CN115341035A - SNP molecular marker for selecting laying weight of hens - Google Patents
SNP molecular marker for selecting laying weight of hens Download PDFInfo
- Publication number
- CN115341035A CN115341035A CN202110520100.7A CN202110520100A CN115341035A CN 115341035 A CN115341035 A CN 115341035A CN 202110520100 A CN202110520100 A CN 202110520100A CN 115341035 A CN115341035 A CN 115341035A
- Authority
- CN
- China
- Prior art keywords
- hens
- molecular marker
- weight
- snp
- egg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 239000003147 molecular marker Substances 0.000 title claims description 23
- 230000017448 oviposition Effects 0.000 claims abstract description 9
- 210000000349 chromosome Anatomy 0.000 claims abstract description 6
- 230000003321 amplification Effects 0.000 claims description 4
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 4
- 239000002773 nucleotide Substances 0.000 claims description 4
- 125000003729 nucleotide group Chemical group 0.000 claims description 4
- 239000003153 chemical reaction reagent Substances 0.000 claims 1
- 108090000623 proteins and genes Proteins 0.000 abstract description 8
- 238000000034 method Methods 0.000 abstract description 6
- 238000007894 restriction fragment length polymorphism technique Methods 0.000 abstract description 5
- 238000012098 association analyses Methods 0.000 abstract description 4
- 108091008146 restriction endonucleases Proteins 0.000 abstract description 2
- 235000013601 eggs Nutrition 0.000 description 31
- 241000287828 Gallus gallus Species 0.000 description 12
- 235000013330 chicken meat Nutrition 0.000 description 12
- 238000009395 breeding Methods 0.000 description 8
- 230000001488 breeding effect Effects 0.000 description 8
- 239000008280 blood Substances 0.000 description 5
- 210000004369 blood Anatomy 0.000 description 5
- 238000012163 sequencing technique Methods 0.000 description 5
- 238000010219 correlation analysis Methods 0.000 description 4
- 238000003205 genotyping method Methods 0.000 description 4
- 238000004458 analytical method Methods 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- RZVAJINKPMORJF-UHFFFAOYSA-N Acetaminophen Chemical compound CC(=O)NC1=CC=C(O)C=C1 RZVAJINKPMORJF-UHFFFAOYSA-N 0.000 description 2
- 238000007400 DNA extraction Methods 0.000 description 2
- 210000003278 egg shell Anatomy 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- 108010000912 Egg Proteins Proteins 0.000 description 1
- 102000002322 Egg Proteins Human genes 0.000 description 1
- 108010042407 Endonucleases Proteins 0.000 description 1
- 102000004533 Endonucleases Human genes 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 239000003146 anticoagulant agent Substances 0.000 description 1
- 229940127219 anticoagulant drug Drugs 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000012258 culturing Methods 0.000 description 1
- 230000002354 daily effect Effects 0.000 description 1
- 238000013480 data collection Methods 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 239000003651 drinking water Substances 0.000 description 1
- 235000020188 drinking water Nutrition 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 238000001976 enzyme digestion Methods 0.000 description 1
- 230000003203 everyday effect Effects 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 230000037406 food intake Effects 0.000 description 1
- 235000012631 food intake Nutrition 0.000 description 1
- 238000001502 gel electrophoresis Methods 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000005286 illumination Methods 0.000 description 1
- 244000144972 livestock Species 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 238000002205 phenol-chloroform extraction Methods 0.000 description 1
- 238000009394 selective breeding Methods 0.000 description 1
- 210000003462 vein Anatomy 0.000 description 1
- 238000009423 ventilation Methods 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses SNP molecular markers for selecting the egg laying weight of hens and application thereof, 2 SNP molecular markers associated with the egg laying weight of the hens are screened on a hen genome through candidate gene association analysis and a restriction endonuclease length polymorphism (PCR-RFLP) technical method, and SNP loci are respectively positioned at the 64953 th site and the 671357474 th site of a No. 1 chromosome. The polymorphism of the SNPs loci is obviously associated with the egg laying weight of the hens, and the SNP molecular markers can be independently used for selecting and improving the egg laying weight of individual hens.
Description
Technical Field
The invention belongs to the technical field of molecular marker selection of livestock production traits, and particularly relates to 2 SNPs molecular markers related to egg laying weight of hens and application thereof.
