CN106282394B

CN106282394B - Method for high-throughput detection of southern rust resistance genotyping of corn and kit thereof

Info

Publication number: CN106282394B
Application number: CN201610964817.XA
Authority: CN
Inventors: 翟晨光; 柴宇超; 王丽丽; 李梦; 郭春兰; 罗朗; 严勇攀; 景润春
Original assignee: China Golden Marker Beijing Biotech Co ltd
Current assignee: China Golden Marker Beijing Biotech Co ltd
Priority date: 2016-10-28
Filing date: 2016-10-28
Publication date: 2020-07-31
Anticipated expiration: 2036-10-28
Also published as: CN106282394A

Abstract

The invention relates to a method for high-throughput detection of corn southern rust disease-resistant major gene RppP25 typing and a kit thereof. In particular, the invention relates to SNP molecular markers for high-throughput detection of southern rust resistant materials of maize, an identification method thereof, a method for detecting the SNP analytical markers, a primer set and a kit.

Description

Method for high-throughput detection of southern rust resistance genotyping of corn and kit thereof

Technical Field

The invention relates to molecular identification of southern rust resistance of corn, in particular to high-throughput detection of molecular markers for molecular identification of southern rust resistance of corn.

Background

Southern rust of corn is a devastating, air-borne disease of corn, caused primarily by stacks of Puccinia polysora Underw. Southern rust in maize occurs primarily in tropical and subtropical regions, and has occurred in temperate regions in recent years. When the disease outbreak occurs, the corn leaves are covered by orange spores of pathogenic bacteria, so that the leaves are quickly withered and die, great loss is caused to the corn production, and even the corn is harvested in severe cases. By adopting an advanced molecular breeding means, resistance resources in a corn resource library are fully utilized, and disease resistance breeding and disease resistance improvement are the most economic and effective way for controlling the southern rust of corn.

The research shows that a major gene cluster for resisting southern rust exists on the short arm of the maize No. 10 chromosome. The major gene cluster for resisting southern rust comprises a disease-resistant major gene RppP25 derived from an immune inbred line P25 for southern rust. The gene mapping result shows that the southern rust resistant gene RppP25 is located in the 40kb interval between the markers P091 and M271.

Therefore, there is a need to develop a kit and a method suitable for high-throughput detection of molecular markers associated with resistance to southern rust in maize, and capable of high-throughput detection of molecular markers associated with resistance to southern rust in maize.

Disclosure of Invention

According to the Single Nucleotide Polymorphism (SNP) information of a southern rust resistance major gene cluster site containing a corn southern rust resistance gene site RpP 25 in Chinese corn germplasm resources, the SNP suitable for high-throughput detection of the polymorphism of the corn southern rust resistance major gene cluster site is obtained as a molecular marker, and a marker primer for detecting the obtained SNP and a corresponding detection and typing method are designed, and can be used for molecular diagnosis of corn southern rust resistance and molecular marker-assisted genetic improvement.

In one aspect, the invention provides one or more SNP molecular markers at the position RppP25 of the southern rust disease resistance major gene of maize suitable for high-throughput detection of southern rust resistance in maize, selected from the following SNP markers listed in table 3: a003135, A003857, A003858, A003859, A003864, A003865, A003866 and A003869, wherein the corresponding position of A003135 is 3,020,570, the allelic site 1 is T and the allelic site 2 is C, subject to the maize reference genome B73V3 version chromosome 10; the position corresponding to A003857 is 2,437,710, the allelic site 1 is A, and the allelic site 2 is G; a003858 corresponds to position 2,450,914, allele 1 is C, and allele 2 is T; the position corresponding to A003859 is 2,469,304, the allelic site 1 is A, and the allelic site 2 is C; a003864 corresponds to position 4,002,339, allele 1 is a, and allele 2 is G; the position corresponding to A003865 is 4,652,445, the allelic site 1 is T, and the allelic site 2 is C; the position corresponding to A003866 is 4,668,571, the allelic site 1 is A, and the allelic site 2 is G; a003869 corresponds to position 4,696,425, allele 1 is G, and allele 2 is T.

