WO2018186643A1 - Composition for reducing skin wrinkles, moisturizing skin, improving skin elasticity, exfoliating skin, inhibiting erythema or reducing skin photoaging, containing cinchonine or salt thereof as active ingredient - Google Patents

Abstract

The present invention relates to a cosmetic composition and a health functional food composition for reducing skin wrinkles, improving skin elasticity, promoting skin moisturizing, exfoliating skin, inhibiting erythema or reducing skin photoaging, the cosmetic composition and the health functional food composition containing cinchonine or a salt thereof as an active ingredient. More specifically, the cinchonine, according to the present invention, exhibits an effect of increasing the amount of procollagen secretion, promoting collagen biosynthesis, decreasing MMPs gene expression, increasing elastin gene expression, inhibiting erythema or inhibiting epidermal hyperplasia, and thus is effective in reducing skin wrinkles, improving skin elasticity, promoting skin moisturizing, exfoliating skin, inhibiting erythema or reducing skin photoaging.

Description

A composition for improving skin wrinkles, moisturizing, enhancing elasticity, exfoliating, inhibiting erythema or improving skin photoaging, containing cinnaconin or salts thereof as an active ingredient.

The present invention relates to a cosmetic composition for improving skin wrinkles or enhancing elasticity comprising cinchonine or a cosmetically acceptable salt thereof as an active ingredient.

Recently, as life expectancy is extended due to the development of medical technology and the quality of life and the desire for healthy and beautiful life are increasing, interest in skin beauty and health is expanding. Accordingly, various cosmetic functional cosmetics have been developed according to the purpose of maintaining healthy skin, and research for preventing, alleviating and improving skin wrinkle formation is being actively conducted. In addition, cosmetic ingredients have recently reached the skin dermis to supply nutrients, and as a result of the change in the perception that skin nutrients or functional ingredients can be ingested to improve skin beauty, resulting in inner beauty foods Excavations have also been actively conducted (Chung, S. et al., Γ-Linolenic acid in borage oil reverses epidermal hyperproliferation in guinea pigs.J Nutr, 132, 3090-3097, 2002; Tanno, O. et al. ., Nicotinamide increases biosynthesis of ceramides as well as other stratum corneum lipids to improve the epidermal permeability barrier.Br J Derm, 143, 524-531, 2000).

The skin is composed of three layers: epidermis, dermis and hypodermis. The epidermis, especially the stratum corneum, which is the outermost layer of the epidermis, acts as a skin barrier, inhibiting the loss of water and electrolytes from the skin. Meanwhile, the dermal layer plays a role in maintaining the elasticity of the skin and supporting the structure through collagen and elastin synthesis. In other words, collagen and elastin are major proteins produced in fibroblasts and are involved in skin mechanical firmness, tissue cohesion and elasticity (Moskowit, RW et al, Role of collagen hydroiysate in bone and joint disease, Semin Arthritis Rheu, 30: 87, 2000). Collagen forms various isoforms according to the form and structural features, and there are 28 kinds of collagen isotypes in human tissues. Among them, collagen is present in types 1, 3. 4. 6. 7. 13, 14, 17 and the like are known. Collagen types 1 and 3 make up the interstitial components of the dermal layer, and collagen type 7 is the major component of the dermal and epidermal junctions (Pei, M. et al., Expression of collagen type) I, II and III in loose body of osteoarthitis, J. Orthop. Sci., 5: 288, 2000).

Type I collagen is the largest amount of extracellular matrix protein in skin connective tissue, and other proteins such as elastin, fibronectin, integrin, fibrillin, and proteoglycan are present. do. The newly synthesized procollagen is secreted into the extracellular space of skin cells through an enzymatic reaction to form a microfibril of triple helix configuration, and the microfibrils combine with leucine-rich small proteoglycans to form fibrils. As a result, these fibrils gather to form collagen fibers that provide skin binding and elasticity (Bateman, J.F. et al., Collagen superfamily.Extracellular matrix, Harwood, New York, 2, 22-26, 1996).

Skin aging is known to decrease collagen content, a protein that accounts for most of the collagen of skin dermis. Collagen decreases the skin's tension and strength. have. Skin aging is largely divided into endogenous aging due to physiological aging and photoaging caused by continuous ultraviolet radiation (UV) exposure. Repeated ultraviolet exposure results in increased collagen degrading enzymes and causing denaturation and destruction of collagen fibers, reducing the elasticity of the skin and promoting the production of wrinkles. In other words, the generation of reactive oxygen species (ROS) increases continuously in skin tissues exposed to ultraviolet rays, and the latter is a signaling system mediated by epidermal growth factor receptor (EGF-R), tumor necrosis factor (TNF) -receptor, etc. Schsenmaier, C. et al., Involvement of growth factor receptors in the mammalian UVC response.Cell, 78: 963-972, 1994; Dy, LC et al., Augmentation of ultraviolet B radiation-induced tumor necrosis factor production by the epidermal platelet-activating factor receptor.J. Biol. Chem .: 274, 26917-2692, 1999), activation of these receptors results in mitogen-activated protein kinase (MAPK). It consists of a continuous phosphorylation that activates proteins that mediate downstream signaling, which in turn activates transcription factors such as activator protein-1 (AP-1) and nuclear factor κB (NF-κB). Induce matr By promoting the activity of collagenase, such as ix metalloproteinases (MMPs), skin elasticity is reduced and wrinkles are promoted (Kang, S. et al., Inflammation and extracellular matrix degradation mediated by activated transcription factors nuclear factor -κB and activator protein-l in Inflammatory acne lesions in vivo.Am J. Pathol., 166: 1691-1699, 2005). AP-1 regulates the expression of numerous genes involved in cell growth and differentiation and strongly regulates the expression of some MMPs. Among the MMPs whose expression is regulated by AP-1, MMP-1 is known as collagenase 1, and is based on type 1 and 3 collagen.

The present invention is to provide a cosmetic composition for improving skin wrinkles or enhancing elasticity, including Cinchonine (Cinchonine) or a cosmetically acceptable salt thereof as an active ingredient.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

The present invention provides a cosmetic composition for improving skin wrinkles or enhancing elasticity comprising cinchonine or a cosmetically acceptable salt thereof as an active ingredient.

The synonin is i) increased procollagen secretion, ii) decreased expression of matrix metalloproteinase (MMP) gene, iii) increased expression of collagen type alpha 1, ColIα2 or Col3α1 or iv) elastin ( elastin) may increase the expression of the gene.

The composition may further include at least one skin wrinkle improving component selected from the group consisting of vitamin C, retinoic acid, transforming growth factor (TGF), protein from animal placenta, betulinic acid and chlorella extract.

The present invention also provides a cosmetic composition for improving skin moisturizing, exfoliating, inhibiting erythema or improving skin photoaging, including cinchonine or a cosmetically acceptable salt thereof as an active ingredient.

The composition can inhibit thickening of the skin epidermal layer.

The composition can inhibit damage to the collagen fiber network of the skin epidermal-dermal bonds.

In addition, the present invention provides a health functional food composition for improving skin wrinkles or enhancing elasticity comprising Cinchonine or a food acceptable salt thereof as an active ingredient.

The present invention also provides a health functional food composition for improving skin moisturizing, exfoliating, inhibiting erythema or improving skin photoaging, including cinchonine or a food acceptable salt thereof as an active ingredient.

In addition, the present invention comprises the step of administering or taking a composition comprising Cinchonine (Cinchonine) or a salt thereof as an active ingredient to the subject to improve skin wrinkles, enhance elasticity, enhance skin moisturization, exfoliation, inhibit erythema or skin photoaging Provide ways to improve.

The present invention also provides a skin wrinkle improvement, elasticity enhancement, skin moisturization enhancement, exfoliation, erythema suppression or skin photoaging improvement of a composition comprising Cinchonine (Cinchonine) or a salt thereof as an active ingredient.

The present invention relates to a composition for improving skin wrinkles, enhancing elasticity, enhancing skin moisturizing, removing dead skin cells, inhibiting erythema or improving skin photoaging, including cinchonine or a salt thereof as an active ingredient, wherein the cinchonine is a fibroblast cell Promoting the secretion of procollagen in, it can increase the amount of activated collagen, increase the amount of collagen fibers in the dermal layer and inhibit the expression of MMPs genes that catalyze the breakdown of collagen, It can be used to improve skin wrinkles or to improve elasticity.

In addition, the cinconin increases the water content of the skin tissue and decreases the water evaporation amount, the skin moisturizing improvement effect, can suppress the erythema, can reduce the thickness of the thickened skin epidermal layer, exfoliation Or skin photoaging by ultraviolet rays etc. can be prevented.

Figure 1 shows the result of measuring the amount of procollagen secretion in human skin fibroblasts.

Figure 2 shows the results of measuring the weight gain and dietary intake of the mice ingested the experimental diet prepared according to Example 2, Comparative Examples 3 and 4.

Figure 3 shows the results of measuring the moisture content, elasticity and erythema index of the mouse skin tissue ingested experimental diet prepared according to Example 2, Comparative Examples 3 and 4.

Figure 4 is a photograph showing the back skin tissue of the mouse taking the experimental diet prepared in Example 2, Comparative Examples 3 and 4.

Figure 5 shows the results of measuring the degree of wrinkles of the skin tissue, such as the mouse taking the experimental diet prepared according to Example 2, Comparative Examples 3 and 4.

Figure 6 shows the results of measuring the skin thickness of the mouse taking the experimental diet prepared in Example 2, Comparative Examples 3 and 4.

Figure 7 shows the collagen fiber (collagen fiber) amount and morphological changes of mice fed the experimental diet prepared according to Example 2, Comparative Examples 3 and 4.

Figure 8 shows the expression changes of collagen and MMPs genes in the back tissue of hairless mice treated with Cinchonine according to the present invention.

Figure 9 shows the expression change of the elastin (Elastin) gene in the back tissue of the hairless mouse treated with Cinchonine according to the present invention.

The present inventors have found that by synonin promotes secretion of procollagen in dermal fibroblasts, increases the amount of collagen fibers in the dermal dermal layer, inhibits the expression of MMPs genes, promotes water content in skin tissues and inhibits water evaporation, The present invention has been found to be effective in improving skin wrinkles, enhancing elasticity and enhancing skin moisturization, and reducing the erythema index and reducing the thickness of the thickened skin epidermal layer, thereby making it effective in inhibiting erythema and removing dead skin cells and improving skin photoaging. Was completed.

As used herein, "skin improvement" refers to maintaining or enhancing the capacity associated with wrinkles and elasticity of the skin. Collagen (collagen) and elastic fiber elastin (collagen) in the dermal layer of the skin is the main protein that plays a role in the skin elasticity, collagen biosynthesis is affected by the internal and external skin. Specifically, the skin cells are reduced in cell activity due to natural aging, the collagen fibers are reduced, or the active oxygen generated by excessive irradiation of ultraviolet rays or stress as an external factor is the thiol group of the protein (thiol: -SH) In response to inhibiting the enzyme activity or by increasing the expression of degradation enzymes, such as collagen, elastin, increase the wrinkles of the skin and decrease the elasticity, the skin aging progresses.

As used herein, "skin light aging" refers to a physiological phenomenon in which the skin ages due to sun exposure (ultraviolet rays), and when exposed to the sun (ultraviolet rays) for a long period of time, deep wrinkles on the face and neck, and drying and The surface of the skin becomes rough or causes pigmentation such as spots and freckles.

For improving skin wrinkles or enhancing elasticity Cosmetics  Composition

The present invention provides a cosmetic composition for improving skin wrinkles or enhancing elasticity comprising cinchonine or a cosmetically acceptable salt thereof as an active ingredient.

Specifically, the cinnacon is an alkaloid contained in a plant such as Cinchona, Cinona officinalis, Cinchona pubescens, Olive (Olea europaea), and Smilax china. As a) -based compound, the structural formula is C ₁₉ H ₂₂ N ₂₀ , the molecular weight is 294.4 g / mol, it may be represented by the formula (1).

 In addition, within the range having the same efficacy as the above-mentioned shinconin, it may include a sinconin hydrate, a sinconin derivative, and the like, and may also include a solvent compound or stereoisomer thereof.

[Formula 1]

There is no particular limitation on the method for obtaining cinnacon, and it is possible to use a compound which is isolated from the plant containing the cinnaconin, chemically synthesized using a known manufacturing method, or commercially available.

The synonin is i) increased procollagen secretion, ii) decreased expression of matrix metalloproteinase (MMP) gene, iii) increased expression of collagen type alpha 1, ColIα2 or Col3α1 or iv) elastin ( elastin) may increase the expression of the gene.

Specifically, collagen, a major protein constituting the skin, is synthesized in the form of procollagen in fibroblasts present in the dermis and then secreted into the extracellular matrix. The procollagen secreted into the extracellular matrix is present on the cell surface. Since the C-terminus is decomposed by peptidase and converted into active collagen, the activated collagen content can be determined by measuring the C-peptide content. In other words, according to the present invention, the synonin may promote synthesis of procollagen in dermal fibroblasts, thereby increasing the amount of activated collagen.

In addition, there are 23 types of matrix metalloproteinases (MMPs) that catalyze collagen degradation, and MMP types known to increase by UV rays are known as Nos. 1, 3 and 9, and these three types of MMPs It is an enzyme that breaks down collagen types 1 and 3. Specifically, in the case of MMP-1, the middle of the collagen fibers are cut and MMP-3 and MMP-9 serve to cut and cut the cut collagen fibers. In other words, the cinconin according to the present invention can significantly inhibit the expression of the MMPs gene, thereby inhibiting the degradation of collagen fibers, and by increasing the synthesis of collagen protein in skin tissue, can inhibit wrinkle formation. .

The dermis of the skin is composed of collagen (collagen fiber) and elastin (elastic fiber). The collagen fibers allow structural integration with skin tension formation, and elastin fibers can enhance skin elasticity by engaging in skin elasticity. Specifically, the syntholin according to the present invention promotes elastin expression, thereby exhibiting skin elasticity enhancing effect.

Furthermore, the composition according to the present invention may further include at least one skin wrinkle improving component selected from the group consisting of vitamin C, retinoic acid, transforming growth factor (TGF), protein from animal placenta, betulinic acid and chlorella extract. It may be, but is preferably vitamin C, but is not limited thereto. Specifically, according to one embodiment of the present invention, when synthesizing the skin fibroblasts with the synonin and vitamin C, the secretion of procollagen 20p% to when compared to the case of the single treatment with the neoconsin or vitamin C alone It can be seen that the 23p% increase, a significant synergistic effect was proved by Colby's formula. In other words, when used together with vitamin C, Cinconin can effectively increase the amount of activated collagen as the secretion of procollagen increases in dermal fibroblasts compared to the case of using it alone.

The dose of cinconin is preferably included at a concentration of 0.1 μM to 1000 μM, but is not limited thereto. At this time, when the cinnaconin is less than the concentration range, the inhibition of MMPs gene expression catalyzing procollagen synthesis and collagen degradation is reduced, there is a problem that it is difficult to exert the effect of skin wrinkle improvement or elasticity enhancement, exceeding the concentration range If so, there may be toxicity concerns, including cytotoxicity.

As described above, the Cinconin according to the present invention promotes procollagen secretion, thereby increasing the amount of activated collagen, decreasing the expression of MMPs genes that catalyze collagen degradation, and increasing the expression of elastin genes. This can prevent or alleviate skin wrinkles and enhance skin elasticity.

The cosmetic composition of the present invention contains Cynconin as an active ingredient and with a dermatologically acceptable excipient, a basic cosmetic composition (washing agents such as cosmetics, creams, essences, cleansing foams and cleansing water, packs, body oils), color cosmetic compositions (Foundation, lipstick, mascara, makeup base), hair product composition (shampoo, rinse, hair conditioner, hair gel) and soap and the like.

The excipients include, but are not limited to, emollients, skin penetration enhancers, colorants, fragrances, emulsifiers, thickeners and solvents. In addition, fragrances, pigments, fungicides, antioxidants, preservatives and moisturizing agents may be further included, and may include thickeners, inorganic salts, synthetic polymer materials and the like for the purpose of improving the properties. For example, in the case of preparing the face wash and the soap with the cosmetic composition of the present invention, it can be easily prepared by adding the above-mentioned sinconin to the normal face wash and the soap base. In the case of preparing the cream, it may be prepared by adding cinnaconin or a salt thereof to a cream base of a general oil-in-water type (O / W). To this, synthetic or natural materials, such as proteins, minerals, vitamins, etc., for the purpose of improving physical properties, such as flavors, chelating agents, pigments, antioxidants, and preservatives, may be added. The content of cinconine contained in the cosmetic composition of the present invention is not limited thereto, but is preferably 0.001 to 10% by weight, more preferably 0.01 to 5% by weight based on the total weight of the composition. If the content is less than 0.001% by weight, the desired anti-aging or anti-wrinkle effect may not be expected, and if it is more than 10% by weight, there may be difficulties in safety or formulation preparation.

Health functional food composition for improving skin wrinkles or enhancing elasticity

The present invention provides a health functional food composition for improving skin wrinkles or enhancing elasticity, including cinchonine or a food acceptable salt thereof as an active ingredient. Specific details of the synonin are as described above.

In the health functional food for skin wrinkle improvement or elasticity enhancement according to the present invention, when using the synonin as an additive of the health functional food, it may be added as it is or used with other foods or food ingredients, according to a conventional method It can be used properly. The mixed amount of the active ingredient can be appropriately determined depending on the purpose of use, such as prevention, health or treatment.

Formulations of dietary supplements may be in the form of powders, granules, pills, tablets, capsules, as well as in the form of general foods or beverages.

There is no restriction | limiting in particular in the kind of said food, The foodstuff which can add the said substance is a dairy product including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, ice cream, etc. , Various soups, beverages, teas, drinks, alcoholic beverages and vitamin complexes, etc., may include all foods in a conventional sense.

In general, in the preparation of food or beverages, the ciconin may be added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less based on 100 parts by weight of the raw material. However, in the case of long-term intake for health and hygiene or for health control, the amount may be below the above range, and the present invention has no problem in terms of safety in terms of using fractions from natural products. The above amount can also be used.

The beverage in the health functional food according to the present invention may contain various flavors or natural carbohydrates, etc. as an additional ingredient, as in general drinks. The above-mentioned natural carbohydrates may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose and polysaccharides such as dextrin and cyclodextrin, sugar alcohols such as xylitol, sorbitol and erythritol. As the sweetening agent, natural sweetening agents such as tautin and stevia extract, synthetic sweetening agents such as saccharin and aspartame, and the like can be used. The ratio of the natural carbohydrate may be about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the beverage according to the present invention.

In addition to the above, the functional food for skin wrinkle improvement or elasticity enhancement according to the present invention is various nutrients, vitamins, electrolytes, flavors, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloid thickeners, pH adjusting agents. And stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks. In addition, the composition for improving sleep of the present invention may contain fruit flesh for the production of natural fruit juice, fruit juice beverage and vegetable beverage. These components can be used independently or in combination. The ratio of such additives is not limited, but is generally selected from the range of 0.01 to 0.1 parts by weight relative to 100 parts by weight of the health functional food of the present invention.

Enhance skin moisturizing, exfoliate, suppress erythema or Skin photoaging  Improvement Cosmetics  Composition

The present invention provides a cosmetic composition for improving skin moisturizing, exfoliating, inhibiting erythema or improving skin photoaging, including cinchonine or a cosmetically acceptable salt thereof as an active ingredient. Specific details of the synonin are as described above.

Specifically, the composition may increase the water content of the skin tissue, reduce the amount of water evaporation, promote skin moisturization, and suppress the erythema by reducing the erythema index.

In addition, the composition may improve skin photoaging by inhibiting the thickening of the skin epidermal layer and inhibiting the damage of the collagen fiber network of the skin epidermal-dermal junction. Specifically, when photoaging by ultraviolet rays or the like proceeds, the formation of the stratum corneum increases to protect the dermal layer of the skin, resulting in thickening of the skin. Therefore, the thickening of the skin epidermal layer by ultraviolet irradiation means that the skin damage due to photoaging is large. According to one embodiment of the present invention, as a result of confirming the change in the skin thickness of the mouse irradiated with ultraviolet rays, the skin thickness was significantly increased by ultraviolet irradiation, and by ingesting an experimental diet containing cinnamon to the ultraviolet irradiated mouse, It was confirmed that the thickness was significantly reduced. That is, the cinconin according to the present invention can improve skin photoaging by reducing the thickness of the epidermal layer thickened by ultraviolet irradiation.

The dose of cinconin is preferably included at a concentration of 0.1 μM to 1000 μM, but is not limited thereto. At this time, when the cinnamon is less than the above concentration range, it is possible to suppress the increase in water content of the skin tissue and increase the amount of water evaporation, it is not possible to effectively suppress the thickening of the skin epidermal layer, the skin moisturizing, exfoliation, suppressing erythema or improving skin photoaging There is a problem that is difficult to achieve the effect of, and if the concentration range is exceeded, there may be concerns of toxicity including cytotoxicity.

As described above, the Cinconin according to the present invention effectively maintains moisture in skin tissue, reduces the erythema index, prevents thickening of the skin epidermal layer, promotes skin moisturization and exfoliation, and promotes erythema. It can suppress and improve skin photoaging.

Enhance skin moisturizing, exfoliate, suppress erythema or Skin photoaging  Health functional food composition for improvement

The present invention provides a health functional food composition for improving skin moisturizing, removing dead skin cells, inhibiting erythema or improving skin photoaging, including cinchonine or a food acceptable salt thereof as an active ingredient. Specific details of the synonin are as described above.

Hereinafter, preferred examples are provided to aid in understanding the present invention. However, the following examples are merely provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.

[ Preparation ]

Preparation  One.

Normal human dermal fibroblasts (neonatal foreskin) were purchased from ATCC (Manassas, VA, USA), and the cells were purchased using fibroblast growth medium (Promo Cell, Heidelberg) at 37 ° C., 5% CO _2. Cultures in incubators were used for the experiment.

Preparation  2.

Five-week-old male albino hairless mice (Skh-1) were purchased from Orient Bio (Gyeonggi-do, Korea) and subjected to a one week period of solid feed. Experimental animals were divided into 4 groups and 5 animals were assigned to each group and used for the experiment. Feed and water were freely ingested during the breeding period, and the temperature was maintained at 22 ± 1 ℃ and humidity at 60 ± 5%, and the photoperiod and dark cycle were adjusted to 12 hours daily.

[ Example ]

Example  One. Procollagen  Type I C-peptide (PIP) Concentration

Human skin fibroblasts of Preparation Example 1 were dispensed at 1.0 × 10 ⁶ cells / well into 12 well-plates and added at a concentration of 100 μM of cinnamonine (CN) and incubated in a CO ₂ incubator for 24 hours. After removing the medium of each well, washed once with PBS and again put 1 ml of PBS was irradiated with ultraviolet B (UVB) at 20 mJ / cm ² conditions. PBS of each well was replaced with medium again and cultured for 24 hours, and then the amount of procollagen secreted into the medium was measured using a procollagen type IC-peptide EIA kit (Takara Bio, Japan). The standard solution included in the collagen measurement kit was diluted by concentration, and the absorbance was measured at 450 nm to prepare a standard concentration curve and calculate the amount of collagen produced.

Comparative example  One.

The same procedure as in Example 1 was conducted except that 100 μM of vitamin C was treated.

Comparative example  2.

The same procedure as in Example 1 was conducted except that 100 μM of cinconine and 100 μM of vitamin C were treated.

As a result, as shown in Figure 1, the control cells irradiated with ultraviolet rays (+ UVB), procollagen secretion was significantly reduced compared to the normal cells (-UVB), in the case of Example 1, the control cells irradiated only with ultraviolet rays ( + UVB) significantly increased the amount of collagen by 24%. In addition, in Comparative Example 2, the amount of collagen was increased by 47% compared to the UV irradiation control cells (+ UVB), which is higher than the amount of collagen observed in Comparative Example 1 or Example 1. In other words, the cinconine according to the present invention has a similar effect to vitamin C known to act to stabilize and promote collagen. In addition, when used with vitamin C, the cinconin may increase the amount of activated collagen by promoting the secretion of procollagen.

Example  2. Neoconin  Added Tablet diet  Intake

Prepared by adding 0.2% Cinchonine (Sigma-Aldrich) to the tablets prepared according to AIN-93 rodent diet composition (Reeves, PG et al., J Nutr, 123: 1939-1951, 1993) to the mouse of Preparation Example 2 The prepared diet was supplied with water between 10 and 11 am daily for 10 weeks, and the composition of the AIN-93 rodent diet is shown in Table 1 below.

During the breeding period, ultraviolet B (UVB) was irradiated to the back of the hairless mice three times a week. The UV irradiation dose was 100 mJ / cm ² for the first week, 200 mJ / cm ^{2 for the} second week, and from 3 to 10 weeks. The irradiation was at 300 mJ / cm ² . During breeding, body weight and skin thickness were measured every week, and photographs of the back skin were taken.

On the last day of the experiment, the animals were fasted for 6 hours and blood and back skin tissues were collected under anesthesia. Blood samples were collected from the abdominal inferior vena cava with a syringe, centrifuged at 2,000 × g for 15 minutes, and plasma was separated and stored frozen at −70 ° C. until analysis. Some of the back skin tissues were immediately stored in the -70 ℃ freezer and used for molecular biological tests, and some were fixed in 10% formalin solution and used for immunohistochemical staining.

Comparative example  3.

3-1) The same procedure as in Example 2 was carried out except that a tablet diet was prepared according to the composition of AIN-93 rodent diet.

3-2) The same procedure as in Comparative Example 3-1) was conducted except that ultraviolet B (UVB) was not irradiated.

Comparative example  4.

The same procedure as in Example 2 was conducted except that the diet prepared by adding 0.2% vitamin C (Sigma-Aldrich) to the AIN-93 tablet diet was supplied.

ingredient	AIN- 93G diet (g / kg diet)	Shinkonin Supplementary diet (CN) (g / kg diet)	Vitamin C Supplement (VitC) (g / kg diet)
Casein	200	200	200
Maltodextrin	132	132	132
Corn starch	397.486	395.486	395.486
Sucrose	100	100	100
cellulose	50	50	50
Soybean oil	70	70	70
Vitamin complex	10	10	10
Mineral complex	35	35	35
Choline Bitartrate	2.5	2.5	2.5
L-cystine	3	3	3
Tert-Butyhydroquinone	0.014	0.014	0.014
Cinchonine	-	2	-
Vitamin c	-	-	2
Total (g)	1,000	1,000	1,000

Experimental Example  1. Changes in Body Weight and Dietary Intake in Hairless Mice

Body weight and dietary intake of the above Example 2, Comparative Examples 3 and 4 mice were measured weekly. As a result, as shown in Figure 2, it was confirmed that the intake of cinnaconin and vitamin C did not significantly affect the weight and twelve intake of the mouse.

Experimental Example  2. Moisturizing skin, elasticity and Erythema index  Measure

Corn moisture, water evaporation, elasticity and erythema index using the Corneometer®, Tewameter®, Cutometer®, Mexameter® (CK Electronics GmbH) for the mice of Examples 2, Comparative Examples 3 and 4 once at the end of the experiment Measured. When measuring, the numerical value that appears by lightly pressing a certain part of the experimental animal and the like was recorded.

As a result, as shown in Figure 3, in the case of Comparative Example 3-1) irradiated with ultraviolet rays for 10 weeks, compared with the case of Comparative Example 3-2) not irradiated with ultraviolet rays, the moisture content of the skin tissue and Elasticity was significantly decreased, while water evaporation and erythema index were significantly increased. In addition, in the case of Example 2, the moisture content and elasticity significantly increased 225% and 82%, respectively, compared to Comparative Example 3-1) despite the same intensity of UV irradiation, moisture evaporation and erythema index 55 respectively It was confirmed that the% and 40% significantly decreased.

Experimental Example  3. Wrinkle measurement of back skin tissue

Skins of Examples 2, Comparative Examples 3-1, and 4 mice subjected to UV irradiation for 10 weeks were made of silicone rubber to measure the extent of wrinkle formation. Attach a disk with a circular hole having a diameter of 1 cm to the back of the mouse, mix the reagent for making a replica plate, thinly spread it on the back of the hairless mouse, dry it completely, and carefully remove the disk to copy the disk. Was produced. Fabrication temperature of the replica plate was carried out at a constant temperature and humidity condition of 20 ~ 23 ℃, humidity 45 ~ 50%, and a silicon rubber impression material (Epigem, Seoul, Korea) for producing a replica plate. Analysis of the simulated platen was performed using a computer image analyzer (Visioline VL650, CK electronic GmbH, Germany) for total wrinkle area, maximum wrinkle depth, mean depth and mean wrinkles. Four wrinkle indicator items such as mean length were analyzed.

As a result, as shown in Figure 4, in Comparative Example 3-1), compared to Comparative Example 3-2) not irradiated with ultraviolet light, it was observed that the fine wrinkles were formed along with the deep wrinkles wrinkles, Example 2 In case of irradiating UV of the same intensity, it was confirmed that the thickness and depth of the wrinkles were remarkably improved compared to the case of Comparative Example 3-1). In addition, as shown in Fig. 5, the total wrinkle area, average wrinkle depth, maximum in the case of Example 2 compared to the case of Comparative Example 3-1) in the result of quantifying the degree of wrinkle formation in the replica plate using a computer image analyzer Wrinkle depth and mean wrinkle length were significantly reduced to 53%, 33%, 43% and 59%, respectively, and the antiwrinkle efficacy of Cinconin was similar to or better than that observed in vitamin C. there was. In other words, it can be seen that the intake of synconin has an effect of significantly inhibiting wrinkle formation by ultraviolet irradiation.

Experimental Example  4. Skin thickness change

(1) back skin thickness measurement

Example 2, Comparative Examples 3 and 4 The skin thickness of the mouse hip was measured using a digital micro caliper (Marathon Watch Company Ltd, Ontario, Canada). The caliper used for the measurement was able to measure up to 0.01 mm and the adjustment function to apply a constant force to the thickness was able to measure the thickness of the skin under the same force.

As a result, as shown in Figure 6a, in the case of Comparative Example 3-1), compared with the case of Comparative Example 3-2) not irradiated with ultraviolet rays, the skin thickness was significantly increased and in the case of Example 2, the comparison Compared to Example 3-1, it was confirmed that the skin thickness was significantly reduced by 14%.

(2) immunohistochemical staining of skin tissue

The dorsal skin tissue of Example 2, Comparative Examples 3 and 4 mice was extracted and fixed in 10% formalin. Subsequently, Hematoxylin and eosin (H & E) staining was performed by a Korean CFC (Gyeonggi-do, Korea) and observed using an optical microscope (IX71, Olympus, JPN) and photographed using a digital camera (DP71, Olympus, JPN). Photographed.

As a result, as shown in Fig. 6B, in Comparative Example 3-1), it was observed that the skin epidermal layer was thickened in comparison with Comparative Example 3-2) which was not irradiated with ultraviolet rays, and in Example 2 by ultraviolet irradiation It was confirmed that the thickness of the thickened epidermal layer was significantly reduced.

Experimental Example  5. Changes in the amount and shape of collagen fibers in the dermis

Except for Masson's trichrome (M & T) staining was carried out in the same manner as in Experimental Example 4- (2).

As a result, as shown in FIG. 7, in Comparative Example 3-2), collagen fibers strongly stained with aniline blue were observed in the dermal layer under the epidermis, but in Comparative Example 3-1), the collagen fibers were aniline blue. It was confirmed that the dye is weakly. In addition, in Example 2, compared to Comparative Example 3-1), the density of collagen fibers in the dermal layer was relatively dense and the arrangement was regular, and staining by aniline blue was also stronger. It was confirmed that there was a close pattern.

Experimental Example  6. Gene Expression Changes in Mouse Skin Tissues

The tissues were pulverized by adding 1 ml of Trizol solution per 0.1 g of dorsal skin tissue of Examples 2, Comparative Examples 3 and 4, and then centrifuged at 4 ° C. and 12,000 × g for 10 minutes. The supernatant was transferred to a new tube and 200 μl of chloroform was added and vortexed. After repeating this process twice, the supernatant was transferred to a new tube and isoprophanol and supernatant were added at a 1: 1 ratio. After shaking vigorously 10 times, the mixture was left at room temperature for 15 minutes, centrifuged at 12,000 × g and 4 ° C. for 10 minutes, and then the supernatant was removed, and 1 ml of 70% ethanol was added to the remaining precipitate, followed by 7,500 × g and 4 ° C. Centrifuge for 5 minutes at. Thereafter, ethanol was removed and the tube containing the RNA precipitate was dried at room temperature for 15 minutes, and then the RNA pellet was dissolved using nuclease free water. Using a UV / VIS spectrophotometer (Beckman coulter, DU730) was measured the concentration of RNA samples extracted at 260 nm and 280 nm wavelength, and the integrity of the RNA samples were confirmed by agarose gel electrophoresis.

CDNA was synthesized by reverse transcription using oligo dT primer and superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA) on RNA samples extracted from the back skin tissue. PCR was performed using 5D and 3 'flanking sequences of the gene cDNA to be amplified and templated cDNA obtained by reverse transcription, the primer sequence used is shown in Table 2 below. 1 μl of the amplified PCR product was electrophoresed on 1% agarose gel to confirm DNA band.

Gene description	Primers	Sequences (5 '→ 3')	Annealing temperature (℃)	PCR product (bp)
Collagen type Ⅰ alpha 1 (Col1α1)	F		ggcaacagtcgcttcaccta	55	164
	R	agtccgaattcctggtctgg
Collagen type Ⅰ alpha 2 (Col1α2)	F		cggttctgttggtcctgttg	55	103
	R	acccctgtgccctttatcac
Collagen type III alpha 1 (Col3α1)	F		taaccaaggctgcaagatgg	55	104
	R	accagtgcttacgtgggaca
	Matrix metallopeptidase 1a (MMP-1a)	F		ccctgtgtttcacaacggag	55	133
R		cctcagcttttcagccatca
	Matrix metallopeptidase 1b (MMP-1b)	F		tttgctcatgcttttctgcc	55	146
R		gaatgggagagtccaaggga
Matrix metallopeptidase 3 (MMP-3)	F		tgctggtatggagcttctgc	55	142
	R	catctccaacccgaggaact
Matrix metallopeptidase 9 (MMP-9)	F		gtggaccatgaggtgaacca	55	102
	R	actgcacggttgaagcaaag
Elastin	F	tagggtgcaaagggttgtgt	60	193
	R	ccaaagagcacaccaacaatca
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH)	F		ggagattgttgccatcaacg	55	122
	R	tgacaagcttcccattctcg

As a result, as shown in FIG. 8, in the case of Comparative Example 3-1), the expression of collagen type 1α1, 1α2, and collagen type 3α1 of the skin tissue was significantly decreased compared to that of Comparative Example 3-2). , MMP-1a and -1b, MMP-3, and MMP-9 gene expression was significantly increased. On the other hand, in the case of Example 2, the expression of collagen type 1α1, 1α2, and collagen type 3α1 were significantly increased as compared with that of Comparative Example 3-1), and MMP-1a, MMP-1b, MMP-3, and MMP-9 gene expression was found to be significantly reduced. That is, cinconin can inhibit the formation of wrinkles by ultraviolet irradiation by increasing collagen protein synthesis of skin tissues and inhibiting the degradation of collagen fibers.

In addition, as shown in FIG. 9, in Comparative Example 3-1), elastin expression was significantly decreased in comparison with Comparative Example 3-2) which was not irradiated with ultraviolet rays, and in Example 2, Comparative Example 3-1 Elastin expression was not only significantly increased, compared to Comparative Example 4, it was confirmed that shows an excellent effect. That is, the synonin may exhibit an effect of promoting skin elasticity through promoting elastin expression.

Hereinafter, the preparation examples of the composition containing the compound of the present invention will be described, but the present invention is not intended to limit the present invention but only to explain in detail.

Formulation example  One: Powder  Produce

Cinconine 20 mg

Lactose Carb 100 mg

Talc 10 mg

The above ingredients were mixed and filled in an airtight cloth to prepare a powder.

Formulation example  2: preparation of tablets

Cinconin 10 mg

Corn starch 100 mg

Lactose Carb 100 mg

Magnesium stearate 2mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

Formulation example  3: Manufacture of capsule

Cinconin 10 mg

3 mg of microcrystalline cellulose

Lactose carb 14.8 mg

Magnesium Stearate 0.2 mg

After mixing the above components, it was filled in gelatin capsules according to the conventional method for producing a capsule to prepare a capsule.

Formulation example  4: Preparation of Injection

Cinconin 10 mg

Mannitol 180 mg

Sterile distilled water for injection 2974 mg

Monohydrogen phosphate 26 mg

After mixing the above components, it was prepared in the above ingredient content per ampoules (2 mL) according to the conventional method for preparing injections.

Formulation example  5: Liquid  Produce

Cinconin 10 mg

Isomerized sugar 10 mg

Mannitol 5 mg

Purified water

Lemon flavor

The above components are dissolved in purified water according to a conventional preparation method, dissolved in purified water, and then lemon juice is added in an appropriate amount. After adjusting to 100 mL in total, sterilized and filled in a brown bottle to prepare a liquid formulation.

Formulation example  6: Preparation of dietary supplements

Cinconin 10 mg

Vitamin mixture proper amount

70 μg of Vitamin A Acetate

Vitamin E 1.0 mg

Vitamin B1 0.13 mg

Vitamin B2 0.15 mg

Vitamin B6 0.5 mg

0.2 μg of vitamin B12

Vitamin C 10 mg

10 μg biotin

Nicotinic Acid 1.7 mg

Folate 50 ㎍

Calcium Pantothenate 0.5mg

Mineral mixture

Ferrous Sulfate 1.75 mg

Zinc Oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium monophosphate 15 mg

Dibasic calcium phosphate 55 mg

Potassium citrate 30 mg

Calcium Carbonate 100 mg

Magnesium chloride 24.8 mg

Although the composition ratio of the above-mentioned vitamin and mineral mixtures is mixed with a component suitable for a health food in a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional health food manufacturing method. The granules may be prepared and used for preparing a health food composition according to a conventional method.

Formulation example  7: Manufacture of health drinks

Cinconin 10 mg

15 g of vitamin C

100 g of vitamin E (powder)

Iron lactate 19.75 g

3.5 g of zinc oxide

Nicotinamide 3.5 g

0.2 g of vitamin A

0.25 g of vitamin B1

0.3 g of vitamin B2

Purified Water Quantification

After mixing the above components according to a conventional healthy beverage production method, and then stirred and heated at 85 ℃ for about 1 hour, the resulting solution is filtered and obtained in a sterilized 2 L container sealed sterilization and then refrigerated and stored in the present invention For the preparation of healthy beverage compositions.

Although the composition ratio is mixed with a component suitable for a favorite beverage in a preferred embodiment, the composition ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and usage.

Hereinafter, the preparation examples of the cosmetic composition containing the compound of the present invention will be described, but the present invention is not intended to limit the present invention, but is only intended to be described in detail.

Production Example  1: nutritional cosmetics ( Milk Croissant )

2.0% by weight of cinnamon of the present invention

Squalane 5.0 wt%

Beeswax 4.0 wt%

Polysorbate60 1.5 wt%

Sorbanthesquioleate 1.5 wt%

0.5% by weight of liquid paraffin

Caprylic / Capric Triglycerides 5.0 wt%

Glycerin 3.0 wt%

Butylene Glycol 3.0 wt%

Propylene Glycol 3.0 wt%

Carboxy vinyl polymer 0.1 wt%

0.2% by weight of triethanolamine

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for nutritional longevity in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

Production Example  2: softening lotion (skin lotion)

Cinchonine 2.0 wt%

Glycerin 3.0 wt%

Butylene glycol 2.0% by weight

Propylene Glycol 2.0 wt%

Carboxy vinyl polymer 0.1 wt%

PEG 12 nonylphenylether 0.2% by weight

Polysorbate 80 0.4% by weight

Ethanol 10.0 wt%

Triethanolamine 0.1% by weight

Preservatives, colorings, flavors

Purified water to 100% by weight

The above blending ratio is mixed composition of a component suitable for a flexible softener in a preferred embodiment, but the blending ratio may be arbitrarily modified, it can be prepared according to the manufacturing method in the general cosmetic field.

Production Example  3: nutrition cream

Cinchonine 2.0 wt%

Polysorbate 60 1.5% by weight

Solbitan Sesquioleate 0.5% by weight

PEG60 Cured Castor Oil 2.0% by weight

10% by weight of liquid paraffin

Squalane 5.0 wt%

Caprylic / Capric Triglycerides 5.0 wt%

Glycerin 5.0 wt%

Butylene glycol 3.0% by weight

Propylene Glycol 3.0 Weight%

Triethanolamine 0.2% by weight

Preservative

Pigment amount

Spices

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for nourishing cream in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

Production Example  4: massage cream

Cinchonine 1.0% by weight

Beeswax 10.0 weight%

Polysorbate 60 1.5% by weight

PEG 60 Cured Castor Oil 2.0% by weight

Sorbanthesquioleate 0.8 wt%

40.0% by weight of liquid paraffin

Squalane 5.0 wt%

Caprylic / Capric Triglyceride 4.0 wt%

Glycerin 5.0 wt%

Butylene glycol 3.0% by weight

Propylene Glycol 3.0 Weight%

Triethanolamine 0.2% by weight

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a massage cream in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a manufacturing method in the general cosmetic field.

Production Example  4: pack

Cinchonine 1.0% by weight

Polyvinyl alcohol 13.0 wt%

Sodium Carboxymethylcellulose 0.2% by weight

Glycerin 5.0 wt%

Allantoin 0.1 wt%

Ethanol 6.0 wt%

PEG 12 nonylphenyl ether 0.3% by weight

Polysorbate60 0.3 wt%

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a pack in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a manufacturing method in the general cosmetic field.

Production Example  6: gel

Cinchonine 0.5 wt%

0.05% by weight of ethylenediamine sodium acetate

Glycerin 5.0 wt%

Carboxy vinyl polymer 0.3 wt%

Ethanol 5.0 wt%

PEG 60 Cured Castor Oil 0.5% by weight

0.3% by weight of triethanolamine

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a gel in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

The blending ratio is a relatively suitable composition for the cosmetic composition in a preferred embodiment, but can be applied to cosmetics of various uses, including other color cosmetics, according to the efficacy that can be applied to a thin coating on the human body, that is, Ointment may be used for manufacturing, and the mixing ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and usage.

Claims (16)

1. Cinchonine (Cinchonine) or a cosmetic composition for improving skin wrinkles or elasticity comprising a cosmetically acceptable salt thereof as an active ingredient.
2. The method of claim 1,

   The synonin is i) increased procollagen secretion, ii) decreased expression of matrix metalloproteinase (MMP) gene, iii) increased collagen type I alpha 1, ColIα2 or Col3α1 expression, or iv) elastin (elastin) Cosmetic composition for improving skin wrinkles or enhancing elasticity, characterized by increasing the expression of the gene.
3. The method of claim 1,

   The composition wrinkles skin further comprising at least one skin wrinkle improving component selected from the group consisting of vitamin C, retinoic acid, transforming growth factor (TGF), protein from animal placenta, betulinic acid and chlorella extract Cosmetic composition for improving or enhancing elasticity.
4. Cinchonine (Cinchonine) or a cosmetic composition for improving skin moisturizing, exfoliation, erythema suppression or skin photoaging improvement comprising the cosmetically acceptable salt thereof as an active ingredient.
5. The method of claim 4, wherein

   The composition is a cosmetic composition for improving skin moisturizing, removing dead skin cells, suppressing erythema or improving skin photoaging, characterized in that to suppress the thickening of the skin epidermal layer.
6. The method of claim 4, wherein

   The composition is a cosmetic composition for improving skin moisturizing, exfoliation, suppressing erythema or improving skin photoaging, characterized in that to inhibit the damage of the collagen fiber (collagen fiber) network of the skin epidermis-dermis.
7. Health functional food composition for improving skin wrinkles or enhancing elasticity comprising Cinchonine (Cinchonine) or a food acceptable salt thereof as an active ingredient.
8. Health functional food composition for improving skin moisturizing, exfoliating, inhibiting erythema or improving skin photoaging, including cinchonine or a food acceptable salt thereof as an active ingredient.
9. A method for improving skin wrinkles, enhancing elasticity, enhancing skin moisturizing, removing keratin, inhibiting erythema or improving skin photoaging, comprising administering or taking a composition comprising Cinchonine or a salt thereof as an active ingredient to an individual.
10. The method of claim 9,

    The composition comprises i) increased procollagen secretion, ii) decreased matrix metalloproteinase (MMP) gene expression, iii) increased collagen type I alpha 1, ColIα2 or Col3α1 expression, or iv) elastin ( elastin) method for increasing expression of the gene.
11. The method of claim 9,

    Said composition inhibits thickening of the skin epidermal layer.
12. The method of claim 9,

    The composition is characterized in that to inhibit the damage of the collagen fiber (collagen fiber) network of the skin epidermal-dermal junction.
13. Use for improving skin wrinkles, enhancing elasticity, enhancing skin moisturizing, exfoliating, inhibiting erythema or improving skin photoaging of a composition comprising cinchonine or a salt thereof as an active ingredient.
14. The method of claim 13,

    The composition comprises i) increased procollagen secretion, ii) decreased expression of matrixmetalloproteinase (MMP) gene, iii) increased collagen type I alpha 1, ColIα2 or Col3α1 expression, or iv) elastin ( elastin) to increase the expression of the gene.
15. The method of claim 13,

    The composition is characterized in that to suppress the thickening of the skin epidermal layer.
16. The method of claim 13,

    The composition is characterized in that it inhibits the damage of the collagen fiber (collagen fiber) network of the skin epidermal-dermal junction.

Images