KR101236296B1 - Production of Seonghwan-commercial chicken No. 1 using Korean native chicken and exotic chicken and distinction method of the product - Google Patents

Abstract

The present invention is a new breed of sexual exchange room produced by breeding a black Cornish male and a Rhode Island Red female to a Reddish brown Korean native chicken. No. 1 and a method of determining the same.
Compared to the pure chicken, the sex test system No. 1 of the present invention not only improves the weight, feed requirement, and the number of laying eggs, but also has a meat taste and quality suitable for national diet.
In particular, it contains non-protein nitrogen compound (NPN) which affects flavor, high collagen and amino acid content, and high content of unsaturated fatty acid which lowers the content of oleic acid and fatty cholesterol in fatty acids.

Description

Production of new varieties Seonghwansilyong system No. 1 using native chickens and alien species and its discrimination method {Production of Seonghwan-commercial chicken No. 1 using Korean native chicken and exotic chicken and distinction method of the product}

The present invention is produced by breeding a black Cornish male and a Rhode Island Red female to a Reddish brown Korean native chicken. Call and how to determine it.

Progeny due to cross-breeding or cross-breeding tend to have superior traits of livestock such as growth rate, survival rate, and spawning water compared to their parental breed or lineage. This is called hybrid stress. When breeding using hybrid accents, broiler chickens are used as the parental system, and the combined breeding breeder is used as the parental system because it has good spawning capacity as well as spawning capacity.

On the other hand, after the Japanese colonial rule, livestock improvement was led by Japanese people, and the replacement of indigenous seeds began. In addition, as the growth-oriented policies of the industrialization era of the 1970s and 1980s accelerated, our native chickens almost disappeared. As we enter the 1990s, perfumes for our taste have been revived, but various similar breeds and hybrid chickens of unknown origin have been sold as some native chickens, leading to consumer distrust.

Therefore, there is a need for research on a specific breed of chicken capable of producing good chicken meat with excellent productivity.

Accordingly, the present inventors have conducted research and efforts to provide chicken having excellent productivity while satisfying meat quality and palatability, and as a result, new chickens obtained through three-way crosses of specific native chicken, Rhode Island red, and black Cornish species have excellent quality. In the meantime, the present invention has been completed by discovering the specific genetic properties.

Therefore, an object of the present invention is to provide a new breed of sexual intercourse practical system No. 1 and a method for determining the same of excellent quality obtained through three-way crossing.

The present invention,

Black Cornish male,

Reddish brown Korean native chicken (Red Island Red females) to breed the improved breeding chickens (F1) produced by crossing the breed is characterized by a new breed of sexual exchange system No. 1.

Further, according to the present invention,

(a) extracting genomic DNA from the chicken breed to be analyzed;

(b) using the extracted genomic DNA as a template and performing PCR using primer pairs of SEQ ID NOs: 3 and 4;

(c) confirming the insertion of SEQ ID NOs: 1 and 2 in the PCR amplification product of step (b);

(d) using the extracted genomic DNA as a template and performing PCR using primer pairs of SEQ ID NOs: 5 and 6; And

(e) performing restriction fragment length formation analysis on the PCR amplification product of step (d) using Alu I restriction enzyme

Variety identification method of the new breed Seonghwansilyong system No. 1 comprising another feature.

Further, according to the present invention,

Another feature is a kit for identifying a variety of new varieties of transgenic lines 1 comprising primer pairs of SEQ ID NOs: 3 and 4, primer pairs of SEQ ID NOs: 5 and 6, and Alu I restriction enzyme.

In general, pure Korean chicken has better taste and quality than foreign breeds, but it is economically disadvantageous to use as a broiler or laying hen because of its light weight and low number of eggs laid annually. Compared to the pure chicken, the sex test system No. 1 of the present invention not only improves the weight, feed requirement, and the number of laying eggs, but also has a meat taste and quality suitable for national diet.

Particularly, the chicken of STU-1 of the present invention contains a non-protein nitrogen compound (NPN) which affects flavor, has a high content of collagen and amino acids, and has a high content of unsaturated fatty acids which lowers the content of oleic acid and fatty cholesterol in fatty acids. Appears high.

By developing a marker that can identify specific genotypes, it is possible to prevent the sale of similar products that occur during the distribution process of sexually transmitted system No. 1 and general broilers.

Figure 1 is a schematic diagram illustrating the production process of the sex room system No. 1 of the present invention.
Figure 2 is a photograph showing the external appearance of the transgenic room system No. 1 of the present invention.
Figure 3 is a photograph comparing the color of the shank of the sex room system 1 and general broiler of the present invention.
Figure 4 shows a recessive white, normal sequence insertion occurs in Intron 4 of the tyrosinase gene.
5 is an electrophoretic photograph of a PCR product confirming the insertion of a recessive white, normal sequence in a tyrosinase gene.
Figure 6 illustrates the difference in restriction enzyme cleavage indicated by monobasic polymorphism present at the 243 th locus of the D-Loop region of mitochondrial DNA.
Figure 7 is an electrophoresis picture confirming the results of the restriction enzyme ( Alu I) treatment of PCR amplification products.