Background
The size of the individual egg weight of the hens is directly related to economic benefits, the increase of the egg weight can improve the yield of the commercial egg and egg products, the decrease of the egg weight can produce small-egg-weight eggs to meet market demands, and requirements can be provided for the egg weight according to different influences caused by the egg weight difference in production. The SNP molecular marker loci related to the egg weight are searched, and the breeding process of the egg weight character can be accelerated by using the modern molecular breeding technology. In order to meet market demands, the locus can provide help for breeding large-egg-weight strain and small-egg-weight strain laying hens. According to the method, based on candidate genes and egg weight phenotype data collection results determined by GWAS correlation analysis results, after sequencing is carried out on candidate fragment amplification by using designed specific primers to determine SNP information, specific endonuclease is selected to carry out genotyping on a population, and the genotyping results and the phenotype data are used for correlation analysis to verify whether sites are related to the egg weight phenotype traits or not. According to the experimental content, the invention obtains two SNPs rs732144631 and rs316447591 related to egg weight, the egg weight phenotype in a population is obviously related to a specific genotype, and the research result provides a suitable genetic marker for the genome breeding of the egg weight phenotype.
Disclosure of Invention
The invention aims to provide an SNP molecular marker for selecting the egg laying weight of hens, and 2 SNPs related to the egg weight are screened by correlating analysis with phenotype data after the SNPs loci screened out after candidate genes are sequenced are genotyped in a population.
In order to achieve the purpose, the invention is realized by the following technical scheme:
the SNP molecular marker for selecting the laying weight of hens is positioned on chromosome 1, 2 molecular markers are independently used, and the specific information is as follows:
the SNP locus of the molecular marker 1 is located at 64135953 th base of a hen No. 1 chromosome, the nucleotide sequence is GAATATTGTGGACAGCRCAATTTTATGTATCT, and the 16 th base is C or T; forward primer for amplification of molecular marker 1: TTTCTTTGTAAAAATCACCC, reverse primer: TGCTTCCCTCTTCCAT.
The SNP locus of the molecular marker 2 is positioned at 67657474 th base of a hen No. 1 chromosome, the nucleotide sequence is CCAAGGTGACAGGGRGCTGTCAAGGGTTTA, and the 16 th base is A or C; forward primers for amplification of molecular marker 2: TCACACGAAGGCACACTCCA, reverse primer: CGTGTGCTGAGAGAGGA.
The SNP molecular marker is obtained by screening through the following method:
1) Collecting experimental samples: collecting a test chicken blood sample for DNA extraction;
2) Collection of phenotypic data: collecting eggs every day, and measuring the weight of the eggs one by one;
3) Sequencing the candidate gene loci and searching SNPs;
4) Genotype determination and correlation analysis of the genotype and the egg laying weight of the chicken: selecting SNPs sites, carrying out genotype typing on individuals in a group by using a PCR-RFLP method, carrying out association analysis on data by using SPSS, and selecting SNP sites which are obviously related to phenotype from the data. The experimental results confirm that the SNPs of the molecular markers 1 and 2 are significantly related to the egg weight phenotype (P < 0.05).
Compared with the prior art, the invention has the following advantages and beneficial effects:
the invention screens genes related to target characters to determine candidate genes, searches SNPs sites by using a first-generation sequencing technology, analyzes the group genotype by using restriction fragment length polymorphism (PCR-RFLP) to perform group verification, and provides 2 new SNP molecular markers for laying hen molecular marker-assisted breeding.
Detailed Description
Example screening of SNP molecular markers associated with egg weight
1) Establishment of Experimental groups
F1 generation is obtained by hybridizing male parent of Turpan chicken and female parent of Laeving chicken, F2 generation population is obtained by intercrossing F1 generation, the experimental population selects self-built F2 generation population, the eggshells of the Turpan chicken and Laeving chicken of the ancestral generation are different in quality, character separation occurs in the F2 generation, and research on the weight of laid eggs is developed on the basis of the character separation. 219 female individuals in total, all chickens were raised in a single cage during the raising process, a 16-hour illumination system was performed, and environmental factors such as free food intake, drinking water, temperature, humidity, ventilation and the like were the same.
2) Collection of samples and phenotypic data
Eggs were collected and labeled daily at around 50 weeks of age for 60 days of the experiment.
The egg weight laid by each chicken during this period was measured and recorded.
After the egg weight measurement is finished, 1mL of blood is collected from the infrawing veins of the test chickens, the blood is placed into 1.5mL of centrifuge tube added with 0.3mL of anticoagulant in advance, and the blood is stored at the temperature of minus 20 ℃ after being mixed uniformly for DNA extraction.
