KR102193649B1 - Microsatellite markers for identification of Oplegnathus fasciatus - Google Patents

Abstract

Provided are a microsatellite marker composition capable of identifying Oplegnathus fasciatus entities by a combination of a first set composed of di1168, di139, tri766, tetra316, tetra504, tetra93, tri771, and tri1129 and a second set composed of tri954, tri580, di2814, di1551, tetra495, tri33, tetra155, and tetra128; and an identification method using the same. The composition and method can contribute to the development of technology for health assessment using monitoring of a natural group of release species and the genetic diversity of release seeds. In addition to preparing the basis for a genetic analysis for establishing a genetic management system for Oplegnathus fasciatus release species and mothers. It is possible to provide basic data for scientific management, preservation, and utilization of release species by obtaining genetic diversity and genomic information of the release species.

Description

Microsatellite markers for identification of Oplegnathus fasciatus individuals using next-generation sequencing method {Microsatellite markers for identification of Oplegnathus fasciatus}

The present invention relates to a genetic marker of doldom, and more specifically, by performing multiplex PCR using a primer specific to a combination of markers selected for identification of a doldom individual, providing a marker with higher discrimination power and increasing the efficiency of gene analysis, confirming the parenthood of doldom The present invention relates to a microsatellite marker for identifying possible dolphin individuals.

The fishery seedling discharge project directly increases fishery resources by producing and releasing healthy seeds. In addition, in the field of natural sciences, in the field of natural science, follow-up surveys such as movement and growth of releasing seedlings, surveys of production volume, catch rate and recapture rate, and region of released seeds in accordance with the 2007 government-enacted ‘Fisheries Seedling Management Project Guidelines’ The effect of genetic research on the impact on the group is to be investigated, and direct and indirect economic analysis is conducted in the field of social science.

However, the systematic and objective analysis of the effect investigation is insufficient because the investigation technique such as label discharge, which is essential for the effect investigation, has not been developed enough to be used in practice. Since survey and evaluation of discharge effects are key data for judging economic feasibility, if this is insufficient, it may lead to waste of national taxes or problems in the ecosystem.

Various tagging methods (label attachment, gill or fin part cutting, fluorescent material (ALC) tag, Decimal Coded Wire Tag (DCWT), Passive Integrated Transponder (PIT) tag, cold brew, hot brew) Etc.) has been tried. However, this physical tagging method requires a new technology due to several disadvantages such as loss of label, lower survival rate, difficulty in labeling seedlings, insufficient recovery rate in the private sector, and food safety anxiety. Genes using genetic markers that can overcome these disadvantages Analysis methods are gradually expanding.

Genetic analysis has been applied since 2013, and in 2014, the development of genetic markers of major fish species, such as locust, flounder, lobster, sea cucumber, blue crab, rockfish, spotted perch, cod, and Ttukji, were developed, paternity and full-sib analysis were conducted. It also provided basic data for the release effect survey on fish species released in 2014. As a genetic analysis method, Restriction Fragment Length Polymorphism (RFLP), Randomly Amplified Polymorphic DNA (RAPD), Inter Simple Sequence Repeat (ISSR), and Simple Sequence Repeat (SSR) with markers applied based on PCR are used.

DNA markers not only reflect the genetic characteristics of organisms in nature, but also as universal characteristics of living organisms, they can be developed and applied to all species and can be used in evaluation studies for the conservation of genetic resources. Early DNA markers were mainly used dominant markers such as RAPD and ISSR, which can easily identify multiple loci. However, in the case of RAPD and ISSR, reproducibility is poor, and due to the characteristics of dominant markers, it is impossible to distinguish between dominant homozygous and heterozygous genotypes in diploids.

On the other hand, the SSR marker is a structure in which a 2-8 bp nucleotide sequence existing on an organism's genome is repeated, and is a part in which polymorphism appears due to a difference in the number of repetitions of the nucleotide sequence. SSR markers using this have a high degree of polymorphism, so they are widely used to evaluate genetic diversity and relationships, and because they are based on differences in DNA sequence, it is possible to analyze a large amount of samples and is not significantly affected by environmental factors. There are no advantages.

In the field of fisheries, it is also used in many areas, such as investigation of release effects using SSR markers, investigation of catch rates, analysis of genetic diversity, identification of households, and selective breeding. If the nucleotide sequence information of the species to be analyzed is sufficiently revealed, the SSR information can be directly searched to develop a marker, but if the nucleotide sequence information is insufficient, a new area had to be developed.

To develop this, recently, using Next-Generation Sequencing (NGS), a method of developing SSR markers by analyzing a large amount of sequence information from the target species for marker development, and directly searching the SSR region has been used. have. In the case of early large-scale sequencing, it took a long time at high cost, but it was analyzed faster and cheaper due to the advancement of technology and is used to reveal genes of many species. And microsatellite markers are becoming more feasible.

In the case of aquatic species, it is necessary to analyze a large amount of individuals, so in order to accurately analyze a large amount of samples in a short time using the multiplex PCR technique, It is essential to continuously accumulate data in the discharge effect investigation as the most scientific paternity method. Scientific investigation through genetic analysis is an essential part for the recovery of fishery resources, and genetic analysis should be conducted with continuity of the project.

Therefore, the present invention is to develop a technology for health assessment through monitoring of the genetic diversity of seeds and natural populations of effluent varieties, and to provide a basis for genetic analysis for establishing a genetic management system for releasing seeds and mothers, We would like to provide a set of microsatellite markers and doldom multiplex PCR primers.