There are three types of allelic typing at SNP sites: allele 1 homozygous, allele 2 homozygous, and allele 1 and allele 2 heterozygous.

In another aspect, the present invention provides a method for early high-throughput detection of corn cob color, the method comprising identifying at least one of the following SNP markers selected from the group consisting of those set forth in table 3, from a nucleic acid sample obtained from a corn variety to be detected: a003135, A003857, A003858, A003859, A003864, A003865, A003866 and A003869.

The person skilled in the art can select an identification method based on the specific SNP site of a known sequence, which may be, for example: direct sequencing, allele-specific probe hybridization, allele-specific primer extension, allele-specific amplification. Specific identification reagents may be selected from, for example, allele-specific oligonucleotides, allele-specific primers, DNA probes, and RNA probes.

Preferably, the identification reagent of the present invention comprises an allele-specific primer. The specific primer may be a primer set selected from the group consisting of:

(1) specific primer 1: FAM-GAAGGTGACCAAGTTCATGCT-GAGGACGAGGACGACGCG (SEQ ID NO:1), specific primer 2: HEX-GAAGGTCGGAGTCAACGGATT-GGAGGACGAGGACGACGCA (SEQ ID NO:2), universal primer: TGCACATGTCAGCCTCAAGACC (SEQ ID NO: 3);

(2) specific primer 1: FAM-GAAGGTGACCAAGTTCATGCT-GGGCGTCAAGTGCGATCTCT (SEQ ID NO:4), specific primer 2: HEX-GAAGGTCGGAGTCAACGGATT-GGCGTCAAGTGCGATCTCC (SEQ ID NO:5), universal primer: TGCTCCTCACAGGATACATGAAGAAT (SEQ ID NO: 6);

(3) specific primer 1: FAM-GAAGGTGACCAAGTTCATGCT-GACTAATAGCTGCATACCACTCAG (SEQ ID NO:7), specific primer 2: HEX-GAAGGTCGGAGTCAACGGATT-TAGACTAATAGCTGCATACCACTCAA (SEQ ID NO:8), universal primer: GAGACCCTATTACTCGTATTGTTGGCA (SEQ ID NO: 9);

(4) specific primer 1: FAM-GAAGGTGACCAAGTTCATGCT-GATGACAGCAGCTAGCAGTGAAAA (SEQ ID NO:10), specific primer 2: HEX-GAAGGTCGGAGTCAACGGATT-ATGACAGCAGCTAGCAGTGAAAG (SEQ ID NO:11), universal primer: CAGAGCTAAGTGAGACAGTGAGAGT (SEQ ID NO: 12);

(5) specific primer 1: FAM-GAAGGTGACCAAGTTCATGCT-ACAGTGATATCTGCAGAAGCTATGT (SEQ ID NO:13), specific primer 2: HEX-GAAGGTCGGAGTCAACGGATT-CAGTGATATCTGCAGAAGCTATGC (SEQ ID NO:14), universal primer: TTTTGTGGTCCTCACCTTCTTTCTCTT (SEQ ID NO: 15);

(6) specific primer 1: FAM-GAAGGTGACCAAGTTCATGCT-CAATGGGGAAAGCTGGATCAAC (SEQ ID NO:16), specific primer 2: HEX-GAAGGTCGGAGTCAACGGATT-GCAATGGGGAAAGCTGGATCAAT (SEQ ID NO:17), universal primer: GTTTTGCACGGCGCATTGTGAAGA (SEQ ID NO: 18);

(7) specific primer 1: FAM-GAAGGTGACCAAGTTCATGCT-CCGGGAGACAAGCAACGACA (SEQ ID NO:19), specific primer 2: HEX-GAAGGTCGGAGTCAACGGATT-CGGGAGACAAGCAACGACG (SEQ ID NO:20), universal primer: TCGCTAGAGCCTCTGGACTACAT (SEQ ID NO: 21); and

(8) specific primer 1: FAM-GAAGGTGACCAAGTTCATGCT-GGTTGGGACACACCAGTTAGG (SEQ ID NO:22), specific primer 2: HEX-GAAGGTCGGAGTCAACGGATT-GGGTTGGGACACACCAGTTAGT (SEQ ID NO:23), universal primer: TGTTTCGCCACTCTGGCATCCTAT (SEQ ID NO: 24).