3) Extraction and detection of chicken genome DNA
Extracting chicken genome DNA from a test chicken blood sample by adopting a phenol-chloroform method, and judging the integrity of the DNA by using gel electrophoresis; the concentration of the DNA was measured and adjusted to 50 ng/. Mu.L to prepare a hen whole genome DNA sample.
4) Determination of SNP sites
Determining candidate genes according to GWAS results, designing specific primers to amplify candidate gene fragments to perform first-generation sequencing, determining detailed information of SNP according to sequencing results, and formulating enzyme digestion typing experiments, wherein the results are shown in Table 1.
TABLE 1 primers and enzymes required for population typing of SNP sites
5) Correlation analysis of genotype determination with egg weight and eggshell quality:
selecting specific restriction endonuclease for the target SNP, carrying out genotyping on individuals, carrying out one-factor variance analysis on the genotyping result and phenotype data by using SPSS (single strand polymorphism), and judging whether the phenotype is associated with the SNP.
6) Analysis results
Association analysis found 2 SNPs (rs 732144631 and rs 316447591) significantly associated with egg laying weight of hens, and the locus information is shown in table 2 (reference genome GRCg6a version).
TABLE 2 sites associated with phenotypic traits
TABLE 3 SNP site and phenotype association analysis results
Note: the SNP genotypes with different shoulder marks in the same character directly indicate that the difference is obvious (P < 0.05)
And (3) obtaining genotype information of SNP loci rs732144631 and rs316447591 of hens in the F2 generation population by PCR-RFLP analysis, wherein the average egg weight of the CT type and the AC type is the largest. The average egg weights of type TT and type CC were minimal.
In the molecular marker-assisted selective breeding, the CT type and the AC type genotypes can be used as the dominant genotypes for breeding heavy egg strains and can be used for breeding laying hens by weight. The TT type and the CC type can be used as the dominant genotypes for culturing the heavy strain of the small eggs, and can be used for breeding the laying hens which are priced by the unit price of the eggs. Both sites can be used independently as molecular markers related to egg weight.
Claims (4)
1. The SNP molecular marker for selecting the laying weight of hens is characterized in that the SNP locus of the molecular marker 1 is located at the 64135953 base of the chromosome 1 of the hens; the SNP locus of the molecular marker 2 is located at the 67657474 th base of the hen No. 1 chromosome.
2. The SNP molecular marker for selecting hen egg weight according to claim 1, wherein the nucleotide sequence of the molecular marker 1 is GAATATTGTGACAGCRCAATTTTTATGTATCT, and the 16 th base is C or T; the nucleotide sequence of the molecular marker 2 is CCAAGGTGACAGGGRGCTGTCAAGGGTTTA, and the 16 th base is A or C.
3. Primer for the amplification of the molecular marker of claim 1, wherein the forward primer of molecular marker 1: TTTCTTTGTAAAAATCACCC, reverse primer: tgcttcccttctctccat; forward primer for molecular marker 2: tcacacgaaggcacactca, reverse primer: CGTGTGCTGAGATGAGGA.
4. The application of the reagent for detecting the molecular marker of claim 1 in the improvement of the characteristics of the egg laying weight of hens.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110520100.7A CN115341035A (en) | 2021-05-12 | 2021-05-12 | SNP molecular marker for selecting laying weight of hens |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110520100.7A CN115341035A (en) | 2021-05-12 | 2021-05-12 | SNP molecular marker for selecting laying weight of hens |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115341035A true CN115341035A (en) | 2022-11-15 |
Family
ID=83977601
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110520100.7A Pending CN115341035A (en) | 2021-05-12 | 2021-05-12 | SNP molecular marker for selecting laying weight of hens |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115341035A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116200506A (en) * | 2023-04-06 | 2023-06-02 | 中国农业大学 | SNP molecular marker combination related to egg weight and application thereof |
| CN117070638A (en) * | 2023-08-08 | 2023-11-17 | 江苏省家禽科学研究所 | Application of SNP genetic marker related to body weight gain in chicken egg producing period in chicken genetic breeding |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102134606A (en) * | 2011-01-10 | 2011-07-27 | 四川农业大学 | Testing method and application of hereditary variation of CRBPI (Cellular Retinol-Binding Protein Type I) gene of chicken |