In Korean Patent Registration No. 10-1775219, the species of sea bream and tilapia, which are difficult to distinguish morphologically, can be identified by molecular biology and can be accessed more scientifically. Disclosed is a probe for determining the species of tilapia and a method for determining the species using the same. In Korean Patent Publication No. 10-2012-0096358, a method for amplifying a horse's supersatellite gene, detecting an allele through electrophoresis of the amplified product, and identifying a horse individual for determining the genotype, and for implementing it Disclosed is a method for individual identification of horses using multiplex PCR. In Korean Patent Publication No. 10-2009-0028894, Korean beef individuals using multiplex PCR characterized in that multiplex PCR is performed using a primer specific to a combination of microsatellite markers selected for effective identification of Korean beef individuals. Disclosed is the identification method of In Korean Patent No. 10-1448121, a method for individual identification of ducks using a multiplex PCR including one or more primer pairs selected from the group consisting of primer pairs consisting of nucleotide sequences represented by SEQ ID NOs: 1 to 24. About.

An object of the present invention is to provide an SSR marker and a method for identifying individuals with high efficiency in individual identification and genetic diversity analysis of Dole Dome ( Olegnathus fasciatus ).

In order to achieve the above object, the microsatellite marker capable of identifying a dolphin individual according to an embodiment of the present invention may be a first set consisting of di1168, di139, tri766, tetra316, tetra504, tetra93, tri771, and tri1129. . In addition, it may be a second set consisting of tri954, tri580, di2814, di1551, tetra495, tri33, tetra155, and tetra128.

The first set and second set markers may include forward and reverse primers consisting of SEQ ID NOs: 1 to 16 and SEQ ID NOs 17 to 32, respectively.

In another embodiment of the present invention, a method for identifying an individual of a stone dome is a multi-simultaneous polymerase chain reaction using the first set consisting of microsatellite markers di1168, di139, tri766, tetra316, tetra504, tetra93, tri771, and tri1129. PCR) amplifying; And analyzing the genetic diversity using the product amplified in the amplification step.

In addition, amplifying multiple simultaneous polymerase chain reactions (Multiplex PCR) using a microsatellite marker composition, which is a second set of tri954, tri580, di2814, di1551, tetra495, tri33, tetra155, and tetra128; And analyzing the genetic diversity using the product amplified in the amplification step.

Contributing to the development of technology for health assessment through monitoring the genetic diversity of natural populations and released seeds by providing a microsatellite marker capable of identifying an individual of dolphin according to the present invention and an identification method using the marker thereof. In addition to preparing the basis for genetic analysis to establish a genetic management system for released seeds and mothers, it is possible to provide basic data for scientific management, preservation, and use of released varieties by obtaining genetic diversity and genome information.

1 shows the results of DNA gel loading of two dolphins selected according to Experimental Example 1.
2 shows the results of the Library QC (Quality Control) test.
3 shows a result of searching an SSR region based on NGS data. (blugen_1 SSR region)
4 shows a result of searching an SSR region based on NGS data. (blugen_2 SSR region)
5 shows the SSR region primer design.
6 shows the results of measuring the purity and concentration of genomic DNA of a stone dome sample.
7 shows the results of measuring the purity and concentration of genomic DNA of a stone dome sample.
8 shows a first set and a second set of microsatellite markers for identifying the final selected individual.
9 shows a picture of a multiplex PCR agarose gel.
10 shows peaks of the genotyping result of the first set of microsatellite markers.
11 shows the peaks of the genotyping result of the second set of microsatellite markers.

The term "marker" of the present invention means a nucleotide sequence used as a reference point when identifying genetically unspecified related loci.

Microsatellites (supersatellites) referred to in the present invention refer to short repeating sequences in the form of mono-, di-, tri- and tetranucleotides distributed throughout the eukaryotes gene. These repeats exist in the form of tandem repeats about 10 to 40 times within the chromosome.

In addition, the microsatellite marker (supersatellite marker) referred to in the present invention may mean a DNA polymorphism detection marker using microsatellite.

SSR (simple sequence repeat, or microsatellite) referred to in the present invention is a structure in which a nucleotide sequence of 2 to 8 bp existing on an organism's genome is simply repeated, and polymorphism appears due to the difference in the number of repetitions of the nucleotide sequence. Refers to.

The term "a pair of primers" in the present invention refers to nucleotide sequences for amplifying a gene to be diagnosed using PCR, and a PCR product by reacting a pair of forward and reverse primers to a gene to be diagnosed To synthesize. At this time, when the forward and reverse primer pairs are determined, the size of the PCR product synthesized therefrom can be predicted.

The term "simultaneous polymerase chain reaction" of the present invention refers to a modified PCR designed to quickly detect deletions or duplications in large genes. This process amplifies genomic DNA by thermal cycling using a plurality of primer pairs and temperature-mediated DNA polymerase.

In other words, it amplifies DNA by the activity of DNA polymerase according to temperature while periodically changing the temperature. The basic mechanism of action is the same as PCR. The first multiplex PCR was designed to detect the deletion of the dystrophin gene, but has been used for SNP analysis since then.

Multiplex PCR is composed of a plurality of primer pairs capable of producing amplification products of various sizes by reacting specifically to different DNA sequences. By targeting multiple genes at once, additional gene information can be obtained, such as repeated three or four times in a single test.