The present invention is a new breed of sexual exchange room produced by breeding a black Cornish male and a Rhode Island Red female to a Reddish brown Korean native chicken. It is characterized by one.

First, the reddish brown traditional chicken is uniformized through the classification of the chickens that have been bred in Korea since then and the restoration project of Example 1, and the reddish brown based system of the present invention among the black, reddish brown, tan, gray, and white systems. Use Its features include strong reversal, strong properties, and good hatching, making it suitable for motherhood. Appearance of the traditional chicken is the body of a slender oblong body, the crest is a single crest red, and the tube is upright about five. Shanks have no feathers, black or dark green, 4 toes, males with large claws. In addition, the traditional chicken is similar to the white leghorn (White leghorn) species, light body and strong wings are rich in carrying power. It is also a short tube, the face is red, the beard is long and red, and the horn is red or milky white. The production capacity of traditional chicken is 270 days old and weighs about 1.7 ~ 2.0 kg.

The appearance selection criteria for each line in the restoration process of the conventional chicken is as shown in Table 1 below.

Part Name Features system maroon partridge black White Type Rectangle and lower toward posterior sphere Comb Scattered crests, erected up to about 5 tubes, medium, thin scarlet scarlet peony scarlet Head Deep and wide in medium size maroon partridge black White Beak Hard and slightly bent Dark brown partridge black partridge Eye Bright and transparent in medium size brown brown Dark brown brown Face Big and without feather scarlet Red peony Red Ear Small and deep scarlet Red black Red Earlobe It is oval to medium size Cerise or white Cerise or white Red or white Cerise or white Meat mustache
(Wattle) Thin and medium in size, hangs under the chin scarlet scarlet Black or red scarlet Neck Straight upright and bent a bit forward maroon partridge black White Feather
(Neck hackle) Many, long, covering the front of the back maroon partridge black White Back Is inclined backward in a straight line maroon partridge black White Breast Round, slightly protruding, forwardly developed Reddish brown or black partridge black White Adbomen Have an elliptical shape Reddish brown or black partridge black White Wing It is a little long and the carrying power is strong. Reddish brown or black Tan or black black White Tail Tail feathers are very good and long Cancer: Green black
Number: Maroon Cancer: Green black
Number: tan black White Leg Have feathers Brown partridge black White Shank Thin, bone solid, without feathers Tan or grey-black Tan or grey-black Gray black or black Tan or grey-black Toe Well developed, 4 toes, no feathers Tan or grey-black Tan or grey-black black Tan or grey-black Daughter-in-law
(Spur) Male daughter's toenails are large Tan or grey-black Tan or grey-black Black or gray black Tan or grey-black

Rhode island reds ( Gallus gallus ) is an egg breeding species with excellent growth and spawning ability. It has single or rose crests, legs and skin are yellow, feathers and egg shells are reddish brown. It is gentle in nature, hatched and meaty, and has good meat and meat quality. Rhode Island Red species weighed between 1.3 kg, 270 days of age 1.8 kg, and 270 days of egg weight, ranging from 55 to 58 g.

Cornish species (Cornish, Gallus gallus ) has a high growth rate and is used for meat use only. It has a small, hard pea, and wings are short but very muscular. Shoulders are wide and both sides of the body are round. The thighs are round and muscular. Corniche's 150-day-old body weight is 3.0kg, 270-day body weight is 3.7kg, and 270-day-old egg weight is about 55-60g.

 For the efficient management of agricultural genetic resources, the Minister of Agriculture, Forestry, Fisheries and Food Affairs regarding Agricultural Genetic Resources shall enact the Act on the Conservation, Management and Utilization of Agricultural Genetic Resources (Enforcement Act 2009. 11.28) (Law No. 9717, May 27, 2009, Other Act Amendment). Article 18 was entrusted to the head of the Rural Development Administration. Act on the Sale, Export of Overseas Genetic Resources and Designation of Management Institutions (Rural Development Administration Notification No. 2009-31) Article 2 Since it must be submitted to the Director, National Academy of Animal Science, it must be approved by the Director of Rural Development Administration for the sale of these varieties.

The tyrosinase gene of STD-1 produced by the three-way crossing is characterized by including both the recessive white nucleotide sequence of SEQ ID NO: 1 and the normal nucleotide sequence of SEQ ID NO: 2.

It includes both the 180 bp recessive white nucleotide sequence (SEQ ID NO: 1) and the 13 bp normal nucleotide sequence (SEQ ID NO: 2) that occur in intron 4 of the tyrosinase gene associated with recessive white.

In addition, the MTS-1 is 243th from the starting base of the D-Loop region of mitochondrial DNA (NCBI gi: 28629852, http://www.ncbi.nlm.nih.gov/nuccore/28629852) that is inherited only to the maternal lineage. It is characterized by being represented by T at the left.

The present invention, based on the genetic properties of the sex room system No. 1,

(a) extracting genomic DNA from the chicken breed to be analyzed;

(b) using the extracted genomic DNA as a template and performing PCR using primer pairs of SEQ ID NOs: 3 and 4;

(c) confirming the insertion of SEQ ID NOs: 1 and 2 in the PCR amplification product of step (b);

(d) using the extracted genomic DNA as a template and performing PCR using primer pairs of SEQ ID NOs: 5 and 6; And

(e) performing restriction fragment length formation analysis on the PCR amplification product of step (d) using Alu I restriction enzyme

Variety identification method of the new breed Seonghwansilyong system No. 1 comprising another feature.

By the method of identification of cultivars, D- of mitochondrial DNA containing both 180 bp recessive white nucleotide sequence (SEQ ID NO: 1) and 13 bp normal nucleotide sequence (SEQ ID NO: 2) generated in intron 4 of the tyrosinase gene In the 243 th locus from the loop region starting base, it can be determined by the transgenic system 1 of the present invention.

Also,

Another feature is a kit for identifying a variety of new varieties of transgenic lines 1 comprising primer pairs of SEQ ID NOs: 3 and 4, primer pairs of SEQ ID NOs: 5 and 6, and Alu I restriction enzyme.

Hereinafter, the present invention will be described in more detail based on the following examples, but the present invention is not limited to the examples.

Example 1 Restoration of Reddish Brown Chicken

In recognition of the importance of our unique seeds, the present inventors began collecting native chicken seeds that have been maintained throughout the country, and hatched and collected 10,353 eggs, reddish brown, yellowish brown, and black with the appearance standards recorded in the literature. The base group was formed by classifying into 5 types which have the characteristics of system, white system and gray-brown system. Based on this seed, it promoted the high-quality meat commercialization of traditional chickens hosted by the Korean Poultry Association.

In pursuit of the high-quality meat-based commercialization of traditional chickens, individuals with relatively superior or fixed phenotypes were selected and formed into basic groups by the appearance and ability test. This process was repeated 15 generations to establish a specific strain of fixed purity. In order to maintain the generational generation, approximately 30% were selected by testing around 800 hens and 200 cocks per line, and about 7 mothers per father were selected. Considered sent off. The selection was based on the results of the individual survey on the main traits such as weight, age, spawning, egg weight, etc., based on the individual's test scores, and the appearance selection was based on the breeding season and the offspring when the hatching was selected. Selection was made based on the characteristics of 1.

The capacity test for capacity improvement and selection was carried out for 270 days to maintain one generation every year. The main traits were examined for each hatch, breeder and spawning group by individual, and the test results were generated by the net management computer program. Passages were maintained through lineage management, selection and drop-off through the data collected and processed by individual households and individuals.

The characteristics of the total number of 3,335 breeding season and 1,971 spawning season were examined as shown in Table 2 of the selected conventional chicken.

Breeding period Spawning season cancer Number synthesis cancer Number synthesis maroon 1,083 191 1,274 607 113 720 partridge 1,094 207 1,301 606 115 721 black 655 105 760 445 85 530

The fertilization rate, hatching rate and survival rate of the selected native chickens were examined and shown in Table 3 below. Fertilization rate refers to the ratio of fertilized eggs to the number of eggs, hatching rate refers to the ratio of the number of generations to fertilized eggs, and survival rate is rearing (0-8 weeks), breeding period (9-21 weeks), spawning period (22 39 weeks) The ratio of last day sorghum to first day sorghum was shown.

Fertilization rate Hatching rate Survival rate Carnivorous Breeder Spawn maroon 97.3 93.3 93.6 96.9 97.3 partridge 96.5 92.1 94.5 97.3 98.4 black 94.7 90.1 92.8 98.0 97.6

Body weight and shin length (length from tibial top to bottom at 8 weeks of age) at 8, 22, and 38 weeks of age were measured and shown in Table 4 below.

Weight (g) Shank length (mm) 8 weeks 22 Weeks 38 Weeks cancer Number maroon 644 ± 74 1,547 ± 171 1,764 ± 227 81.2 ± 3.6 91.4 ± 3.3 partridge 612 ± 66 1,488 ± 167 1,699 ± 239 80.5 ± 4.3 91.2 ± 4.6 black 665 ± 79 1,583 ± 202 1,801 ± 272 81.5 ± 4.2 91.8 ± 5.4

In addition, the number of egg spawning and egg weight (average of individual measurements at the time of first spawning and 38 weeks of age) between the days of the first day of each individual spawning, from the date of spawning to the end date was measured and the results are shown in Table 5 below.

Estimated age (days) Spawning water () Egg weight (g) First spawn 38 weeks old maroon 150.3 ± 13.1 82.8 ± 13.2 35.6 ± 3.7 51.7 ± 3.6 partridge 144.9 ± 11.7 87.6 ± 14.3 34.1 ± 3.4 50.6 ± 3.3 black 148.5 ± 14.2 80.2 ± 13.9 35.0 ± 4.0 51.2 ± 3.3

Example 2 Genetic Analysis of Native Chicken, Black Cornish and Rhode Island Red Species Using Supersatellites

Five milliliters of blood from each of the three chickens (Red Brown, Yellow Brown, Black) native chicken, Cornish species and Rhode Island Red held by the Institute of Animal Science and Technology were collected, and then phenol, chloroform and isoamyl alcohol were used. DNA was extracted and DNA amount was measured by UV spectrophotometer.

On the other hand, to prepare a genetic map of chickens to prepare a pair of primers in the microsatellite locus developed by the international joint research in Table 6 to use for population analysis. For PCR reactions, 1 × reaction buffer (50 mM KCl, 10 mM Tris-Cl, pH 8.2), 1.5 mM MgCl ₂ 0.01% triton X-100; Sigma, 50 ng genomic DNA, 50 μM dNTP (dATP is 5 μM), a-32p-dATP (5 nCi), 5 pmol primer, 0.5 unit Taq DNA polymerase was added and the final volume was adjusted to 10 μl.

PCR was repeated 30 times for 5 minutes at 95 ° C., 1 minute at 94 ° C., 1 minute at the annealing temperature in Table 6, and 2 minutes at 72 ° C., and reacted at 72 ° C. for 7 minutes to obtain a PCR product. PCR products were electrophoresed on polyacrylamide sequencing gels, dried and the size of the amplified products was observed. In order to determine the size of the band, M13 phage DNA was subjected to sequencing reaction, followed by electrophoresis on the same gel, and the sizes thereof were compared, and the results are shown in Table 6 below.

Super satellites order PCR product Primer sequence Annealing Temperature (℃) ADL 019 (AC) ₁₀ AT (AC) ₂ 104 bp TGCTGCCTAGACCAGTTCAA 50 TCTGCTGGGATTATGTGTCA ADL 134 (CA) ₁₇ 123 bp TTCCATAATCCATCAATCAG 48 TTTTCCTCTCCCTCCATTTT ADL 111 (TG) ₁₅ (T ₄ G) ₅ T ₇ 128 bp CCTTCCTGACCTTCCACTTC 49 CCACAAAAATACCCACCATC ADL 109 (AC) ₁₃ 216 bp ATCTCCATAACTTCTGCTGC 46 AAAAATAAAATATCTCCCAG ADL 136 (TG) ₁₀ TC (TG) ₁₀ 145 bp TGTCAAGCCCATCGTATCAC 52 CCACCTCCTTCTCCTGTTCA ADL 102 (CA) ₁₄ 122 bp TTCCACCTTTCTTTTTTATT 50 GCTCCACTCCCTTCTAACCC

Table 7 shows the number of alleles in the polymorphism analysis using the supersatellite.

Super satellites Traditional chicken Black cornish Rhode Island Red maroon partridge black ADL 019 5 2 5 4 3 ADL 134 One One 4 One 3 ADL 111 4 5 5 3 2 ADL 109 2 3 3 3 2 ADL 136 5 4 4 5 2 ADL 102 4 5 6 6 3

In addition, the heterozygosity value was calculated through genotype frequency to confirm the degree of genetic variation, and the value calculated using the frequency of each allele under the assumption of Hardy-Weinberg (HW) equilibrium of the population. In order to confirm the agreement with the measured value, the x ² test proposed by Barker et al. (1986) was performed as in Equation 1 below.

[Equation 1]

n: total population

H: 1-∑Pi ² (Theoretical heterozygosity)

h: frequency of observed heterozygous individuals

Pi: frequency of allele i

The results are shown in Table 8 below.

Super satellites Traditional chicken Black cornish Rhode Island Red maroon partridge black ADL 019 Measures 0.80 0.00 0.60 0.80 0.80 Calculated value 0.72 0.48 0.78 0.70 0.48 ADL 134 Measures 0.00 0.00 0.40 0.00 0.20 Calculated value 0.00 0.00 0.48 0.00 0.18 ADL 111 Measures 0.80 0.40 0.60 0.00 0.20 Calculated value 0.61 0.76 0.78 0.32 0.18 ADL 109 Measures 0.40 0.60 0.80 0.20 0.40 Calculated value 0.32 0.66 0.62 0.42 0.32 ADL 136 Measures 0.60 0.00 0.20 0.20 0.00 Calculated value 0.72 0.64 0.58 0.74 0.00 ADL 102 Measures 0.60 0.40 0.80 1.00 0.60 Calculated value 0.76 0.76 0.80 0.78 0.62

The genetic characteristics of the population according to the heterozygosity value, the native chickens show a higher heterozygosity than the foreign species, considering that having a similar number of alleles, black cornish species and Rhode Island Red Species are considered to have higher selection pressure than traditional chickens.

Example 3 Production of Sexual Use Room No. 1

Red-brown native chickens between 21 and 72 weeks old and indigenous Rhode Island red females between 25 and 64 weeks old were crossed to produce improved native chicken breeders (F1). The female of the improved conventional chicken breeder and the black cornish male of 21 to 72 weeks of age were produced to produce a new breed of sexually modified use No. 1 (F2). 1 shows a schematic diagram of the production process of Sunghwan Room System No. 1.

The produced chicks were transferred to jukchusa and bred while maintaining the temperature inside the cage at about 32 ° C. for the first week. When the indoors were dried at high temperature in early autumn, the appetite was reduced, growth was low, and mortality was maintained. Therefore, the humidity was maintained at 60 to 70%. Water is essential for physiological mechanisms such as chicken thermoregulation, metabolism, and breathing, so a water supply is installed within a radius of 2 m. The first gathering was fed by diluting vitamins and antibiotics with water and soaked for 2 hours. Until 5 weeks of age, the broilers were fed early broilers and electric feeds with high protein content, and from 5 weeks to 10 weeks of age, they fed late broiler feeds with high energy content, and increased energy and protein content to improve meat quality after 10 weeks of age. Native chickens (ME 3,150 kal, CP 16%) were lowered.

Nutrient content of feed fed by breeding stage is shown in Table 9 below.

nutrient Week 0 to 5 5 to 10 More than 10 weeks ME (Metabolism energy), kcal / kg 3,050 3,100 3,150 Crude protein,% 22.0 19.0 16.0 Calcium,% 1.00 0.80 0.80 Phosphate,% 0.45 0.35 0.35 Methionine,% 0.48 0.34 0.33 Lysine,% 1.05 0.90 0.84

The produced sex test system No. 1 is uniform in appearance because the genotype is based on the pure system, especially the males have colorful feathers, and especially the shank shells have a dark blue color. It was easy to distinguish by enemy. The appearance of the produced sex room system No. 1 is shown in FIG. 2, and a photograph comparing the color of the general broiler and the shin part is shown in FIG. 3.

Example 4 Measurement of Growth Rate and Feeding Requirements of Sexual Use Room System No. 1

The fast growth rate of chickens is economical because the number of days it takes to reach the delivery weight is fast and the amount of feed required to increase weight is small. The Sexual Use System No. 1 showed an average body weight of 1,484 g at 8 weeks of age, and was higher than the weight of the conventional Chicken Soup system shown in Table 4, and the Sexual Use System No. 1 of the present invention was developed as compared to the conventional chicken system. It was confirmed that the speed is fast.

In addition, it is very important to select a breeder with a low feed requirement for the increase since the feed cost accounts for about 70% of the broiler production costs. Compared with the conventional chicken net and feed requirements are shown in Table 10 below.

Breed (kg) 0-4 weeks 0 to 8 weeks 0 to 10 weeks Seonghwan Room System No. 1 2.08 2.64 3.07 Maroon Native Chicken 2.08 3.09 3.44 Black traditional chicken 3.21 3.30 3.70

As shown in Table 10, feed requirements did not differ significantly from 0 to 4 weeks of age, but as time passes, it was confirmed that the feed demand rate was significantly improved than that of native chicken.

Example 5 Investigation of Meat Components of Sexual Use Room No. 1

1) water, crude protein, crude fat content

Moisture content, crude protein mass, and crude fat amount of each of the conductor parts of the sexually modified use system No. 1 and general broilers of the present invention are shown in Table 11 below.

kind moisture(%) Crude protein (%) Crude fat (%) chest Bridge chest Bridge chest Bridge Seonghwan Room System No. 1 75.1 74.4 20.5 20.1 1.14 3.74 Common broiler 74.6 75.8 22.8 19.1 0.68 3.16

The chemical composition of breast meat and leg meat of Sunghwan Shilyong system No. 1 showed similar results to those of general broilers, but crude fats that increased meat softness were high. The high crude fat in your muscles can have a marbling-like effect on beef, which can increase meat tenderness.

2) Nonprotein nitrogen compound and collagen content

Non-protein nitrogen compound (NPN) is an ingredient that increases with the post-aging time and affects flavor after cooking. Collagen (Collagen) plays an important role in determining the muscle tissue of meat. In particular, collagen makes the meat feel chewy when the chicken is cooked by moist heat, and its content is generally high in high-moist areas.

The contents of nonprotein nitrogen compounds and collagen were measured and compared with carcasses of carcasses of the Sunghwan Utilization No. 1 and common broilers, and the results are shown in Table 12 below.

kind NPN (%) Collagen(%) chest Bridge chest Bridge Seonghwan Room System No. 1 0.257 0.024 0.535 0.867 Common broiler N.D. N.D. 0.515 0.822

In the general broiler, non-protein nitrogen compounds were not detected at all, whereas in the sex test system No. 1 of the present invention, non-protein nitrogen compounds were detected in the breast meat at a high concentration, and collagen was also contained in a higher content than the general broilers. I could confirm that.

3) amino acid content

Amino acids enhance the flavor of meat products, especially glutamic acid, methionine and cysteine, which are important amino acids that are involved in taste and flavor in chicken. Therefore, amino acid composition was compared in the breast meat of Sexual Use System No. 1 and normal broilers, and the results are shown in Table 13 below.

Amino acid (g / 100g) Seonghwan Room System No. 1 Common broiler Asp. 1.444 1.409 Glu. 2.198 1.716 Ser. 0.524 0.432 Gly . 1.072 0.905 His. 0.393 0.316 Arg. 1.336 0.902 Thr. 0.668 0.582 Ala. 1.209 0.806 Pro. 1.026 0.730 Tyr. 0.78 0.482 Val. 0.980 1.867 Met . 0.567 0.383 Cys . 0.157 0.098 Ile. 0.893 0.519 Leu. 1.411 0.834 Phe. 1.381 0.645 Lys. 1.905 0.715

As shown in Table 13, it was confirmed that the content of most amino acid components in the sex room system No. 1 of the present invention appear higher than the general broiler.

4) fatty acid content

Oleic acid, which accounts for the highest proportion of unsaturated fatty acids in each type, has a great influence on taste and flavor. Beef is generally scored high in sensory evaluation when the content of oleic acid is high. The composition of fatty acids was compared in breast meat of Sunghwan practical system No. 1 and broiler chickens, and the results are shown in Table 14 below.

fatty acid(%) Seonghwan Room System No. 1 Common broiler Lauric acid (C12: 0) 0.07 0.28 Myristic acid (C14: 0) 0.73 1.23 Palmitic acid (C16: 0) 22.83 25.51 Palmitoleic acid (C16: 1) 5.02 7.42 Stearic acid (C18: 0) 7.77 6.66 Oleic acid ( C18 :One) 45.12 37.94 Linoleic acid (C18: 2) 16.66 18.98 Linolenic acid (C18: 3) 0.16 0.31 Gadoleic acid (C20: 1) 0.72 0.69 Arachidonic acid (C20: 4) 0.15 0.11 Eicopentaenoic acid (C20: 5) 0.76 0.65 Total 100 Saturated fatty acid 31.40 33.75 Unsaturated fatty acid 68.60 66.25 Saturated fatty acid / unsaturated fatty acid 0.46 0.51

As shown in Table 14, it can be seen that the ratio of oleic acid in the total fatty acid in breast meat of No. 1 of the present invention is higher than the general broiler. In addition, it can be confirmed that unsaturated fatty acids lowering blood cholesterol content also appear high in the Sexual Use System No. 1 of the present invention.

Example 6 sensory evaluation

Evaluation of Flavor, Aroma, Tenderness, Juiciness and Acceptability using the Five Senses of the Sexual Use Room No. 1 of the Present Invention and Breast Meat and Leg Meat of Common Broilers And the results are shown in Table 15 below.

kind smell zest Juiciness year Purity chest Bridge chest Bridge chest Bridge chest Bridge chest Bridge Sex exchange system
No. 1 5.55 5.18 5.82 4.55 4.55 5.36 6.28 5.18 5.91 4.55 Common broiler 5.73 4.73 5.64 5.00 4.27 4.82 6.27 4.91 5.09 5.18 Odor: 0 points (smell very weak), 5 (usually), 10 (very strong)
Flavor: 0 points (very weak), 5 (usually), 10 (very strong)
Juicy: 0 points (no juice), 5 (normal), 10 (very juice)
Year: 0 points (very tough), 5 (usually), 10 (very light)
Palatability: 0 points (very much), 5 (usually), 10 (very good)

As shown in Table 15, in the overall items of smell, succulents, years, palatability, it was confirmed that the sex room system No. 1 of the present invention is superior to the general broiler. Therefore, the sexual exchange system No. 1 of the present invention can be evaluated to be bred into a variety that suits the taste of Koreans.

Example 7 Genetic Properties of Sexual Use System No. 1

1) Extraction of Test Subject and DNA Sample

Rhode Island Red, Red Brown Native Chicken, Black to investigate the presence or absence of a recessive white nucleotide sequence occurring in intron 4 of the tyrosinase gene and the single nucleotide polymorphism occurring at the 243 th locus from the base of the D-Loop region of mitochondrial DNA. Sexual breeder No. 1 (F1) produced by cross breeding of Cornish, Ross, Harvard, Abaaker, Rhode Island Red (♀) and reddish brown chicken (♂), Sexual Use Room No. 1 (F2) of the present invention and commercial broiler respectively 24 experiments were carried out as follows.

In order to extract genomic DNA, 1 ml of EDTA mixed blood was centrifuged at 1000 rpm for 10 minutes to recover leukocytes, and genomic DNA was extracted from the recovered leukocytes using PrimePrep Kit (GenetBio, Korea).

2) PCR to analyze the presence or absence of sequence insertion in tyrosinase gene

In order to analyze the presence or absence of the insertion of the 180 bp recessive white sequence (SEQ ID NO: 1) and the 13 bp normal sequence (SEQ ID NO: 2) generated from intron 4 of the tyrosinase gene, the forward primer (TYR_F, 5'-TTGACATGAGTACCATGAGC) PCR was performed using primer pairs of −3 ′, SEQ ID NO: 3) and reverse primers (TYR_R, 5′-CTCAAAGCCAACAGCTACCT-3 ′, SEQ ID NO: 4). The PCR was conducted under conditions of repeating 20 seconds at 94 ° C., 20 seconds at 59 ° C., and 30 seconds at 72 ° C. for 36 times. The PCR was performed on a 1% agarose gel to confirm the presence of nucleotide sequence insertion. It moved. Insertion of the nucleotide sequence in the tyrosinase gene is shown in Figure 4, the electrophoresis results are shown in Table 16 and FIG.

Type F2 F1 CC RIR KNC_RB C_B Harvard Ross AA DD 0 0 0 0 0 24 0 0 0 Dd 24 0 5 0 0 0 0 8 0 dd 0 24 19 24 24 0 24 16 24 Sum 24 24 24 24 24 24 24 24 24 F2: No. 1 of the present invention room of the present invention
F1: Seonghwan breeder No. 1 produced by crossroading of Rhode Island Red (♀) and reddish brown chicken (♂)
CC: Commercial Broiler
RIR: Rhode Island Red
KNC_RB: Reddish Brown Chicken
C_B: Black Cornish
AA: Aba Acre

As a result, three forms of DD (normal isomorphism), Dd (deformation) and dd (recessive white isomorphism) were identified, and all of the sex room system No. 1 according to the present invention had a Dd form. On the other hand, Seonghwan breeder No. 1, Rhode Island red, red brown native chicken, Harvard, and Abaaker produced by the Rhode Island Red (♀) and red brown native chickens (♂) were all in dd form. Ross had two forms, Dd (33.3%) and dd (66.7%). Commercially distributed broilers of white chickens, like Ross, had two forms, Dd (20.8%) and dd (79.2%).

3) PCR-RFLP for single nucleotide polymorphism analysis at the 243 th locus from the base of the D-Loop region

 D-Loop region of mitochondrial DNA (http://www.ncbi.nlm.nih.gov/nuccore/28629852?from=1&to=1231&report=gbwithparts) to analyze monobasic polymorphisms occurring at the 243 th locus from the starting base PCR was performed using primer pairs of forward primers (D-243F, 5'-AGGACTACGGCTTGAAAAGC-3 ', SEQ ID NO: 5) and reverse primers (D-243R, 5'-ATGTGCCTGACCGAGGAACCAG-3', SEQ ID NO: 6). The PCR was carried out under the condition of repeating 20 seconds at 94 ° C., 20 seconds at 65 ° C., and 45 seconds at 72 ° C. for 36 times. The PCR amplification product was confirmed by electrophoresis on 1% agarose gel.

Thereafter, restriction fragment length polymorphism (RFLP) was performed using restriction enzymes ( Alu I, 5'-AGCT-3 '). 6 shows the difference in restriction enzyme cleavage by single nucleotide polymorphism. As a result of the restriction fragment length formation, the product was electrophoresed on 2% agarose gel to confirm its form.

As shown in FIG. 7, the T-type allele does not show cleavage by restriction enzymes, but in the case of C-type allele, cleavage appears. Table 17 shows the result of analysis of the restriction fragment length polymorphism.

Type F2 F1 CC RIR KNC_RB C_B Harvard Ross AA T 24 24 0 24 24 24 0 0 0 C 0 0 24 0 0 0 24 24 24 F2: No. 1 of the present invention room of the present invention
F1: Seonghwan breeder No. 1 produced by crossroading of Rhode Island Red (♀) and reddish brown chicken (♂)
CC: Commercial Broiler
RIR: Rhode Island Red
KNC_RB: Reddish Brown Chicken
C_B: Black Cornish
AA: Aba Acre

As shown in Table 17, Sunghwan room system No. 1 of the present invention and Rhode Island Red (♀) and red brown conventional chicken (♂) produced by the breeding No. 1, Rhode Island Red, red brown native chicken and black cornish Were all in the form of T, but commercial broilers, commercially available white broilers, Harvard, Ross, and Abacre were all in C form.

4) Distinguishing Method of Sexual Use System No. 1

Analysis of presence or absence of a recessive white association sequence using PCR of 2) and single nucleotide polymorphism analysis of the 23rd locus of the D-Loop region of the mitochondrial DNA of 3) for the determination of STI-1 of the present invention And the results are shown in Table 18 below.

Type F2 F1 CC RIR KNC_RB C_B Harvard Ross AA DD / T 0 0 0 0 0 24 0 0 0 Dd / T 24 0 0 0 0 0 0 0 0 dd / T 0 24 0 24 24 0 0 0 0 DD / C 0 0 0 0 0 0 0 0 0 Dd / C 0 0 5 0 0 0 0 8 0 dd / C 0 0 19 0 0 0 24 16 24 F2: No. 1 of the present invention room of the present invention
F1: Seonghwan breeder No. 1 produced by crossroading of Rhode Island Red (♀) and reddish brown chicken (♂)
CC: Commercial Broiler
RIR: Rhode Island Red
KNC_RB: Reddish Brown Chicken
C_B: Black Cornish
AA: Aba Acre

As shown in Table 18, the sex room system No. 1 of the present invention has a Dd form in which both normal and recessive white nucleotide sequences are inserted in the presence or absence of nucleotide sequences in the tyrosinase gene, and the D-Loop of mitochondrial DNA. Monobasic polymorphism of region 243rd locus showed T-shape, showing different characteristics from other varieties. Therefore, it could be confirmed that the varieties of sex system 1 can be identified through the process of 2) and 3).

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Production of Seonghwan-commercial chicken No. 1 using Korean          native chicken and exotic chicken and distinction method of the          product <160> 6 <170> Kopatentin 1.71 <210> 1 <211> 180 <212> DNA <213> Gallus gallus <400> 1 gaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa gatttgaaag aataagaatt 60 ttcctatcag aaagagcaaa cacttttccc aggtagttgt cagcaaatac agttgctgca 120 cttttgggtc tttcatggtt agagagatta aagcttgcat gcctaacgga ctcgctgaaa 180                                                                          180 <210> 2 <211> 13 <212> DNA <213> Gallus gallus <400> 2 atagtgacta ctt 13 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TYR_F primer <400> 3 ttgacatgag taccatgagc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TYR-R primer <400> 4 ctcaaagcca acagctacct 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> D-243F primer <400> 5 aggactacgg cttgaaaagc 20 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> D-243R primer <400> 6 atgtgcctga ccgaggaacc ag 22

Claims (7)

Black Cornish ( Gallus gallus ) males,
Reddish brown Korean native chicken (Rhode island reds, Gallus gallus ) is a new breed of chicken produced by crossing the female (F1) produced by crossing the male,
The tyrosinase gene of the new breed chicken includes both the nucleotide sequence of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 2, and is a new breed of chicken, characterized in that it appears as T at the 243 th locus from the start base of the D-Loop region of mitochondrial DNA. Practical system No. 1.
delete delete delete (a) extracting genomic DNA from the chicken breed to be analyzed;
(b) using the extracted genomic DNA as a template and performing PCR using primer pairs of SEQ ID NOs: 3 and 4;
(c) confirming the insertion of SEQ ID NOs: 1 and 2 in the PCR amplification product of step (b);
(d) using the extracted genomic DNA as a template and performing PCR using primer pairs of SEQ ID NOs: 5 and 6;
(e) performing restriction fragment length formation analysis of the PCR amplification product of step (d) using Alu I restriction enzyme; And
(f) The base at the 243 th locus is identified as T from the D-Loop region starting base of mitochondrial DNA by insertion of SEQ ID NOs: 1 and 2 in step (c) and restriction fragment length formation analysis in step (e). If it is, the step of identifying as a new breed Sunghwan practical system No. 1
Breed identification method of chicken new breed Seonghwansilyong No. 1, comprising a.
delete Primer pairs of SEQ ID NOs: 3 and 4 for confirming insertion of SEQ ID NOs: 1 and 2 in genomic DNA of a chicken to be analyzed;
Primer pairs of SEQ ID NOs: 5 and 6 for confirming the nucleotide sequence at the 243th locus from the D-Loop region starting base of mitochondrial DNA; and
Breed identification kit of chicken new breed sex room system No. 1, characterized by containing Alu I restriction enzyme.

Images