In addition, on the premise that a specific SNP marker at the site of the southern rust disease resistance major gene RppP25(RppP25 gene) of corn is known, a primer for amplifying the sequence is designed by adopting a conventional design rule of the primer, which is a general routine skill for those skilled in the art, and the detection method of the invention is not limited to specific primer sets. The skilled worker is able to follow the SNP markers listed in Table 3: a003135, A003857, A003858, A003859, A003864, A003865, A003866 and A003869 can be designed into different primer pairs, but all are based on the premise that the SNP markers are provided by the invention, and therefore, the invention is in the protection scope.

In another aspect, the present invention provides SNP markers selected from the following in table 3: the application of one or more of A003135, A003857, A003858, A003859, A003864, A003865, A003866 and A003869 in high-throughput detection of southern rust resistance of corn.

In another aspect, the present invention provides a method for screening SNP molecular markers associated with the site of a maize southern rust resistance major gene RppP25(RppP25 gene) and the resistance of maize southern rust, the method comprising the steps of (1) selecting SNPs near the segment of the maize southern rust resistance major gene RppP25(RppP25 gene), (2) designing KASP primer sets corresponding to each SNP based on KASP Master Mix kit of L GC company according to the selected SNPs, (3) performing PCR amplification using the KASP primer sets designed in step (2) using maize genomic DNA as a template, (4) genotyping the SNP sites amplified by PCR for SNP markers that are successful in genotyping, and (5) comparing the successful SNP markers in genotyping with a statistically significant number of samples of known maize southern rust resistance phenotype, performing T-TEST calculation, and selecting a SNP molecular marker that is significantly different from P <0.05 as a marker associated with the resistance of maize southern rust.

Preferably, the SNP molecular markers related to the resistance of the southern corn rust are one or more of the following SNP markers selected from the sites of a southern corn rust resistance major gene RppP25(RppP25 gene) in Table 3: a003135, A003857, A003858, A003859, A003864, A003865, A003866 and A003869.

In another aspect, the present invention provides an allele-specific primer set for identifying a SNP marker selected from table 3: a003135, A003857, A003858, A003859, A003864, A003865, A003866 and A003869.

The allele-specific primer set may be a KASP primer set designed according to the KASP Master Mix kit of L GC, and may be, for example, a primer set selected from the group consisting of:

In another aspect, the present invention provides a kit for identifying the following SNP markers selected from table 3: a003135, A003857, A003858, A003859, A003864, A003865, A003866 and A003869. The kit comprises a reagent selected from the group consisting of: allele-specific oligonucleotides, allele-specific primers, DNA probes, and RNA probes.

Preferably, the kit comprises an allele-specific primer set. Further preferably, the allele-specific primer set is a primer set selected from the group consisting of:

Those skilled in the art can design other allele-specific oligonucleotides, allele-specific primers, DNA probes, and RNA probes suitable for the detection of the SNP markers of the present invention according to the specific SNP markers, as long as the allele-specific oligonucleotides, DNA probes, and RNA probes can hybridize allele-specifically to the SNP markers.

Preferably, the reagent is immobilized on a substrate. Further preferably, the reagents are arranged on an array.

In another aspect, the present invention provides the use of reagents for identifying one or more of the following SNP markers in table 3 for early identification of corn cob color: a003135, A003857, A003858, A003859, A003864, A003865, A003866 and A003869.

Preferably, the reagents for identifying one or more of the following SNP markers in table 3 are selected from: allele-specific oligonucleotides, allele-specific primers, DNA probes, and RNA probes.

Preferably, the allele-specific primer is a primer set selected from the group consisting of:

Unless defined otherwise, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

“SNP”That is, "single nucleotide polymorphism" refers to a polymorphism of a DNA sequence caused by a variation of a single nucleotide in a genome.

"alleles"Refers to a pair of genes located at a given locus on a pair of homologous chromosomes. SNP alleles are the two nucleotides that characterize the SNP.

"allele-specific oligonucleotides"Refers to an oligonucleotide that hybridizes to an allelic target nucleotide that comprises a single nucleotide variation.

"allele-specific hybridization"Refers to the specific base pairing of an allele-specific oligonucleotide with an allele target nucleotide that contains a single nucleotide variation when the oligonucleotide is hybridized to its target nucleic acid.

Allele-specific primers "Refers to specific primers that can be used to amplify a target nucleotide that contains a single nucleotide variation allele.

The SNP molecular marker identified by the invention, the primer for detecting the SNP molecular marker and the corresponding detection and typing method have the characteristics of high flux, low cost and high accuracy, provide a new technical means for the molecular marker method to assist in selecting corn progeny resistant to different corn southern rust diseases, and can be used for molecular identification of the corn southern rust diseases.

Drawings

FIG. 1 shows the distribution of the dot clusters of each genotype successfully typed in the KASP method.

FIG. 2 shows the physical linkage of 8 SNP markers identified according to the invention on maize chromosome 10 to the maize southern rust disease resistance major gene RppP25 (B73 reference genome V3 version).

Detailed Description

The technical solution of the present invention is further described below with reference to the following embodiments and the accompanying drawings. These examples are given solely for the purpose of illustration and are not intended to limit the scope of the invention.

The experimental procedures for which specific conditions are not noted in the following examples are generally performed according to conventional conditions, such as those described in molecular cloning by Sambrook et al, A laboratory Manual (New York: Cold Spring Harbor L laboratory Press, 2001), or according to conditions recommended by the manufacturer of the apparatus or reagents.

Example 1 selection of SNP molecular markers for the site of the southern Rust resistance major Gene RppP25(RppP25 Gene) in maize

The RppP25 gene is located in the region 3,130,061 to 3,133,063 of maize chromosome 10 (refer to the position of maize genome B73V3 version), from which maize 56K SNP chips are labeled, 8 SNP sites are selected for marker development in the intervals 2,100,671 and 4,992,947, see table 1.

TABLE 1 SNP site information linked to the RppP25 gene (chromosomal location position maize reference genome B73V3 version position)

Site name	Chromosome number	ChromosomePosition (V3)	Allelic site 1	Allelic site 2
					SYN17244	10	3,020,570	T	C
SYN17617	10	2,437,710	A	G
					PZE-110002424	10	2,450,914	C	T
PZE-110002524	10	2,469,304	A	G
					PZE-110004402	10	4,002,339	A	G
SYN4482	10	4,652,445	T	C
					SYN4502	10	4,668,571	A	G
SYN4481	10	4,696,425	G	T

According to a commercially available KASP Master Mix detection kit of L GC company, Primer design is performed by using Primer3 Primer design software, the design result is shown in Table 2, 8 KASP marker Primer sets are totally designed, each marker Primer set comprises a specific Primer 1, a specific Primer 2 and a universal Primer, wherein the 5' ends of the specific Primer 1 and the specific Primer 2 are respectively connected with an Allle-1 tail and an Allle-2 tail, and two tailing sequences of the Allle-1 tail and the Allle-2 tail are respectively marked with FAM and HEX fluorescent groups, and the specific sequences are shown as follows:

Allele-1 tail：GAAGGTGACCAAGTTCATGCT

Allele-2 tail：GAAGGTCGGAGTCAACGGATT

TABLE 2 marker primer set design

Example 2 high throughput detection of SNP molecular marker of maize southern rust disease-resistant major gene RppP25 locus

The 8 KASP primer sets designed in example 1 were used, and the SNP sites were analyzed after PCR amplification using corn genomic DNA as a template.

1. Extracting sample genome DNA:

extracting the genome DNA of the corn sample to be tested according to a plant genome DNA extraction kit (catalog number: DP-305) provided by TIANGEN company and a kit instruction, and specifically comprising the following steps:

(1) grinding 100mg of fresh or 20 ℃ frozen sample material in liquid nitrogen;

(2) rapidly transferring the ground powder into a centrifuge tube pre-filled with 700 mu l of buffer solution GP1 preheated at 65 ℃, quickly reversing and uniformly mixing the buffer solution GP1 containing mercaptoethanol with the final concentration of 0.1 wt%, placing the centrifuge tube in a water bath at 65 ℃ for 20 minutes, and reversing the centrifuge tube in the water bath process to mix the samples for a plurality of times;

(3) adding 700 μ l chloroform, mixing well, centrifuging at 12,000rpm for 5 min; note: if plant tissue rich in starch or polysaccharide is extracted, before step 3, performing equal volume extraction with phenol and chloroform (1: 1);

(4) carefully transferring the upper-layer water phase obtained in the previous step into a new centrifugal tube, adding 700 mu l of buffer solution GP2, and fully and uniformly mixing;

(5) transferring the mixed liquid into an adsorption column CB3, centrifuging at 12,000rpm for 30s, and discarding the waste liquid;

(6) adding 500ul of GD (anhydrous ethanol is added before use) buffer solution into the adsorption column CB3, centrifuging at 12,000rpm for 30s, and discarding waste liquid;

(7) adding 600ul of rinsing liquid PW (checking whether absolute ethyl alcohol is added before use) into the adsorption column CB3, centrifuging at 12,000rpm for 30s, and pouring off waste liquid;

(8) repeating the step (7);

(9) the adsorption column CB3 was put back into the collection tube, centrifuged at 12000rpm for 2min, and the waste liquid was discarded. Placing the adsorption column CB3 at room temperature for a plurality of minutes to thoroughly dry the residual rinsing liquid in the adsorption material;

(10) placing adsorption column CB3 into a clean centrifuge tube, suspending and dropwise adding appropriate amount of 50-200 μ l elution buffer TE (pH value is 7.0-8.5) into the middle position of the adsorption membrane, and standing at room temperature for 2-5 min. Centrifuging at 12000rpm for 2min to collect DNA solution; and

(11) and detecting the content and purity of the DNA by using an ultraviolet spectrophotometer, wherein the result shows that the A260/280 of the detected sample is between 1.8 and 2.0, and the purity of the extracted DNA is high.

PCR amplification:

taking the genome DNA prepared in the step 1 as a template, and performing DNA dilution and plate rotation on a TECAN liquid automatic workstation; the whole PCR process is completed on a Douglas scientific Array Tape platform; adding the DNA and the PCR mix to a 384 PCR reaction Array Tape on a Nexar workstation; completing PCR reaction in Soellex water bath; detecting the fluorescence intensity on Araya, and reading data; completing program setting and data analysis in an intelliics management system; the nucleotide sequences of the primers are shown in Table 2.

The PCR reaction system is 3 mu l, and the components are as follows:

the PCR amplification reaction conditions are as follows:

pre-denaturation at 94 ℃ for 15 min;

the first step of amplification reaction, pre-denaturation at 94 ℃ for 20 seconds, pre-denaturation at 65-55 ℃ for 60 seconds, and 10 cycles, wherein each cycle is reduced by 1 ℃;

the second amplification step, pre-denaturation at 94 ℃ for 20 seconds, pre-denaturation at 55 ℃ for 60 seconds, and 35 cycles.

The fluorescent signal was read on an Araya fluorescent reader. Data reading was performed using the software of intellimics from Douglas scenfic corporation. Results analysis was performed using the software of intelliics from Douglas scenfic.

3. Genotyping

There are three types of allelic typing at SNP sites: allele 1 homozygous, allele 2 homozygous, and allele 1 and allele 2 heterozygous. The results obtained from the PCR amplification reaction were analyzed as described in 2 above. Referring to FIG. 1, SNP locus allele 1 homozygous (cluster 1), SNP locus allele 2 homozygous (cluster 2), allele 1 and allele 2 heterozygous (cluster 3) constitute three groups with definite typing respectively, the negative control (cluster 4) is not significantly amplified, such a genotype point cluster profile corresponds to a marker with successful genotyping, and 8 markers are markers with successful genotyping (see Table 3).

TABLE 3 typing results

Marker name	Site name	Typing results
			A003135	SYN17244	Success of the method
A003857	SYN17617	Success of the method
			A003858	PZE-110002424	Success of the method
A003859	PZE-110002524	Success of the method
			A003864	PZE-110004402	Success of the method
A003865	SYN4482	Success of the method
			A003866	SYN4502	Success of the method
A003869	SYN4481	Success of the method

4. Correlation of genotype with phenotype

Three allelic classifications (allele 1 homozygous, allele 2 homozygous, allele 1 and allele 2 heterozygous) of the above successfully typed 8 markers are given the numbers 2,0 and 1, respectively, according to Table 4.

TABLE 4 marker genotype digitization

Referring to table 5, the maize southern rust phenotype and genotype of 88 samples of known phenotypes were compared and marker results were T-TEST calculated between phenotype groups, with P <0.05 indicating significant levels of difference between the two groups, P values for high resistance & resistance/high susceptibility & disease and high resistance/high susceptibility phenotype and genotype were calculated, respectively, with markers with P values <0.05 being useful markers. Referring to table 6, the P values of the 8 markers shown in table 4 are all less than 0.05, and therefore all can be used to distinguish high resistance & disease/high susceptibility & disease and high resistance/high susceptibility in corn (see table 5, table 6 and fig. 2). FIG. 2 shows the physical linkage of 8 markers on chromosome 10 of maize that successfully correlate phenotype and genotype of southern rust in maize with the maize disease resistance major gene RppP25 (genomic position V3). The 8 markers were distributed within 1.6M on both sides of GRMZM2G060884 (FIG. 2).

TABLE 6 correlation of genotypes and southern corn rust phenotypes

TABLE 5 comparison of phenotypic and genotypic data

Note: "0", "1" and "2" are the results after digitization according to the genotype of the attached Table 1, "\" indicates no detection or failure and no typing results, and "HR", "R", "S" and "HS" indicate the high resistance, sensation and high susceptibility phenotypes of southern rust in maize, respectively.

Sequence listing

<110> Zhongyujin Mark (Beijing) Biotechnology Ltd

<120> method for high-throughput detection of corn southern rust resistance genotyping and kit thereof

<130>PM2089YJ66CN

<160>24

<170>PatentIn version 3.5

<210>1

<211>39

<212>DNA

<213> Artificial sequence

<400>1

gaaggtgacc aagttcatgc tgaggacgag gacgacgcg 39

<210>2

<211>40

<212>DNA

<213> Artificial sequence

<400>2

gaaggtcgga gtcaacggat tggaggacga ggacgacgca 40

<210>3

<211>22

<212>DNA

<213> Artificial sequence

<400>3

tgcacatgtc agcctcaaga cc 22

<210>4

<211>41

<212>DNA

<213> Artificial sequence

<400>4

gaaggtgacc aagttcatgc tgggcgtcaa gtgcgatctc t 41

<210>5

<211>40

<212>DNA

<213> Artificial sequence

<400>5

gaaggtcgga gtcaacggat tggcgtcaag tgcgatctcc 40

<210>6

<211>26

<212>DNA

<213> Artificial sequence

<400>6

tgctcctcac aggatacatg aagaat 26

<210>7

<211>45

<212>DNA

<213> Artificial sequence

<400>7

gaaggtgacc aagttcatgc tgactaatag ctgcatacca ctcag 45

<210>8

<211>47

<212>DNA

<213> Artificial sequence

<400>8

gaaggtcgga gtcaacggat ttagactaat agctgcatac cactcaa 47

<210>9

<211>27

<212>DNA

<213> Artificial sequence

<400>9

gagaccctat tactcgtatt gttggca 27

<210>10

<211>45

<212>DNA

<213> Artificial sequence

<400>10

gaaggtgacc aagttcatgc tgatgacagc agctagcagt gaaaa 45

<210>11

<211>44

<212>DNA

<213> Artificial sequence

<400>11

gaaggtcgga gtcaacggat tatgacagca gctagcagtg aaag 44

<210>12

<211>25

<212>DNA

<213> Artificial sequence

<400>12

cagagctaag tgagacagtg agagt 25

<210>13

<211>46

<212>DNA

<213> Artificial sequence

<400>13

gaaggtgacc aagttcatgc tacagtgata tctgcagaag ctatgt 46

<210>14

<211>45

<212>DNA

<213> Artificial sequence

<400>14

gaaggtcgga gtcaacggat tcagtgatat ctgcagaagc tatgc 45

<210>15

<211>27

<212>DNA

<213> Artificial sequence

<400>15

ttttgtggtc ctcaccttct ttctctt 27

<210>16

<211>43

<212>DNA

<213> Artificial sequence

<400>16

gaaggtgacc aagttcatgc tcaatgggga aagctggatc aac 43

<210>17

<211>44

<212>DNA

<213> Artificial sequence

<400>17

gaaggtcgga gtcaacggat tgcaatgggg aaagctggat caat 44

<210>18

<211>24

<212>DNA

<213> Artificial sequence

<400>18

gttttgcacg gcgcattgtg aaga 24

<210>19

<211>41

<212>DNA

<213> Artificial sequence

<400>19

gaaggtgacc aagttcatgc tccgggagac aagcaacgac a 41

<210>20

<211>40

<212>DNA

<213> Artificial sequence

<400>20

gaaggtcgga gtcaacggat tcgggagaca agcaacgacg 40

<210>21

<211>23

<212>DNA

<213> Artificial sequence

<400>21

tcgctagagc ctctggacta cat 23

<210>22

<211>42

<212>DNA

<213> Artificial sequence

<400>22

gaaggtgacc aagttcatgc tggttgggac acaccagtta gg 42

<210>23

<211>43

<212>DNA

<213> Artificial sequence

<400>23

gaaggtcgga gtcaacggat tgggttggga cacaccagtt agt 43

<210>24

<211>24

<212>DNA

<213> Artificial sequence

<400>24

tgtttcgcca ctctggcatc ctat 24

Claims

1. The application of the reagent for identifying the SNP molecular markers in the site typing of the southern rust disease resistance major gene RpP 25 of the corn so as to detect the southern rust disease resistance of the corn in high throughput,

the SNP molecular marker is A003135, the position corresponding to the A003135 is 3,020,570, the allelic site 1 is T, and the allelic site 2 is C, based on chromosome 10 of maize reference genome B73V 3.

2. The use according to claim 1, for high throughput detection of southern rust resistance in maize comprising identifying said SNP molecular markers in a nucleic acid sample obtained from a maize variety to be detected, said method being selected from the group consisting of: direct sequencing, allele-specific probe hybridization, allele-specific primer extension, allele-specific amplification.

3. Use according to claim 2, characterized in that the allele-specific primer extension uses the following primer sets:

specific primer 1: FAM-GAAGGTGACCAAGTTCATGCT-GAGGACGAGGACGACGCG (SEQ ID NO:1),

specific primers 2: HEX-GAAGGTCGGAGTCAACGGATT-GGAGGACGAGGACGACGCA (SEQ ID NO:2), and

the general primer is as follows: TGCACATGTCAGCCTCAAGACC (SEQ ID NO: 3).

4. Use of a reagent for identifying SNP molecular markers for site typing of a southern rust resistance major gene RppP25 of maize to detect southern rust resistance of maize at high throughput,

5. The use according to claim 4, said agent being a primer set of:

specific primer 1: FAM-GAAGGTGACCAAGTTCATGCT-GAGGACGAGGACGACGCG (SEQ ID NO:1),

the general primer is as follows: TGCACATGTCAGCCTCAAGACC (SEQ ID NO: 3).

6. The use according to claim 5, wherein the reagents of the kit are immobilized on a substrate or are arranged on an array.