KR101787319B1 - Composition comprising Cinchonine or as active ingredients for anti-wrinkle, skin moisturizing, improving skin elasticity, exfoliating, inhibiting erythema or improving skin photo-aging - Google Patents

Abstract

The present invention relates to a cosmetic composition for improving skin wrinkles, elasticity enhancement, skin moisturizing enhancement, exfoliation, erythema suppression or skin photoaging improvement comprising Cinchonine or a salt thereof as an active ingredient; And health functional food compositions. More specifically, the synonin according to the present invention has an effect of increasing procollagen secretion amount, promoting collagen biosynthesis, decreasing the expression of MMPs gene, decreasing the expression of elastin gene, suppressing erythema, It is effective for improvement of wrinkles of skin, improvement of elasticity, improvement of moisturizing, exfoliation, suppression of erythema or improvement of skin photoaging.

Description

TECHNICAL FIELD The present invention relates to a composition for improving skin wrinkles, moisturizing, elasticity enhancement, exfoliation, erythema suppression or skin photoaging, which comprises Cinchonine or a salt thereof as an active ingredient. improving skin elasticity, exfoliating, inhibiting erythema or improving skin photo-aging}

The present invention relates to a cosmetic composition for improving skin wrinkles or elasticity comprising Cinchonine or a cosmetically acceptable salt thereof as an active ingredient.

Recent advances in medical technology have led to increased interest in skin care and health as life expectancy has been extended and quality of life has been improved and the desire for a healthy and beautiful life has increased. Various cosmetic functional cosmetics have been developed for the purpose of maintaining a healthy skin, and researches for prevention of skin wrinkle formation, mitigation and improvement have been actively carried out. In addition, recently, cosmetic ingredients reach skin dermis and there is a limitation in supplying nutrients. As a result of the change in perception that ingestion of nutrients or functional ingredients to the skin can provide a skin cosmetic enhancement effect, JNutr, 132, 3090-3097 (2002), Tanno, O. et al., ≪ RTI ID = 0.0 > al., ≪ / RTI & , Nicotinamide increases biosynthesis of ceramides as well as other stratum corneum lipids to improve the epidermal permeability barrier (Br J Derm, 143, 524-531, 2000).

The skin consists largely of epidermis, dermis, and hypodermis. The epidermis, especially the stratum corneum, which is the outermost layer of the epidermis, acts as a skin barrier to inhibit the loss of moisture and electrolytes from the skin. While the dermis, through the synthesis of collagen and elastin, maintains the elasticity of the skin and supports the structure. In other words, collagen and elastin are the main proteins produced in fibroblasts, which are involved in the mechanical durability of the skin, the binding force and the resilience of tissues (Moskowit, RW et al, Role of collagen hydrolysate in bone and joint disease, Semin Arthritis Rheu, 87, 2000). Collagen forms a variety of isoforms depending on its morphology and structural characteristics. There are 28 types of collagen isotypes in human tissues, including collagen types 1, 3. 6. 7. 13, 14, 17 are known. Collagen type 1 and 3 form the intercellular component of the dermis, while collagen type 7 is the main component of the dermal and epidermal junction (Pei, M. et al., Expression of collagen type I, II and III in the loose body of osteoarthritis, J. Orthop. Sci., 5: 288, 2000).

In skin connective tissue, type I collagen is the most abundant of extracellular matrix proteins, and other proteins such as elastin, fibronectin, integrin, fibrillin, and proteoglycans exist. The newly synthesized procollagen is secreted into the extracellular space of the skin cells through enzymatic reaction and forms a microfibril of a triple helix configuration. The microfibrils combine with leucine-rich small proteoglycans to form a fibril. As a result, these fibrils aggregate to form collagen fibers that provide skin's binding and elasticity (Bateman, J. F. et al., Collagen superfamily. Extracellular matrix, Harwood, New York, 2, 22-26, 1996).

Skin aging is known to be caused by a decrease in collagen content, which is the protein that occupies most of the collagen in skin dermal tissue. Since collagen gives skin tension and strength, collagen reduction has a very deep relationship with skin aging and wrinkle formation have. Skin aging is largely divided into endogenous aging by physiological aging and photoaging caused by continuous exposure to ultraviolet radiation (UV). Repeated exposure to ultraviolet light results in increased collagenase and denaturation and destruction of collagen fibers, reducing skin elasticity and promoting the production of wrinkles. In other words, the development of reactive oxygen species (ROS) is increased in the skin tissue exposed to ultraviolet rays continuously, and the signal transduction system mediated by epidermal growth factor receptor (EGF-R), tumor necrosis factor (TNF) (Sachsenmaier, C. et al., Involvement of growth factor receptors in the mammalian UVC response. Cell, 78: 963-972, 1994; Dy, LC et al., Augmentation of Activation of these receptors results in mitogen-activated protein kinase (MAPK) activity, resulting in the activation of these receptors by ultraviolet radiation-induced tumor necrosis factor production by the epidermal platelet-activating factor receptor. J. Biol. Chem .: 274, 26917-2692 (AP-1) and nuclear factor κB (NF-κB), resulting in the activation of proteins that mediate the downstream signaling pathways involved. Induce and ma promotes the activity of collagenase such as trix metalloproteinase (MMPs), thereby reducing skin elasticity and promoting wrinkle formation (Kang, S. et al., Inflammation and extracellular matrix degradation mediated by activated transcription factors nuclear factor -KB and activator protein-1 in Inflammatory acne lesions in vivo, Am J. Pathol., 166: 1691-1699, 2005). AP-1 regulates the expression of a number of genes involved in cell growth and differentiation and strongly regulates the expression of some MMPs. Among MMPs whose expression is regulated by AP-1, MMP-1 is known as collagenase 1, and type 1 and 3 collagen are substrates.

The present invention is to provide a cosmetic composition for improving skin wrinkles or elasticity comprising Cinchonine or a cosmetically acceptable salt thereof as an active ingredient.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

The present invention provides a cosmetic composition for skin wrinkle improvement or elasticity enhancement comprising Cinchonine or a cosmetically acceptable salt thereof as an active ingredient.

(I) increased secretion of procollagen, (ii) decreased expression of matrix metalloproteinase (MMP) gene, (iii) increased expression of Col I alpha 1 (collagen type I alpha 1), Col I alpha 2 or Col 3 alpha 1, or iv) lt; RTI ID = 0.0 > elastin < / RTI >

The composition may further comprise at least one skin wrinkle-improving ingredient selected from the group consisting of vitamin C, retinoic acid, transforming growth factor (TGF), animal placenta-derived protein, betulinic acid and chlorella extract.

The present invention provides a cosmetic composition for enhancing skin moisturizing, exfoliation, erythema suppression or skin phototherapy comprising Cinchonine or a cosmetically acceptable salt thereof as an active ingredient.

The composition can suppress the thickening of the skin epidermal layer.

The composition can inhibit the damage of the collagen fiber network of the epidermal-dermal connective area.

The present invention provides a health functional food composition for skin wrinkle improvement or elasticity enhancement comprising Cinchonine or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention provides a health functional food composition for enhancing skin moisturizing, exfoliation, erythema suppression or skin photoaging comprising Cinchonine or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention relates to a composition comprising cinchonine or a salt thereof as an active ingredient for improving skin wrinkles, improving elasticity, enhancing skin moisturizing, exfoliation, erythema suppression or skin photoaging, Promotes secretion of procollagen, thereby increasing the amount of activated collagen, increasing the amount of collagen fibers in the dermal layer of the skin, and inhibiting the expression of MMPs gene that catalyzes the degradation of collagen, It can be used for skin wrinkle improvement or elasticity enhancement.

In addition, since the shinkonin increases the moisture content of the skin tissue and decreases the moisture evaporation amount, the skin moisturizing effect is improved, the erythema can be suppressed, the thickened skin surface layer thickness can be reduced, Or skin photo-aging due to ultraviolet rays or the like can be prevented.

Fig. 1 shows the results of measurement of secretion amount of procollagen in human dermal fibroblast.
Fig. 2 shows the results of measurement of body weight gain and dietary intake of mice fed the experimental diet prepared according to Example 2, Comparative Examples 3 and 4. Fig.
Fig. 3 shows the results of measuring water content, elasticity, and erythema index of mouse skin tissues consumed in the experimental diet prepared according to Example 2, Comparative Examples 3 and 4.
FIG. 4 is a photograph showing the dorsal skin tissue of a mouse that was fed with the experimental diet prepared according to Example 2, Comparative Examples 3 and 4; FIG.
FIG. 5 shows the results of measurement of the degree of wrinkling of skin tissues such as mice fed with the experimental diet prepared according to Example 2, Comparative Examples 3 and 4. FIG.
Fig. 6 shows the results of measurement of skin thickness of a mouse ingested with the experimental diet prepared according to Example 2, Comparative Examples 3 and 4. Fig.
FIG. 7 shows changes in the amount and morphology of collagen fibers in mice fed the experimental diet prepared according to Example 2, Comparative Examples 3 and 4. FIG.
Fig. 8 shows changes in expression of collagen and MMPs genes in the dorsal tissues of hairless mice treated with Cinchonine according to the present invention.
Fig. 9 shows changes in expression of the elastin gene in the dorsal tissues of hairless mice treated with Cinchonine according to the present invention.

The present inventors have found that cinchonin promotes the secretion of procollagen from skin fibroblasts, increases the amount of collagen fibers in the dermal layer of skin, suppresses the expression of MMPs gene, promotes water content in skin tissue and suppresses water evaporation, It was confirmed that the present invention is effective in improving skin wrinkles, elasticity enhancement and skin moisturizing effect, and it is confirmed that it is effective in erythema suppression, exfoliation and skin photoaging improvement by decreasing the erythema index and decreasing the thickened skin skin layer, .

The term "improvement of skin wrinkles" in the present specification means to maintain or enhance the ability to relate to wrinkles and elasticity of the skin. Collagen (collagen) and elastin (elastin), which are the collagen fibers of the skin dermis layer, play a key role in maintaining skin elasticity. Collagen biosynthesis is affected by internal and external skin. Specifically, the skin cells are reduced in cellular activity due to natural aging, and collagen fibers are decreased. When extreme ultraviolet rays are irradiated as an external factor, or when active oxygen generated by stress or the like causes thiol (-SH) To increase the expression of collagen and elastase, thereby increasing the wrinkles of the skin and reducing the elasticity, thereby aging the skin.

The term "skin photoaging" in the present specification means a physiological phenomenon in which skin ages due to exposure to sunlight (ultraviolet rays). When exposed to the sun (ultraviolet ray) for a long period, deep wrinkles are increased on the face and neck, The surface of the skin becomes rough, or pigmentation such as spots and freckles occurs.

For improving skin wrinkles or elasticity Cosmetics  Composition

The present invention provides a cosmetic composition for skin wrinkle improvement or elasticity enhancement comprising Cinchonine or a cosmetically acceptable salt thereof as an active ingredient.

Specifically, the cinchonin is an alkaloid contained in plants such as Cinchona, Cinchona officinalis, Cinchona pubescens, Olea europaea and Smilax china. ) System compound, the structural formula is C ₁₉ H ₂₂ N ₂₀ , the molecular weight is 294.4 g / mol, and can be represented by the following formula (1).

 In addition, it may contain cinchonine hydrate, cinchonine derivative and the like within the range having the same efficacy as cinchonine, and may also include a solvent or a stereoisomer thereof.

[Chemical Formula 1]

The method for obtaining the shinkonin is not particularly limited, and it can be separated from the plant containing the shinkonin, chemically synthesized using a known production method, or commercially available.

(I) increased secretion of procollagen, (ii) decreased expression of matrix metalloproteinase (MMP) gene, (iii) increased expression of Col I alpha 1 (collagen type I alpha 1), Col I alpha 2 or Col 3 alpha 1, or iv) lt; RTI ID = 0.0 > elastin < / RTI >

Specifically, collagen, which is the main protein that constitutes the skin, is synthesized in the form of procollagen in fibroblasts present in the skin dermis and then secreted into the extracellular matrix. The procollagen secreted into the extracellular matrix is called procollagen Peptidase cleaves the C-terminus and converts to active collagen. The amount of activated collagen can be measured by measuring the C-peptide content. That is, the synonin according to the present invention can increase the amount of activated collagen by promoting the synthesis of procollagen in the skin fibroblast.

In addition, there are 23 types of matrix metalloproteinases (MMPs) that catalyze collagen degradation in mammals. MMP types 1, 3, and 9, which are increased by ultraviolet rays, are known as 1, 3, and 9, and these three types of MMPs It is an enzyme that breaks collagen type 1 and 3. Specifically, in the case of MMP-1, the middle of the collagen fiber is cut, and MMP-3 and MMP-9 serve to cut the cut collagen fiber in detail. That is, the shinkonin according to the present invention significantly inhibits the degradation of collagen fibers by significantly reducing the expression of MMPs gene, and by increasing the synthesis of collagen protein in skin tissue, have.

The skin's dermis consists of collagen, collagen fibers, and elastin, an elastic fiber. The collagen fibers can be structurally integrated with skin tension formation, and elastin fibers can enhance skin elasticity by being involved in skin elasticity. Specifically, synonin according to the present invention promotes elastin expression, thereby exhibiting skin elasticity-enhancing effect.

Furthermore, the composition according to the present invention further comprises at least one skin wrinkle-improving ingredient selected from the group consisting of vitamin C, retinoic acid, transforming growth factor (TGF), animal placenta-derived protein, betulinic acid and chlorella extract And is preferably vitamin C, but is not limited thereto. Specifically, according to one embodiment of the present invention, when cinchonin and vitamin C are treated together in dermal fibroblasts, secretion of procollagen is reduced to 20p% or more as compared with the case of treating shinkonin or vitamin C alone 23p% increase, and it showed a remarkable synergistic effect by the Colby formula. In other words, when used together with vitamin C, synonin can effectively increase the amount of activated collagen as the secretion of procollagen from skin fibroblasts increases, compared to when used alone.

The dose of cinchonine is preferably in the range of 0.1 μM to 1000 μM, but is not limited thereto. At this time, when the concentration of cinchonine is less than the above-mentioned concentration range, the inhibition of MMPs gene expression that catalyzes the synthesis of procollagen and degradation of collagen is lowered and it is difficult to exhibit the effect of improving skin wrinkles or improving elasticity. , There may be concern about toxicity, including cytotoxicity.

As described above, the synonin according to the present invention accelerates secretion of procollagen, thereby increasing the amount of activated collagen, decreasing the expression of the MMPs gene that catalyzes collagen degradation, and increasing the expression of the elastin gene , It is possible to prevent or alleviate the wrinkles of the skin and improve the skin elasticity.

The cosmetic composition of the present invention contains cinchonin as an active ingredient, together with dermatologically acceptable excipients, basic cosmetic composition (cleanser, pack, body oil such as lotion, cream, essence, cleansing foam and cleansing water) (Such as foundation, lipstick, mascara, make-up base), hair product composition (shampoo, rinse, hair conditioner, hair gel) and soap.

Such excipients include, but are not limited to, emollients, skin penetration enhancers, colorants, perfumes, emulsifiers, thickeners and solvents. In addition, it may further contain flavors, pigments, bactericides, antioxidants, preservatives, moisturizers and the like, and may include thickeners, inorganic salts and synthetic polymeric substances for the purpose of improving physical properties. For example, when a cleanser and a soap are prepared with the cosmetic composition of the present invention, shinkonin can be easily added to a common cleanser and a soap base. In the case of producing a cream, it can be prepared by adding cinnamonine or a salt thereof to a cream base of a general underwater type (O / W). A synthetic or natural material such as a flavor, a chelating agent, a coloring matter, an antioxidant, an antiseptic, and a protein, a mineral, and a vitamin for the purpose of improving a physical property may be further added. The content of cinchonine contained in the cosmetic composition of the present invention is not limited thereto, but is preferably 0.001 to 10% by weight, more preferably 0.01 to 5% by weight, based on the total weight of the whole composition. If the content is less than 0.001% by weight, the desired anti-aging or wrinkle-reducing effect can not be expected. If the content is more than 10% by weight, safety or formability may be difficult.

Health functional food composition for improving skin wrinkles or improving elasticity

The present invention provides a health functional food composition for skin wrinkle improvement or elasticity enhancement comprising Cinchonine or a pharmaceutically acceptable salt thereof as an active ingredient. The concrete content of the cinchonine is as described above.

In the health functional food for skin wrinkle improvement or elasticity enhancement according to the present invention, when shinkonin is used as an additive for health functional food, it can be added as it is or can be used together with other food or food ingredients, It can be used properly. The amount of the active ingredient to be mixed may be suitably determined according to each use purpose such as prevention, health, or treatment.

Formulations of health functional foods may be in the form of powders, granules, pills, tablets, capsules, as well as in the form of ordinary foods or beverages.

There is no particular limitation on the type of the food, and examples of the food to which the above substance can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, , Various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and may include foods in a conventional sense.

Generally, in the production of foods or beverages, the cinchonine may be added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on 100 parts by weight of the raw material. However, in the case of long-term consumption intended for health and hygiene purposes or for health control purposes, the amount may be less than the above range. Further, since the present invention uses fractions from natural products, there is no problem in terms of safety, Or more.

The beverage in the health functional food according to the present invention may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages. The above-mentioned natural carbohydrates may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. Examples of sweeteners include natural sweeteners such as tau martin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like. The ratio of the natural carbohydrate may be about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the beverage according to the present invention.

In addition to the above, the health functional food for improving skin wrinkles or improving elasticity according to the present invention may contain various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and salts thereof, alginic acid and its salts, organic acids, protective colloid thickening agents, , Stabilizers, preservatives, glycerin, alcohols, and carbonating agents used in carbonated beverages. In addition, the composition for improving sleep of the present invention may contain flesh for the production of natural fruit juice, fruit juice drink and vegetable drink. These components may be used independently or in combination. The ratio of such additives is not limited, but is generally selected in the range of 0.01 to 0.1 parts by weight based on 100 parts by weight of the health functional food of the present invention.

Skin moisturizing enhancement, exfoliation, erythema suppression or Skin photoaging  For improvement Cosmetics  Composition

The present invention provides a cosmetic composition for enhancing skin moisturizing, exfoliation, erythema suppression or skin phototherapy comprising Cinchonine or a cosmetically acceptable salt thereof as an active ingredient. The concrete content of the cinchonine is as described above.

Specifically, the composition can increase the moisture content of the skin tissue and decrease the moisture evaporation amount, thereby improving skin moisturization and reducing erythema index, thereby suppressing erythema.

In addition, the composition can improve the skin photoaging by inhibiting the thickening of the skin epidermal layer and inhibiting damage to the collagen fiber network of the skin-epidermis-binding site. Specifically, as the photoaging by ultraviolet rays proceeds, the formation of the stratum corneum increases to protect the skin dermal layer, and the skin becomes thick. Therefore, the thickening of the skin skin layer by ultraviolet irradiation means that skin damage due to photoaging is large. According to one embodiment of the present invention, skin thickness changes of a mouse irradiated with ultraviolet rays were examined. As a result, skin thickness was significantly increased by ultraviolet irradiation, and by eating an experimental diet containing shinkonin in the ultraviolet irradiated mouse, And the thickness was significantly decreased. That is, the shinkonin according to the present invention can improve the skin photoaging by reducing the thickness of the skin layer which is thickened by ultraviolet irradiation.

The dose of cinchonine is preferably in the range of 0.1 μM to 1000 μM, but is not limited thereto. When the concentration of cinchonine is less than the above range, it is possible to suppress the increase of the moisture content of the skin tissue, increase the moisture evaporation amount, and effectively prevent the thickening of the skin surface layer. Thus, skin moisturizing, exfoliation, And there is a concern that toxicity including cytotoxicity may occur when the concentration range is exceeded.

As described above, the shinkonin according to the present invention effectively maintains moisture in the skin tissue, decreases the erythema index, prevents the thickness of the skin skin layer from becoming thicker, thereby enhancing skin moisturization, suppressing erythema, Can be improved.

Skin moisturizing enhancement, exfoliation, erythema suppression or Skin photoaging  Health functional food composition for improvement

The present invention provides a health functional food composition for enhancing skin moisturizing, exfoliation, erythema suppression or skin photoaging comprising Cinchonine or a pharmaceutically acceptable salt thereof as an active ingredient. The concrete content of the cinchonine is as described above.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[ Preparation Example ]

Preparation Example  One.

Human fibroblasts were purchased from ATCC (Manassas, Va., USA) and cultured in fibroblast growth medium (Promo Cell, Heidelberg) at 37 ° C in 5% CO ₂ And incubated in an incubator.

Preparation Example  2.

A 5-week-old male albino mouse (Skh-1) was purchased from Orient Bio (Korea) and subjected to a week of adaptation period with a solid feed. The experimental animals were divided into 4 groups and 5 mice were assigned to each group. During the breeding period, feed and water were freely consumed. The temperature was maintained at 22 ± 1 ° C, the humidity was maintained at 60 ± 5%, and the light period and the dark cycle were adjusted to 12 hours each day.

[ Example ]

Example  One. Procollagen  Type I C-peptide (PIP) concentration measurement

Human skin fibroblasts of Preparation Example 1 were added at a concentration of 1.0 × 10 ⁶ cells / well in a 12-well plate at a concentration of 100 μM shinkonin (CN), and cultured in a CO ₂ incubator for 24 hours. After removing the medium from each well, the plate was washed once with PBS, and 1 ml of PBS was added thereto. Ultraviolet B (UVB) was then irradiated at 20 mJ / cm ² . PBS was re-cultured for 24 hours, and the amount of procollagen secreted into the medium was measured using procollagen type I C-peptide EIA kit (Takara Bio, Japan). The standard solution contained in the collagen measurement kit was diluted by concentration, absorbance was measured at 450 nm to prepare a standard concentration curve and the amount of collagen production was calculated.

Comparative Example  One.

Vitamin C < / RTI > was treated in the same manner as in Example 1 above.

Comparative Example  2.

Except that 100 쨉 M of cinchonine and 100 쨉 M of vitamin C were treated in the same manner as in Example 1 above.

As a result, as shown in FIG. 1, compared to normal cells (-UVB), the amount of procollagen secreted was significantly reduced in the control cells (+ UVB) irradiated with ultraviolet rays. In Example 1, + UVB), the amount of collagen was significantly increased by 24%. In the case of Comparative Example 2, the amount of collagen was significantly increased by 47% as compared with the UV-irradiated control cells (+ UVB), which is higher than the amount of collagen observed in Comparative Example 1 or Example 1. That is, the synonin according to the present invention has an effect similar to that of vitamin C, which is known to stabilize and promote collagen and the like. In addition, when synonin is used together with vitamin C, the amount of activated collagen can be increased by promoting secretion of procollagen.

Example  2. Shinkonin  Added Refined diet  Intake

(0.2% Cinchonine (Sigma-Aldrich) was added to the purified diet prepared according to the AIN-93 rodent diet composition (Reeves, PG et al., J Nutr, 123: 1939-1951, The diets were fed with water for 10 weeks and daily from 10 to 11 am, and the composition of the AIN-93 rodent diet is shown in Table 1 below.

Ultraviolet B (UVB) was irradiated three times a week to the dorsal part of the hairless mice during the experimental period. Ultraviolet irradiation dose was 100 mJ / cm ² for the first week, 200 mJ / cm ^{2 for the second} week, 300 mJ / cm < ^{2 &} gt ;.

On the last day of the experiment, the animals were sacrificed for 6 hours and anesthetized, blood and skin tissue were collected. Blood samples were collected from the abdominal subclavian vein using a syringe and placed in EDTA coated tubes. After centrifugation at 2,000 xg for 15 minutes, the plasma was separated and stored frozen at -70 ° C until analysis. Some of the skin tissues were immediately stored in a -70 ° C freezer and used for molecular biology. Some were fixed in 10% formalin solution and used for immunohistochemical staining.

Comparative Example  3.

3-1) The same procedure as in Example 2 was carried out except that the purified dietary preparation prepared in accordance with the AIN-93 rodent diet composition was supplied.

3-2) Except that ultraviolet B (UVB) was not irradiated, the same procedure as in Comparative Example 3-1) was carried out.

Comparative Example  4.

AIN-93 was prepared in the same manner as in Example 2 except that 0.2% vitamin C (Sigma-Aldrich) was added to the purified diet.

ingredient AIN- 93G diet
(g / kg diet) Shinkonin supplement diet (CM)
(g / kg diet) Vitamin C supplement (VitC)
(g / kg diet) Casein 200 200 200 Maltodextrin 132 132 132 Corn starch 397.486 395.486 395.486 Sucrose 100 100 100 cellulose 50 50 50 Soybean oil 70 70 70 Vitamin complex 10 10 10 Mineral complex 35 35 35 Colin Beavertre 2.5 2.5 2.5 L-cystine 3 3 3 Tert-butyhydroquinone 0.014 0.014 0.014 Cinchonine - 2 - Vitamin C - - 2 Total (g) 1,000 1,000 1,000

Experimental Example 1. Change in body weight and dietary intake of reared mice

The mice of Example 2, Comparative Examples 3 and 4 were weighed and their dietary intakes were measured. As a result, as shown in Fig. 2, it was confirmed that consumption of cinchonine and vitamin C did not significantly affect the body weight and twelve intake of the mice.

Experimental Example 2. Skin moisturizing, elasticity and erythema index measurement

The skin moisture content, water evaporation amount, elasticity and erythema index of the mice of Example 2, Comparative Examples 3 and 4 were measured once using the Corneometer®, Tewameter®, Cutometer® and Mexameter® (CK Electronics GmbH) Respectively. In the measurement, the numerical value obtained by lightly pressing a certain portion of the test animal or the like was recorded.

As a result, as shown in Fig. 3, in the case of Comparative Example 3-1) irradiated with ultraviolet rays for 10 weeks, compared with the case of Comparative Example 3-2) in which no ultraviolet ray was irradiated, The elasticity was significantly decreased while the water evaporation and erythema index were significantly increased. In the case of Example 2, water content and elasticity were significantly increased by 225% and 82%, respectively, compared with Comparative Example 3-1, although the same UV intensity was irradiated, and the water evaporation and erythema indexes were 55 % And 40%, respectively.

Experimental Example 3. Measurement of wrinkles of dorsal skin

Example 2 and Comparative Examples 3-1 and 4 in which ultraviolet rays were irradiated for 10 weeks The skin of the mouse was simulated with silicone rubber to measure the degree of formation of wrinkles. A disk with a circular hole with a diameter of 1 cm was attached to the back of the mouse, and the reagent for preparing the simulated plate was mixed and thinly spread on the back part of the reared mouse, completely dried, and then carefully peeled off the disk, Respectively. The temperature of the simulated plate was 20 ~ 23 ℃ and the humidity was 45 ~ 50%. The impression material (Epigem, Seoul, Korea) was used for simulating plate. Using the computerized image analyzer (Visioline VL650, CK electronic GmbH, Germany), the total wrinkle area, max wrinkle depth, mean depth and mean And length (mean length).

As a result, as shown in Fig. 4, in Comparative Example 3-1), it was observed that fine wrinkles were formed with coarse and deep wrinkles as compared with Comparative Example 3-2) in which no ultraviolet ray was irradiated. , It was confirmed that the thickness and depth of wrinkles were remarkably improved such that deep wrinkles were almost eliminated compared with the case of Comparative Example 3-1) even though UV of the same intensity was irradiated. As shown in FIG. 5, the degree of wrinkle formation in the simulated plate was also numerically measured using a computer image analyzer, and the total wrinkle area, the average wrinkle depth, and the average The wrinkle length and the maximum wrinkle depth were significantly reduced to 53%, 33%, 43%, and 59%, respectively, and it was confirmed that the wrinkle reducing effect of the synkinin was similar to or better than the wrinkle improving effect observed with vitamin C there was. That is, it can be seen that the ingestion of cinchonine has an effect of remarkably suppressing the generation of wrinkles by ultraviolet irradiation.

Experimental Example 4 Skin thickness change

(1) Measurement of skin thickness change

The skin thicknesses of the Example 2, Comparative Examples 3 and 4 mouse hips were measured using a Digital Micro Caliper (Marathon Watch Company Ltd., Ontario, Canada). The calipers used in the measurement were able to measure up to 0.01mm and had a control function to apply constant force to the thickness, so it was possible to measure the skin thickness under the same force.

As a result, as shown in Fig. 6A, in the case of Comparative Example 3-1), skin thickness was significantly increased as compared with the case of Comparative Example 3-2) in which no ultraviolet ray was irradiated, and in the case of Example 2, The skin thickness was significantly reduced by 21% as compared to Example 3-1).

(2) Immunohistochemical staining of skin tissue

The dorsal skin tissues of Example 2, Comparative Examples 3 and 4 mice were harvested and fixed in 10% formalin. After staining with hematoxylin and eosin (H & E), they were observed with an optical microscope (IX71, Olympus, JPN), and a digital camera (DP71, Olympus, JPN) .

As a result, as shown in Fig. 6B, in the case of Comparative Example 3-1), the skin skin layer was thickened compared with Comparative Example 3-2) in which no ultraviolet ray was irradiated, and in Example 2, It was confirmed that the thickness of the thickened epidermal layer was remarkably reduced.

EXPERIMENTAL EXAMPLE 5. Quantity and morphology of collagen fibers in the dermal layer

Masson ' s trichrome (M & T) staining was performed in the same manner as in EXPERIMENTAL EXAMPLE 4- (2).

As a result, as shown in Fig. 7, in the case of Comparative Example 3-2), collagen fibers strongly stained with aniline blue were observed in the dermal layer below the epidermis, whereas in the case of Comparative Example 3-1, It was confirmed that it was weakly stained by. In addition, in Example 2, the density of the collagen fibers in the dermal layer was relatively dense, the arrangement was regular, and the degree of staining by aniline blue was also stronger than in Comparative Example 3-1) And it was confirmed that it showed a close aspect.

Experimental Example 6. Gene Expression Change in Mouse Skin Tissue

1 ml of Trizol solution was added to 0.1 g of dorsal skin tissue of Example 2, Comparative Examples 3 and 4 mice, and the tissue was pulverized and then centrifuged at 12,000 x g for 10 minutes at 4 ° C. The supernatant was transferred to a new tube and 200 μl of chloroform was added and vortexed. This process was repeated twice, and the supernatant was transferred to a new tube, and isoprophanol and supernatant were added at a ratio of 1: 1. After 10 h of vigorous shaking, the mixture was allowed to stand at room temperature for 15 min, centrifuged at 12,000 × g for 10 min at 4 ° C., and then the supernatant was removed. 1 ml of 70% ethanol was added to the remaining precipitate, Lt; / RTI > for 5 minutes. After removing the ethanol, the tube containing the RNA precipitate was dried at room temperature for 15 minutes, and the RNA pellet was dissolved using nuclease free water. The concentration of RNA extracted at 260 nm and 280 nm wavelength was measured using a UV / VIS spectrophotometer (Beckman coulter, DU730) and agarose gel electrophoresis was performed to confirm the integrity of the RNA sample.

(GIBCO BRL, Gaithersburg, Md., USA). The reverse transcription was performed using oligo dT primer and superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA). PCR was carried out using 5 'and 3' flanking sequences of the cDNA to be amplified as a template, using the cDNA obtained from the reverse transcription as a template. The primer sequences used at this time are shown in Table 2 below. 1 μl of the amplified PCR product was electrophoresed on 1% agarose gel to confirm the DNA band.

Gene description Primers Sequences (5 '- > 3') Annealing
온도
(° C) PCR
product
(bp) Collagen type Ⅰ alpha 1 (Col1α1) F ggcaacagtcgcttcaccta 55 164 R agtccgaattcctggtctgg Collagen type Ⅰ alpha 2 (Col1α2) F cggttctgttggtcctgttg 55 103 R acccctgtgccctttatcac Collagen type Ⅲ alpha 1 (Col3α1) F taaccaaggctgcaagatgg 55 104 R accagtgcttacgtgggaca Matrix metallopeptidase 1a (MMP-1a) F ccctgtgtttcacaacggag 55 133 R cctcagcttttcagccatca Matrix metallopeptidase 1b (MMP-1b) F tttgctcatgcttttctgcc 55 146 R gaatgggagagtccaaggga Matrix metallopeptidase 3 (MMP-3) F tgctggtatggagcttctgc 55 142 R catctccaacccgaggaact Matrix metallopeptidase 9 (MMP-9) F gtggaccatgaggtgaacca 55 102 R actgcacggttgaagcaaag Elastin F tagggtgcaaagggttgtgt 60 193 R ccaaagagcacaccaacaatca Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) F ggagattgttgccatcaacg 55 122 R tgacaagcttcccattctcg

As a result, as shown in Fig. 8, in the case of Comparative Example 3-1), the expression of collagen type 1α1, 1α2, and collagen type 3α1 in the skin tissue was significantly decreased as compared with the case of Comparative Example 3-2) , MMP-1a and -1b, MMP-3, and MMP-9 gene expression were significantly increased. On the other hand, the expression of collagen type 1α1, 1α2, and collagen type 3α1 was significantly increased compared to the case of Comparative Example 3-1 in Example 2, and the expression of MMP-1a, MMP-1b, MMP- -9 gene expression was significantly decreased. That is, synonin increases collagen protein synthesis in skin tissue and inhibits collagen fiber decomposition, thereby suppressing wrinkle formation caused by ultraviolet irradiation.

As shown in Fig. 9, in Comparative Example 3-1), elastin expression was significantly reduced as compared with Comparative Example 3-2) in which no ultraviolet light was irradiated. In Example 2, Comparative Example 3-1 ), The elastin expression was significantly increased, and it was confirmed that the elastin expression was also excellent when compared with Comparative Example 4. In other words, synonin can enhance the skin elasticity by promoting elastin expression.

Hereinafter, formulation examples of the composition containing the compound of the present invention will be described, but the present invention is not intended to be limited thereto but is specifically described.

Formulation Example 1: Preparation of powder

Shinkonin 20 mg

100 mg of lactose hydrate

10 mg of talc

The above ingredients were mixed and filled in an airtight container to prepare powders.

Formulation Example 2: Preparation of tablets

Shinkonin 10 mg

Corn starch 100 mg

100 mg of lactose hydrate

Magnesium stearate 2 mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

Formulation Example 3: Preparation of capsules

Shinkonin 10 mg

3 mg of microcrystalline cellulose

Lactose hydrate 14.8 mg

Magnesium stearate 0.2 mg

After mixing the above components, the capsules were filled in gelatin capsules in accordance with the usual methods for preparing capsules.

Formulation Example 4: Preparation of injection

Shinkonin 10 mg

180 mg mannitol

2974 mg of sterile distilled water for injection

26 mg of sodium hydrogen phosphate

After the above components were mixed, they were prepared with the above ingredient contents per ampoule (2 mL) according to the usual injection preparation method.

Formulation Example 5: Preparation of a liquid preparation

Shinkonin 10 mg

10 mg of isomerized sugar

5 mg mannitol

Purified water quantity

Lemon incense quantity

The components are dissolved in purified water according to the usual preparation method, and the lemon flavor is added in an appropriate amount. Then, purified water is added to adjust the total volume to 100 mL, sterilized and filled in a brown bottle to prepare a liquid preparation.

Formulation Example 6: Preparation of Health Functional Foods

Shinkonin 10 mg

Vitamin mixture quantity

Vitamin A Acetate 70 ㎍

Vitamin E 1.0 mg

0.13 mg of vitamin B ₁

0.15 mg of vitamin B ₂

0.5 mg of vitamin B ₆

Vitamin B ₁₂ 0.2 g

10 mg vitamin C

Biotin 10 μg

Nicotinic acid amide 1.7 mg

50 ㎍ of folic acid

Calcium pantothenate 0.5 mg

Mineral mixture quantity

1.75 mg of ferrous sulfate

0.82 mg of zinc oxide

Magnesium carbonate 25.3 mg

15 mg of potassium phosphate monobasic

Secondary calcium phosphate 55 mg

Potassium citrate 30 mg

100 mg of calcium carbonate

24.8 mg of magnesium chloride

Although the composition ratio of the above-mentioned vitamin and mineral mixture is comparatively mixed with a composition suitable for health food as a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional method for producing healthy foods , Granules can be prepared and used in the manufacture of health food compositions according to conventional methods.

Formulation Example 7: Preparation of health drinks

Shinkonin 10 mg

Vitamin C 15 g

Vitamin E (powder) 100 g

19.75 g of ferrous lactate

3.5 g of zinc oxide

Nicotinic acid amide 3.5 g

Vitamin A 0.2 g

Vitamin B ₁ 0.25 g

0.3 g of vitamin B ₂

Purified water quantitation

The above components were mixed according to a conventional health drink manufacturing method, and the mixture was heated at 85 DEG C for about 1 hour with stirring, and the solution thus prepared was filtered to obtain a sterilized 2-liter container, which was sealed and sterilized, ≪ / RTI >

Although the compositional ratio is relatively mixed with a component suitable for a favorite drink, it is also possible to arbitrarily modify the compounding ratio according to the regional or national preference such as the demand class, the demanding country, and the use purpose.

Hereinafter, a preparation example of a cosmetic composition containing the compound of the present invention will be described, but the present invention is not intended to be limited thereto but is specifically explained.

Production Example 1: Nutritional lotion (milk lotion)

The inventive shinkonin 2.0 wt%

Squalane 5.0 wt%

4.0 wt%

Polysorbate 60 1.5 wt%

1.5% by weight of sorbitan sesquioleate

0.5% by weight liquid paraffin

Caprylic / capric triglyceride 5.0 wt%

Glycerin 3.0 wt%

3.0% by weight of butylene glycol

3.0% by weight of propylene glycol

Carboxyvinyl polymer 0.1 wt%

0.2% by weight triethanolamine

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-described ingredients is comparatively comparable to that of a nutritional lotion, the compounding ratio of the ingredients may be arbitrarily varied and can be prepared according to a conventional method in the field of cosmetics.

Production Example 2: Flexible Longevity (Skin lotion)

The inventive shinkonin 2.0 wt%

Glycerin 3.0 wt%

Butylene glycol 2.0 wt%

Propylene glycol 2.0 wt%

Carboxyvinyl polymer 0.1 wt%

PEG 12 nonyl phenyl ether 0.2 wt%

Polysorbate 80 0.4 wt%

Ethanol 10.0 wt%

0.1% by weight triethanolamine

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-described components is a mixture of the components suitable for the relatively long softening time, it may be arbitrarily varied in its blending ratio, and it can be produced according to a conventional production method in the field of cosmetics.

Production Example 3: Nourishing cream

The inventive shinkonin 2.0 wt%

Polysorbate 60 1.5 wt%

0.5% by weight of sorbitan sesquioleate

PEG 60 hardened castor oil 2.0 wt%

10% by weight liquid paraffin

Squalane 5.0 wt%

Caprylic / capric triglyceride 5.0 wt%

Glycerin 5.0 wt%

3.0% by weight of butylene glycol

3.0% by weight of propylene glycol

0.2% by weight triethanolamine

Antiseptic

Pigment amount

Fragrance quantity

Purified water to 100%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparable to that of the nutritional cream, the compounding ratio of the ingredients may be arbitrarily varied and can be produced by a conventional method in the field of cosmetics.

Production Example 4: Massage cream

1.0% by weight < RTI ID = 0.0 >

Wax 10.0 wt%

Polysorbate 60 1.5 wt%

PEG 60 hardened castor oil 2.0 wt%

0.8% by weight of sorbitan sesquioleate

Liquid paraffin 40.0 wt%

Squalane 5.0 wt%

Caprylic / capric triglyceride 4.0 wt%

Glycerin 5.0 wt%

3.0% by weight of butylene glycol

3.0% by weight of propylene glycol

0.2% by weight triethanolamine

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparatively suitable for the massage cream, the compounding ratio thereof may be arbitrarily modified, and can be manufactured according to a conventional manufacturing method in the field of cosmetics.

Production Example 4:

1.0% by weight < RTI ID = 0.0 >

Polyvinyl alcohol 13.0 wt%

0.2% by weight of sodium carboxymethylcellulose,

Glycerin 5.0 wt%

Allantoin 0.1 wt%

6.0% by weight of ethanol

PEG 12 nonyl phenyl ether 0.3 wt%

Polysorbate 60 0.3 wt%

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above components is comparatively comparatively compatible with the pack, the compounding ratio thereof may be arbitrarily varied and can be produced by a conventional method in the field of cosmetics.

Production Example 6: Gel

0.5% by weight < RTI ID = 0.0 >

0.05% by weight of sodium ethylenediaminetetraacetate

Glycerin 5.0 wt%

Carboxyvinyl polymer 0.3 wt%

5.0% by weight of ethanol

PEG 60 hardened castor oil 0.5 wt%

Triethanolamine 0.3 wt%

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparable to that of the gel, the blending ratio may be arbitrarily varied and can be produced by a conventional method in the field of cosmetics.

Although the compounding ratio is comparatively comparatively suitable for the cosmetic composition, it can be applied to cosmetics for various uses including other color cosmetics. Depending on its effectiveness, it can be applied to a human body thinly, It can be used for manufacturing in ointment, and it is also possible to arbitrarily modify the compounding ratio according to the regional or national preference such as demand level, demand country, use purpose, and the like.

Claims (8)

Cinchonine or a cosmetically acceptable salt thereof as an active ingredient, which comprises: i) increased secretion of procollagen, ii) increased expression of ColI alpha 1 (collagen type I alpha 1), Col I alpha 2 or Col 3 alpha 1, or iii) wherein the expression of the elastin gene is increased.
delete The method according to claim 1,
Wherein the composition further comprises at least one skin wrinkle-improving component selected from the group consisting of vitamin C, retinoic acid, transforming growth factor (TGF), animal placenta-derived protein, betulinic acid and chlorella extract
A cosmetic composition for improving skin wrinkles or improving elasticity.
A cosmetic composition for enhancing skin moisturizing, exfoliation, erythema suppression or skin photo-aging comprising Cinchonine or a cosmetically acceptable salt thereof as an active ingredient.
5. The method of claim 4,
Wherein the composition is characterized by inhibiting the thickening of the skin epidermal layer
A cosmetic composition for promoting skin moisturizing, exfoliation, erythema suppression or skin photoaging.
5. The method of claim 4,
The composition is characterized by inhibiting damage to the collagen fiber network of the epidermal-dermal binding site
A cosmetic composition for promoting skin moisturizing, exfoliation, erythema suppression or skin photoaging.
Cinchonine or a pharmaceutically acceptable salt thereof as an active ingredient, which comprises: i) an increase in the procollagen secretion amount, ii) an increase in expression of Col I alpha 1 (collagen type I alpha 1), Col I alpha 2 or Col 3 alpha 1, or iii) wherein the expression of the elastin gene is increased.
A health functional food composition for enhancing skin moisturizing, exfoliation, erythema suppression or skin photo-aging comprising Cinchonine or a pharmaceutically acceptable salt thereof as an active ingredient.

Images