WO2017146414A1 - Composition for skin moisturization and skin wrinkle alleviation, containing α-terpineol as active ingredient - Google Patents

Abstract

The present invention provides a cosmetic composition, a food composition, a composition for external application to the skin, and a pharmaceutical composition, all of which are for skin moisturization, skin wrinkle alleviation, skin elasticity improvement and erythema inhibition, and contain α-terpineol as an active ingredient. The compositions containing α-terpineol have effects of increasing the amount of procollagen secretion, inhibiting erythema, promoting collagen biosynthesis, reducing MMP-1 gene expression and inhibiting the hyperplasia of the epidermal layer of the skin, thereby having effects of skin moisturization, skin wrinkle alleviation, skin elasticity improvement and erythema inhibition.

Description

Skin moisturizing and skin wrinkle improvement composition containing α-terpineol as an active ingredient

The present invention relates to a composition for improving skin moisturizing and skin wrinkles containing α-terpineol as an active ingredient, and more specifically to skin moisturizing, skin wrinkle improvement, and skin elasticity containing α-terpineol as an active ingredient. It relates to a method of moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema using a cosmetic composition, food composition, pharmaceutical composition for enhancing or inhibiting erythema and a composition containing an external composition for skin and α-terpineol as an active ingredient. .

The skin is composed of three layers: epidermis, dermis and hypodermis. The epidermis, especially the stratum corneum, which is the outermost layer of the epidermis, acts as a skin barrier, inhibiting the loss of water and electrolytes from the skin. Meanwhile, the dermal layer plays a role in maintaining the elasticity of the skin and supporting the structure through collagen and elastin synthesis. In other words, collagen and elastin are major proteins produced in fibroblasts and are involved in skin mechanical firmness, tissue binding strength and elasticity. Collagen forms various isoforms according to the form and structural features, and there are 28 collagen isotypes in human tissues. Among them, collagen is present in type 1, 3. 4. 6. 7. 13, 14, 17 and the like are known. Collagen types 1 and 3 make up the interstitial components of the dermal layer, and collagen type 7 is the major component of the dermal and epidermal junctions.

Type 1 collagen is the largest amount of extracellular matrix protein in skin connective tissue, and other proteins such as elastin, fibronectin, integrin, fibrin, and proteoglycan are present. The newly synthesized procollagen is hydroxylated at proline and lysine amino acid residues and is secreted into the extracellular space in the form of twisted helixes. Here, procollagen is cut off at both ends by procollagen proteinase to form collagen protein, and the latter form microfibril of triple helix configuration, and microfibrils are combined with leucine-rich small proteoglycans to fibril To form. As a result, the fibrils thus formed form collagen fibers that provide skin binding and elasticity.

Skin aging is known to decrease collagen content, a protein that accounts for most of the collagen of skin dermis. Collagen decreases the skin's tension and strength. have. Skin aging is largely divided into endogenous aging due to physiological aging and photoaging caused by continuous ultraviolet radiation (UV) exposure. Repeated ultraviolet exposure results in increased collagen degrading enzymes and causing denaturation and destruction of collagen fibers, reducing the elasticity of the skin and promoting the production of wrinkles.

Recently, as life expectancy is extended due to the development of medical technology and the quality of life and the desire for healthy and beautiful life are increasing, interest in skin beauty and health is expanding. Various cosmetic functional cosmetics have been developed to maintain healthy skin, and research for preventing, alleviating and improving skin wrinkle formation is being actively conducted. In addition, cosmetic ingredients have recently reached the skin dermis to supply nutrients, and as a result of the change in the perception that skin nutrients or functional ingredients can be ingested to improve skin beauty, resulting in inner beauty foods Excavations are also actively underway.

In this regard, the present applicant has conducted research to develop a food or cosmetic material that is effective in moisturizing and improving wrinkles by inhibiting the action of collagen degrading enzymes in natural products with few side effects and promoting collagen synthesis.

The present inventors confirmed the fact that α-terpineol has an effect of moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema, and completed the present invention.

Accordingly, it is an object of the present invention to provide a cosmetic composition, a food composition, a pharmaceutical composition and an external preparation for skin moisturizing, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema containing α-terpineol as an active ingredient.

Still another object of the present invention is to provide a method of moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema using a composition containing α-terpineol as an active ingredient.

In order to achieve the above object, the present invention provides a cosmetic composition for moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema containing α-terpineol as an active ingredient.

According to another preferred embodiment of the present invention, α-terpineol may be included in 0.0001 to 20% by weight based on the total weight of the cosmetic.

According to another preferred embodiment of the present invention, the composition of the present invention has at least one effect selected from the group consisting of increased procollagen secretion, promoting collagen biosynthesis, reducing the expression of the MMP-1 gene and inhibiting the formation of skin stratum corneum. It may be to have.

According to another preferred embodiment of the present invention, the cosmetic of the present invention skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisturizing lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream , Essence, Pack, Mask Pack, Mask Sheet, Soap, Shampoo, Cleansing Foam, Cleansing Lotion, Cleansing Cream, Body Lotion, Body Cleanser, Latex, Press Powder, Loose Powder and Eye Shadow have.

According to another preferred embodiment of the present invention, the composition of the present invention may further comprise a cosmetically acceptable carrier.

According to another preferred embodiment of the present invention, the composition of the present invention may further comprise a skin wrinkle improvement component or skin elasticity enhancing component. The skin wrinkle improvement component or skin elasticity enhancing component may be specifically selected from the group consisting of vitamin C, retinoic acid, TGF, protein from animal placenta, betulinic acid and chlorella extract.

The present invention also provides a skin external preparation composition for moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema containing α-terpineol as an active ingredient.

The present invention also provides a food composition for moisturizing the skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema containing α-terpineol as an active ingredient.

According to another preferred embodiment of the present invention, the food of the present invention may be prepared in any one formulation selected from the group consisting of tablets, granules, powders, capsules, liquid solutions and rings.

The present invention also provides a pharmaceutical composition for moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema containing α-terpineol as an active ingredient.

The present invention also provides a method for improving skin wrinkles or improving skin elasticity using a composition containing α-terpineol as an active ingredient.

According to a preferred embodiment of the present invention, α-terpineol may be included in 0.0001 to 20% by weight based on the total weight of the composition.

According to another preferred embodiment of the present invention, the composition of the present invention has at least one effect selected from the group consisting of increased procollagen secretion, promoting collagen biosynthesis, reducing the expression of the MMP-1 gene and inhibiting the formation of skin stratum corneum. It may be to have.

According to a preferred embodiment of the present invention, the composition may be the cosmetic composition, the skin external composition, the food composition or the pharmaceutical composition.

The present invention provides a cosmetic composition, food composition, external skin preparation and pharmaceutical composition for moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema containing α-terpineol as an active ingredient. The composition containing α-terpineol has an effect of increasing the amount of procollagen secretion, promoting collagen biosynthesis, decreasing the expression of MMP-1 gene, and inhibiting skin thickening of the epidermal layer, thereby moisturizing the skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema. Effective in

1 is a graph measuring procollagen secretion in human dermal fibroblasts (-UVB: UVB-treated control group, + UVB: UVB-treated control group, αTN: UVB treated with α-terpineol) Experimental group, VitC: control group treated with vitamin C after UVB irradiation, αTN + VitC: experimental group treated with α-terpineol and vitamin C after UVB irradiation).

Figure 2 is an electrophoresis picture and graph measuring the amount of procollagen and MMP-1 gene expression in human fibroblasts.

Figure 3 is a graph showing the weight gain (A and B) and the dietary intake (C and D) of mice fed the experimental diet.

Figure 4 is a graph measuring the water content (A), water evaporation (B), elasticity (C) and erythema index (D) of the mouse skin tissue ingested experimental diet.

5 is a photograph of the back skin tissue of a mouse fed an experimental diet.

Figure 6 is a photograph (A) and a graph (B) showing the degree of wrinkle formation of skin tissues, such as mice fed the experimental diet.

Figure 7 is a graph (A) and a picture (B) showing the skin thickness of the mouse fed the experimental diet.

FIG. 8 is an electrophoretic photograph and a graph showing changes in collagen and MMPs gene expression in mouse back tissues ingested α-terpineol.

9 is an experimental result comparing the PIP expression concentration of the α-terpineol and the analog compound terpinene-4-ol component of the present invention.

Hereinafter, the present invention will be described in more detail.

As described above, α-terpineol has been known for the use of pain suppression, but no research has been conducted on the effects of skin moisturizing, erythema suppression, skin elasticity enhancement and skin wrinkle relief.

The composition containing α-terpineol provided by the present invention has an effect of increasing the amount of procollagen secretion, promoting collagen biosynthesis, decreasing the expression of MMP-1 gene, and inhibiting skin thickening of the epidermal layer, thereby moisturizing skin, inhibiting erythema, and skin wrinkles. Effective for improving or enhancing skin elasticity.

Accordingly, the present invention provides a cosmetic composition for moisturizing the skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema containing α-terpineol as an active ingredient.

α-terpineol is a monoterpene compound, Cas No. is 98-55-5, the structural formula is C ₁₀ H ₁₈ O, and the molecular weight is 154.25 g / mol. The structure is shown in the following formula (1). α-terpineol is 3-cyclohexene-1-methanol; α, α-4-trimethyl; 1-p-menthen-8-ol; p-menth-1-en-8-ol (isomer unspecified); 1-methyl-4-isopropyl-1-cyclohexen-8-ol; α-terpilenol; α-terpineol; It is also called tinnitus such as terpineol schlechthin. α-terpineol is colorless crystals with a melting point of 31 to 35 ° C and a boiling point of 217 to 218 ° C.

[Formula 1]

α-terpineol is isolated and extracted from various natural products such as Acacia farnesiana (Cassia flowers), Achillea millefolium (Carpenter's Weed, Yaro), Acorus calamus (Calamus), Aframomum melegueta (Alligator Pepper, Guinea ginger) can do.

α-terpineol is registered as a flavoring agent in the Korean KFDA and US FDA food additive databases, and is classified as FRAS (generally recognized as safe as a flavor ingredient) by the Flavor and Extract Manfacturers' Association. 3045). It is mainly used as a fragrance ingredient in cosmetics, perfumes, fragrances, shampoos, soaps and detergents, and 100-1000 tons are used annually worldwide.

The reported physiological activity of α-terpineol has been reported to have an effect of lowering blood pressure by acting to expand mesenteric vessels. Recently, it has been reported that α-terpineol reduces arterial blood pressure and improves antioxidant activity in N-nitro-L-arginine methyl ester-induced hypertension rat model. In carrageenan-induced pain mouse models, α-terpineol has been shown to reduce pain and improve pleurisy. However, the effect of α-terpineol on skin moisturization, skin wrinkle improvement, skin elasticity enhancement or erythema suppression effect is not known.

LD ₅₀ values of α-terpineol were reported to be 5,170 mg / kg orally in rats, and 2,830 mg / kg orally in mice, and 2,000 mg / kg in intramuscular injection. In addition, α-terpineol did not show genetic variation in the Ames test and did not show carcinogenicity in experiments with lung cancer model mice.

For metabolite excretion of α-terpineol, rats intraperitoneally injected 100 mg of α-terpineol in a metabolic experiment in rats for 48 hours in urine for α-terpineol glucuronide conjugate and p- It has been reported that it was excreted in the form of menthan-1,2,8, -triol.

Thus, the administration of α-terpineol at low concentrations, in particular 0.001 to 5,170 mg / kg, more preferably 0.001 to 2,000 mg / kg, is not very toxic or cosmetic compositions, skin preparations, food compositions or It can be used as a pharmaceutical composition.

As used herein, the term “improve skin wrinkles or enhance skin elasticity” means to maintain or enhance the ability to relate to wrinkles and elasticity of the skin. Collagen (collagen) and elastic fiber elastin (collagen) in the dermal layer of the skin is the main protein that plays a role in the skin elasticity, collagen biosynthesis is affected by the internal and external skin. Specifically, the skin cells are reduced in cell activity due to natural aging, the collagen fibers are reduced, or the active oxygen produced by excessive irradiation of ultraviolet rays or stress as an external factor, the thiol group of the protein (thiol: -SH) In response to inhibiting the enzyme activity or by increasing the expression of degradation enzymes, such as collagen, elastin, increase the wrinkles of the skin and decrease the elasticity, the skin aging progresses.

Α-terpineol contained in the cosmetic composition described in the present invention may be included in 0.0001 to 20% by weight relative to the total weight of the cosmetic. Less than 0.0001% by weight of α-terpineol in the cosmetics may have a small amount of anti-wrinkle effect, and more than 20% by weight of α-terpineol may exhibit known toxicity.

The composition of the present invention may have one or more effects selected from the group consisting of increased procollagen secretion, promotion of collagen biosynthesis, decreased expression of MMP-1 gene, and inhibition of stratum corneum formation.

According to one embodiment of the present invention, the human skin fibroblasts were treated with UV irradiation with drugs to measure the amount of procollagen and procollagen type I C-peptide (PIP) secreted into the extracellular matrix. As shown, procollagen secretion was significantly decreased in control cells (+ UVB) irradiated with ultraviolet rays compared to normal cells (-UVB), and control with only ultraviolet rays in α-terpineol-treated cells with UV irradiation. The amount of collagen was increased by 27% compared to the cells (+ UVB). On the other hand, cells treated with α-terpineol with vitamin C increased 54% significantly compared to the control cells (+ UVB), indicating that vitamin C (+ 27%) or α-terpineol (+ 27%). ) Showed higher values than the amount of collagen observed in cells treated alone (see FIG. 1).

According to one embodiment of the present invention, the expression of collagen type 1α1 and α2 and collagen type 3α1 was significantly increased in the α-terpineol intake group compared to the + UVB control group, and MMP-1a and -1b, MMP- 3, and MMP-9 gene expression was significantly reduced (see Figure 8). Therefore, α-terpineol can alleviate wrinkles caused by UV irradiation by increasing collagen protein synthesis in the subcutaneous tissue and inhibiting collagen fiber degradation.

According to one embodiment of the present invention, after treatment with human dermal fibroblasts, the procollagen and MMP-1 gene expression changes were measured. As shown in FIG. 2, α-terpineol was significantly affected by ultraviolet rays. Significantly decreased expression of procollagen was significantly increased, while MMP-1 gene expression significantly increased by ultraviolet light was significantly decreased. The gene expression control effect of α-terpineol was shown to be similar to vitamin C (see Fig. 2).

As used herein, the term "cosmetic composition" is a composition comprising the compound, the formulation may be in any form. Examples of such formulations include cosmetics prepared using the composition, such as nutrition creams, eye creams, massage creams, creams such as cleansing creams, packs, lotions such as nutrient lotions, essences, soft cosmetics, and nutrient cosmetics. And powders, foundations, makeup bases, and the like, and may be prepared and commercialized in any of these forms to achieve the object of the present invention, and are not limited to the above examples. In addition, the cosmetic composition according to the present invention can be formulated by a conventional cosmetic preparation method.

Specifically, the cosmetics of the present invention include skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisturizing lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, essence, pack, mask pack, mask sheet It may be one having a formulation selected from the group consisting of, soap, shampoo, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, emulsion, press powder, loose powder and eye shadow.

The cosmetic composition of the present invention may further include a cosmetically acceptable carrier, and it is possible to apply and formulate as needed the usual ingredients to be formulated in general skin cosmetics.

Specifically, the cosmetic composition of the present invention may further include a transdermal penetration enhancer. As used herein, the term transdermal penetration enhancer is a composition that allows a desired component to penetrate into the blood vessel cells of the skin at a high absorption rate. Preferably other phospholipid components, liposome components and the like used in lecithin cosmetics are included, but are not limited to these.

In addition, as the oil which can be mainly used as an oil phase component, one or more selected from vegetable oil, mineral oil, silicone oil and synthetic oil can be used. More specifically, mineral oil, cyclomethicone, squalane, octyldodecyl myristate, olive oil, Vitis binifera seed oil, macadamia nut oil, glyceryl octanoate, castor oil, ethylhexyl isononanoate, dimethicone Chicon, cyclopentasiloxane, sunflower seed oil and the like can be used.

In addition, 0.1 to 5% by weight of a surfactant, a higher alcohol, and the like may be added to reinforce the emulsifying ability. Such surfactants may be used conventional surfactants such as nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, phospholipids, and the like, specifically, sorbitan sesquinolate, polysorbate 60 , Glyceryl stearate, lipophilic glyceryl stearate, sorbitan oleate, sorbitan stearate, die-cetyl phosphate, sorbitan stearate / sucrosecoate, glyceryl stearate / polyethylene glycol-100 Stearate, ceteareth-6 oleate, arachidyl alcohol / behenyl alcohol / arachidyl glucoside. Polypropylene glycol-26-butes-26 / polyethylene glycol-40 hydrogenated castor oil and the like can be used. As the higher alcohol, alcohols having 12 to 20 carbon atoms, such as cetyl alcohol, stearyl alcohol, octyldodecanol, isostearyl alcohol, etc. may be used alone or in combination of one or more thereof.

The aqueous phase component may further add 0.001 to 5% by weight of one or more thickeners such as carbomer, xanthan gum, bentonite, magnesium aluminum silicate, cellulose gum, dextrin palmitate and the like to adjust the viscosity or hardness of the aqueous phase.

In addition, the cosmetic composition of the present invention, if necessary, active ingredients such as higher fatty acids, vitamins, sunscreens, antioxidants (butylhydroxyanisole, propyl gallic acid, elixolic acid, tocopheryl acetate, butylated hydroxy) Toluene), preservatives (methylparaben, butylparaben, propylparaben, phenoxyethanol, imidazolidinylurea, chlorphenesin, etc.), colorants, pH adjusters (triethanolamine, citric acid, citric acid, sodium citrate, malic acid, Sodium malic acid, fmaric acid, sodium pramate, succinic acid, sodium succinate, sodium hydroxide, sodium monohydrogen phosphate, etc., moisturizers (glycerine, sorbitol, propylene glycol, butylene glycol, hexylene glycol, diglycerin , Betaine, glycerin-26, methylgluse-20 and the like), lubricants and the like can be further added.

In addition, the cosmetic composition of the present invention further comprises a substance capable of auxiliaryly providing essential nutrients to the skin, and may preferably contain auxiliary agents including, but not limited to, natural flavors, cosmetic flavors, or herbal medicines. have.

In addition, the cosmetic composition of the present invention may further comprise a skin wrinkle improvement component or skin elasticity enhancing component. The specific skin wrinkle improving component or skin elasticity enhancing component may be any one or more selected from the group consisting of vitamin C, retinoic acid, TGF, protein from animal placenta, betulinic acid and chlorella extract, most preferably Vitamin C.

In an embodiment of the present invention, when treated with vitamin C and α-terpineol together, 54% improved procollagen secretion was observed, but when treated with vitamin C alone, 27% and α-terpineol alone were treated. 27% procollagen secretion was improved. Substituting these results into Colby's formula, it can be seen that synergistic effects are achieved when α-terpineol and vitamin C are treated together.

On the other hand, in the process of measuring the skin wrinkle improvement effect through the experimental diet, even when the same feed amount was administered to the mice, it was confirmed that the statistically effective weight loss effect in the experimental group administered with α-terpineol (FIG. 3). Therefore, α-terpineol of the present invention is characterized in that it further has a weight loss effect.

The present invention provides a skin external preparation composition for moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema containing α-terpineol as an active ingredient.

The external preparation composition of the present invention is used for the purpose of maintaining skin moisturization, improving skin wrinkles, preventing and delaying the formation of wrinkles, and is not particularly limited in the formulation thereof. It may be a cosmetic composition having a long life, nourishing longevity, massage cream, nutrition cream, pack, mask pack, mask sheet, gel or skin adhesive cosmetic formulation, and also, such as lotion, ointment, gel, cream, patch or spray It may be a transdermal dosage form.

In addition, in the external preparation composition of each formulation, other components than the essential components described above can be appropriately selected and blended by those skilled in the art without difficulty according to the formulation or purpose of use of other external preparations.

The present invention provides a food composition for moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema containing α-terpineol as an active ingredient.

The food composition of the present invention may be prepared in any one formulation selected from the group consisting of tablets, granules, powders, capsules, liquid solutions and rings. Food composition according to the present invention may be formulated in the form of powder, liquid, tablets, soft capsules, granules, tea bags, instant tea or drink by including α-terpineol as an active ingredient. The content of α-terpineol as an active ingredient can be suitably determined depending on the purpose of use (prevention or improvement). In general, the amount of α-terpineol included in the food composition may be added at 0.1 to 90% by weight of the total food weight. However, in the case of prolonged intake for health and hygiene purposes or health control purposes, the amount may be below the above range. In addition, the food composition according to the present invention, in addition to α-terpineol, other ingredients that can give a synergistic effect to the main effect, preferably within the range of not impairing the main effect of the present invention, for example, vitamin C Compounds for improving wrinkles such as or green tea extracts, mulberry extract, licorice extract, lettuce extract, betel nut extract, golden extract, wild ginseng extract may also contain natural products.

The food composition formulated in such a form may be added to the food as it is, or used with other foods or food ingredients, and may be appropriately used according to conventional methods. Examples of foods include drinks, meats, sausages, breads, biscuits, rice cakes, chocolate, candy, snacks, confectionery, pizza, ramen, dairy products including other noodles, gums, ice creams, various soups, beverages, alcoholic beverages and vitamin complexes. , Dairy products and dairy products, and all functional foods in the conventional sense.

When the food composition of the present invention is a drink, it contains α-terpineol as an essential ingredient in the indicated ratio, and there are no particular restrictions on other ingredients used for the manufacture of other drinks, and various flavors such as ordinary drinks. Agent or natural carbohydrate and the like may be included as additional components. Examples of such natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And conventional sugars such as polysaccharides such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As a flavoring agent other than the above-mentioned, a natural flavoring agent, a synthetic flavoring agent, etc. can be used. The proportion of such natural carbohydrates is generally about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the composition of the present invention.

In addition, the food composition of the present invention is a variety of nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, coloring and neutralizing agents (such as cheese, chocolate), pectic acid and salts thereof, alginic acid and its Salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks, and the like. In addition, the food composition of the present invention may contain a pulp for producing natural fruit juice and fruit juice beverage and vegetable beverage. These components can be used independently or in combination. The proportion of such additives is not so critical but is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of the α-terpineol of the present invention.

The present invention provides a pharmaceutical composition for moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema containing α-terpineol as an active ingredient.

The compound of the present invention has a skin aging inhibitory effect by inhibiting the cellular aging and the generation of reactive oxygen species by UV, and by promoting the expression of extracellular matrix protein in the skin cells, it is effective in improving wrinkles of the skin, thereby inhibiting skin aging. Or it may be used as a pharmaceutical composition for improving skin wrinkles.

The throughput of the pharmaceutical composition for improving wrinkles or enhancing skin elasticity used in the present invention should be a pharmaceutically effective amount. As used herein, the term "pharmaceutically effective amount" refers to an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and an effective dose level may refer to an individual type and severity, age, sex, It can be determined according to the type of virus infected, the activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of treatment, factors including the drug used concurrently and other factors well known in the medical arts. Effective amounts may vary depending on the route of treatment, the use of excipients, and the possibility of use with other agents, as will be appreciated by those skilled in the art.

Pharmaceutical compositions for moisturizing the skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema of the present invention may be prepared using methods well known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal. It may be prepared in a pharmaceutical formulation. In the preparation of the formulation, it is preferred that the active ingredient is mixed or diluted with the carrier or enclosed in a carrier in the form of a container.

Therefore, the pharmaceutical composition for moisturizing the skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema according to the present invention may be prepared by oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, It may be formulated and used in the form of external preparations and patches, and may further include suitable carriers, excipients or diluents commonly used in the preparation of the composition.

For example, carriers, excipients and diluents that may be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium Phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used.

In addition, the pharmaceutical composition of the present invention can be added and used in the manufacture of quasi-drugs for the purpose of skin moisturizing or skin wrinkle improvement. When the pharmaceutical composition of the present invention is used as an quasi-drug additive, the compound may be added as it is or used with other quasi-drug or quasi-drug components, and may be appropriately used according to a conventional method. The mixed amount of the active ingredient may be suitably determined depending on the purpose of use (prevention, health or therapeutic treatment).

The present invention also provides a method of moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema using a composition containing adipic acid containing α-terpineol as an active ingredient.

According to one embodiment of the present invention, the erythema index decreased 28% in the mouse group administered α-terpineol, and the erythema index decreased 19% in the vitamin C-administered group. This means that it has an effect of inhibiting erythema better than vitamin C.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example  One. Human skin fibroblasts  Wrinkle Improvement Efficacy of α-terpineol

1-1) Cell Culture

Normal human dermal fibroblasts (neonatal foreskin) were purchased from ATCC (Manassas, VA, USA) and used. The purchased cells were incubated in a 37%, 5% CO ₂ incubator using a fibroblast growth medium (Promo Cell, Heidelberg) and used for the experiment.

1-2) Determination of Procollagen Type I C-peptide (PIP) Concentration

In order to examine collagen biosynthesis, human fibroblasts were injected into 12 well-plates at 1.0 × 10 ⁶ cells / well, and α-terpineol and vitamin C were added at a concentration of 100 μM in a CO ₂ incubator for 24 hours. Incubated. After removing the medium of each well, washed once with PBS, and again put 1 ml of PBS and irradiated with ultraviolet B (UVB) at 20 mJ / cm ² conditions. PBS of each well was replaced with medium again and cultured for 24 hours, and then the amount of procollagen secreted into the medium was measured using a procollagen type I C-peptide EIA kit (Takara bio, Japan). The standard solution included in the collagen measurement kit was diluted by concentration, and the absorbance was measured at 450 nm to prepare a standard concentration curve and calculate the amount of collagen produced.

1-3) RNA isolation and reverse transcription-polymerase chain reaction (RT-PCR) using Trizol method

334 μl of Trizol solution was added per 1 × 10 ⁷ cells of human dermal fibroblasts, and then centrifuged at 4 ° C. and 12,000 × g for 10 minutes. The supernatant was transferred to a new tube and 67 μl of chloroform was added and vortexed. Again, the supernatant was transferred to a new tube and isopropanol was added so that the ratio of the supernatant to isoprophenol was 1: 1. Shake vigorously 10 times and leave at room temperature for 15 minutes, centrifuge at 12,000 × g, 4 ℃ for 10 minutes, remove supernatant, add 1 ml of 70% ethanol to the remaining precipitate, and then at 7,500 × g, 4 ℃ Centrifuge for 5 minutes. After removing the ethanol, the tube containing the RNA precipitate was dried at room temperature for 15 minutes, and the RNA pellet was dissolved using water without nuclease. UV / VIS spectrophotometer (Beckman coulter, DU730) was used to measure the concentration of RNA samples extracted at 260 nm and 280 nm wavelength, and agarose gel electrophoresis was performed to determine the integrity of the RNA samples (integrity) Confirmed.

RNA samples extracted from human skin fibroblasts were synthesized by performing reverse transcription using oligo dT primers and superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA). PCR was performed using the 5D and 3 'flanking sequences of the gene cDNA to be amplified as a template and the cDNA obtained through reverse transcription. The primer sequences used are shown in [Table 1]. As shown. 1 μl of the amplified PCR product was electrophoresed on a 1% agarose gel to confirm DNA bands.

Primer sequences used for RT-PCR

gene	primer	Sequence (5 '→ 3')	Annealing  Temperature (℃)	PCR product (bp)	SEQ ID NO:
Procollagen	F		TCTTCAAGCCATCCTGTGTG	60	168	One
	R		GCGAGTCTGTGTTTTTGCAG			2
Metalloproteinase 1 (MMP-1)	F		ATGACATGAGTCCGGAGCAA	60	122	3
	R		TCATCTCCTGGGTCCCTTTC			4
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH)	F		GTGATGGCATGGACTGTGGT	55	203	5
	R		GGAGCCAAAAGGGTCATCAT			6

1-4) Measurement result of procollagen secretion change

Collagen, the main protein constituting the skin, is synthesized in the form of procollagen from fibroblasts present in the dermis and then secreted into the extracellular matrix. Procollagen secreted into the extracellular matrix is cleaved at the C-terminus by the procollagen peptidase present on the cell surface and formed into active collagen, so the activated collagen content can be determined by measuring the C-peptide content. As a result of measuring the amount of procollagen and procollagen type I C-peptide (PIP) secreted into the extracellular matrix by treating drugs with ultraviolet irradiation to human skin fibroblasts, as shown in FIG. Procollagen secretion was significantly decreased in cells (+ UVB) compared to normal cells (-UVB), and in collagen-treated cells with α-terpineol in combination with UV irradiation, compared with control cells (+ UVB) irradiated with ultraviolet rays only. This increased by 18%. On the other hand, cells treated with α-terpineol with vitamin C increased 54% significantly compared to control cells (+ UVB), indicating that vitamin C (+ 27%) or α-terpineol (+ 27%). ) Higher than the amount of collagen observed in cells treated alone (see FIG. 1). Therefore, α-terpineol increases the amount of collagen in human skin fibroblasts, and this collagen increase effect is more effective when used with vitamin C.

1-5) Measurement result of procollagen and MMP-1 gene expression

As a result of measuring procollagen and MMP-1 gene expression after treatment with human dermal fibroblasts, as shown in FIG. 2, α-terpineol significantly reduced the expression of procollagen significantly reduced by UV light. On the other hand, MMP-1 gene expression significantly increased by ultraviolet light was significantly decreased. The gene expression control effect of α-terpineol was shown to be similar to vitamin C (see Fig. 2). Therefore, α-terpineol may not only increase procollagen synthesis in UV-irradiated human skin fibroblasts, but also inhibit MMP-1 expression and ultimately contribute to the increase of collagen content closely related to skin wrinkles. .

Example 2 Evaluation of the Efficacy of Skin Wrinkles, Moisturizing and Elasticity of α-terpineol in Mice

2-1) Preparation of Experimental Diet, Breeding of Experimental Animals and Ultraviolet Irradiation

Five-week-old female albino hairless mice (SKH-1) used in this experiment were purchased from Orient Bio (Gyeonggi-do, Korea) and subjected to a one-week adaptation period with solid feed. Experimental animals were divided into 4 groups and 4 animals were used for each group. All experimental groups were divided into the normal control group (-UVB), the ultraviolet irradiation group (+ UVB), and the UV-irradiated group which ingested α-terpineol (αTN) or vitamin C (VitC). Feed and water were freely ingested during the breeding period, and the temperature was maintained at 22 ± 1 ℃ and humidity at 60 ± 5%, and the photoperiod and dark cycle were adjusted to 12 hours daily.

The -UVB and + UVB groups consumed tablets prepared according to the AIN-93 rat diet (Reeves, PG et al., J Nutr, 123: 1939-1951, 1993). A diet prepared by adding 0.2% α-terpineol (Sigma-Aldrich) and the VitC group to the AIN-93 tablet diet by adding 0.2% vitamin C (Sigma-Aldrich) for 13 weeks. The composition of the detailed experimental diet is shown in [Table 2]. The diet was fed with water between 10 am and 11 am daily, and dietary intake was measured daily.

Ultraviolet B (UVB) was irradiated to the back of the hairless mice three times a week during the breeding period. The UV irradiation dose was 73 mJ / cm ² for the first week, 146 mJ / cm ^{2 for the} second week, and 219 from 3 to 13 weeks. It was investigated at mJ / cm ² . During breeding, body weight and skin thickness measurements were taken and back skin photographs were taken every week. Skin thickness was measured by the hip portion of hairless mice using a digital micro caliper (Marathon Watch Company Ltd, Ontario, Canada). The caliper used for the measurement was able to measure up to 0.01 mm, and it has a control function to apply a constant force to the thickness, so that the thickness of the skin was measured under the same force.

After the experiment was completed, the animals were anesthetized and blood was collected and used for hematological analysis. Some of the dorsal skin tissues were cut and stored in the freezer, and some were used for molecular biological tests. Fixed to and used for immunohistochemical staining.

Experimental composition table

ingredient	AIN-93G Dietary (g / kg diet)	α-terpineol Supplementary diet ( αTN ) (g / kg diet)	Vitamin C Supplementary diet ( Vitc ) (g / kg diet)
Casein	200	200	200
Maltodextrin	132	132	132
Corn starch	397.486	395.486	395.486
Sucrose	100	100	100
cellulose	50	50	50
Soybean oil	70	70	70
Vitamin complex	10	10	10
Mineral complex	35	35	35
Choline Bitartrate	2.5	2.5	2.5
L-cystine	3	3	3
Tert-Butyhydroquinone	0.014	0.014	0.014
α-terpineol	-	2	-
Vitamin c	-	-	2
Total (g)	1,000	1,000	1,000

2-2) Skin moisturizing, elasticity and erythema index measurement

Skin moisture content, water evaporation, elasticity and erythema index were measured once using the Corneometer ^® , Tewameter ^® , Cutometer ^® and Mexameter ^® (CK Electronics GmbH), respectively. When measuring, the numerical value that appears by lightly pressing a certain part of the experimental animal and the like was recorded.

2-3) Wrinkle measurement of the back skin tissue

The skin of the hairless mice irradiated with ultraviolet rays for 13 weeks was made with silicone rubber to measure the extent of wrinkle formation. Attach a disk with a circular hole with a diameter of 1 cm to the back of the hairless mouse, mix the reagent for making a replica, thinly spread it on the back of the hairless mouse, dry it completely, and carefully remove the disk. Was produced. Fabrication temperature of the replica plate was carried out at a constant temperature and humidity condition of 20 ~ 23 ℃, humidity 45 ~ 50%, and a silicon rubber impression material (Epigem, Seoul, Korea) for producing a replica plate. Analysis of the simulated platen was performed using a computer image analyzer (Visioline VL650, CK electronic GmbH, Germany) for total wrinkle area, maximum wrinkle depth, mean depth and mean wrinkles. Four wrinkle indicator items such as mean length were analyzed.

2-4) Immunohistochemical staining of skin tissue

The back skin tissue of hairless mice was extracted, fixed in 10% formalin, and then stained with hematoxylin and eosin (H & E). Observations were made using a fluorescence microscope (ECLIPSE E600, Nikon, Japan), and photographs were taken using a digital camera (DXM 1200F, Nickon, Japan).

2-5) RT-PCR Analysis

The tissue was pulverized by adding 1 ml of Trizol solution per 0.1 g of back skin tissue, and then centrifuged at 4 ° C. and 12,000 × g for 10 minutes. The supernatant was transferred to a new tube and 200 μl of chloroform was added and vortexed. This process was repeated twice, after which the supernatant was transferred to a new tube, and isopropanol and supernatant were added in a 1: 1 ratio. After shaking vigorously 10 times and left at room temperature for 15 minutes, centrifugation was performed at 12,000 × g and 4 ° C. for 10 minutes, and then the supernatant was removed. Centrifuge for 5 minutes at. After removing the ethanol, the tube containing the RNA precipitate was dried at room temperature for 15 minutes, and the RNA pellet was dissolved using water without nuclease. UV / VIS spectrophotometer (Beckman coulter, DU730) was used to measure the concentration of RNA samples extracted at 260 nm and 280 nm wavelength, and agarose gel electrophoresis was performed to confirm the integrity of the RNA samples (integrity) It was.

CDNA was synthesized by performing reverse transcription using oligo dT primer and superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA). PCR was performed using 5D and 3 'flanking sequences of the gene cDNA to be amplified as a template and cDNA obtained through reverse transcription, and the primer sequences used were shown in [Table 3]. As shown. 1 μl of the amplified PCR product was electrophoresed on a 1% agarose gel to confirm DNA bands.

Primer sequences used for RT-PCR

gene	primer	Sequence (5 '→ 3')	Annealing  Temperature (℃)	PCR product (bp)	SEQ ID NO:
Collagen type Ⅰ alpha 1 (Col1α1)	F		ggcaacagtcgcttcaccta	55	164	7
	R		agtccgaattcctggtctgg			8
Collagen type Ⅰ alpha 2 (Col1α2)	F		cggttctgttggtcctgttg	55	103	9
	R		acccctgtgccctttatcac			10
Collagen type III alpha 1 (Col3α1)	F		taaccaaggctgcaagatgg	55	104	11
	R		accagtgcttacgtgggaca			12
Matrix metallopeptidase 1a (MMP-1a)	F		ccctgtgtttcacaacggag	55	133	13
	R		cctcagcttttcagccatca			14
Matrix metallopeptidase 1b (MMP-1b)	F		tttgctcatgcttttctgcc	55	146	15
	R	gaatgggagagtccaaggga			16
Matrix metallopeptidase 3 (MMP-3)	F		tgctggtatggagcttctgc	55	142	17
	R		catctccaacccgaggaact			18
Matrix metallopeptidase 9 (MMP-9)	F		gtggaccatgaggtgaacca	55	102	19
	R		actgcacggttgaagcaaag			20
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH)	F		ggagattgttgccatcaacg	55	122	21
	R		tgacaagcttcccattctcg			22

2-6) Results of Weight and Dietary Intake of Hairless Mice

As shown in FIG. 3, UV irradiation, α-terpineol and vitamin C intake did not significantly affect the weight and dietary intake of hairless mouse mice (see FIG. 3).

2-7) Measurement of moisture content, elasticity and erythema index changes in skin tissue of UV-radiated hairless mice

As shown in FIG. 4, the + UVB control group irradiated with UV rays for 13 weeks significantly reduced water content and elasticity of skin tissues, compared to the normal group (-UVB) group not irradiated with UV rays, while water evaporation and erythema index. Increased significantly (see Figure 4). In the case of α-terpineol-ingested group (αTN), moisture content and elasticity increased significantly 37% and 36%, respectively, compared to the + UVB control group, despite UV irradiation at the same intensity. Was significantly decreased by 47% and 20%, respectively. The effect of α-terpineol on skin tissue moisture content, elasticity and erythema index was similar to that of vitamin C (see FIG. 5).

2-8) Measurement Results of Changes in Skin Wrinkles in Ultraviolet Irradiated Hairless Mice

In order to evaluate the effect of α-terpineol ingestion on the formation of skin wrinkles, UV-irradiated anti-wrinkle activity of the α-Tpineol-fed group (αTN) was irradiated with UVB for 13 weeks. The back skin of the irradiated control group (+ UVB) was photographed and compared. As shown in FIG. 6, the + UVB control group was able to visually observe the formation of fine wrinkles with a number of coarse and deeply dug wrinkles compared to the normal group (-UVB) that was not irradiated with ultraviolet rays, and α-terpineol intake In the case of the group, compared to the + UVB control group, the thickness and depth of the wrinkles were markedly reduced, and thus, the skin condition was improved similar to that observed in the -UVB group not irradiated with ultraviolet rays (see FIG. 5).

The skin of the back skin of the hairless mice irradiated with UV light for 13 weeks was prepared by using a silicone rubber to measure the extent of wrinkle formation. The + UVB control group was thicker and deeper than the normal group (-UVB). It was observed that fine wrinkles were formed together with the α-terpineol intake group, and despite the same intensity of UV irradiation, deep wrinkles were almost disappeared compared to the + UVB control group. It confirmed (refer FIG. 6). In the results of numerical simulation of the wrinkle formation on the mock plate using a computer image analyzer, the αTN group had a total wrinkle area of 40%, a maximum wrinkle depth of 65%, an average wrinkle depth of 19%, and an average wrinkle in the αTN group compared to the + UVB group. The length was significantly reduced by 45%, and the anti-wrinkle effect of α-terpineol was similar to the anti-wrinkle effect observed in vitamin C (see FIG. 6). Therefore, it can be seen that ingestion of α-terpineol significantly inhibits wrinkle formation by ultraviolet irradiation.

2-9) Measurement Results of Changes in Skin Thickness of Ultraviolet Irradiated Hairless Mice

As photoaging progresses due to ultraviolet rays, the formation of the stratum corneum increases to protect the dermal layer of the skin, and the thickness of the skin epidermal layer becomes thick, and the thickness of the skin thickened by ultraviolet irradiation means that the skin damage caused by photoaging is large. Gail J Molecular mechanism of skin ageing Mech Ageing Dev 123: 801-810, 2002)

As a result of measuring the thickness of the back skin using a digital micro caliper on the last day of experimental breeding, as shown in FIG. 7, the group ingesting α-terpineol significantly reduced skin thickness by 20% compared to the + UVB control group. Was confirmed (see FIG. 7A). The skin epidermal layer thickness of hairless mice by H & E staining of skin tissue was also observed in the + UVB control group compared to the normal group (-UVB) that was not irradiated with UV, and the thickening of the skin epidermal layer was observed in the αTN group. It was confirmed that the thickness of the thickened epidermal layer was significantly reduced compared to the control (see Fig. 7B).

2-10) Gene Expression Changes in Skin Tissue of Ultraviolet Irradiated Hairless Mice

Collagen types 1 and 3 are proteins that constitute the cytoplasmic components of the dermal layer, and in particular, type 1 collagen is present in the largest amount of extracellular matrix proteins present in skin connective tissue. On the other hand, there are 23 types of MMPs that catalyze collagen breakdown in mammals, and MMP types known to increase by ultraviolet rays are known as Nos. 1, 3, and 9. These three types of MMPs are enzymes that degrade collagen types 1 and 3. Known as While MMP-1 cuts the middle of collagen fibers, MMP-3 and MMP-9 are known to play a role in subdividing and cutting the cut collagen fibers.

As a result of evaluating gene expression changes by RT-PCR analysis on skin tissue, collagen type 1α1 and α2 and collagen type 3α1 of + UVB control group were compared with normal group (-UVB) without UV irradiation. The expression of MMP-1a and -1b, MMP-3, and MMP-9 genes were significantly increased. In the α-terpineol group, the expression of collagen type 1α1 and α2 and collagen type 3α1 were significantly increased compared to the + UVB control group. The expression of MMP-1a and -1b, MMP-3, and MMP-9 genes was significantly increased. Significantly decreased (see FIG. 8). Therefore, α-terpineol is thought to mitigate wrinkle formation by UV irradiation by increasing collagen protein synthesis in the subcutaneous tissues and inhibiting collagen fiber degradation.

Example  3. Anti-wrinkle effect and skin irritation sensory test

3-1) Formulation Examples and Comparative Examples

Component composition of the nourishing cream containing α-terpineol was prepared as shown in Table 4 below. At this time, the unit of component content is weight%.

Composition of Nutritional Cream Containing α-terpineol

number	ingredient	Example	Comparative example
One	Cetearyl Alcohol	1.5	1.5
2	Glyceryl Stearate	1.0	1.0
3	Polysorbate 60	1.2	1.2
4	Sorbitan sesquioleate	0.3	0.3
5	Cetyloctanoate	6.0	6.0
6	Squalane	8.0	8.0
7	Apricot Kernel Oil	4.0	4.0
8	Dimethicone	1.0	1.0
9	Butylene Glycol	5.0	5.0
10	glycerin	4.0	4.0
11	Magnesium Aluminum Silicate	0.2	0.2
12	Xanthan Gum	0.05	0.05
13	antiseptic	a very small amount	a very small amount
14	Purified water	Remaining amount		Remaining amount
15	α-terpineol	1.0	-

On the other hand, among the components identified by each component number in Table 4, components 1 to 8 were first dissolved by heating at a temperature of 70 ° C, and then components 9 to 13 were dissolved and dispersed in component 14 and emulsified in heating to 70 ° C. . Thereafter, the emulsified product was cooled to a temperature of 56 ° C., and then component 15 dissolved in the fractionated component 9 was added thereto, stirred, and cooled to room temperature to prepare.

The comparative example for the formulation example, except for the component 15 α-terpineol, except for the component composition or the manufacturing method was set to proceed in the same manner.

3-2) Wrinkle improvement effect and skin irritation sensory test

In order to evaluate the skin wrinkle improvement effect and skin irritation of the cosmetic composition for skin wrinkle improvement according to the present invention, a sensory test was carried out using the nutrition cream prepared in the above formulation example and the comparative formulation example.

Specifically, in order to measure the antiwrinkle effect of the skin when the nourishing creams of the formulation examples and the comparative formulations shown in Table 4 were applied to the skin, the left side of the face was provided with the nourishing cream of the formulation example (test) Group), and the right side of the face was allowed to continuously use the nutrition cream (control) of the formulation comparative example once a day for 12 weeks.

In the sensory test, the anti-wrinkle effect of skin was evaluated based on the nourishing cream of the comparative formulation, and the anti-wrinkle effect of the nourishing cream of the formulation was relatively evaluated. This phenomenon was evaluated. The evaluation was performed based on the five-point method of very good (5 points), good (4 points), moderate (3 points), bad (2 points), very bad (1 point), and the results are shown in Table 5 below. Indicated. In Table 5, the skin irritation indicates the degree of no skin irritation.

Skin irritation and wrinkle improvement test results

number	Skin irritation		Wrinkle improvement effect
	Example	Comparative example	Example	Comparative example
One	3	4	4	4
2	5	5	5	5
3	5	5	5	4
4	4	4	5	3
5	4	4	5	4
6	3	4	5	5
7	4	4	4	4
8	4	4	4	3
9	5	5	5	4
10	4	4	4	4
11	5	5	4	4
12	5	5	4	5
13	4	4	4	4
14	4	4	5	4
15	5	4	4	5
16	5	5	4	4
17	5	5	5	4
18	4	5	4	3
19	4	5	5	5
20	4	4	4	4
Average	4.3	4.45	4.45	4.1

As shown in Table 5, the skin irritation evaluation score for the cosmetic composition of the formulation example according to the present invention was evaluated very good as 4.3 points, it can be confirmed that the skin stimulation degree is low, as in the formulation comparative example, excellent skin safety. there was.

In addition, the relative skin wrinkle improvement effect of the cosmetic composition of the formulation example compared to the formulation comparative example was found to be very excellent in the degree of improvement to an evaluation score of 4.45.

As described above, the present invention provides a cosmetic composition containing α-terpineol as an active ingredient. The cosmetic composition according to the present invention has no skin side effects, and is very useful for improving wrinkles of the skin because of its excellent anti-wrinkle effect, collagen synthesis effect, and collagenase expression inhibiting effect. It is thought that the composition containing α-terpineol of the present invention may be used as a material for functional cosmetics or health functional foods in the future.

3-3) Skin Moisturizing Increase Measurement Test

In order to measure the antiwrinkle effect of the skin when the nourishing creams of Formulation Examples and Formulation Comparative Examples described in Table 4 were applied to the skin, the left side of the face was provided with nourishing creams (test group) of 20 women over 20 years old. On the right side of the face, the nutritional cream (control) of the comparative formulation was continuously used once a day for 12 weeks.

The electrical conductivity of the epidermis at constant temperature and constant humidity (24 ° C, 40% relative humidity) before and after the start of application, 4 weeks, 8 weeks, 12 weeks after application, and 2 weeks after application was stopped. The skin moisture level was measured using a skin moisture meter that measures the amount of moisture present in the skin by measuring the value.

The test results are shown in the following [Table 6], and the results of the following [Table 6] were obtained after treatment for a certain period of time (4 weeks, 8 weeks, 12 weeks) based on the Koniometer value measured immediately before the start of the test. The increase in measured values is expressed as a percentage.

Moisture growth rate

division	Moisture Growth Rate (%)
	4 Weeks	8 Weeks	12 Weeks
Test group average	43	51	65
Control mean	13	35	42

As shown in [Table 6], in the group to which the nutrient cream containing α-terpineol was applied, it was confirmed that the skin moisture content was increased significantly compared to the control group.

Example  4. Experimental effect of skin elasticity

Applicants compared the skin activity effects of the compound terpinene-4-ol component similar to the α-terpineol of the present invention to confirm the superiority of the α-terpineol wrinkle improvement efficacy. To this end, experiments were performed to compare procollagen type I C-peptide (PIP) expression concentrations in human dermal fibroblasts according to the method described in Example 1, and the results are shown in FIG. 9.

Specifically, each experimental group (αTN, Terpinen-4-ol) and control (+ UVA) human dermal fibroblasts were irradiated with UV 30 mJ / cm 2, and the experimental groups α-terpineol (αTN) and terpinene-4, respectively. After treatment with 100 μM of Terpinen-4-ol, the concentration of procollagen type I C-peptide (PIP) secreted into the extracellular matrix was measured.

As a result, in the experimental group treated with α-terpineol with ultraviolet irradiation (αTN), the amount of collagen increased 37% significantly compared to the control cells (+ UVA) irradiated with ultraviolet rays, whereas terpinene-4-ol was treated. In one cell (Terpinen-4-ol), the amount of collagen increased only 11% compared to the control group (+ UVA). The collagen synthesis ability of the present invention α-terpineol was confirmed to be three times or more superior to terpinene-4-ol, thereby demonstrating the excellent skin activity effect of α-terpineol.

[Production Example 1]

Production of cosmetics

1-1) Preparation of flexible lotion

A flexible lotion containing α-terpineol as an active ingredient was prepared according to a conventional method.

Component Content (wt%) α-terpineol 0.1, Glycerine 3.0, Butylene Glycol 2.0, Propylene Glycol 2.0, Carboxyvinyl Polymer 0.1, Ethanol 10.0, Triethanolamine 0.1, Preservative, Trace Pigment, Trace Fragrance

1-2) Preparation of Nutritional Cream

A nutritious cream containing α-terpineol as an active ingredient was prepared according to a conventional method. Component content is described in weight percent.

α-terpineol 0.1, beeswax 10.0, polysorbate 60 1.5, sorbitan sesquioleate 0.5, liquid paraffin 10.0, squalane 5.0, caprylic / capric triglyceride 5.0, glycerin 5.0, butylene glycol 3.0, propylene glycol 3.0, triethanolamine 0.2, preservatives, trace pigments, trace fragrances and trace purified water

1-3) Preparation of Mask Pack Composition and Mask Pack

A mask pack composition containing α-terpineol as an active ingredient was prepared according to a conventional method. Component content is described in weight percent.

α-terpineol 0.1, cytosterol 13.0, polyglyceryl 2-oleate 0.2, ceramide 0.1, ceteareth-4 5.0, cholesterol 0.3, dicetylphosphate 0.4, concentrated glycerin 2.0, macadamia oil 10.0, carboxyvinyl polymer 0.4 Xanthan gum 0.1, preservative 0.2, flavor 0.15. Purified Water 68.05 Total 100.0

A mask pack product was prepared by impregnating the prepared mask pack composition into a nonwoven fabric (width x length, 10 × 10 cm).

[Production Example 2]

Preparation of Pharmaceutical Formulations

2-1) Preparation of Powder

2 g of α-terpineol of the present invention

1 g lactose

The above ingredients were mixed and filled in airtight cloth to prepare a powder.

2-2) Preparation of Tablet

100 mg of α-terpineol of the present invention

Corn starch 100 mg

Lactose 100 mg

2 mg magnesium stearate

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

2-3) Preparation of Capsule

100 mg of α-terpineol of the present invention

Corn starch 100 mg

Lactose 100 mg

2 mg magnesium stearate

After mixing the above components, the capsule was prepared by filling in gelatin capsules according to the conventional method for producing a capsule.

2-4) Preparation of Ring

1 g of α-terpineol of the present invention

Lactose 1.5 g

1 g of glycerin

Xylitol 0.5 g

After mixing the above components, it was prepared to be 4 g per ring in a conventional manner.

2-5) Preparation of Granules

Α-terpineol 150 mg of the present invention

Soy extract 50 mg

Glucose 200 mg

Starch 600 mg

After mixing the above components, 100 mg of 30% ethanol was added, dried at 60 ° C. to form granules, and then filled into fabrics.

[Production Example 3]

Manufacture of food

The nutraceutical composition containing α-terpineol was prepared by the conventional liquid preparation method with the same composition as the respective preparation examples. The final volume is 100 ml in each liquid. This formulation example can be prepared by a conventional production method as well as liquid tablets, powders, granules and the like.

Ingredients (wt%) α-terpineol 100 mg, honey 1500 mg, vitamin C 50 mg, vitamin B6 10 mg, nicotinic acid amide 10 mg, royal jelly 80 mg, preservatives, fragrance, microcrystalline residue total 100 mg

Claims (18)

1. Cosmetic composition for moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema with α-terpineol as an active ingredient.
2. The method of claim 1,

   The α-terpineol is a cosmetic composition for moisturizing skin, improving skin wrinkles, enhancing skin elasticity or erythema suppression, characterized in that 0.0001 to 20% by weight based on the total weight of the cosmetic.
3. The method of claim 1,

   The composition has one or more effects selected from the group consisting of increased procollagen secretion, promotion of collagen biosynthesis, decreased expression of MMP-1 gene, and inhibition of skin epidermal layer thickening, skin moisturization, skin wrinkle improvement, skin Cosmetic composition for enhancing elasticity or inhibiting erythema.
4. The method of claim 1,

   The cosmetics include skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, essence, pack, mask pack, mask sheet, soap, shampoo Moisturizing, improving skin wrinkles, enhancing skin elasticity, characterized in that it has one of the formulations selected from the group consisting of cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, latex, press powder, loose powder and eye shadow Or cosmetic composition for inhibiting erythema.
5. The method of claim 1,

   The composition is a cosmetic composition for moisturizing skin, improving skin wrinkles, enhancing skin elasticity or erythema suppression, characterized in that it further comprises a cosmetically acceptable carrier.
6. The method of claim 1,

   The composition is a cosmetic composition for skin moisturizing, skin wrinkle improvement, skin elasticity enhancement or erythema suppression further comprises a skin wrinkle improvement component.
7. The method of claim 6,

   Additional skin wrinkle improvement ingredients are for moisturizing the skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema, which is at least one selected from the group consisting of vitamin C, retinoic acid, TGF, protein from animal placenta, betulinic acid and chlorella extracts. Cosmetic composition.
8. A food composition for moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema containing α-terpineol as an active ingredient.
9. The method of claim 8,

   The food is a food composition for moisturizing skin, improving skin wrinkles, enhancing skin elasticity or erythema suppression, characterized in that it is prepared in any one formulation selected from the group consisting of tablets, granules, powders, capsules, liquid solutions and pills.
10. A pharmaceutical composition for moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema containing α-terpineol as an active ingredient.
11. Skin external preparation composition for moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema containing α-terpineol as an active ingredient.
12. Method of moisturizing skin, improving skin wrinkles, enhancing skin elasticity or inhibiting erythema using a composition containing α-terpineol as an active ingredient.
13. The method of claim 12,

    The α-terpineol is 0.0001 to 20% by weight based on the total weight of the composition, characterized in that the skin moisturizing, skin wrinkle improvement, skin elasticity enhancement or erythema suppression method.
14. The method of claim 12,

    The composition has one or more effects selected from the group consisting of increased procollagen secretion, promotion of collagen biosynthesis, decreased expression of MMP-1 gene, and inhibition of skin epidermal layer thickening, moisturizing skin, improving skin wrinkles, and skin elasticity. Methods of enhancing or inhibiting erythema.
15. The method of claim 12,

    The composition is a method for moisturizing skin, improving skin wrinkles, enhancing skin elasticity or erythema suppression, characterized in that at least one selected from the group consisting of a cosmetic composition, a composition for external application, a food composition and a pharmaceutical composition.
16. The method of claim 15,

    The cosmetics include skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, essence, pack, mask pack, mask sheet, soap, shampoo Moisturizing skin, improving skin wrinkles, enhancing skin elasticity, characterized in that it has one of the formulations selected from the group consisting of cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, latex, press powder, loose powder and eye shadow Or erythema suppression method.
17. The method of claim 12,

    The composition is a method for moisturizing skin, improving skin wrinkles, skin elasticity enhancement or erythema suppression further comprising a skin wrinkle improvement component or skin elasticity enhancing component.
18. The method of claim 17,

    The additional skin wrinkle improvement component is any one or more selected from the group consisting of vitamin C, retinoic acid, TGF, protein from animal placenta, betulinic acid and chlorella extract, skin moisturization, skin wrinkle improvement, skin elasticity enhancement or erythema suppression Way.

Images