In the multiplex PCR technique, since several different primer pairs are put in one tube and reacted, inhibition may occur between primers, so when applying to multiplex PCR, it is important to select primers for the genes to be amplified. Do.

In addition, since suitable binding temperatures may differ for each of the several primers included, when applying multiplex PCR, optimization of a binding temperature suitable for multiplex PCR is required so that all of the PCR primer pairs included in a single PCR reaction can effectively bind. If the nucleotide sequence information of the species to be analyzed is sufficiently revealed, the SSR information can be directly searched to develop a marker, but if the nucleotide sequence information is insufficient, a new domain must be developed.

To develop this, recently, a method of developing SSR markers by analyzing a large amount of nucleotide sequence information from the target species for marker development using NGS (next generation sequencing) and directly searching the SSR region has been used. In the case of large-scale sequencing in the early stages, it took a long time at high cost, but it was analyzed faster and cheaper due to the advancement of technology, and is used to reveal genes of many species, and for aquatic species for which SSR markers have not been developed, sequencing using NGS and The feasibility of developing microsatellite markers is increasing.

The term "next generation sequencing (NGS)" as used herein refers to a sequencing technique capable of generating a large amount of reads, typically a sequence of thousands or many sequence reads, more than a few hundred at the same time.

The present invention was to develop a marker for individual identification using the SSR site of Dole Dome ( Olegnathus fasciatus ). The microsatellite marker for identification of doldom individual of the present invention was finally divided into two sets and combined to enable multiple simultaneous polymerase chain reaction (Multiplex PCR) using a total of 16 microsatellite markers.

The microsatellite marker composition for identification of doldom individual according to an embodiment of the present invention consists of two sets, the first set being di1168 (SEQ ID NO: 1 and 2), di139 (SEQ ID NO: 3 and 4), tri766 (SEQ ID NO: 5) And 6), tetra316 (SEQ ID NO: 7 and 8), tetra504 (SEQ ID NO: 9 and 10), tetra93 (SEQ ID NO: 11 and 12), tri771 (SEQ ID NO: 13 and 14), tri1129 (SEQ ID NO: 15 and 16) Amplified with forward and reverse primers.

In addition, the second set includes tri954 (SEQ ID NO: 17 and 18), tri580 (SEQ ID 19 and 20), di2814 (SEQ ID NO: 21 and 22), di1551 (SEQ ID NO: 23 and 24), tetra495 (SEQ ID NO: 25 and 26), It is amplified with forward and reverse primers consisting of tri33 (SEQ ID NO: 27 and 28), tetra155 (SEQ ID NO: 29 and 30), and tetra128 (SEQ ID NO: 31 and 32).

The present invention is SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, SEQ ID NO: 9 and 10, SEQ ID NO: 11 and 12, SEQ ID NO: 13 and 14, SEQ ID NO: 15 and 16 It provides a first set of primers consisting of a pair of forward and reverse primers.

The present invention is SEQ ID NO: 17 and 18, SEQ ID NO: 19 and 20, SEQ ID NO: 21 and 22, SEQ ID NO: 23 and 24, SEQ ID NO: 25 and 26, SEQ ID NO: 27 and 28, SEQ ID NO: 29 and 30, SEQ ID NO: 31 and 32 It provides a second set of primers consisting of a pair of forward and reverse primers.

Hereinafter, an experimental example related to the microsatellite marker for identifying individuals of Oplegnathus fasciatus using the next-generation sequencing method of the present invention is as follows.

< Experimental example 1> Doldom genomic DNA extraction

For the development of SSR markers, Oplegnathus fasciatus , which secures the sample for analysis, 82 Dole Dome were received from the South Sea Headquarters of Korea Fisheries Resources Corporation on August 8, 2019 and 23 Dole Dome on September 25, 2019 On November 7th, 30 stones were received. The subjects were samples fixed in 99.9% alcohol, and the quantities are shown in Table 1.

Sample information kind Number of samples Remark Stone dome 2 NGS analysis 133 Genotyping analysis

The two stone domes received from the South Sea Headquarters of Korea Fisheries Resources Corporation were used as samples for NGS analysis (NGS; next generation sequencing) analysis. In order to extract high quality DNA required for NGS analysis, DNA was extracted within 10 days after receiving the sample, and in this process, a DNeasy Blood & Tissue kit (QIAGEN, Germany) was used. The protocol used for DNA extraction is as follows. About 30 mg of sample tissue is washed with distilled water and ground. After adding 360 µl of ATL buffer + 40 µl of Proteinase K + 4 µl of RNase A to the pulverized sample tissue, react at 60° C. for 4 hr or more. After the reaction was completed, the sample was centrifuged at 13,000 rpm for 15 min, and the supernatant was transferred to a 1.5 ml tube. Add the same amount of AL buffer and mix well.

Add the same amount of 100% EtOH, mix well and transfer to 2 ml collection tube + DNeasy Mini spin column. After centrifugation at 8,000 rpm for 1 min and removal of the passing solution, 500 μl of AW1 buffer was added. After centrifugation at 8,000 rpm for 1 min to remove the passing solution, 500 µl of AW2 buffer was added. After centrifugation at 13,000 rpm for 1 min to remove the liquid passing through, the reagent remaining in the column is completely removed. Transfer the column to a 1.5 ml tube, add 30 µl of Elution Buffer, and react for 1 min at room temperature. DNA extracted by centrifugation at 13,000 rpm for 1 min is used.