| CN105349637A (en) * | 2015-10-26 | 2016-02-24 | 中国农业大学 | SNP molecular marker related to egg weight and application of SNP molecular marker |
| WO2020062160A1 (en) * | 2018-09-29 | 2020-04-02 | 中国农业大学 | Laying hen whole genome snp chip and use thereof |
-
2021
- 2021-05-12 CN CN202110520100.7A patent/CN115341035A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102134606A (en) * | 2011-01-10 | 2011-07-27 | 四川农业大学 | Testing method and application of hereditary variation of CRBPI (Cellular Retinol-Binding Protein Type I) gene of chicken |
| CN105349637A (en) * | 2015-10-26 | 2016-02-24 | 中国农业大学 | SNP molecular marker related to egg weight and application of SNP molecular marker |
| WO2020062160A1 (en) * | 2018-09-29 | 2020-04-02 | 中国农业大学 | Laying hen whole genome snp chip and use thereof |
Non-Patent Citations (2)
| Title |
|---|
| 佚名: "rs316447591", 《ENSEMBL RELEASE 103》, 28 February 2021 (2021-02-28), pages 1 - 2 * |
| 佚名: "rs732144631", 《ENSEMBL RELEASE 103》, 28 February 2021 (2021-02-28), pages 1 - 2 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116200506A (en) * | 2023-04-06 | 2023-06-02 | 中国农业大学 | SNP molecular marker combination related to egg weight and application thereof |
| CN116200506B (en) * | 2023-04-06 | 2024-04-09 | 中国农业大学 | SNP molecular marker combination related to egg weight and application thereof |
| CN117070638A (en) * | 2023-08-08 | 2023-11-17 | 江苏省家禽科学研究所 | Application of SNP genetic marker related to body weight gain in chicken egg producing period in chicken genetic breeding |
| CN117070638B (en) * | 2023-08-08 | 2024-04-26 | 江苏省家禽科学研究所 | Application of SNP genetic marker related to body weight gain in chicken egg producing period in chicken genetic breeding |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112322753B (en) | SNP molecular marker related to intramuscular fat of pork and application thereof | |
| CN106480228B (en) | The SNP marker and its application of rice low cadmium-accumulation gene OsHMA3 | |
| CN111910008B (en) | Molecular marker related to chicken growth and development and application thereof | |
| CN113957155B (en) | SNP molecular marker related to grass carp characters and application thereof | |
| CN107164463A (en) | It is a kind of to be used for the SNP marker of measure and/or genetic improvement pig growth traits | |
| CN104673902B (en) | SNP molecular marker related to breast muscle weight and breast muscle percentage of chicken and application of SNP molecular marker | |
| CN111926085B (en) | Molecular marker influencing chicken muscle brightness and application thereof | |
| CN115341035A (en) | SNP molecular marker for selecting laying weight of hens | |
| CN111926086B (en) | Molecular marker influencing oblique growth of chicken body and application thereof | |
| CN116356038A (en) | Breeding method for screening Fugu rubripes individuals with rapid growth performance | |
| CN110468217B (en) | SNP molecular marker related to pH and drip loss traits of pig muscle and application thereof | |
| CN108251418B (en) | SNP molecular marker related to growth speed of broiler chicken and application thereof | |
| CN107475413B (en) | Method for screening crassostrea gigas parent shellfish with high content of unsaturated fatty acid C20:3 omega 6 | |
| CN112080570A (en) | KASP labeled primer combination for identifying hybrid stichopus japonicus in Zhongrussia and application thereof | |
| CN102732514B (en) | Identification method for chemotactic factor acceptor 9 gene used as molecular marker for bovine excellent superovulation trait and application of same | |
| CN109439763B (en) | Molecular marker for identifying 817 broiler chickens and yellow-leg free-range chickens and application | |
| CN116179714B (en) | Molecular marker related to chicken slaughtering and meat quality characteristics and breeding method of high-quality slaughtering and processing type novel variety | |
| CN111172295A (en) | Method for detecting cow VAMP7 gene CNV marker and special kit | |
| CN114480669B (en) | Molecular marker related to chicken breast muscle color traits and application thereof | |
| CN111910009B (en) | Molecular marker influencing chicken bursal disease index and application thereof | |
| CN111961732B (en) | Molecular marker influencing full bore weight of chicken and application thereof | |
| CN109439764B (en) | Molecular marker for identifying native-like eggs and native eggs and application | |
| CN115044682A (en) | Molecular marker related to growth traits of Hu sheep, detection method and application thereof | |
| CN109136392B (en) | Genetic diversity identification method and reagent for multi-generation meiotic gynogenesis megalobrama amblycephala | |
| CN108546778B (en) | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |