KR101796866B1 - Composition having effects of skin moisturizing, exfoliating, improving skin elasticity, inhibiting erythema, anti-wrinkle or improving skin photoaging comprising at least one selected from the group consisting of cymene, behenic acid, 2-methoxynaphthalene, thymol and salts thereof - Google Patents

Abstract

The present invention relates to a cosmetic material composition, a health functional food composition, a medical product, and a quasi-drug composition having effects of alleviating skin wrinkles, improving skin moisturizing, removing corneum, improving skin elasticity, suppressing erythema, and alleviating skin photoaging, comprising at least one selected from the group consisting of cymene, behenic acid, 2-methoxynaphthalene, thymol, and a salt thereof as an active ingredient. The cymene, behenic acid, 2-methoxynaphthalene, thymol, and salt thereof of the present invention exhibit activities of increasing a skin moisture content, decreasing a skin moisture evaporation amount, increasing a pro-collagen secretion amount, promoting collagen biosynthesis, controlling collagen fiber damage, suppressing collagen fiber decomposition, suppressing erythema, and suppressing hypertrophy of an outer skin layer, thereby being useful for materials of functional cosmetics, health functional foods, medical products, quasi-drugs, or the like providing effects of improving skin moisturizing, removing corneum, improving skin elasticity, alleviating skin wrinkles, suppressing erythema, and/or alleviating skin photoaging.

Description

Improving skin skin, improving skin elasticity, suppressing erythema, improving skin wrinkles or improving skin texture, comprising at least one selected from the group consisting of cymene, behenic acid, 2-methoxynaphthalene, The present invention relates to a composition having a photoaging effect and a composition having a photoaging effect. The present invention relates to a composition having an improved photoaging effect, and salts thereof.

The present invention relates to a composition containing at least one selected from the group consisting of cymene, behenic acid, 2-methoxynaphthalene, thymol and salts thereof as an active ingredient. More specifically, the present invention relates to a composition for improving skin moisture content, Behenic acid, 2-methoxynaphthalene, thymol, or a salt thereof, which exhibits an activity of suppressing collagen fiber damage, inhibiting collagen fiber decomposition, suppressing erythema and inhibiting the thickening of the skin surface layer, by increasing the amount of procollagen secretion, promoting collagen biosynthesis, A health functional food composition, a medicament, and a quasi-drug composition having an effect of improving skin moisturizing, skin exfoliation, skin elasticity enhancement, erythema suppression, skin wrinkle improvement and / or skin photoaging improvement.

Recent advances in medical technology have led to increased interest in skin care and health as life expectancy has been extended and quality of life has been improved and the desire for a healthy and beautiful life has increased. Various cosmetic functional cosmetics have been developed for the purpose of maintaining a healthy skin, and researches for prevention of skin wrinkle formation, mitigation and improvement have been actively carried out. In addition, recently, cosmetic ingredients reach skin dermis and there is a limitation in supplying nutrients. As a result of the change in perception that ingestion of nutrients or functional ingredients to the skin can provide a skin cosmetic enhancement effect, JNutr, 132, 3090-3097 (2002), Tanno, O. et al., ≪ RTI ID = 0.0 > al., ≪ / RTI & , Nicotinamide increases biosynthesis of ceramides as well as other stratum corneum lipids to improve the epidermal permeability barrier (Br J Derm, 143, 524-531, 2000).

The skin consists largely of epidermis, dermis and hypodermis. The outer layer of the epidermis, especially the outer layer of the epidermis, plays a role as a skin barrier, thereby causing loss of water and electrolytes from the skin While the dermis, through the synthesis of collagen and elastin, maintains the elasticity of the skin and supports the structure. In other words, collagen and elastin are the main proteins produced in fibroblasts, which are involved in the mechanical durability of the skin, the binding force and the resilience of tissues (Moskowit, RW et al, Role of collagen hydrolysate in bone and joint disease, Semin Arthritis Rheu, 87, 2000). Collagen constitutes various isoforms according to its morphological and structural characteristics. There are 28 types of collagen isotypes in human tissues. Collagen existing in skin tissues is classified into types 1 and 3. 4. 6. 7. 13, 14, 17, etc. are known. Collagen type 1 and 3 form the intercellular component of the dermis, while collagen type 7 is the main component of the dermal and epidermal junction (Pei, M. et al., Expression of collagen type I, II and III in the loose body of osteoarthritis, J. Orthop. Sci., 5: 288, 2000).

In skin connective tissue, type I collagen is the most abundant of extracellular matrix proteins, and other proteins such as elastin, fibronectin, integrin, fibrillin, and proteoglycan exist. The newly synthesized procollagen is secreted into the extracellular space of the skin cells through an enzymatic reaction and forms a microfibril of a triple helix configuration, while microfibrils form leucine-rich small proteoglycans -rich small proteoglycans) to form a fibril. As a result, these fibrils are gathered to form collagen fibers that provide skin's binding force and elasticity (Bateman, J. F. et al., Collagen superfamily. Extracellular matrix, Harwood, New York, 2, 22-26, 1996).

Skin aging is known to be caused by a decrease in collagen content, which is the protein that occupies most of the collagen in skin dermal tissue. Since collagen gives skin tension and strength, collagen reduction has a very deep relationship with skin aging and wrinkle formation have. Skin aging is largely divided into endogenous aging by physiological aging and photoaging caused by continuous exposure to ultraviolet radiation (UV). Repeated exposure to ultraviolet light results in increased collagenase and denaturation and destruction of collagen fibers, reducing skin elasticity and promoting the production of wrinkles. In other words, the development of reactive oxygen species (ROS) is increased in skin tissue exposed to ultraviolet rays continuously, and the latter is a signal transduction system mediated by growth factor receptor (EGF-R), tumor necrosis factor (TNF) (Sachsenmaier, C. et al., Involvement of growth factor receptors in the mammalian UVC response. Cell, 78: 963-972, 1994; Dy, LC et al., Augmentation of ultraviolet B radiation-induced tumor necrosis factor production by the epidermal platelet-activating factor receptor. J. Biol. Chem .: 274, 26917-2692, 1999). Activation of these receptors results in continuous phosphorylation, which activates proteins that mediate downstream signaling, including mitogen-activated protein kinase (MAPK), resulting in activator protein-1 (AP-1 ) And nuclear factor κB (NF-κB) to induce inflammatory responses and promote the activity of collagenases such as matrix metalloproteinases (MMPs), thereby reducing skin elasticity and promoting wrinkle formation (Kang, S. et al., Inflammation and extracellular matrix degradation mediated by activated transcription factor nuclear factor-kB and activator protein-1 in Inflammatory acne lesions in vivo. Am J. Pathol., 166: 1691-1699, 2005) . AP-1 regulates the expression of a number of genes involved in cell growth and differentiation and strongly regulates the expression of some MMPs. Among MMPs whose expression is regulated by AP-1, MMP-1 is known as collagenase 1, and type 1 and 3 collagen are substrates.

On the other hand, there are three isomers of cymene, o-cymene, m-cymene and p-cymene. The physiological activities of p-cymene reported in the prior art are as follows: It has been reported that lipolytic efficacy measured by oleic acid production is very excellent (Choi et al, " Lipolytic effects of citrus peel oils and their components. "Journal of Agricultural and Food Chemistry 54: 3254-3258, 2006 In mice, the oral administration of p-cymene complex at a dose of 20-40 mg / kg has been reported to have pain relief and anti-inflammatory effects (Quintans et al., Improvement of p-cymene antinociceptive and anti-inflammatory effects by inclusion in? -cyclodextrin. Phytomedicine 20: 436-440, 2013).

The behenic acid is called Moringa It is mainly contained in plants such as oleifera (Drumstick tree), Arachis hypogaea (Peanut, peanut), and the bioactivity of behenic acid is not known.

2-methoxynaphthalene has been used mainly as a soap perfume, and there is no physiologically active function of 2-methoxynaphthalene reported in the prior art.

Thymol is a kind of monoterpene phenol that has strong antioxidant activity extracted from thyme or essential oil of oregano. It is one of the aromatic essential oils that have been used for a long time and is the main constituent of thyme. Thymol is registered as a flavoring agent in Korean KFDA and US FDA food additives database, and it is a food additive that is allowed to be directly added for human consumption as chemical seasoning and supplements.

As reported in the prior art, the effectiveness of thymol in reducing the resistance of bacterium resistant to ampicillin, penicillin, and the like has been reported (Palaniappan et al., Use of natural antimicrobials to increase antibiotic susceptibility of drug resistant bacteria. (Zarrini et al., " Post-antibacterial "), which has been reported to be effective in inhibiting the growth of drug resistance pathogens due to strong antioxidative action of thymol (International Journal of Food Microbiology 140: 164-168, 2010) effect of thymol. Pharmaceutical Biology 48: 633-636, 2010). In addition, because of its strong antimicrobial and antifungal effects, it has been used locally for various medicines in the past, and is believed to have been used to make mummies in ancient Egypt. It has also been reported that plant essential oils containing a large amount of thymol and cadaverine in yellow flies induced by mutation induced by urethanes are effective in improving mutation effectively (Mezzoug, N. et al., Investigation of the mutagenic and antimutagenic effects of Origanum compactum essential oil and some of its constituents Mutation Research / Genetic Toxicology and Environmental Mutagenesis 629: 100, 2007).

It has been reported that thymol absorption is well absorbed through the intestinal membrane and is easily absorbed by the transdermal system in most cases (Osol et al., "Dispensatory of the United (Tox-Info) is reported to be released through the lungs, urine, feces, and skin, without metabolism in the body or metabolized by the liver, , Food and Drug Safety Evaluation Institute).

However, cymene, behenic acid, 2-methoxynaphthalene, and thymol have not been reported for their physiological activities related to skin health.

The inventors of the present invention have conducted studies to develop food or cosmetic materials effective for reducing wrinkles by inhibiting collagenase activity and promoting the synthesis of collagen in natural products with low side effects. As a result, it has been found that cement, behenic acid, Naphthalene or thymol exhibits an effect of improving skin moisturizing, skin exfoliation, skin elasticity enhancement, erythema suppression, skin wrinkle improvement and / or skin photoaging improvement.

It is an object of the present invention to provide a cosmetic composition having an effect of improving skin moisturizing, skin exfoliation, skin elasticity enhancement, erythema suppression, skin wrinkle improvement and / or skin photoaging improvement.

Another object of the present invention is to provide a health functional food composition having skin moisturizing, skin exfoliation, skin elasticity enhancement, erythema suppression, skin wrinkle improvement and / or skin photoaging improvement.

Another object of the present invention is to provide a pharmaceutical or quasi-drug composition having skin moisturizing effect, skin exfoliation, skin elasticity enhancement, erythema suppression, skin wrinkle improvement and / or skin photoaging improvement effect.

In order to solve the above-mentioned problems, the present invention provides a cosmetic composition for improving skin moisturizing, cosmetics, cosmetics, cosmetics, cosmetics, perfume, cosmetics, The present invention provides a cosmetic composition having skin exfoliation, skin elasticity enhancement, erythema suppression, skin wrinkle improvement, and / or skin photoaging improvement effect.

The present invention also relates to a skin moisturizing composition comprising at least one selected from the group consisting of cimene, behenic acid, 2-methoxynaphthalene, thymol and a pharmaceutically acceptable salt thereof as an active ingredient, (EN) Disclosed is a health functional food composition having an effect of improving skin color, preventing erythema, suppressing skin wrinkles and / or improving skin photoaging.

According to a preferred embodiment of the present invention, the cimene, behenic acid, 2-methoxynaphthalene, thymol or a pharmaceutically acceptable salt thereof may be contained in an amount of 0.0001 to 20% by weight based on the total weight of the cosmetic composition.

According to another preferred embodiment of the present invention, the cosmetic composition may be at least one selected from the group consisting of a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nutrition lotion, a massage cream, A formulation selected from the group consisting of a pack, a mask pack, a mask sheet, an exfoliant, a soap, a shampoo, a cleansing foam, a cleansing lotion, a cleansing cream, a body lotion, a body cleanser, a latex, a press powder, a loose powder, ≪ / RTI >

According to another preferred embodiment of the present invention, the health functional food composition may be prepared in any one form selected from the group consisting of tablets, granules, powders, capsules, liquid solutions and rings.

According to another preferred embodiment of the present invention, the cosmetic composition or health functional food composition may further comprise a skin wrinkle improving component.

According to another preferred embodiment of the present invention, the further skin wrinkle improving component is selected from the group consisting of vitamin C, retinoic acid, transforming growth factor (TGF), animal placenta-derived protein, betulinic acid and chlorella extract Lt; / RTI >

The present invention also relates to a cosmetic composition comprising at least one selected from the group consisting of cymene, behenic acid, 2-methoxynaphthalene, thymol and salts thereof as an active ingredient to improve skin moisturizing, skin exfoliation, skin elasticity, A pharmaceutical or quasi-drug composition having an effect of improving skin wrinkles and / or improving skin photoaging.

The composition of the present invention containing at least one selected from the group consisting of cymene, behenic acid, 2-methoxynaphthalene, thymol, and salts thereof as an active ingredient can be used for improving the skin moisture content, decreasing the amount of skin moisture evaporation, increasing the amount of procollagen, Improved skin moisturization, skin exfoliation, skin elasticity enhancement, erythema suppression, skin wrinkle enhancement, skin wrinkle enhancement, and / or skin photoaging enhancement by promoting collagen biosynthesis, inhibiting collagen fiber damage, inhibiting collagen fiber decomposition, inhibiting erythema And the like. Since cymene, behenic acid, 2-methoxynaphthalene or thymol of the present invention is a natural product, it is safe for the human body and has few side effects, and can be used as various materials such as cosmetics, health functional foods, medicines or quasi-drugs.

FIG. 1 is a graph showing the results of measuring the amount of procollagen secreted by UVB at 20 mJ / cm 2 in human skin fibroblasts, followed by treatment with 100 μM of vitamin C or p-cymene for 24 hours and ELISA analysis (FIG. UVB: normal group without UVB treatment, + UVB: control group treated with UVB, CM: test group treated with p-cymene after UVB irradiation, VitC: control group treated with vitamin C after UVB irradiation, CM + VitC: UVB irradiation followed by treatment with p-cymene and vitamin C).
FIG. 2 is a graph showing the results of measuring the amount of procollagen secreted by UVB at 20 mJ / cm 2 in human skin fibroblasts, followed by treatment with 100 μM of vitamin C or thymol for 24 hours, and ELISA analysis (-UVB: UVB-treated normal group, + UVB: control group treated with UVB, TM: test group treated with UVB and then treated with thymol, VitC: control group treated with UVB and control group treated with vitamin C, and TM + VitC: An experimental group treated with thymol and vitamin C).
FIG. 3 is a graph showing weight gain and dietary intake of mice consuming an experimental diet containing p-cymene (CM) as an experimental substance in the composition of Table 1 (A: body weight, B: weight gain, C and D: Dietary intake).
FIG. 4 is a graph showing weight gain and dietary intake of mice fed with an experimental diet containing behenic acid (BA) as an experimental substance in the composition of Table 1 (A: weight, B: weight gain, C and D: Intake).
FIG. 5 is a graph showing weight gain and dietary intake of mice fed with an experimental diet containing 2-methoxynaphthalene (2MN) as an experimental substance in the composition of Table 1 (A: body weight, B: weight gain, C and D: Dietary intake).
6 is a graph showing weight gain and dietary intake of mice consuming an experimental diet containing Tymol (TM) as an experimental substance in the composition of Table 1 (A: body weight, B: weight gain, C and D: dietary intake ).
FIG. 7 is a graph showing the relationship between the moisture content (A), moisture evaporation amount (B), elasticity (C) and erythema index (R) of the skin tissue of mice fed with an experimental diet containing p-cymene D).
FIG. 8 is a graph showing the moisture content (A), moisture evaporation amount (B), elasticity (C) and erythema index (D) of the skin tissue of a mouse fed with an experimental diet containing behenic acid (BA) FIG.
FIG. 9 is a graph showing the moisture content (A), moisture evaporation amount (B), elasticity (C) and erythema (B) of the skin tissue of a mouse fed with an experimental diet containing 2-methoxynaphthalene And the index (D).
FIG. 10 is a graph showing the moisture content (A), moisture evaporation amount (B), elasticity (C), and erythema index (D) of the skin tissue of mice fed with an experimental diet containing thymol (TM) Fig.
11 is a photograph showing the dorsal skin tissue of each of the mice that ingested the experimental diet containing p-cymene (CM) as an experimental substance in the composition of Table 1;
12 is a photograph showing the dorsal skin tissue of each of the mice consuming the experimental diet containing behenic acid (BA) as an experimental substance in the composition of Table 1;
FIG. 13 is a photograph showing the dorsal skin tissues of each of the mice consuming the experimental diet containing 2-methoxynaphthalene (2MN) as an experimental substance in the composition of Table 1. FIG.
14 is a photograph showing the dorsal skin tissue of each of the mice consuming an experimental diet containing thymol (TM) as an experimental substance in the composition of Table 1;
FIG. 15 is a photograph (A) and a graph (B) showing the degree of wrinkle formation of the dorsal skin tissue of a mouse ingested with an experimental diet containing P-cymene (CM) as a test substance in the composition of Table 1.
FIG. 16 is a photograph (A) and a graph (B) showing the degree of wrinkle formation of the dorsal skin tissue of a mouse that consumed an experimental diet containing behenic acid (BA) as a test substance in the composition of Table 1.
FIG. 17 is a photograph (A) and a graph (B) showing the degree of wrinkle formation of the dorsal skin tissue of a mouse in which an experimental diet containing 2-methoxynaphthalene (2MN) as a test substance in the composition of Table 1 was ingested.
FIG. 18 is a photograph (A) and a graph (B) showing the degree of wrinkle formation of the dorsal skin tissue of a mouse that consumed an experimental diet containing thymol (TM) as a test substance in the composition of Table 1.
FIG. 19 is a graph (A) and a skin surface layer photograph (B) of a skin thickness of a mouse ingested with an experimental diet containing P-cymene (CM) as a test substance in the composition of Table 1.
FIG. 20 is a graph (A) and a skin skin layer photograph (B) showing the skin thickness of a mouse ingested with an experimental diet containing behenic acid (BA) as a test substance in the composition of Table 1.
FIG. 21 is a graph (A) and a skin surface layer photograph (B) of a skin thickness of a mouse ingested with an experimental diet containing 2-methoxynaphthalene (2MN) as a test substance in the composition of Table 1.
FIG. 22 is a graph (A) and skin skin layer photograph (B) of skin thickness of a mouse in which an experimental diet containing thymol (TM) was taken as a test substance in the composition of Table 1.
FIG. 23 is a photograph showing changes in the amount and morphology of collagen fibers in a mouse consuming an experimental diet containing P-cymene (CM) as a test substance in the composition of Table 1. FIG.
24 is a photograph showing changes in the amount and morphology of collagen fibers in a mouse in which an experimental diet containing behenic acid (BA) as a test substance in the composition of Table 1 was ingested.
25 is a photograph showing changes in the amount and morphology of collagen fibers in a mouse in which an experimental diet containing 2-methoxynaphthalene (CM) as a test substance in the composition of Table 1 was ingested.
FIG. 26 is a photograph showing changes in the amount and morphology of collagen fibers in a mouse consumed with an experimental diet containing thymol (TM) as a test substance in the composition of Table 1. FIG.
FIG. 27 shows the results of RT-PCR measurement of changes in the expression of collagen and MMP genes in tissues such as hairless mice treated with P-cymene (CM).
Fig. 28 shows the results of RT-PCR measurement of changes in the expression of collagen and MMP genes in tissues such as hairless mice treated with behenic acid (BA).
FIG. 29 shows the results of RT-PCR measurement of changes in the expression of collagen and MMP genes in tissues such as hairless mice treated with 2-methoxynaphthalene (2MN).
FIG. 30 shows the results of RT-PCR measurement of changes in the expression of collagen and MMP genes in tissues such as thymol (TM) -mediated reared mice.

Hereinafter, the present invention will be described in more detail.

As described above, there is no particular report on the physiological activities related to skin health such as improvement of skin wrinkles, moisturizing, and elasticity enhancement of cymene, behenic acid, 2-methoxynaphthalene and thymol.

Under these backgrounds, the present inventors have confirmed the novel activity of cymene, behenic acid, 2-methoxynaphthalene and thymol associated with skin health, and have found that the cymene, behenic acid, behenic acid, 2-methoxynaphthalene, A health functional food composition, a pharmaceutical product and a quasi-drug composition containing at least one selected as an active ingredient.

The composition provided by the present invention is excellent in skin moisture content, reduced skin moisture evaporation, increased amounts of procollagen secretion, promotion of collagen biosynthesis, inhibition of collagen fiber damage, inhibition of collagen fiber decomposition, erythema suppression, Improvement in skin moisturization, removal of skin exfoliation, improvement in skin elasticity, suppression of erythema, improvement in skin wrinkles and / or improvement in skin photoaging.

Accordingly, the present invention relates to a cosmetic composition comprising at least one selected from the group consisting of cymene, behenic acid, 2-methoxynaphthalene, thymol, and cosmetically acceptable salts thereof as an active ingredient to improve skin moisturizing, (EN) A cosmetic composition having an effect of improving skin color, preventing erythema, suppressing skin wrinkles and / or improving skin photoaging.

Cymene is an alkylbenzene-based compound having a structural formula of C ₁₀ H ₁₄ and a molecular weight of 134.21 g / mol. Cymene is referred to as o-cymene, m-cymene and p-cymene, which have three isomers and are represented by the following chemical formulas 1, 2 and 3, respectively, . Among these isomers, p-cymene is also known as 1-methyl-4- (1-methylethyl) benzene, 4-isopropyltoluene, 4-methylcumene and paracymene. The p-cymene is a colorless liquid component and has a melting point of -68 ° C and a boiling point of 177 ° C.

[Chemical Formula 1]

(2)

(3)

p-cymene is a component of essential oils, including Nigella Sativa (Black Seed), Thymus zygis (Thyme white, Time White), Origanum vulgare (Oregano, oregano), Thymus vulgaris (Thyme, Time), Cinnamomum Camphor (camphor), Trachyspermum ammi (Ajowan), Croton eluteria are mainly contained in plants such as (Cascarilla, Kasuga GW), Cuminum cyminum (Cumin, Cumin), Satureja (Savory, Savory), Capsicum annuum (Pepper, pepper), Monarda (Bee balm). p-cymene is an aromatic organic compound registered as a flavoring agent in Korean KFDA and US FDA food additives database.

Behenic acid is a carboxylic acid compound having a structure represented by the following formula (4). The Cas No. is 112-85-6 and the structural formula is CH ₃ (CH ₂ ) ₃ O COOH. C ₃₂ H ₄ O ₃ , and a molecular weight of 340.59 g / mol. The IUPAC name for behenic acid is docosanoic acid and is synonym of 1-docosanoic acid, n-docosanoic acid, n-docosanoate, glycon B-70, hydrofolic acid 560, hydrofol 2022-55, hystrene 5522, hystrene 9022, prifrac 2989 Also called. Behenic acid is a solid component in a white wax state, melting point is 81-82 ° C, boiling point is 306 ° C.

[Chemical Formula 4]

Mount Behen is mainly found in plants such as Moringa oleifera (Drumstick tree), Arachis hypogaea (Peanut).

2-methoxynaphthalene is a hydroxyl-based compound having a structure represented by the following formula (5). The Cas No. is 93-04-9, the structural formula is C ₁₁ H ₁₀ O, and the molecular weight is 158.2 g / mol. 2-Naphthol methyl ether, 2-Naphthyl methyl ether, 6-Methoxy-2-naphthalene, Methyl 2-naphthyl ether, Methyl b-naphthyl ether, Nerolin, b-Methoxynaphthalene, b Naphthol methyl ether, and b-Naphthyl methyl ether. 2-Methoxynaphthalene is a white crystalline component with a melting point of 70-73 ° C and a boiling point of 274 ° C.

[Chemical Formula 5]

Thymol is a compound having the structure of the following formula (6), and the IUPAC name is 2-isopropyl-5-methylphenol. The Cas No. is 89-83-8, the structural formula is C ₁₀ H ₁₄ O, and the molecular weight is 150.22. g / mol. Tymol is also known as 2-Isopropyl-5-methylphenol, 5-Methyl-2- (1-methylethyl) phenol, 5-Methyl-2-isopropylphenol and IPMP. Thymol is a colorless crystal component and has a herb spice odor and a smell reminiscent of time. It has a melting point of 51 ° C and a boiling point of 232.8 ° C.

[Chemical Formula 6]

Thimol is Euphrasia rostkoviana (Eyebright), Monarda Didymia (Bergamot), Monarda fistulosa (Bee balm), Trachyspermum Ammi (Ajowan), Origanum dictamnus (Origanum), Origanum It is mainly contained in plants such as onites (Pot Marjoram, Marjoram), Origanum vulgare (Oregano, oregano), Thymus glandulosus , Thymus hyemalis (Thymus), Thymus vulgaris (German thyme) and Thymus zygis .

The method for obtaining cymene, behenic acid, 2-methoxynaphthalene and thymol of the present invention is not particularly limited, and can be separated from a plant containing the compound, chemically synthesized using a known production method, or used commercially .

The LD ₅₀ value of p-cymene was 4.75 g / kg orally when administered to rats (Jenner et al, "Food flavors and compounds of related structure I. Acute oral toxicity." Food and Cosmetics Toxicology 2: 327-343, 1964 ), And more than 5 g / kg in the case of rabbit application to skin (Opdyke et al, "Monographs on fragrance raw materials: p-Cymene" Food and Cosmetics Toxicology 12: 401-402, 1974).

Therefore, the oral administration of p-cymene at a dose of 0.1 mg / kg to 4,700 mg / kg, preferably 1 mg / kg to 3,000 mg / kg, or a dose of 0.1 mg / kg to 5,000 mg / kg, preferably 1 mg / To 4,000 mg / kg, the p-cymene can be applied to the cosmetic composition, the health functional food composition, the medicinal product or the quasi-drug composition at a proper concentration depending on the administration method and administration purpose, Can be used.

The no-observed-adverse-effect level (NOAEL) of behenic acid was reported to be 4.36 g / kg body weight / day in hamsters and 4.04 g / kg body weight / day in rats (Webb et al. 2. Short-term safety and metabolism in rats and hamsters, International Journal of Toxicology 10: 341-356, 1991).

Therefore, when behenic acid is administered at a dose of 0.1 mg / kg to 4,360 mg / kg, preferably 1 mg / kg to 3,000 mg / kg, the behenic acid is very little or no toxic, , A health functional food composition, a pharmaceutical product, or a quasi-drug composition in an appropriate concentration according to the present invention.

The LD ₅₀ value of 2-methoxynaphthalene was reported to be 5,000 mg / kg for skin application in rabbits and 5,000 mg / kg for oral administration in rats (Food and Cosmetics Toxicology. 13: 885, 1975).

Therefore, oral administration of 2-methoxynaphthalene at a dose of 0.1 mg / kg to 5,000 mg / kg, preferably 1 mg / kg to 4,000 mg / kg, or application to the skin is very insignificant or toxic, The naphthalene may be used in a cosmetic composition, a health functional food composition, a pharmaceutical product or a quasi-drug composition at an appropriate concentration within the above concentration range according to the administration method and administration purpose.

LD ₅₀ values of thymol were reported to be 100 mg / kg for intravenous injection, 955 mg / kg for oral administration, and 880 mg / kg for oral administration to guinea pig in mice (Tox-Info ), Food and Drug Safety Evaluation Institute).

Therefore, oral administration of thymol at a dose of 0.01 mg / kg to 950 mg / kg, preferably 0.1 mg / kg to 700 mg / kg, is insignificant or not toxic. Therefore, , A health functional food composition, a pharmaceutical product, or a quasi-drug composition in an appropriate concentration according to the present invention.

Cymene, behenic acid, 2-methoxynaphthalene, and thymol, which are included in the composition of the present invention as an effective ingredient, may include hydrates, derivatives, and the like of these compounds within the range of the same effect, and their solvates and stereoisomers May also be included. In particular, the cymene may include, without limitation, three isomers of o-cymene, m-cymene, and p-cymene.

In the present invention, the term " improvement of skin wrinkles " means maintaining or strengthening the ability to relate to the wrinkles and elasticity of the skin. Collagen (collagen) and elastin (elastin), which are the collagen fibers of the skin dermis layer, play a key role in maintaining skin elasticity. Collagen biosynthesis is affected by internal and external skin. Specifically, the skin cells are reduced in cellular activity due to natural aging, and collagen fibers are decreased. When extreme ultraviolet rays are irradiated as an external factor, or when active oxygen generated by stress or the like causes thiol (-SH) To increase the expression of collagen and elastase, thereby increasing the wrinkles of the skin and reducing the elasticity, thereby aging the skin.

In the context of the present invention, the term "cosmetically acceptable salt", "pharmaceutically acceptable salt", "pharmaceutically acceptable salt" or "salt thereof" refers to an acid addition salt formed by a free acid have. Acid addition salts can be prepared in a conventional manner, for example, by dissolving the compound in an excess amount of an aqueous acid solution and precipitating the salt with a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. It is also possible to heat an equimolar amount of the compound and an acid or alcohol (e.g., glycol monomethyl ether) in water, and then evaporate the mixture to dryness, or the precipitated salt may be subjected to suction filtration.

As the free acid, an inorganic acid or an organic acid can be used. The inorganic acid may be, for example, hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc. These may be used alone or in admixture of two or more. Non-limiting examples of the organic acid include methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, mandelic acid, The present invention also relates to the use of a compound of formula (I) as an acid, citric acid, lactic acid, glycollic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanillyric acid, hydroiodic acid and the like. These may be used alone or in combination of two or more.

In addition, the cement, behenic acid, 2-methoxynaphthalene and thymol can be used to make cosmetically or pharmaceutically acceptable metal salts using bases. The alkali metal or alkaline earth metal salt can be obtained, for example, by dissolving the compound in an excess amount of an alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the non-soluble compound salt, and evaporating and drying the filtrate. The metal salt is preferably, but not limited to, sodium, potassium or calcium salt. The corresponding silver salt can also be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (for example, silver nitrate).

The salts of cymene, behenic acid, 2-methoxynaphthalene, and thymol are all salts of acidic or basic groups that may be present in the above cymene, behenic acid, 2-methoxynaphthalene and thymol compounds, unless otherwise indicated . For example, the salts of cymene, behenic acid, 2-methoxynaphthalene and thymol may include sodium, calcium and potassium salts of hydroxy groups, and other cosmetically acceptable salts of amino groups include hardrobromide (Salicylate) salts such as hydrochlorides, sulfates, hydrogensulfates, phosphates, hydrogen phosphates, dihydrogen phosphates, acetates, succinates, citrates, tartrates, lactates, mandelates, methanesulfonates And the like, and can be produced through a method for producing a salt known in the art.

The effective content of cimene, behenic acid, 2-methoxynaphthalene, thymol or a cosmetically acceptable salt thereof in the cosmetic composition of the present invention is not particularly limited and may be in the range of 0.0001 to 20% by weight based on the total weight of the composition have. When the amount of cimene, behenic acid, 2-methoxynaphthalene, thymol or the salt thereof is less than 0.0001% by weight in the cosmetic, the effect of improving wrinkles may be insufficient. If the amount of the cosmetic is more than 20% by weight,

In one embodiment of the present invention, when p-cymene or thymol was treated with human skin fibroblasts irradiated with ultraviolet light, it was confirmed that the secretion amount of procollagen type I C-peptide (PIP) was increased in comparison with control cells irradiated only with ultraviolet light 1 and 2).

In another embodiment of the present invention, the experimental diet shown in Table 1 containing p-cymene, behenic acid, 2-methoxynaphthalene or thymol as a test substance together with ultraviolet irradiation was supplied to hairless mice for 10 weeks, MMP-1a, MMP-1b, MMP-1b, MMP-1b, MMP-1b, MMP-1b and MMP-1b, and the expression of collagen type 1α1, -3, and MMP-9 gene expression were measured. As a result, it was confirmed that p-cymene, behenic acid, 2-methoxynaphthalene or thymol significantly increased skin moisture content and elasticity, and significantly decreased water evaporation and erythema index (Figs. 7 to 10). In addition, p-cymene, behenic acid, 2-methoxynaphthalene or thymol improves the dermal tissue wrinkles of experimental animals (Figs. 11-14) and significantly reduces skin wrinkle area, depth and length, (Figs. 15 to 18), the thickness of the skin layer that has been thickened by ultraviolet irradiation is also remarkably reduced (Figs. 19 to 22), and the effect of tightening the density of the collagen fibers and keeping the arrangement regular (FIG. 23 to FIG. 26), significantly increases the expression of collagen type 1α1, 1α2 and 3α1, and significantly reduces the expression of MMP-1a, MMP-1b, MMP-3 and MMP- And inhibited the degradation of collagen fibers, thereby effectively suppressing the formation of wrinkles by ultraviolet irradiation (Figs. 27 to 30).

Accordingly, the composition of the present invention comprising at least one selected from the group consisting of cimene, behenic acid, 2-methoxynaphthalene, thymol and salts thereof can be used for improving skin wrinkles, improving skin moisturizing, Functional foods, medicines or quasi-drugs that provide skin wrinkle improvement, erythema suppression, and / or skin photoaging improvement effects.

The term "cosmetic composition" used in the present invention is a composition containing the above-mentioned compound, and the formulation can be in any form. Examples of such formulations include cosmetic preparations made using the above composition, such as creams such as nutritional creams, eye creams, massage creams, cleansing creams, lotions such as packs, nutritional lotions, essences, softening longevity, A powder, a foundation, a makeup base, and the like, and may be manufactured and commercialized in any form of these formulations in order to achieve the object of the present invention, and the present invention is not limited thereto. Further, the cosmetic composition according to the present invention can be formulated into a usual cosmetic preparation method.

Specifically, the cosmetic composition of the present invention can be used as a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nutrition lotion, a massage cream, a nutrition cream, a moisturizing cream, a hand cream, , An exfoliant, a soap, a shampoo, a cleansing foam, a cleansing lotion, a cleansing cream, a body lotion, a body cleanser, an emulsion, a press powder, a loose powder and an eye shadow.

The cosmetic composition of the present invention may contain, in addition to cimene, behenic acid, 2-methoxynaphthalene, thymol or salts thereof, other excipients such as excipients, carrier and the like, It is possible to do.

Specifically, the cosmetic composition of the present invention may further comprise a transdermal penetration enhancer. As used herein, the term transdermal penetration enhancer is a composition that allows a desired component to penetrate into vascular cells of the skin at a high absorption rate. But are not limited to, other phospholipid components, liposomal components, and the like, preferably used in lecithin cosmetics.

As the oil which can be mainly used as an oil component, at least one selected from vegetable oil, mineral oil, silicone oil and synthetic oil can be used. More specifically, there may be mentioned mineral oil, cyclomethicone, squalane, octyldodecyl myristate, olive oil, Vitisviniferase seed oil, macadamia nut oil, glyceryl octanoate, castor oil, ethylhexyl isononanoate, Chicone, cyclopentasiloxane, sunflower seed oil and the like can be used.

Further, 0.1 to 5% by weight of a surfactant, a higher alcohol and the like may be added to reinforce the emulsifying ability. As such surfactants, conventional surfactants such as nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, phospholipids and the like can be used. Specific examples thereof include sorbitan sesquiunorate, polysorbate 60 Sorbitan stearate, sorbitan stearate, sucrose stearate / sucrose cocoate, glyceryl stearate / polyethylene glycol-100 Stearate, cetearyl-6 olivate, arachidyl alcohol / behenyl alcohol / arachidyl glucoside, polypropylene glycol-26-butes-26 / polyethylene glycol-40 hydrogenated castor oil, have. As the higher alcohol, an alcohol having 12 to 20 carbon atoms such as cetyl alcohol, stearyl alcohol, octyldodecanol, isostearyl alcohol, etc. may be used alone or in admixture of one or more.

In order to control the viscosity or hardness of the water phase, 0.001 to 5% by weight of at least one thickening agent such as carbomer, xanthan gum, bentonite, magnesium aluminum silicate, cellulose gum, dextrin palmitate and the like may be further added.

In addition, the cosmetic composition of the present invention may contain, if necessary, a medicinal ingredient such as higher fatty acids and vitamins, an ultraviolet screening agent, an antioxidant (butylhydroxyanisole, gallic acid propylate, eicosorbic acid, tocopheryl acetatide, (Triethanolamine, citric acid, citric acid, sodium citrate, malic acid, citric acid, etc.), preservatives (methylparaben, butylparaben, propylparaben, phenoxyethanol, imidazolidinyl urea, chlorphenesin and the like) And the like), a humectant (glycerin, sorbitol, propylene glycol, butylene glycol, hexylene glycol, diglycerin, etc.), sodium hydrogen carbonate , Betaine, glycereth-26, methylglucose-20, etc.), lubricant, and the like.

In addition, the cosmetic composition of the present invention further comprises a substance capable of supplementally providing an essential nutrient to the skin, and preferably it may contain an auxiliary agent including, but not limited to, a natural flavor, a cosmetic flavor, have.

In addition, the cosmetic composition of the present invention may further comprise a skin wrinkle improving component or a skin elasticity improving component. The specific skin wrinkle improving component or skin elasticity enhancing component may be one or more selected from the group consisting of vitamin C, retinoic acid, TGF, protein from animal placenta, betulinic acid and chlorella extract, and most preferably, Vitamin C < / RTI >

In an embodiment of the present invention, when cymene or thymol is treated with vitamin C in human skin fibroblasts irradiated with ultraviolet rays, the amount of collagen is measured to be higher than that of cymene, thymol and vitamin C alone (Fig. 1 and Fig. 2).

The present invention also relates to a skin moisturizing composition comprising at least one selected from the group consisting of cimene, behenic acid, 2-methoxynaphthalene, thymol and a pharmaceutically acceptable salt thereof as an active ingredient, (EN) Disclosed is a health functional food composition having an effect of improving skin color, preventing erythema, suppressing skin wrinkles and / or improving skin photoaging.

The above description of "cymene", "behenic acid", "2-methoxynaphthalene", "thymol" and "a pharmaceutically acceptable salt thereof" is as described above.

The term " health functional food " in the present invention refers to a food prepared and processed in the form of tablets, capsules, powders, granules, liquids and rings using raw materials and components having useful functions in the human body. Here, 'functional' refers to the structure and function of the human body to obtain nutritional effects and obtain useful effects for health use such as physiological action. The health functional food of the present invention can be prepared by a method commonly used in the art and can be prepared by adding raw materials and ingredients that are conventionally added in the art. In addition, the formulations of the above health functional foods may also be manufactured without limitations as long as they are acceptable as health functional foods. The health functional food composition of the present invention is advantageous in that it has no side effects that may occur when a medicine is taken for a long time by using a food as a raw material, unlike a general medicine, and is excellent in portability and improves skin moisturization, skin exfoliation, , Erythema suppression, skin wrinkle improvement and / or skin photoaging improvement.

The health functional food composition of the present invention may be prepared in any one form selected from the group consisting of tablets, granules, powders, capsules, liquid solutions and rings.

The health functional food composition according to the present invention can be used as an active ingredient in the form of a powder, a liquid, a tablet, a soft capsule, a granule, a tea bag or the like containing cymene, behenic acid, 2-methoxynaphthalene, , An instant tea or a drink, and the like. The content of cymene, behenic acid, 2-methoxynaphthalene or thymol as an active ingredient can be appropriately determined depending on the intended use (for prevention or improvement). Generally, the amount of cymene, behenic acid, 2-methoxynaphthalene or thymol contained in the health functional food composition may be 0.1 to 90% by weight of the total food weight. However, in the case of long-term consumption intended for health and hygiene purposes or for health control purposes, the amount may be less than the above range. In addition, the health functional food composition according to the present invention may have a synergistic effect on the main effect, in addition to cement, behenic acid, 2-methoxynaphthalene or thymol within the range not impairing the main effect of the present invention And other natural components such as wrinkle-improving compounds such as vitamin C or green tea extract, mulberry extract, licorice extract, bark extract, bingo extract, golden extract, and wild ginseng extract.

The health functional food composition formulated in the above-described form can be added directly to the food or can be used together with other food or food ingredients, and can be suitably used according to a conventional method. Examples of food products include dairy products including drinks, meat, sausage, bread, biscuits, rice cakes, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gums, ice cream, soups, , Dairy products and dairy products, and all health functional foods in the ordinary sense are included.

When the health functional food composition of the present invention is a drink, it contains cymene, behenic acid, 2-methoxynaphthalene or thymol as essential components in the indicated ratios, and there are special restrictions on other ingredients used for the purpose of producing other drinks And may contain various flavoring agents or natural carbohydrates as additional ingredients such as ordinary beverages. Examples of such natural carbohydrates include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose and the like; And polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol and erythritol. Natural flavors and synthetic flavors and the like can be used as the flavors other than those described above. The ratio of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the composition of the present invention.

In addition, the health functional food composition of the present invention can be used as a nutritional supplement, a vitamin, a mineral (electrolyte), a flavor such as a synthetic flavor and a natural flavor, a coloring agent and a thickening agent (cheese, chocolate etc.), a pectic acid and its salt, And salts thereof, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in carbonated drinks, and the like. In addition, the inventive food composition of the present invention may contain natural fruit juice and pulp for the production of fruit juice drinks and vegetable drinks. These components may be used independently or in combination. The proportion of such additives is not critical, but is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of the cement, behenic acid, 2-methoxynaphthalene or thymol of the present invention.

The present invention also relates to a cosmetic composition comprising at least one selected from the group consisting of cymene, behenic acid, 2-methoxynaphthalene, thymol and salts thereof as an active ingredient to improve skin moisturizing, skin exfoliation, skin elasticity, A quasi-drug or a pharmaceutical composition having an effect of improving skin wrinkles and / or improving skin photoaging.

The descriptions of the above-mentioned "cymene", "behenic acid", "2-methoxynaphthalene", "thymol" and "salts thereof" are as described above.

When cymene, behenic acid, 2-methoxynaphthalene, thymol, or a pharmaceutically acceptable salt thereof of the present invention is used as a medicine, it may further contain one or more active ingredients exhibiting the same or similar functions. For example, a known skin wrinkle-improving component or elasticity-enhancing component may be included. The addition of the additional skin wrinkle improving ingredient and the elasticity enhancing ingredient can further improve the wrinkle improving and elasticity improving effect of the composition of the present invention. When the above ingredients are added, skin safety, easiness of formulation, and stability of effective ingredients can be considered according to the combined use. In one embodiment of the present invention, the pharmaceutical composition is a wrinkle-improving ingredient known in the art, and includes at least one selected from the group consisting of vitamin C, retinoic acid, TGF, protein from animal placenta, betulinic acid and chlorella extract And may further comprise a skin wrinkle improving ingredient. The additional skin wrinkle improving ingredient may be contained in an amount of 0.0001 to 10% by weight based on the total weight of the composition, and the above content range may be determined according to requirements such as collagen synthesis promoting activity, skin safety, Can be adjusted accordingly.

In addition, the pharmaceutical composition for improving skin wrinkles and improving elasticity of the present invention may further comprise a pharmaceutically acceptable carrier.

Pharmaceutically acceptable carriers may contain a variety of ingredients such as buffer, injectable sterile water, normal saline or phosphate buffered saline, sucrose, histidine, salts and polysorbates.

The pharmaceutical composition of the present invention can be administered orally or parenterally, and can be administered in the form of a general pharmaceutical preparation, for example, various forms of oral and parenteral administration at the time of clinical administration. In the case of formulation, , An extender, a binder, a wetting agent, a disintegrant, a surfactant, and the like.

Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may be prepared by mixing the pharmaceutical composition of the present invention with at least one excipient such as starch, calcium carbonate, Sucrose, lactose, gelatin, and the like.

In addition to simple excipients, lubricants such as magnesium stearate talc are also used. Examples of the liquid preparation for oral use include suspensions, solutions, emulsions, and syrups. In addition to water and liquid paraffin, simple diluents commonly used, various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included .

Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. Examples of suppository bases include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like.

When the pharmaceutical composition of the present invention contains an effective amount of cement, behenic acid, 2-methoxynaphthalene, thymol, or a pharmaceutically acceptable salt thereof, it is desirable to provide a composition for improving skin moisturizing, skin exfoliation, skin elasticity, Wrinkle improvement or skin photo-aging improvement effect can be provided. In the present invention, the term "effective amount" refers to the amount of a compound capable of inhibiting or inhibiting the generation of wrinkles of the skin or alleviating the wrinkles already formed. The effective amount of cymene, behenic acid, 2-methoxynaphthalene, thymol, or a pharmaceutically acceptable salt thereof contained in the composition of the present invention can be appropriately determined depending on the form in which the composition is produced, the method in which the compound is applied to the skin, Will vary. For example, when the composition is commercialized as a medicament for dermatological treatment due to wrinkles of skin, reduction of elasticity, stain, etc., it is more preferable to use cement, behenic acid, -Methoxynaphthalene, thymol, or a pharmaceutically acceptable salt thereof.

The term "quasi-drug product" used in the present invention means products that are less active than drugs, among the products used for diagnosing, treating, improving, alleviating, treating or preventing diseases of human or animal. For example, Quasi-drugs are products that are used for the purpose of treating or preventing diseases of humans or animals, products that are mild or have no direct action on the human body.

The quasi-drug composition of the present invention is used for the purpose of improving skin moisturization, removing horny skin, enhancing skin elasticity, suppressing erythema, improving skin wrinkles and / or improving skin photoaging, and there is no particular limitation in its formulation, A lotion, an ointment, a gel, a cream, a patch or a spray, or a cosmetic composition having the form of a softening agent, a softening agent, a nutrient lotion, a massage cream, a nutritional cream, a pack, a mask pack, a mask sheet, ≪ / RTI >

In addition, the quasi-drug composition in each formulation can be blended by arbitrarily selecting other components according to the formulation of the other quasi-drugs, the purpose of use, and the like. The mixing amount of the active ingredient can be appropriately determined according to the intended use (inhibition or relaxation). For example, conventional adjuvants such as thickeners, stabilizers, solubilizers, vitamins, pigments and flavors, and carriers and the like.

The content of cymene, behenic acid, 2-methoxynaphthalene, thymol or a salt thereof of the present invention is preferably 0.0001 to 20% by weight based on the total weight of the quasi-drug composition. When it is more than 20% by weight, the color and stability are poor when the composition is prepared, and when it is less than 0.0001%, the effect is insignificant.

In addition, in the quasi-drug composition of each formulation, components other than the above-mentioned essential components may be mixed and selected without difficulty by those skilled in the art depending on the formulation or purpose of use.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

The efficacy of p-cymene or thymol for wrinkle improvement using human skin fibroblast

1-1. Experimental Method

1) Cell culture

Human dermal fibroblast (nor mal, human, neonatal, ATCC No. PCS-201-010) was purchased from ATCC (Manassas, VA, USA). The cells were cultured in a 5% CO ₂ incubator at 37 ° C using a fibroblast growth medium (Promo Cell, Heidelberg).

2) Procollagen Type I C-peptide (PIP) concentration measurement

To examine the collagen biosynthesis performance, human fibroblasts were added to a 12-well plate at a density of 1.0 × 10 ⁶ cells / well and p-cymene, thymol and vitamin C were added at a concentration of 100 μM, respectively, Lt; / RTI > in a CO ₂ incubator. After removing the media from each well, the plate was washed once with PBS, and 1 ml of PBS was added thereto. Ultraviolet B (UVB) was then irradiated at 20 mJ / cm ² . PBS was re-cultured for 24 hours, and the amount of procollagen secreted into the medium was measured using procollagen type C-peptide EIA kit (Takara Bio, Japan). The standard solution contained in the collagen measurement kit was diluted by concentration, absorbance was measured at 450 nm to prepare a standard concentration curve and the amount of collagen production was calculated.

1-2. Experiment result

1) Changes in the amount of procollagen secreted

Collagen, the main protein that makes up the skin, is synthesized in the form of procollagen in fibroblasts in the skin dermis and then secreted into the extracellular matrix. Procollagen secreted into the extracellular matrix is broken down by the procollagen peptidase present on the cell surface and is formed into active collagen. Therefore, the active collagen content can be measured by measuring the C-peptide content. Each value of Figures 1 and 2 represents means ± SEM of three measurements from three independent wells. The mean value of the other alphabets is statistically significant (p <0.05). The amount of procollagen type I C-peptide (PIP) secreted into the extracellular matrix of the human skin fibroblasts by treatment with ultraviolet light was measured in the control cells (+ UVB) irradiated with ultraviolet light. -UVB), and the amount of collagen was significantly increased in UV-irradiated cells (CM) treated with p-cimene compared to UV-irradiated control cells (+ UVB) by 11%. On the other hand, the amount of collagen in the cells treated with vitamin C (CM + VitC) was significantly increased by 46% as compared with the UV-irradiated control cells (+ UVB) (+ 11%) compared to the amount of collagen observed in cells treated alone (Figure 1). When these results are assigned to call informality, it can be confirmed that synergy is exhibited when p-cymene and vitamin C are treated together. Thus, p-cymene increases the amount of activated collagen in human dermal fibroblasts, and this collagen-increasing effect is more effective when used with vitamin C.

Likewise, in the cells treated with UV irradiation, the amount of collagen was significantly increased by 22% as compared with the UV irradiated control cells (+ UVB). In the cells treated with vitamin C, the amount of collagen was significantly increased by 52% as compared with UV-irradiated control cells (+ UVB), which was treated with vitamin C (+ 37%) or thymol (+ 22% Which is higher than the amount of collagen observed in the cells (Fig. 2). These results, when assigned to the call informality, show synergistic effects when thymol and vitamin C are treated together. Thus, thymol increases the amount of activated collagen in human dermal fibroblasts, and this collagen-increasing effect appears to be more effective when used with vitamin C.

Evaluation of skin wrinkle, moisturizing and elasticity-enhancing efficacy of experimental materials (p-cymene, behenic acid, 2-methoxynaphthalene or thymol)

2-1. Experimental Method

1) Experimental formula is prepared, raising of experimental animals and ultraviolet irradiation

The 5-week-old female albino hairless mouse (Skh-1) used in this example was purchased from Gyeonggi-do, Korea and subjected to a week of adaptation period with a solid feed. The experimental animals were divided into 4 groups and 5 mice were assigned to each group. All experimental groups were divided into two groups: normal controls (-UVB), UV-irradiated group (UVB), UV irradiated group (pCM, BA, 2MN or TM) or vitamin C I divided it. During the breeding period, feed and water were freely consumed. The temperature was maintained at 22 ± 1 ° C, the humidity was maintained at 60 ± 5%, and the light period and the dark cycle were adjusted to 12 hours each day.

-UVB group and + UVB group were fed a purified diet prepared according to AIN-93 rodent diet composition (Ree ves, PG et al., J Nutr, 123: 1939-1951, 1993) (Sigma-Aldrich), 2-methoxynaphthalene (Sigma-Aldrich) or thymol (Sigma-Aldrich), and the VitC group was treated with AIN-93 tablet The diets were supplemented with 0.2% vitamin C (Sigma-Aldrich) for 10 weeks. The composition of the experimental diet is shown in Table 1 below. Diets were supplied daily with water between 10 am and 11 am, and the dietary intake was measured daily.

Experimentation table ingredient AIN-93G diet
(g / kg diet) Experimental material
Supplement diet
(CM, BA , 2MN
or TM )
(g / kg diet) Vitamin C
Supplement diet ( VitC )
(g / kg diet) Casein 200 200 200 Maltodextrin 132 132 132 Corn starch 397.486 395.486 395.486 Sucrose 100 100 100 cellulose 50 50 50 Soybean oil 70 70 70 Vitamin complex 10 10 10 Mineral complex 35 35 35 Colin Beavertre 2.5 2.5 2.5 L-cystine 3 3 3 Tert-butyhydroquinone 0.014 0.014 0.014 The experimental materials (p-cymene, behenic acid, 2-methoxynaphthalene or thymol) - 2 - Vitamin C - - 2 Total (g) 1,000 1,000 1,000

During the experimental period, ultraviolet B (UVB) was irradiated three times a week on the back of the hairless mice. The amount of ultraviolet irradiation was 73 mJ / cm ² for the first week, 146 mJ / cm ^{2 for the second} week, 219 mJ / cm &lt; ^{2 &} gt ;. Body weight and skin thickness were measured weekly during the breeding, and photographs of the back skin were taken. The skin thickness was measured in the buttocks of reared mice using a digital micro caliper (Marathon Watch Company Ltd., Ontario, Canada). The calipers used in the measurement were able to measure up to 0.01 mm and had a control function to apply constant force to the thickness, and it was possible to measure the skin thickness under the same force.

On the last day of the experiment, the animals were sacrificed for 6 hours and anesthetized, blood and skin tissue were collected. Blood samples were collected from the abdominal subclavian vein using a syringe and placed in EDTA coated tubes. After centrifugation at 2,000 × g for 15 minutes, the plasma was separated and stored frozen at -70 ° C. until analysis. Some of the skin tissues were immediately stored in a -70 ° C freezer and used for molecular biology. Some were fixed in 10% formalin solution and used for immunohistochemical staining.

2) Skin moisturizing, elasticity and erythema index measurement

The skin moisture content, water evaporation, elasticity and erythema index of the experimental animals were measured once at the end of the experiment using Corneometer®, Tewameter®, Cutometer®, and Mexameter® (CK Electronics GmbH), respectively. In the measurement, the numerical value obtained by lightly pressing a certain portion of the test animal or the like was recorded.

3) Wrinkle measurement of skin tissue

The skin of hairless mice exposed to ultraviolet rays for 10 weeks was simulated with silicone rubber to measure the degree of formation of wrinkles. A disk with a circular hole with a diameter of 1 cm was attached to the back part of the hairless mouse, and the reagent for preparing the simulated plate was mixed and thinly spread on the back part of the hairless mouse, completely dried, and then carefully peeled off the disk, Respectively. The temperature of the simulated plate was 20 ~ 23 ℃ and the humidity was 45 ~ 50%. The impression material (Epigem, Seoul, Korea) was used for simulating plate. Using the computerized image analyzer (Visioline VL650, CK electronic GmbH, Germany), the total wrinkle area, max wrinkle depth, mean depth and mean And length (mean length).

4) Immunohistochemical staining of skin tissue

(H & E) and Masson 's trichrome (M & T) staining were performed on a light microscope (IX71, Olympus, JPN) and photographed using a digital camera (DP71, Olympus, JPN).

5) RT-PCR analysis

The tissue was pulverized by adding 1 ml of Trizol solution per 0.1 g of skin tissue, and centrifuged at 12,000 xg for 10 minutes at 4 ° C. The supernatant was transferred to a new tube and 200 μl of chloroform was added and vortexed. This process was repeated twice, and the supernatant was transferred to a new tube, and isoprophanol and supernatant were added at a ratio of 1: 1. After 10 minutes of shaking, the mixture was allowed to stand at room temperature for 15 minutes, centrifuged at 12,000 xg for 10 minutes at 4 ° C, and the supernatant was removed. 1 ml of 70% ethanol was added to the remaining precipitate, Gt; min. &Lt; / RTI &gt; After removing the ethanol, the tube containing the RNA precipitate was dried at room temperature for 15 minutes, and the RNA pellet was dissolved using nuclease free water. The concentration of RNA extracted at 260 nm and 280 nm wavelength was measured using a UV / VIS spectrophotometer (Beckman coulter, DU730) and agarose gel electrophoresis was performed to confirm the integrity of the RNA sample.

(GIBCO BRL, Gaithersburg, Md., USA). The reverse transcription was performed using oligo dT primer and superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA). PCR was carried out using 5 'and 3' flanking sequences of the cDNA to be amplified as a template, using the cDNA obtained from the reverse transcription as a template. The primer sequences used at this time are shown in Table 2. 1 μl of the amplified PCR product was electrophoresed on 1% agarose gel to confirm the DNA band.

The primer sequences used for RT-PCR gene primer The sequence (5 '- &gt; 3') Annealing temperature
(° C) PCR product
(bp) Collagen type I
alpha1 (Col1? 1) F ggcaacagtcgcttcaccta
(SEQ ID NO: 1) 55
164
R agtccgaattcctggtctgg
(SEQ ID NO: 2) Collagen type I
alpha2 (Col1? 2) F cggttctgttggtcctgttg
(SEQ ID NO: 3) 55
103
R acccctgtgccctttatcac
(SEQ ID NO: 4) Collagen type Ⅲ
alpha1 (Col3? 1) F taaccaaggctgcaagatgg
(SEQ ID NO: 5) 55
104
R accagtgcttacgtgggaca
(SEQ ID NO: 6) Matrix
metallopeptidase 1a (MMP-1a) F ccctgtgtttcacaacggag
(SEQ ID NO: 7) 55
133 R cctcagcttttcagccatca
(SEQ ID NO: 8) Matrix
metallopeptidase 1b (MMP-1b) F tttgctcatgcttttctgcc
(SEQ ID NO: 9) 55
146
R gaatgggagagtccaaggga
(SEQ ID NO: 10) Matrix
metallopeptidase 3 (MMP-3) F tgctggtatggagcttctgc
(SEQ ID NO: 11) 55
142
R catctccaacccgaggaact
(SEQ ID NO: 12) Matrix
metallopeptidase 9 (MMP-9) F gtggaccatgaggtgaacca
(SEQ ID NO: 13) 55
102
R actgcacggttgaagcaaag
(SEQ ID NO: 14) Glyceraldehyde
3-phosphate
dehydrogenase
(GAPDH) F ggagattgttgccatcaacg
(SEQ ID NO: 15) 55
122
R tgacaagcttcccattctcg
(SEQ ID NO: 16)

2-2. Experiment result

1) Weight and dietary intake of reckless mice

The intake of ultraviolet light, p-cymene, behenic acid, 2-methoxynaphthalene, thymol and vitamin C did not significantly affect body weight and dietary intake of reared mice (Figs. 3 to 6). The values in Figures 3 to 6 are the mean ± SEM of 5 mice.

2) Changes in water content, elasticity and erythema index of ultraviolet irradiated mouse skin

The moisture content and elasticity of the skin tissues were significantly decreased while the moisture evaporation and erythema indexes were significantly increased compared with the normal group (-UVB) not irradiated with ultraviolet light for 10 weeks in the UV-irradiated control group (Fig. 7 To 10). In the case of p-cymene (CM), water content and elasticity were significantly increased by 97% and 81%, respectively, compared to the + UVB control group, while the water evaporation and erythema indexes were 53 % And 29%, respectively (Fig. 7).

In the case of behenic acid-containing group (BA), moisture content and elasticity were significantly increased by 91% and 99%, respectively, compared with the + UVB control group, and the moisture evaporation and erythema indexes were 56 % And 30%, respectively (Fig. 8).

In the case of 2-methoxynaphthalene-supplemented group (2MN), moisture content and elasticity were significantly increased by 95% and 79%, respectively, compared with the + UVB control group, Were significantly reduced by 57% and 31%, respectively (FIG. 9).

In the TM (TM) group, the moisture content and elasticity were significantly increased by 107% and 76%, respectively, and the water evaporation and erythema indices were 51% And 29%, respectively (Fig. 10).

The values in Figures 7 to 10 are the mean ± SEM of 5 mice and the alphabet on the bar represents a significant difference by one-way ANOVA followed by Duncan's multiple range test (p < 0.05).

3) Changes in skin wrinkle formation in ultraviolet irradiated mice

To evaluate the effect of p-cymene, behenic acid, 2-methoxynaphthalene or thymol ingestion on the degree of skin wrinkles, the back skin area of the experimental animals was photographed. The + UVB control group, which was irradiated with UVB for 10 weeks, was able to visually observe the formation of fine wrinkles with many coarse and deep wrinkles compared with the normal UV group (-UVB) , 2-methoxynaphthalene, or thymol-supplemented group, the thickness and depth of the wrinkles were remarkably decreased compared with the + UVB control group, and it was confirmed that the wrinkles were improved in a similar manner to the skin condition observed in the unexposed UVB group To 14).

As a result of the measurement of the degree of wrinkle formation, the + UVB control group was thicker and deeper than the non-UV irradiated normal group (-UVB) And the wrinkles were formed with fine wrinkles. In the p-cymene, behenic acid, 2-methoxynaphthalene, or thymol-supplemented groups, deep wrinkles almost disappeared compared to the + UVB- It was confirmed that the thickness and depth of the wrinkles were remarkably improved (Figs. 15A, 16A, 17A, and 18A). The results of the numerical analysis of the degree of wrinkle formation in the simulated plate using a computerized image analyzer showed that the CM group had a total wrinkle area of 60%, a maximum wrinkle depth of 66%, an average wrinkle depth of 33%, and an average wrinkle The length was significantly reduced by 63%, and the wrinkle-reducing effect of such p-cymene was similar to the wrinkle-reducing effect observed in vitamin C (FIG. 15B).

In the BA group, the total wrinkle area was 56%, the maximum wrinkle depth was 68%, the average wrinkle depth was 44%, and the average wrinkle length was significantly reduced by 71% compared to the + UVB group. Was similar to the wrinkle-reducing effect observed with vitamin C (Fig. 16B).

In the 2MN group, the total wrinkle area was 76%, the maximum wrinkle depth was 69%, the average wrinkle depth was 47%, and the average wrinkle length was significantly reduced by 74% compared with the + UVB group. Such 2-methoxynaphthalene The wrinkle-reducing effect was similar to the wrinkle-reducing effect observed with vitamin C (Fig. 17B).

In the TM group, the total wrinkle area was 73%, the maximum wrinkle depth was 59%, the average wrinkle depth was 43%, and the average wrinkle length was significantly reduced by 69% compared to the + UVB group. Similar to the wrinkle-reducing effect observed in vitamin C (Fig. 18B).

Values of Figures 15B, 16B, 17B and 18B are mean ± SEM of 5 mice and the alphabet on the bar represents a significant difference by one-way ANOVA followed by Duncan's multiple range test (p < 0.05 ). Therefore, it can be seen that the ingestion of p-cymene, behenic acid, 2-methoxynaphthalene or thymol has an effect of remarkably suppressing the generation of wrinkles by ultraviolet irradiation.

4) Changes in skin thickness of ultraviolet irradiated mice

As the photoaging by ultraviolet rays proceeds, the formation of the stratum corneum is increased to thicken the skin to protect the skin dermis layer, and thus the thickness of the skin skin layer is increased by ultraviolet irradiation, which means that skin damage due to photoaging is large J Molecular mechanism of skin aging Mech Ageing Dev. 123: 801-810, 2002).

The thickness of the back skin was measured using a digital micro caliper on the last day of the experiment. As a result, the + UVB control group showed a significant increase in the skin thickness compared with the normal UV group (-UVB), and the p-cymene, The skin thicknesses of 2-methoxynaphthalene or thymol-treated groups were significantly reduced by 22%, 19%, 16% and 14%, respectively, compared to the + UVB control group (Figs. 19A, 20A, 21A and 22A). Figures 19A, 20A, 21A and 22A are mean ± SEM of 5 mice, and the alphabets on the bar represent significant differences by one-way ANOVA followed by Duncan's multiple range test (p < 0.05 ).

As a result of observing the skin surface layer thickness of hairless mice through H & E staining of skin tissues, it was observed that the skin surface layer was thickened compared to the normal group (UVB) not exposed to ultraviolet rays in the + UVB control group, In the case of 2MN and TM groups, it was confirmed that the thickened skin layer was significantly reduced by ultraviolet irradiation (FIGS. 19B, 20B, 21B and 22B).

5) Quantity and morphology of collagen fibers in dermal layer of ultraviolet irradiated mice

In the case of skin that has undergone photoaging by ultraviolet irradiation, the collagen fiber network of the epidermal-dermal binding site is damaged, and therefore the amount and shape of the collagen fiber is used as a skin photoaging index (Varani et al., "Inhibition of type I procollagen synthesis damaged collagen in photoaged skin and collagenase-degraded collagen in vitro. "The American Journal of pathology 158: 931-942, 2001). Ultrastructural examination of collagen fibers stained with Masson's trichrome showed that the anionic blue-colored collagen fibers were observed in the dermal layer under the epidermis of the UVB group, but UVB In the UVB group were weakly stained with aniline blue. In the case of UVB-irradiated mice fed with p-cymene, behenic acid, 2-methoxynaphthalene or thymol for 10 weeks, the densities of the dermal collagen fibers were relatively denser than those of the control group irradiated only with ultraviolet light, (-UVB) (Figs. 23 to 26).

6) Changes in gene expression in ultraviolet irradiated mouse skin

Collagen type 1 and 3 are proteins that constitute the epidermal component of the dermal layer. In particular, type 1 collagen is present in the largest amount among the extracellular matrix proteins present in the connective tissue of the skin. Meanwhile, 23 types of MMPs catalyzing collagen degradation exist in mammals. MMP types 1, 3 and 9 are known to increase by ultraviolet rays. These three types of MMPs are enzymes that degrade collagen type 1 and 3 to be. It is known that MMP-1 cleaves the middle of collagen fibers while MMP-3 and MMP-9 cleave the cut collagen fibers (Quan T. et al., Elevated matrix metalloproteinases and collagen fragmentation J Dermatological Science 23: S30-S36, 2000). In this study, we have investigated the effects of various types of cytokines in human dermal fibroblast.

As a result of RT-PCR analysis of gene expression in skin tissues, it was found that the + UVB control group had higher collagen type 1α1 and α2, and collagen type 3α1 (compared to -UVB) Expression of MMP-1a and -1b, MMP-3, and MMP-9 gene were significantly increased. On the other hand, the expression of collagen type 1α1 and α2 and collagen type 3α1 was significantly increased in p-cymene, behenic acid, 2-methoxynaphthalene, or thymol-supplemented group compared to the + UVB control group and MMP-1a and -1b, MMP-3, and MMP-9 gene expression were significantly decreased (Figs. 27 to 30). Therefore, it is considered that p-cymene, behenic acid, 2-methoxynaphthalene, or thymol suppresses the formation of wrinkles by irradiation of ultraviolet rays by increasing collagen protein synthesis in skin tissue and inhibiting collagen fiber decomposition.

The above results suggest that p-cymene, behenic acid, 2-methoxynaphthalene or thymol has the effect of preventing or alleviating skin wrinkles caused by ultraviolet rays. In the future, it is expected that the functional cosmetics, health functional foods, medicines or quasi-drugs As a result.

Skin wrinkle improvement, skin irritation and skin exfoliation sensation test

3-1. Nutritional cream containing experimental material ( Experimental Example  1 to 4) and  Preparation of Nutrition Cream Containing No Experimental Material (Comparative Example 1)

number ingredient Experimental Example 1
(weight%) Experimental Example 2
(weight%) Experimental Example 3
(weight%) Experimental Example 4
(weight%) Comparative Example 1
(weight%) One Cetearyl alcohol 1.5 1.5 1.5 1.5 1.5 2 Glyceryl
Stearate One One One One One 3 Polysorbate 60 1.2 1.2 1.2 1.2 1.2 4 Sorbitan
Sesquioleate 0.3 0.3 0.3 0.3 0.3 5 Cetyl octanoate 6 6 6 6 6 6 Squalane 8 8 8 8 8 7 Abcord
Kernel oil 4 4 4 4 4 8 Dimethicone One One One One One 9 Butylene glycol 5 5 5 5 5 10 glycerin 4 4 4 4 4 11 Magnesium aluminum
Silicate 0.2 0.2 0.2 0.2 0.2 12 Xanthan gum 0.05 0.05 0.05 0.05 0.05 13 antiseptic a very small amount a very small amount a very small amount a very small amount a very small amount 14 Purified water Balance Balance Balance Balance Balance 15 p-cymene One - - - - Behenic acid - One - - - 2-methoxynaphthalene - - One - - Thymol - - - One -

Of the components identified by the respective component numbers in Table 3, Components 1 to 8 are first dissolved by heating at a temperature of 70 캜, and then Components 9 to 13 are dissolved and dispersed in Component 14 and emulsified by heating at 70 캜. Thereafter, the emulsified product was cooled to a temperature of 56 ° C, and the component 15 dissolved in the fractionated component 9 was added and stirred, followed by cooling at room temperature to prepare nutritional creams of Experimental Examples 1 to 4.

In Comparative Example 1, the composition and manufacturing method were the same except for the component 15 (p-cymene, behenic acid, 2-methoxynaphthalene or thymol) as an experimental material.

3-2. Wrinkle improvement effect and skin irritation sensory test

In order to evaluate the skin wrinkle-improving effect and skin irritation of the cosmetic composition according to the present invention, a sensory test was performed using the nutritional creams prepared in Experimental Examples 1 to 4 and Comparative Example 1 in Table 3 above.

Specifically, in order to measure the effect of improving the wrinkles of the skin when the nutritional creams of Experimental Examples 1 to 4 and Comparative Example 1 shown in Table 3 were respectively applied to skin, 40 women of 20 to 50 age brackets After dividing into four groups, the nutrient cream (test group) of Experiments 1 to 4 of Table 3 is shown on the left side of the face and the nutritional cream (control group) of Comparative Example 1 of Table 3 is applied to the right side of the face once a day And to use it continuously for the week.

The effect of wrinkle improvement on the skin of the sensory test was relatively evaluated on the basis of the nutritive cream of Comparative Example 1 based on the nutrient cream of Experimental Examples 1 to 4, , Stinging, and erythema. The evaluation was carried out in accordance with the blotting law standards of excellent (5 points), excellent (4 points), normal (3 points), poor points (2 points) and very poor points (1 point) Respectively. The skin irritation in Table 4 indicates that the higher the score, the less skin irritation. In Table 4 and 5, Comparative Example 1 shows the average value of four persons.

number Skin irritation Experimental Example 1
(CM) Experimental Example 2
(BA) Experimental Example 3
(2MN) Experimental Example 4
(TM) Comparative Example 1 One 5 5 4 4 4.75 2 5 4 5 5 4.5 3 5 5 5 4 4 4 4 4 5 5 4.5 5 5 3 4 4 4 6 4 4 4 3 4 7 5 4 3 4 4.25 8 4 5 5 5 4.75 9 3 4 4 3 4.5 10 5 5 5 5 4 Average 4.5 4.3 4.4 4.2 4.325

number wrinkle improvement Experimental Example 1
(CM) Experimental Example 2
(BA) Experimental Example 3
(2MN) Experimental Example 4
(TM) Comparative Example 1 One 4 5 4 5 4.5 2 4 4 5 5 4.25 3 5 4 5 4 4 4 3 5 4 4 4 5 4 4 5 4 3.75 6 5 4 5 4 3.75 7 4 4 4 3 3.5 8 4 5 5 5 4.25 9 5 5 4 5 4.5 10 5 4 4 5 4 Average 4.3 4.4 4.5 4.4 4.05

As shown in Table 4, the skin irritation evaluation scores for the nutritional cream formulations of Experimental Examples 1 to 4 each containing p-cymene, behenic acid, 2-methoxynaphthalene and thymol were 4.5, 4.3, 4.4 and 4.2, and it was confirmed that skin safety was excellent because skin irritation degree was low similarly to the nutritional cream formulation of Comparative Example 1 which received 4.325 points.

In addition, the nutritional cream of Experimental Examples 1 to 4 containing p-cymene, behenic acid, 2-methoxynaphthalene and thymol, respectively, as compared with the nutritional cream formulation of Comparative Example 1, The formulations were rated 4.3, 4.4, 4.5, and 4.4, respectively, in order (Table 5).

Therefore, the cosmetic composition containing any one or more selected from the group consisting of p-cymene, behenic acid, 2-methoxynaphthalene, thymol and cosmetically acceptable salts thereof of the present invention as an active ingredient has no skin side effect, Wrinkle improvement effect, increase of synthesis of collagen protein and inhibition of decomposition of collagen fiber.

3-3. Increase skin moisture test measurement test

In order to measure the water retention ability of the skin when the nutritional cream of Experimental Examples 1 to 4 and Comparative Example 1 shown in Table 3 were respectively applied to the skin, 40 women of 20 to 50 years old age were distributed evenly After dividing into four groups, the nutrient cream (test group) of Experiments 1 to 4 of Table 3 was applied to the left part of the face and the nutritional cream (control group) of Comparative Example 1 of Table 3 was gently massaged Respectively. Massage was carried out evenly over a minute.

Skin moisture content was measured by using a coneometer in a constant temperature and humidity room at room temperature of 25 캜 and relative humidity of 45% before application. The skin moisture content of each of Experimental Examples 1 to 4 and Comparative Example 1 of Table 3 was measured on the left side And on the right side were rested for 10 minutes after application, and the skin moisture content was measured 12 hours after application and 24 hours after application. The moisture content of the skin was measured using a coneometer (CM820, Courage Khazaka electronic GmbH, Germany) which measures the moisture content of the skin by measuring the skin's electric capacity according to the moisture content of the skin. The coneometer measures the amount of moisture present in the epidermis of the skin by measuring the degree of ion of water using a sensor and numerically expressing the amount of water to calculate the amount of moisture, and the measurement method is as follows.

1) A coneometer probe was placed on the skin area to be measured.

2) When the probe is pressed onto the skin, the electrical conductivity of the skin is quantified through the sensor and displayed on the screen.

3) Measurement was repeated with different measurement sites.

4) After the measurement, the sensor was wiped with a tissue paper such as a kim wipe and then measured again.

The measurement values of Experimental Examples 1 to 4 are the average value of 10 persons for each group, and the measurement value of Comparative Example 1 is the average value of the four groups.

exam
matter Skin moisture (%) Before application After 12 hours After 24 hours Experimental Example 1
(CM) 30.2 43.7 38.2 Experimental Example 2
(BA) 30.1 43.5 38 Experimental Example 3
(2MN) 30.0 43.9 38.5 Experimental Example 4
(TM) 30.0 44.6 38.7 Comparative Example 1 30.1 38.2 30.6

As shown in the above results, when the nutritional cream of Comparative Example 1 was applied, the skin moisture amount was increased to some extent after 12 hours of application, but it returned to a level similar to that before application after 24 hours. On the other hand, when the nutritional cream of Experimental Example 1 containing p-cymene, behenic acid, 2-methoxynaphthalene or thymol, respectively, was applied to the skin, the moisture retention lasted more than 24 hours and the skin moisture- .

3-4. Skin exfoliation effect test

In order to measure the water retention ability of the skin when the nutritional cream of Experimental Examples 1 to 4 and Comparative Example 1 shown in Table 3 were respectively applied to the skin, 40 women of 20 to 50 years old age were distributed evenly After dividing into four groups, the nutrient cream (test group) of Experiments 1 to 4 of Table 3 was applied to the left part of the face and the nutritional cream (control group) of Comparative Example 1 of Table 3 was gently massaged Respectively. Massage was carried out evenly over a minute.

Skin mass mass was measured using a Charm view (Moritex, Japan) in a temperature and humidity chamber at room temperature of 25 ° C and a relative humidity of 45% before application, and compared with Experimental Examples 1 to 4 in Table 3 Example 1 The formulations were applied to the left and right sides of the face, respectively, and the mass of the skin after 24 hours was measured and the skin keratin reduction was calculated. The measured values of Experimental Examples 1 to 4 are the average value of 10 for each group, and the measured value of Comparative Example 1 is the average value of the four groups.

exam
matter Skin mass (%) Before application After 24 hours Skin keratin reduction Experimental Example 1
(CM) 20.3 10.2 10.1 Experimental Example 2
(BA) 20.3 10.4 9.9 Experimental Example 3
(2MN) 20.3 10.6 9.7 Experimental Example 4
(TM) 20.1 9.8 10.3 Comparative Example 1 20.2 15.6 4.6

As shown in the results of Table 7 above, the nutritional creams of Experimental Examples 1 to 4 each containing p-cymene, behenic acid, 2-methoxynaphthalene or thymol were superior to the nutritional cream of Comparative Example 1 . As the moisturizing effect is given to the skin, the respective masses are reduced. The nutritional creams of Experimental Examples 1 to 4 are superior to the nutritional creams of Comparative Example 1 due to their excellent moisture holding ability as demonstrated in Examples 3-3, .

[ Manufacturing example  1] Manufacture of cosmetics

1-1. Production of flexible lotion

A flexible lotion containing p-cymene, behenic acid, 2-methoxynaphthalene or thymol as active ingredients was prepared in the composition shown in Table 8 below.

Furtherance Manufacturing example  1-1 ( weight% ) p-cymene, behenic acid,
2-methoxynaphthalene or thymol 0.1 ethanol 10.0 Polyoxyethylene sorbitan polylauric acid 1.0 Paraoxybenzoic acid methyl 0.2 glycerin 5.0 1,3-butylene glycol 6.0 incense Suitable amount Pigment Suitable amount

1-2. Manufacture of nutrition lotion

A nutritional lotion containing p-cymene, behenic acid, 2-methoxynaphthalene or thymol, respectively, was prepared in the composition shown in Table 9 below.

Furtherance Manufacturing example  1-2 ( weight% ) p-cymene, behenic acid,
2-methoxynaphthalene or thymol 0.05 Vaseline 2.0 Sesquioleic acid sorbitan 0.8 Polyoxyethylene oleylethyl 1.2 Paraoxybenzoic acid methyl Suitable amount Propylene glycol 5.0 ethanol 3.2 Carboxyvinyl polymer 18.0 Potassium hydroxide 0.1 Pigment Suitable amount incense Suitable amount

1-3. Manufacture of nutrition cream

A nutritional cream containing p-cymene, behenic acid, 2-methoxynaphthalene or thymol, respectively, was prepared with the composition shown in Table 10 below.

Furtherance Manufacturing example  1-3 (wt%) p-cymene, behenic acid,
2-methoxynaphthalene or thymol 0.2 Stearic acid 15.0 Cetanol 1.0 Potassium hydroxide 0.7 glycerin 5.0 Propylene glycol 3.0 antiseptic Suitable amount incense Suitable amount Purified water to 100

1-4. Manufacture of packs

A pack containing p-cymene, behenic acid, 2-methoxynaphthalene or thymol, respectively, was prepared with the composition of Table 11 below.

Furtherance Manufacturing example  1-4 ( weight% ) p-cymene, behenic acid,
2-methoxynaphthalene or thymol 0.05 glycerin 5.0 Propylene glycol 4.0 Polyvinyl alcohol 15.0 ethanol 8.0 Polyoxyethylene oleyl ether 1.0 Paraoxybenzoic acid methyl 0.2 Pigment Suitable amount incense Suitable amount

1-5. Manufacture of essences

Essences containing p-cymene, behenic acid, 2-methoxynaphthalene or thymol, respectively, were prepared with the composition shown in Table 12 below.

Furtherance Manufacturing example  1-5 ( weight% ) p-cymene, behenic acid,
2-methoxynaphthalene or thymol 0.2 Propylene glycol 10.0 glycerin 10.0 Sodium hyaluronate aqueous solution (1%) 5.0 ethanol 5.0 Polyoxyethylene hardened castor oil 1.0 Paraoxybenzoic acid methyl 0.1 incense Suitable amount Purified water to 100

[ Manufacturing example  2] Manufacture of health functional foods

2-1. Manufacture of Health Functional Foods

A health functional food containing p-cymene, behenic acid, 2-methoxynaphthalene or thymol, respectively, was prepared with the composition shown in Table 13 below.

Furtherance Manufacturing example  2-1 p-cymene, behenic acid,
2-methoxynaphthalene or thymol 1000 mg Vitamin mixture Suitable amount Vitamin A acetate 1.0 mg Vitamin E 0.13 mg Vitamin B1 0.15 mg Vitamin B2 0.5 mg Vitamin B6 0.2 [mu] g Vitamin B12 10 mg Vitamin C 10 [mu] g Biotin 1.7 mg Nicotinic acid amide 50 [mu] g Folic acid 0.5 mg Calcium pantothenate Suitable amount Mineral mixture Suitable amount Ferrous sulfate 1.75 mg Zinc oxide 0.82 mg Magnesium carbonate 25.3 mg Potassium monophosphate 15 mg Dibasic potassium phosphate 55 mg Potassium citrate 90 mg Calcium carbonate 100 mg Magnesium chloride 24.8 mg

Although the composition ratio of the above-mentioned vitamin and mineral mixture is comparatively mixed with a component suitable for a health functional food as a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above components may be mixed The granules can then be prepared and used in the manufacture of a health functional food composition according to conventional methods.

2-2. Manufacture of health drinks

Health drinks containing p-cymene, behenic acid, 2-methoxynaphthalene or thymol, respectively, were prepared with the compositions of Table 14 below.

Furtherance Manufacturing example  2-2 (mg) p-cymene, behenic acid,
2-methoxynaphthalene or thymol 1000 mg Citric acid 1000 mg oligosaccharide 100 g Plum concentrate 2 g Taurine 1 g Purified water Suitable amount

The above components were mixed according to a conventional health drink manufacturing method, and the resulting solution was stirred and heated at 85 DEG C for about 1 hour. The resulting solution was filtered and sterilized in 21 containers for sterilization, Used in the manufacture of health beverage compositions. Although the composition ratio is a mixture of the components suitable for the preferred beverage as a preferred embodiment, the compounding ratio may be arbitrarily varied depending on the regional and national preferences such as the demand level, the demanding country, and the intended use.

2-3. Manufacture of tablets

Tablets containing p-cymene, behenic acid, 2-methoxynaphthalene or thymol, respectively, were prepared according to a conventional tablet preparation method with the composition shown in Table 15 below.

Furtherance Manufacturing example  2-3 (mg) p-cymene, behenic acid,
2-methoxynaphthalene or thymol 100 mg Corn starch 100 mg Lactose 100 mg Magnesium stearate 2 mg

2-4. Preparation of capsules

Capsules containing p-cymene, behenic acid, 2-methoxynaphthalene or thymol were prepared in the form of a tablet according to the following Table 16 in a gelatin capsule according to a conventional capsule preparation method.

Furtherance Manufacturing example  2-4 (mg) p-cymene, behenic acid,
2-methoxynaphthalene or thymol 100 mg Corn starch 100 mg Lactose 100 mg Magnesium stearate 2 mg

2-5. Manufacture of rings

In the composition shown in Table 17 below, a ring was prepared so as to be 4 g per ring according to a conventional ring production method.

Furtherance Manufacturing example  2-5 (mg) p-cymene, behenic acid,
2-methoxynaphthalene or thymol 1 g Lactose 1.5 g glycerin 1 g Xylitol 0.5 g

2-6. Manufacture of granules

In the composition shown in the following Table 18, 100 mg of 30% ethanol was added and the mixture was dried at 60 캜 to form granules, which were then filled in bubbles to prepare granules.

Furtherance Manufacturing example  2-6 (mg) p-cymene, behenic acid,
2-methoxynaphthalene or thymol 150 mg Soybean extract 50 mg glucose 200 mg Starch 600 mg

[ Manufacturing example  3]

Manufacture of ointment for external skin

A skin external ointment containing p-cymene, behenic acid, 2-methoxynaphthalene or thymol was prepared with the composition shown in Table 19 below.

Furtherance Manufacturing example  3 ( weight% ) p-cymene, behenic acid,
2-methoxynaphthalene or thymol 0.5 Diethyl sebacate 8.0 Nonsense 5.0 Polyoxyethylene oleyl ether
Phosphate 6.0 Sodium benzoate Suitable amount

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> Composition having effects of skin moisturizing, exfoliating,          improving skin elasticity, inhibiting erythema, anti-wrinkle or          improving skin photo-making at least one selected from          the group consisting of cymene, behenic acid,          2-methoxynaphthalene, thymol and salts thereof <130> 1060479 <160> 16 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen type 1 alpha 1 forward primer <400> 1 ggcaacagtc gcttcaccta 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen type 1 alpha 1 reverse primer <400> 2 agtccgaatt cctggtctgg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen type 1 alpha 2 forward primer <400> 3 cggttctgtt ggtcctgttg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen type 1 alpha 2 reverse primer <400> 4 acccctgtgc cctttatcac 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen type 3 alpha 1 forward primer <400> 5 taaccaaggc tgcaagatgg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen type 3 alpha 1 reverse primer <400> 6 accagtgctt acgtgggaca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMP-1a forward primer <400> 7 ccctgtgttt cacaacggag 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMP-1a reverse primer <400> 8 cctcagcttt tcagccatca 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMP-1b forward primer <400> 9 tttgctcatg cttttctgcc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMP-1b reverse primer <400> 10 gaatgggaga gtccaaggga 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMP-3 forward primer <400> 11 tgctggtatg gagcttctgc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMP-3 reverse primer <400> 12 catctccaac ccgaggaact 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMP-9 forward primer <400> 13 gtggaccatg aggtgaacca 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MMP-9 reverse primer <400> 14 actgcacggt tgaagcaaag 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 15 ggagattgtt gccatcaacg 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 16 tgacaagctt cccattctcg 20

Claims (10)

The cosmetic composition according to claim 1, wherein the cosmetic composition contains at least one selected from the group consisting of cymene, behenic acid, 2-methoxynaphthalene, thymol and cosmetically acceptable salts thereof as an active ingredient Wherein the composition has at least one effect selected from the group consisting of an increase in the amount of procollagen secretion, an acceleration of collagen biosynthesis, a decrease in expression of the MMP-1 gene, and an inhibition of skin thickening of the skin surface. , Erythema suppression, skin wrinkle improvement or skin photoaging improvement. The cosmetic composition according to claim 1, wherein the cement, behenic acid, 2-methoxynaphthalene, thymol or a cosmetically acceptable salt thereof is contained in an amount of 0.0001 to 20% by weight based on the total weight of the composition. The composition according to claim 1, wherein the composition is at least one selected from the group consisting of a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizer, a nutrition lotion, a massage cream, a nutritional cream, And is characterized in that it is made of any one of the formulations selected from the group consisting of mask sheet, exfoliating agent, soap, shampoo, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, emulsion, press powder, loose powder and eye shadow / RTI &gt; The cosmetic composition according to claim 1, wherein the composition further comprises a skin wrinkle improving component. [Claim 5] The method of claim 4, wherein the skin wrinkle improving component further comprises at least one member selected from the group consisting of vitamin C, retinoic acid, transforming growth factor (TGF), protein from animal placenta, betulinic acid and chlorella extract &Lt; / RTI &gt; The composition according to any one of claims 1 to 3, which comprises as an active ingredient at least one selected from the group consisting of cymene, behenic acid, 2-methoxynaphthalene, thymol and a pharmaceutically acceptable salt thereof, Wherein the composition has at least one effect selected from the group consisting of an increase in collagen secretion, an increase in collagen biosynthesis, a decrease in expression of MMP-1 gene, and an inhibition of skin thickening of skin. A skin wrinkle, or a skin photoaging effect. The health functional food composition according to claim 6, wherein the composition is one selected from the group consisting of tablets, granules, powders, capsules, liquid solutions and rings. 7. The health functional food composition according to claim 6, wherein the composition further comprises a skin wrinkle improving ingredient. [Claim 9] The method of claim 8, wherein the skin wrinkle improving component further comprises at least one selected from the group consisting of vitamin C, retinoic acid, transforming growth factor (TGF), protein from animal placenta, betulinic acid and chlorella extract &Lt; / RTI &gt; The pharmaceutical composition according to claim 1, which contains, as an active ingredient, at least one selected from the group consisting of cymene, behenic acid, 2-methoxynaphthalene, thymol and salts thereof, Promoting collagen biosynthesis, decreasing the expression of the MMP-1 gene, and inhibiting the skin surface layer thickening. The present invention provides a skin moisturizing effect, skin exfoliation, skin elasticity enhancement, erythema suppression, Or a skin anti-aging effect.

Images