<Experimental Example 2> DNA library preparation

DNA QC (Quality Control) test was also conducted before library production to reconfirm whether the concentration and purity were sufficient to produce data. DNA quantity was measured by picogreen using Victor3 fluorometry, and the degree of degradation of DNA was confirmed through electrophoresis.

High quality DNA for NGS analysis was extracted using the two stone dome according to Experimental Example 1. After the DNA extraction was completed, DNA gel loading and the presence of DNA were checked using 1% agarose in order to proceed with the QC (Quality Control) test. FIG. 1 shows the DNA gel loading results of two dolphins selected according to Experimental Example 1, and Table 2 shows the DNA concentration of dolphins. Finally, it was confirmed that the main band of genomic DNA was confirmed in both of the two dolphins, and the purity was also extracted with high quality.

Dolphin DNA concentration Sample ID Nucleic Acid Unit blugen_1 138.017 ng/ul blugen_2 173.346 ng/ul

A library was prepared for the DNA of two dolphins that passed the QC test, and the size, concentration, and purity of the prepared library were checked using Agilent's 2100 BioAnalyzer. The concentration standard for producing high-quality data is to be at least 5 nM when the total volume is 10 μ, and raw data is produced when passing. 2 shows the results of the Library QC (Quality Control) test.

Raw data for Doldom DNA was generated using llumina's HiSeq system (HS4000), and a read with an insert size of 500 bp was created with the aim of producing more than 15 Gb, which is more than 15 times the genome size. Reads 1 and 2 were merged using the FLASH tool, and assembly was performed to obtain a contig graph, and the final untangled assembly was performed.

After checking the total base reads produced, the production amount of data corresponding to Q20 was confirmed. Q-score can be seen as an algebraic number of errors that can occur when calling a base, and Q20 is the probability of 99% accuracy with the probability of calling one base incorrectly when calling 100 bases. Table 3 below shows the assembly result and length information of the sample.

Doldom assembly result and length information Sample ID Number of Contig Contigs Sum (bp) N50 (bp) blugen_1 122,951 706,300,120 10,458 blugen_2 133,707 675,924,121 7,647

Using the generated NGS data, total read bases, total reads, GC (%), and Q20 (%) values were derived, and Table 4 below shows NGS raw data information. Accordingly, in the case of the total read bases of both dolphins according to Experimental Example 1, generation of 15G bases or more was completed, and Q20 (%) was also confirmed with high reliability as 96% or more.

NGS raw data information Sample ID Total read bases Total reads GC(%) Q20(%) blugen_1 18,402,898,802 121,873,502 40.84 96.74 blugen_2 15,290,072,458 101,258,758 40.89 96.67

< Experimental example 3> SSR area Marker design

For the data, only reads with a Q20 of 90% or more were left and filtered. After de novo assembly, an SSR marker primer having a PCR product size of 100 to 400 bp was designed using a MISA tool that selects only the SSR region and searches for repeated sequences, and the annealing temperature is 58 to 60°C.

When the marker design of the SSR region was completed through NGS, there were no repeated sequences in the primer sequence, and the SSR repeat region of the amplification site was repeated at least 8 in principle, and the markers were selected. In addition, the same site was not amplified through the redundancy test with other markers, and the individual nucleotide sequences of the corresponding markers were confirmed by performing multiple alignment through the Mega (ver. 6) program.

The produced data were filtered based on 99% reliability to select only the SSR region, and the marker was selected by considering the number of repeat motifs and product size. 3 to 4 show results of searching an SSR region based on NGS data. As a result, for blugen_1, 191,958 dinucleotides, 75,878 trinucleotides, and 23,285 tetranucleotides were found, and 180,081 for blugen_2, 72,205 for trinucleotides, and 21,973 tetranucleotides were found.

Based on the repeat motif from the SSR region, the Tm value (annealing temperature) was 58 to 60°C and the amplified fragment size was 100 bp or more and 400 bp or less, and the primer design was performed, and FIG. 5 shows the SSR region primer design.

When the primer design was completed, in order to increase the amplification efficiency, there was no repetitive sequence among the primer sequences, and the predicted fragment size was evenly selected between 200-400 bp, and 192 primer pairs were selected for the primary marker candidate group.

PCR screening is performed using the first selected marker candidate group. In the case of PCR, an efficient AccuPower PCR PreMix (Bioneer, Korea) was used, and a quick PCR screening test was performed to check the amplification of the corresponding size through a marker designed at the same temperature. The reagent concentration and PCR conditions used in the PCR according to the experimental example of the present invention are shown in Tables 5 and 6 below.

The PCR machine used Veriti® 96-Well Thermal Cycler (Applied Biosystems, USA), and the electrophoresis was performed using 1% agarose gel and loaded at 120 V for 20 min to confirm the results.

PCR for screening test concentration PCR Contents DNA template 1 μl Premix(bioneer) - Forward primer (5 p) 2 μl Reverse primer(5 p) 2 μl Ultra Pure water 15 μl Total 20 μl

PCR for screening test conditions PCR Condition Initial denaturetion 94℃ 5 min 1 cycle Denaturation 94℃ 30 sec 35 cycle Annealing 55℃ 30 sec Extension 72℃ 40 sec Final extension 72℃ 7 min 1 cycle Hold 4℃

Genomic DNA was extracted from the dome sample for genotyping according to Experimental Example 1, and DNA quality was measured through a spectrophotometer, Nanodrop-2000 (ThermoFisher Scientific, USA). In the measurement, it was confirmed that the A260/A280 value appeared between 1.6 and 2.0, and FIGS. 6 to 7 show the results of measuring the purity and concentration of genomic DNA of a stone dome sample.

The first PCR screening was performed using the first selected marker candidate group and 4 high-purity stone dome, and the electrophoresis result was confirmed. Marker candidate groups of 100 primer pairs, in which bands are clearly visible on the gel, and diversity is ensured, were secondarily selected.

In general, several markers for the same SSR region are sometimes produced in the selection and development of marker candidates. Accordingly, according to the experimental example of the present invention, in order to prevent errors in this part, it was confirmed whether or not overlapping was performed using the fragment sequence of the amplification site for all markers. Thereafter, 70 markers were secondarily selected in consideration of the ratio of di- and tri-tetra, and it was confirmed that the sequence between the markers to be developed did not overlap through cluster and multiple alignment.

A dye labeled primer was prepared using the 70 markers selected for the second time. Four fluorescent substances were attached to the 5'side of the forward primer to confirm the genotyping result, and the size of the amplified product was When they overlap each other, they were labeled with a fluorescent substance of a different color so that they could be distinguished by the color of the fluorescent substance. To minimize background noise, 6 oligomers (GTTTCT) were tailed at the 5'end of the reverse primer to facilitate analysis.

In order to develop a multiplex PCR marker composition in which the eight markers correspond to the first set, the most efficient marker should be selected from the PCR environment of each marker under the same chemical reaction conditions, and there should be no null allele. In order to construct an optimal multiplex PCR set, development was conducted based on the amplification efficiency of all markers, excellent identification of markers, securing of Allele diversity, and confirmation through null allele check.

The selected 70 dye labeled primers were subjected to genotyping analysis by designating a random group, and the presence or absence of PCR amplification was confirmed. Except for markers that are not well amplified or difficult to select peaks, markers with stable PCR and accurate peaks were selected. A null allele check was performed based on the genotyping data on which the scoring was completed, and the presence or absence of null allele was analyzed through a micro-checker program.

When null allele occurred, the marker was excluded from selection, and those with stable PCR amplification efficiency were selected. As a result of genotyping and diversity analysis of markers considering the range according to the dye, the first set and the second set of microsatellite markers for identification of dolphin individuals were finally developed.

FIG. 8 shows a first set and a second set of microsatellite markers for identifying the final selected individual, Table 7 below shows a combination of a first set of microsatellite markers, and Table 8 shows a combination of a second set of microsatellite markers.

Combination of the first set of microsatellite markers Dye Marker Sequence(5' to 3') Sequence number Repeat Motif Repeat no. Size range FAM di1168 F TGTTCCGGCTTTTGCTTTCG One CA 14 202-235 di1168 R TCCCTGCTCTCTCTTCCAGT 2 di139 F ATGCCATCTGTCTAAGGGCG 3 AC 13 301~351 di139 R TGCAGTCAGTCCCCTCCATA 4 VIC tri766 F GAGCACACCTCCCTCAAACA 5 GAG 10 208~220 tri766 R CCTACTCCCCTGAAGGACCA 6 tetra316 F CAGCCAGCGAAGTATCAGGT 7 GATA 13 368~408 tetra316 R GTTGTCACACAAGCTGCAGG 8 NED tetra504 F TGGGAATCTGCTGCATCACA 9 TGTC 13 213-243 tetra504 R ACGACTGAACACTGGAGCTG 10 tetra93 F GTGCAGTGAAATGCCACCAT 11 AGAT 14 302~338 tetra93 R TGTGTCTCTCTCCCTCTGGG 12 PET tri771 F TTCAAGGGCATGTCTCGCTT 13 GAG 9 247~268 tri771 R ACCCGCTGGTTTAGAGTGTG 14 tri1129 F GGTTTTGCACACTGCCTGAG 15 TCC 14 304~316 tri1129 R AACATACCCCGGTGAGGAGA 16

Combination of the second set of microsatellite markers Dye Name Sequence(5' to 3') Sequence number Repeat Motif Repeat no. Size range FAM tri954 F CAGCTCCTCATCAGCAGAGG 17 TAA 13 202-235 tri954 R CCCAGCGTTTCTCCTGATCA 18 tri580 F ATGATGGCACTCACCACCTC 19 CCT 9 304~318 tri580 R GCCTATCCCCACTTTCCCTC 20 VIC di2814 F ACCCTTGGTGCAACAGTGAT 21 TG 14 215~240 di2814 R TGGGTCAATTCACGAGTGGG 22 di1551 F TTACGACAGTGACCCTCCCT 23 CT 10 347~367 di1551 R CAACCGCACTGTTCATCCAC 24 NED tetra495 F ACATCTGCTGCTCTCGTCAG 25 TGTC 8 275~282 tetra495 R GTCTGCACACCACGTCTACA 26 tri33 F CAGCTTCGCAGTGCTTCATC 27 AAC 13 374~384 tri33 R GAGAGTGTGGTCAGCGTCAA 28 PET tetra155 F CATGGAGCGGGGATCTACAC 29 ATCT 15 237~273 tetra155 R TGGTGATGTTTCCAGCCCTC 30 tetra128 F ATGGGAAAGACGGGGGTAGA 31 ATAG 11 319~335 tetra128 R CGCTGCTGTCCACATTCATG 32

< Experimental example 4> Multiple simultaneous polymerase chain reaction (Multiplex PCR ) Condition investigation

In general, in order to construct a set of microsatellite marker compositions, it is very important to have the same chemical reaction conditions among the PCR environments of 8 markers per set and to properly control the multiplex PCR conditions.

In particular, in order to simultaneously amplify all markers with an annealing temperature of 58~60℃, the touch-down PCR method is carried out by 1℃, and genotyping can be analyzed by appropriately considering the distribution of alleles and the lowest and highest fragment sizes. Made it possible.

Among the primers first selected through PCR screening, dye labeled primers were synthesized by selecting markers with a clearly visible band and diversity in the corresponding size. Dye labeled primer is a fluorescent substance of a different color so that if the size of the amplification product overlaps with each other, four fluorescent substances such as FAM, VIC, NED, and PET are attached to the 5'side of the forward primer so that the color of the fluorescent substance can be distinguished. Labeled with.

In addition, HS Prime Taq DNA Polymerase (2.5 units/µl) from GeNet Bio was used to increase the amplification efficiency during PCR. The presence or absence of multiplex PCR amplification, the height and shape of the peak in the range were checked, and scoring was performed to confirm that there was no null allele during genotyping. The null allele test was performed using a micro-checker program (ver 2.2), and when null allele occurred, the corresponding marker was excluded from selection.

PCR was performed using a multiplex PCR set that does not contain null allele and includes 8 markers. After dilution of the amplified PCR product by 30X, 1 µl of the amplification product and the strandard size standard GeneScan LIZ500 (Applied Biosystems, USA) and Hi-Di Formaide (Applied Biosystems, USA) mixture were diluted 1:9 to obtain a sample for analysis. Was used as. This sample was subjected to electrophoresis to be classified by size using an automatic sequence analysis device.

A standard allele ladder for each marker was made, and all individuals were scored using an analysis program such as GeneMapper version 4.0 (Applied Biosystems, USA), and data were collected and analyzed by classifying them by size and type of marker. For reproducibility in multiplex PCR, the most suitable PCR conditions were suggested by establishing PCR composition and conditions.

In the case of multiplex PCR, the effect of the annealing temperature and the concentration of reagents added during the multiplex PCR are greatly affected.The touch-down PCR method lowers the temperature to minimize the effect of the annealing temperature, and the optimum composition and conditions of the reagent are corrected. And proceeded. Tables 9 to 11 below show conditions for establishing optimal Multiplex PCR conditions.

multiplex PCR conditions (same as the first set and the second set) Initial Step Pre-Denaturation 95℃, 10 min 1st Step
(9 cycles) Melt 94℃, 60 sec Annealing 58℃, 90 sec Extend 72℃, 60 sec 2nd Step
(5 cycles) Melt 94℃, 60 sec Annealing 57℃, 90 sec Extend 72℃, 60 sec 3rd Step
(25 cycles) Melt 94℃, 60 sec Annealing 56℃, 90 sec Extend 72℃, 60 sec Final Step Final Extension 65℃, 5 min Final Step 8℃ Hold

Doldom multiplex PCR composition (1st set) Multiplex PCR contents uM Vol.(µl) Vol.(µl) -Forward -Reverse DNA template (50 ng ~ 100 ng/ul) 1-2 10X buffer 1.5 10 mM dNTP mix 1.5 SET 1 di1168 10 0.15 0.15 di139 10 0.3 0.3 tri766 10 0.15 0.15 tetra316 10 0.35 0.35 tetra504 10 0.15 0.15 tetra93 10 0.25 0.25 tri771 10 0.2 0.2 tri1129 10 0.25 0.25 HS Prime Taq DNA Polymerase (2.5 U/ul) 0.3 DW - Total vol. up to D.W 15

Doldom multiplex PCR composition (2nd set) Multiplex PCR contents uM Vol. (Μl) Vol. (Μl) -Forward -Reverse DNA template (50 ng ~ 100 ng/ul) 1-2 10X buffer 1.5 10 mM dNTP mix 1.5 SET 2 tri954 10 0.15 0.15 tri580 10 0.3 0.3 di2814 10 0.2 0.2 di1551 10 0.35 0.35 tetra495 10 0.25 0.25 tri33 10 0.5 0.5 tetra155 10 0.2 0.2 tetra128 10 0.3 0.3 HS Prime Taq DNA Polymerase (2.5 U/ul) 0.3 DW - Total vol. up to D.W 15

Single PCR and multiplex PCR were performed using the developed 16 markers, followed by electrophoresis at 50 V and 4 hr on 4% agarose gel. 9 shows a picture of a multiplex PCR agarose gel. As a result of multiplex PCR, a band from a minimum of 202 bp to a maximum of 408 bp could be identified.

< Experimental example 5> Microsatellite DNA Marker exclusion power analysis

The exclusion power of the multiplex PCR set was calculated and analyzed by calculating the exclusion power of each microsatellite DNA marker with respect to the results of the analysis of the entire dolomite sample. The exclusion power of the entire marker was 1.3925 X 10 ^-13 , which showed a high discrimination power.If an analysis of additional individuals is performed, it is not a large range, but there is a possibility that some error may occur. Is considered to be excellent in discrimination.

< Experimental example 6> Genetic diversity assessment

Allele frequency per locus, Polymorphic Information Content (PIC), alleles for genetic diversity analysis of dolphin samples using the first and second sets of developed 16 markers of microsatellite markers. The number (K), observed and expected heterozygote rates (Ho, He) were obtained through Cervus 3.07 software (Marshall et al., 1998), and in FSTAT ver2.93 software (Goudet, 1995), based on the minimum number of samples. Allelic richness (Ar), Gene diversity index, and FIS values were calculated to correct the number of alleles. To verify the significance of Hardy-Weinberg equilibrium (HWE), Bonferroni correction, which is an adjusted p value, was applied, and the p value analyzed in Cervus 3.07 software was derived.

Using the first set and second set of microsatellite markers of the developed dolphin, the genetic diversity and population genetic analysis of 96 dolphins were carried out. FIG. 10 shows the peaks of the genotyping result of the first set of microsatellite markers, and FIG. 11 shows the peak of the genotyping of the second set of microsatellite markers. The number of alleles (K) for 96 dolphins was 6-20, with an average of 11.25.

Among the first and second sets of microsatellite markers developed, the di1551 marker showed the lowest number of alleles with 6, and the di2814 marker showed the most with 20. An average of 11.23 were analyzed by applying Allele richness (Ar) according to the variation of the number of individuals.

The expected value of heterozygous ratio (He), which is the ratio of two alleles at the loci of one individual, was 0.81 on average for all analyzed samples, and the observed value of heterozygous ratio (Ho) was 0.82. In addition, the polymorphism information index (PIC) was averaged 0.78 for the whole.

For HWEp, Bonferroni correction, which is an adjusted p value, was applied, and the average value was 0.46. Twelve of the 16 markers developed showed no difference in the significance test. However, it was confirmed that there was a difference in some markers (tri766, di1551, tetra495, tetra155), and this was found that the analyzed population is highly likely to fail to maintain the genetic equilibrium due to one of the causes of analysis of a small number of individuals, artificial mating, etc. Feed.

Table 12 below shows the genetic diversity and population genetic analysis results of 96 dolphins. The intrinsic coefficient (FIS) was found to be -0.01 on the overall average, which can be considered to be unlikely to change rapidly in a genetically stable state. Gene diversity (Ge.Di) showed a high value of 0.81 on average of 96 dolphins.

The number of alleles (K), the number of samples (N), the number of alleles corrected for the population size (Ar; allelic richness), the observed heterozygosity (Ho), and the expected heterozygosity rate (He ; expected heterozygosity), polymorphism information contents (PIC), probability of Hardy-Weinberg equilibrium (HWE) tests with Bonferroni correction (p)(NS: not significant, *: significant at the 5% level, **: significant at the 1% level, ***: significant at the 0.1% level, ND: not done), inbreeding coefficient (FIS), and gene diversity.

Gene Diversity and Deep Monogenetic Analysis Results Loci 96 stone sea bream K N Ar Ho He PIC HWEp FIS Ge.di di1168 10 96 10.00 0.875 0.765 0.730 0.573 NS -0.140 0.767 di139 18 96 17.98 0.854 0.881 0.866 0.165 NS 0.033 0.881 tri766 9 96 8.97 0.740 0.743 0.698 0.000 *** -0.003 0.745 tetra316 18 96 17.98 0.938 0.919 0.908 0.996 NS -0.019 0.919 tetra504 13 95 13.00 0.916 0.872 0.854 0.991 NS -0.048 0.873 tetra93 12 95 12.00 0.811 0.812 0.785 0.840 NS 0.005 0.812 tri771 8 95 8.00 0.874 0.825 0.796 0.516 NS -0.058 0.825 tri1129 9 96 9.00 0.813 0.844 0.820 0.430 NS 0.038 0.843 tri954 9 95 9.00 0.832 0.836 0.811 0.395 NS -0.004 0.837 tri580 8 94 8.00 0.713 0.783 0.755 0.199 NS 0.095 0.784 di2814 20 93 20.00 0.871 0.893 0.879 0.981 NS 0.027 0.894 di1551 6 95 6.00 0.611 0.605 0.569 0.000 *** -0.005 0.604 tetra495 6 94 6.00 0.670 0.670 0.611 0.000 *** -0.007 0.673 tri33 11 93 11.00 0.806 0.797 0.767 0.920 NS -0.010 0.797 tetra155 13 94 13.00 0.947 0.895 0.880 0.000 *** -0.058 0.894 tetra128 10 93 10.00 0.828 0.848 0.824 0.428 NS 0.027 0.849 Average 11.25 94.75 11.25 0.82 0.81 0.78 0.46 -0.01 0.81

As a result of the diversity analysis of a total of 16 microsatellite markers according to Experimental Example 6 of the present invention, the average of the number of alleles was 11.25, indicating an appropriate value. As a result of converting this to Ar, which is a value obtained by applying the number of samples of the analysis group, the result was similar to the number of alleles observed at 11.23.

The observed value of the heterozygous ratio (Ho) and the expected value of the heterozygous ratio (He) analyzed below can predict the genetic diversity of the analyzed population by comparing the heterozygous ratio. The average Ho and He values of the sample group were 0.82 and 0.81, indicating very high values.

Ho was analyzed lower than He in 8 loci, but the difference was very small. Therefore, the current analysis group has many alleles, and since the frequency of each allele is good, it is judged that the genetic diversity is very high. If the PIC value, which is an index indicating the degree of genetic polymorphism of a marker, is between 0 and 1 and is higher than 0.7, it can be referred to as'informative', and between 0.44 and 0.7 can be judged as'informative'. In addition, the PIC value increases as the type of allele type and the number of varieties corresponding thereto increases, and the larger the PIC value of the corresponding marker, the greater the variety of allele types generated between varieties, and breed identification is high.

As a criterion for determining the degree of polymorphism of the currently widely used msDNA marker, when the He value is 0.6 or higher and the PIC value is 0.5 or higher, it can be regarded as a marker with high polymorphism. As a result of this task, the He values of the 16 msDNA markers were found to be 0.81 on average from 0.605 to 0.919, and the PIC values from 0.569 to 0.908, on average 0.78. These results suggest that 16 microsatellite markers are markers with sufficient polymorphism in the polymorphism analysis of the dolphin cultivar.

As a result of examining whether the sample group for each locus conforms to Hardy-Weinberg Equilibrium (HWE), the four loci di1551, tri766, tetra128, and tetra495 showed significant differences after Bonferroni correction. Theoretically, in the natural group, various individuals are randomly involved in spawning, so that the genetic composition of the group remains unchanged, but the farming group selects a limited number of mothers and individuals showing favorable characteristics among them. Therefore, it is believed that the genetic composition of seedlings produced over generations is out of the genetic equilibrium because the method of breeding that actively participates in spawning is used.

In order to confirm the intimacy according to the genetic fixation of each microsatellite marker group, the FIS value was checked. FIS is a measure of the degree of heterozygous reduction for each group, and it can determine the degree of inbreeding according to the degree of genetic fixation within the group. The higher the FIS value, the higher the degree of correlation between individuals in the group, and the lower the value, the lower the intimacy. The average FIS value of the sample group in this task was -0.01, confirming that the degree of inbreeding was very low.

In the development of markers for aquatic organisms, it is necessary to develop systematic markers according to genotyping of several groups rather than analysis on a specific minority group. This is considered to be essential because securing sufficient quantities of samples from various households is prioritized. Accordingly, according to the experimental example of the present invention, for the purpose of developing a microsatellite marker to increase the efficiency of gene analysis, securing diversity in the number of alleles, selecting null alleles and designing the marker, the marker according to the present invention is a genetic analysis and It is believed to be suitable for use as a marker for paternity.

The present invention not only contributes to the development of technology for health assessment through monitoring of the genetic diversity of the natural group of effluent varieties and the releasing seeds, and provides a basis for genetic analysis for establishing a genetic management system for doldom releasing seeds and mothers, It has industrial applicability because it can provide basic data for scientific management, preservation, and utilization by acquiring genetic diversity and genome information of effluent varieties.

<110> Jeollanam-do <120> Microsatellite markers for identification of Oplegnathus fasciatus <130> p20-031 <160> 32 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> di1168 forward primer <400> 1 tgttccggct tttgctttcg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> di1168 reverse primer <400> 2 tccctgctct ctcttccagt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> di139 forward primer <400> 3 atgccatctg tctaagggcg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> di139 reverse primer <400> 4 tgcagtcagt cccctccata 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tri766 forward primer <400> 5 gagcacacct ccctcaaaca 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tri766 reverse primer <400> 6 cctactcccc tgaaggacca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tetra316 reverse primer <400> 7 cagccagcga agtatcaggt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tetra316 reverse primer <400> 8 gttgtcacac aagctgcagg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tetra504 forward primer <400> 9 tgggaatctg ctgcatcaca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tetra504 reverse primer <400> 10 acgactgaac actggagctg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tetra93 forward primer <400> 11 gtgcagtgaa atgccaccat 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tetra93 reverse primer <400> 12 tgtgtctctc tccctctggg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tri771 forward primer <400> 13 ttcaagggca tgtctcgctt 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tri771 reverse primer <400> 14 acccgctggt ttagagtgtg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tri1129 forward primer <400> 15 ggttttgcac actgcctgag 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tri1129 reverse primer <400> 16 aacatacccc ggtgaggaga 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tri954 forward primer <400> 17 cagctcctca tcagcagagg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tri954 reverse primer <400> 18 cccagcgttt ctcctgatca 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tri580 forward primer <400> 19 atgatggcac tcaccacctc 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tri580 reverse primer <400> 20 gcctatcccc actttccctc 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> di2814 forward primer <400> 21 acccttggtg caacagtgat 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> di2814 reverse primer <400> 22 tgggtcaatt cacgagtggg 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> di1551 forward primer <400> 23 ttacgacagt gaccctccct 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> di1551 reverse primer <400> 24 caaccgcact gttcatccac 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tetra495 forward primer <400> 25 acatctgctg ctctcgtcag 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tetra495 reverse primer <400> 26 gtctgcacac cacgtctaca 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tri33 forward primer <400> 27 cagcttcgca gtgcttcatc 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tri33 reverse primer <400> 28 gagagtgtgg tcagcgtcaa 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tetra155 forward primer <400> 29 catggagcgg ggatctacac 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tetra155 reverse primer <400> 30 tggtgatgtt tccagccctc 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tetra128 forward primer <400> 31 atgggaaaga cgggggtaga 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tetra128 reverse primer <400> 32 cgctgctgtc cacattcatg 20

Claims (4)

Di1168, di139, tri766, tetra316, tetra504, tetra93, tri771, tri1129 are specific for microsatellite markers consisting of 8 groups, and include primers consisting of nucleotide sequences represented by SEQ ID NO: 1 to SEQ ID NO: 16 Identification kit delete Amplifying a nucleic acid sample of a stone dome to be analyzed by multiplex PCR using the kit for identification of an individual of claim 1,
Individual identification method of stone dome through microsatellite marker, comprising the step of analyzing genetic diversity using the product amplified in the amplification step 4. , Allelic richness (Ar), gene diversity index, and at least one selected from FIS values.

Images