carp, a 578bp obvious band (shown as SEQ ID NO. 4) appears in the carp, and no band in the ordinary silver carp is an introgression gene fragment, so that the Changfeng silver carp and the ordinary silver carp can be identified, and the specific DNA molecule is derived from the carp genome.
The foregoing is merely a preferred embodiment of the present application, but the scope of the present application is not limited thereto, and any changes or substitutions easily contemplated by those skilled in the art within the technical scope of the present application should be covered by the scope of the present application.
Claims (4)
1. A method for identifying a long-range silver carp and a common silver carp comprises the following steps:
obtaining a DNA sample to be detected, wherein the DNA sample to be detected is from at least one of the Changfeng silver carp and the ordinary silver carp;
taking the DNA as a template, and carrying out PCR reaction by adopting primer pairs shown in SEQ ID NO. 2-3;
gel electrophoresis is performed to detect the resulting PCR reaction products, and the source of the DNA sample is confirmed from the bands of the gel electrophoresis.
2. The method of claim 1, wherein judging the source of the DNA sample comprises at least silver carp if the gel electrophoresis results in a 620bp band.
3. Application of primer pair or kit in identification of Changfeng silver carp and ordinary silver carp;
the primer pair is shown as SEQ ID NO. 2-3, the kit is a PCR amplification kit, and the kit comprises the primer pair and reagents required by PCR.
4. The use of claim 3, wherein the reagents required for performing PCR comprise one or more of DNA polymerase, mg2+, dNTP, PCR Buffer and sterile water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310733161.0A CN116769927B (en) | 2023-06-20 | 2023-06-20 | Introgression gene, primer, method and application for identifying silver carp in Changfeng |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310733161.0A CN116769927B (en) | 2023-06-20 | 2023-06-20 | Introgression gene, primer, method and application for identifying silver carp in Changfeng |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN116769927A CN116769927A (en) | 2023-09-19 |
| CN116769927B true CN116769927B (en) | 2024-01-02 |
Family
ID=88005829
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310733161.0A Active CN116769927B (en) | 2023-06-20 | 2023-06-20 | Introgression gene, primer, method and application for identifying silver carp in Changfeng |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116769927B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112725465A (en) * | 2021-02-02 | 2021-04-30 | 中国水产科学研究院长江水产研究所 | Precise Changfeng silver carp identification primer, identification method and application thereof |
| CN112877444A (en) * | 2021-02-02 | 2021-06-01 | 中国水产科学研究院长江水产研究所 | Molecular marker for identifying Changfeng silver carp, identification method and application |
| CN114891897A (en) * | 2021-06-29 | 2022-08-12 | 宁德师范学院 | Method for screening molecular marker of large yellow croaker DNA methylation and qRT-PCR primer |
-
2023
- 2023-06-20 CN CN202310733161.0A patent/CN116769927B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112725465A (en) * | 2021-02-02 | 2021-04-30 | 中国水产科学研究院长江水产研究所 | Precise Changfeng silver carp identification primer, identification method and application thereof |
| CN112877444A (en) * | 2021-02-02 | 2021-06-01 | 中国水产科学研究院长江水产研究所 | Molecular marker for identifying Changfeng silver carp, identification method and application |
| CN114891897A (en) * | 2021-06-29 | 2022-08-12 | 宁德师范学院 | Method for screening molecular marker of large yellow croaker DNA methylation and qRT-PCR primer |
Non-Patent Citations (2)
| Title |
|---|
| XM_051887328.1;NCBI;GenBank;第1-2页 * |
| 长丰鲢与长江鲢形态差异与判别分析;梁宏伟;李忠;罗相忠;潘光碧;邹桂伟;;水生生物学报(第05期);第1059-1064页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN116769927A (en) | 2023-09-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111394445B (en) | Indel marker for sex identification of channa maculata and application thereof | |
| CN105506162B (en) | SNP (single nucleotide polymorphism) marker related to rapid growth of crassostrea gigas as well as identification method and application thereof | |
| JP6877680B2 (en) | Method for identifying Lycodon rufozonus with growth genetic traits | |
| KR101796306B1 (en) | Mircrosatellite marker for detecting Haliotis gigantean and method of detecting Haliotis gigantean using the same | |
| CN109880893A (en) | DNA fragment specific and application for mystus nemurus sex identification | |
| CN102876777B (en) | The special primer of brown croaker EST microsatellite marker and screening method | |
| CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| CN110724735B (en) | SNP locus and primer for rapidly identifying individual sex of fugu obscurus and method thereof | |
| CN108588238B (en) | Method for rapidly identifying sex specific molecular marker and genetic sex of Charybdis feriatus | |
| KR102074139B1 (en) | Genetic markers and methods for identifying species belong to Cobitidae | |
| CN116769927B (en) | Introgression gene, primer, method and application for identifying silver carp in Changfeng | |
| CN104073557B (en) | The reference gene of long oyster Poly (I:C) stress tests fluorescent quantitation and primer thereof and application | |
| CN106868198B (en) | Multiplex PCR primer group for simultaneously detecting four pathogenic bacteria of catfishes and monitoring method | |
| CN113502334B (en) | Molecular marker C27449 for rapidly identifying genetic sex of Penaeus japonicus and application thereof | |
| CN113699224B (en) | Molecular marker C2 for sex identification of Chinese prawn and application thereof | |
| CN111118130B (en) | Method for rapidly identifying sex of macrobrachium rosenbergii | |
| CN115011701A (en) | SNP molecular marker with cryptocaryon irritans disease resistance-related traits for trachinotus ovatus and application of SNP molecular marker | |
| CN117165695B (en) | Introgression gene, primer, method and application for identifying Changfeng silver carp | |
| KR102083306B1 (en) | Genetic markers and methods for identifying species belong to Myxinidae | |
| CN113637766A (en) | InDel molecular marker related to genetic sex identification of micropterus salmoides and application thereof | |
| KR100913941B1 (en) | Korean native pig specific DNA markers and method for detecting Korean native pig using the markers | |
| CN110951892A (en) | SSR primer pair group, kit, identification method and application for identification of several sturgeon species | |
| CN113373244B (en) | Method for rapidly detecting genetic sex of channel catfish based on SNP locus specific primer extension reaction | |
| CN116949135B (en) | Identification method of Changfeng silver carp introgression gene and application thereof | |
| KR101720969B1 (en) | Composition for discrimination of Yeonsan Ogye |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |