WO2018070707A1 - Composition for preventing or treating muscle disease comprising decanal or pharmaceutically acceptable salt thereof as active ingredient - Google Patents

Abstract

The present invention relates to a composition for preventing or treating a muscle disease or improving myofunction comprising decanal or a pharmaceutically acceptable salt thereof as an active ingredient and, more specifically, to a pharmaceutical composition for preventing or treating a muscle disease, a health functional food composition for preventing or improving a muscle disease, a pharmaceutical composition for promoting muscle differentiation or for regenerating or strengthening muscle, a health functional food composition for promoting muscle differentiation or for regenerating or strengthening muscle, a cosmetic composition for improving myofunction, and a livestock feed composition for preventing or treating a muscle disease, which comprise decanal or a pharmaceutically acceptable salt thereof as an active ingredient.

Description

Decantal or a pharmaceutical composition for preventing or treating muscle diseases comprising a pharmaceutically acceptable salt thereof as an active ingredient

This application claims the priority of Korean Patent Application No. 10-2016-0132845, filed October 13, 2016, the entirety of which is a reference of the present application.

The present invention relates to a composition for preventing or treating muscle diseases comprising decanal or a pharmaceutically acceptable salt thereof as an active ingredient.

In Korea, the elderly population accounted for 7.2% of the total population in 2000 and entered an aging society. In 2050, the aged population is expected to enter an aging society (more than 20%). Muscle mass in humans decreases with age (10-15% at 50-70 years, and more than 30% at 70-80 years), thereby weakening muscle strength and muscle function, which is called sarcopenia. do. Geriatric muscular dystrophy is a major cause of limiting the independent living of the elderly by inducing activity disorder and gait disorder. In addition, myopathy decreases basal metabolic rate, increases insulin resistance, promotes type 2 diabetes, and increases the risk of hypertension and cardiovascular disease by 3-5 times. Currently, no drug has been approved for the treatment of myopathy, and drug repositioning technology is being developed to apply myostatin inhibitor or other FDA-approved drugs to myopathy.

Meanwhile, muscle is divided into skeletal muscle, cardiac muscle, and smooth muscle, and skeletal muscle is the most abundant tissue in the human body, and occupies 40-45% of body weight. . Skeletal muscles attach to bones through the tendons, creating bone movement or force. One muscle is made up of numerous myofibers, which in turn are made up of numerous myofibers composed of actin and myosin. When actin and myosin overlap each other, they shorten or lengthen the muscles, causing the entire muscle to contract and relax. An increase in myofibril size means an increase in myofiber thickness, resulting in an increase in muscle.

The types of muscle fibers that make up muscle are classified into Type, Type IIA and Type B mainly by the metabolic process and contraction rate that produce ATP. 'Type muscle fiber' has a slow contraction rate and contains a large number of myoglobin and mitochondria, which is suitable for continuous and low-intensity aerobic activity. Type muscle fibers have a red color and are also referred to as red muscles, and soleus is typical. On the other hand, 'Type B muscle fiber' is very short due to its fast shrinkage rate, but is used for high intensity anaerobic exercise, and has a low content of myoglobin, resulting in white color. Type A muscle fibers follow the intermediate characteristics of the two muscle fibers mentioned above. As you get older, the type of muscle and type II muscle fibers change, as well as all types of muscle fibers.

Skeletal muscles have the characteristics of being regenerated and maintained according to the environment, but these characteristics are lost with age, and consequently, as aging progresses, muscle mass is reduced and muscle strength is also lost. Signaling systems involved in the growth and regeneration of muscle include signaling mediated by insulin like growth factor 1 (IGF-1) / AKT to regulate protein synthesis. The activation of IGF-1 receptor (IGF-1R) in the muscle cell membrane increases AKT phosphorylation through IRS1 and PI3K phosphorylation, and the latter activates mTORC phosphorylation. Activation of mTORC increases the phosphorylation of ribosomal protein S6 kinase beta-1 (P70S6K1), increases mRNA translation, increases eukaryotic translation initiation factor 4 G (eIF4G) activity, and eukaryotic translation initiation factor 4E binding protein Phosphorylate 1 (4E-BP1) protein. eIF4G and 4E-BP1 are involved in the formation of the eIF4F complex, that is, eIF4G binds to eIF4A and eIF4E to form an eIF4F complex, while phosphorylation of 4E-BP1 inhibits its binding to eIF4E, leading to an increase in free eIF4E. . The latter combines with other translation initiation factors (eIF4G and eIF4A) to form an eIF4F complex, which in turn promotes translation initiation by stabilizing ribosomal structures, ultimately increasing protein synthesis.

In addition, AKT phosphorylation stimulates muscle fiber growth by increasing eIF2B expression through glycogen synthase kinase 3 (GSK3) and also inhibits muscle loss by inhibiting the expression of forkhead box O (FOXO), a protein-related transcription factor. Muscle loss is regulated by signaling mediated by receptors of the TGF-β family, including myostatin, transforming growth factor beta (TGF-β), and activin. Binding of the ligand to the TGF-β type II receptor phosphorylates the type I receptor, the latter phosphorylates the smad 2/3 complex and eventually activates FOXO. The latter increases the gene expression of muscle-specific ubiquitin-ligase, muscle RING-finger protein-1 (MuRF1) and Muscle Atrophy F-Box (MaFbx) / atrogin-1, which attach ubiquitin to the lysine site of the target protein. Promote proteolysis, eventually leading to muscle loss.

Therefore, the present inventors have attempted to develop a food material that is effective in improving muscles and improving muscle loss by inhibiting the degradation of muscle proteins and promoting synthesis in natural products with few side effects.

The present inventors have tried to find a naturally derived compound that can prevent or treat muscle diseases without side effects. As a result, the mechanism of muscle enhancement and muscle loss action of decanal was identified.

Accordingly, an object of the present invention is to solve the above problems, prevent or treat muscle diseases comprising a decanal compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient It is to provide a pharmaceutical composition.

[Formula 1]

Still another object of the present invention is to provide a health functional food composition for preventing or improving muscle diseases including a decanal compound or a pharmaceutically acceptable salt thereof as an active ingredient.

Still another object of the present invention is to provide a pharmaceutical composition for promoting muscle differentiation, muscle regeneration, or muscle strengthening, including a decanal compound or a pharmaceutically acceptable salt thereof as an active ingredient.

Still another object of the present invention is to provide a health functional food composition for promoting muscle differentiation, muscle regeneration or muscle enhancement, including a decanal compound or a pharmaceutically acceptable salt thereof as an active ingredient.

Still another object of the present invention is to provide a decanal compound or a pharmaceutical composition for improving muscle function, including a pharmaceutically acceptable salt thereof as an active ingredient.

Still another object of the present invention is to provide a composition for animal feed for preventing or treating muscle diseases, including a decanal compound or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention is to provide a method for preventing or treating muscle diseases, including administering a composition comprising decanal or a pharmaceutically acceptable salt thereof as an active ingredient.

Furthermore, the present invention is to provide a use of a composition comprising decanal or a pharmaceutically acceptable salt thereof as an active ingredient for the preparation of a preventive or therapeutic agent for muscle diseases.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating muscle diseases comprising a decanal compound represented by the following Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

[Formula 1]

According to a preferred embodiment of the present invention, the composition may be to increase the expression of p-4E-BP1 or p-p70S6K1 protein.

According to another preferred embodiment of the present invention, the composition may be to reduce the expression of MuRF1 (Muscle Ring-Finger Protein) or MaFbx (Muscle atrophy F-box).

According to another preferred embodiment of the present invention, the compound may be included in the composition at a concentration of 0.1 to 1000μM.

According to another preferred embodiment of the present invention, the muscle disease may be a muscle disease due to muscle function degradation, muscle reduction, muscle wasting or muscle degeneration.

According to another preferred embodiment of the present invention, the muscle disease is atony, muscular atrophy, muscular dystrophy, ataxia, cachexia, rigid spinesyndrome, At least one selected from the group consisting of amyotrophic lateral sclerosis, rigid spinse syndrome, Charcot-Marie-Tooth disease and sarcopenia It may be.

In addition, the present invention provides a decanal compound or a health functional food composition for preventing or improving muscle diseases, including a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for promoting muscle differentiation, muscle regeneration or muscle enhancement, including a decanal compound or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a health functional food composition for promoting muscle differentiation, muscle regeneration, or muscle strengthening, including a decanal compound or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a decanal compound (Decanal) or a pharmaceutically acceptable salt thereof as an active ingredient provides a cosmetic composition for improving muscle function.

In addition, the present invention provides a composition for animal feed for the prevention or treatment of muscle diseases comprising a decanal compound (Decanal) or a pharmaceutically acceptable salt thereof as an active ingredient.

According to a preferred embodiment of the present invention, the livestock may be one livestock selected from the group consisting of cattle, pigs, chickens, ducks, goats, sheep and horses.

The present invention relates to a composition for preventing or treating muscle diseases, or improving muscle function, comprising decanal or a pharmaceutically acceptable salt thereof as an active ingredient, wherein the decanal is used to synthesize muscle protein in muscle cells and It is possible to increase the expression of proteins associated with increased muscle mass, and the expression of enzymes involved in muscle protein degradation can be suppressed from the mRNA level, so muscle differentiation, muscle regeneration, Increasing muscle mass can increase muscle strength and inhibit muscle loss. In addition, high fat diets may improve muscle loss and muscle weakness associated with ingestion.

Therefore, the composition of the present invention can be used for preventing or treating muscle diseases, muscle differentiation, muscle regeneration and muscle mass increase or muscle function improvement.

Figure 1 shows the change in the thickness of myotubes in mouse myoblasts. FIG. 1A is a microscopic image of giemsa-wright stained root canal cells, and FIG. 1B is a result of measuring the diameter of the root canal cells, and each value is the mean ± standard error of three crystals in three independent wells. P <0.05 indicates statistical significance

Figure 2 shows the expression changes of molecules related to protein degradation and synthesis in mouse myoblasts treated with decanal. 2A shows the protein levels of p-4E-BP1, Total 4E-BP1, p-p70S6K1, and Total p70S6K1, and FIG. 2B shows the gene expression levels of MaFbx and MuRF1. Each value is the mean ± standard error of three determinations in three independent wells. P <0.05 indicates statistical significance.

Figure 3 is a graph showing the results of the increase in the muscle extremities muscle intake by decanal.

Figure 4 is a graph showing the change in muscle fiber diameter of mouse muscle tissue by decanal intake. 4a shows rectus femoris, 4b soleus, and 4c gastrocnemius muscle tissues.

Hereinafter, the present invention will be described in detail.

As described above, the search for a substance that has excellent muscle function regulating activity and can be applied safely is still required, but studies on the effects of decanal on muscle disease and muscle function improvement have not been reported until now.

Deccanal according to the present invention can increase the expression of proteins related to muscle protein synthesis and muscle mass increase in muscle cells, can exhibit an effect of increasing muscle mass in muscle diseases caused by muscle function degradation, muscle wasting or muscle degeneration It is effective as an active ingredient of a composition for preventing or treating diseases.

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating muscle diseases comprising a decanal compound represented by Formula 1 below or a pharmaceutically acceptable salt thereof as an active ingredient.

[Formula 1]

The term "decanal" of the present invention is an aldehyde-based compound, which may be represented as chemical identification number (CAS No.) 112-31-2, aldehyde C-10, caprinaldehyde, decyl aldehyde, Also known as tinnitus such as decanaldehyde.

Deccanal is widely used as an anti-drug agent and as a medicine. The biological activity of decanal reported so far is that decanal is treated in embryos cells of sea urchins and copepods (aquatic animals such as black fleas), causing apoptosis. By inducing reproductive failure (Romano et al. A marine diatom-derived aldehyde induces apoptosis in copepod and sea urchin embryos.Journal of Experimental Biology 206: 3487-3494, 2003), decanal and N-amino-N ' The treatment of -1-octylguanidine (AOG) with tumor cells, HeLa cells and bacteria, has been reported to produce synergistic activity and inhibit growth (Rideout et al. Self-assembling cytotoxins.Science 233: 561-563 , 1986) It has been reported that decanal's potent nematicidal activity blocks and inhibits the reproduction of parasitic nematodes in the roots of plants (Kim et al. Nematicidal activity of plant es). sential oils and components from coriander (Coriandrum sativum), oriental sweetgum (Liquidambar orientalis), and valerian (Valeriana wallichii) essential oils against pine wood nematode (Bursaphelenchus xylophilus) .Journal of Agricultural and Food Chemistry 56: 7316-7320, 2008.

However, in the present invention, decanal increases the thickness of myotubes, increases the expression of proteins associated with muscle protein synthesis and muscle mass, and reduces the expression of genes that promote the degradation of muscle proteins. It was confirmed that there is a prophylactic or therapeutic effect.

The composition of the present invention may be characterized by increasing the expression of p-4E-BP1 or p-p70S6K1 protein.

In addition, the composition of the present invention may be characterized by reducing the expression of the MuRF1 (Muscle Ring-Finger Protein) or MaFbx (Muscle atrophy F-box).

Specifically, representative molecules related to protein synthesis include p70S6K1, 4E-BP1, and eIF members, and these three molecules are regulated by higher mTORCs. Activation of mTORc phosphorylates p70S6K1 and activated p70S6K1 phosphorylates 40S ribosomal protein S6 to increase mRNA translation. Activation of mTORC also increases the activity of eIF4G and simultaneously phosphorylates 4E-BP1, both molecules involved in forming the eIF4F complex. That is, eIF4G binds to eIF4A and eIF4E to form an eIF4F complex, while when 4E-BP1 is phosphorylated, its binding ability with eIF4E is inhibited to increase the free eIF4E. The latter combines with other translation initiation factors (eIF4G and eIF4A) to form an eIF4F complex, which in turn promotes translation initiation by stabilizing ribosomal structures, ultimately increasing protein synthesis. MAFbx / Atrogin-1 and MuRF1 are muscle-specific ubiquitin-ligases, which are representative proteins that attach ubiquitin to the lysine site of the target protein to promote protein degradation and ultimately muscle loss.

As shown in Example 2 of the present invention, the composition of the present invention was confirmed to change the expression of molecules related to protein synthesis and degradation. Specifically, it was confirmed that the expression of p-4E-BP1 and p-p70S6K1 proteins involved in protein synthesis decreased by dexamethasone treatment in mouse myoblasts treated with decanal was significantly increased. On the other hand, it was confirmed that the expression of mRTA of MaFbx and MuRF1 significantly reduced muscle induction by promoting muscle protein degradation. Through this, the composition of the present invention was confirmed that by increasing the p-4E-BP1 and p-p70S6K1 protein phosphorylation, by inhibiting MuRF1 and MaFbx gene expression can reduce muscle loss and increase the amount of muscle.

In addition, the pharmaceutical composition for preventing or treating muscle diseases does not specifically limit the content as long as it contains decanal or a pharmaceutically acceptable salt thereof, and preferably may be included in a concentration of 0.1 to 1000 μM, more Preferably it may comprise a concentration of 0.1 to 500μM, more preferably may comprise a concentration of 1 to 100μM. Specifically, as shown in Example 1 of the present invention, it was confirmed that the myofiocytes treated with decanal 100μM increased 74% in thickness of myotubes reduced by dexamethoasone treatment.

In addition, the muscle disease of the present invention is preferably a disease reported in the art as a muscle disease caused by muscle function decline, muscle loss, muscle wasting or muscle degeneration, and specifically, atony, muscular atrophy , Muscular dystrophy, muscular dystrophy, cachexia, rigid spinesyndrome, amyotrophic lateral sclerosis, rigid spinse syndrome, Sharco-Marie-Tus disease ( Charcot-Marie-Tooth disease) and sarcopenia is more preferably any one or more selected from the group consisting of, but is not limited thereto.

In addition, the present invention provides a pharmaceutical composition for promoting muscle differentiation, muscle regeneration or muscle strengthening comprising a decanal compound represented by the following Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient. Details of the decanal are as described above.

[Formula 1]

The muscle wasting or degeneration is caused by a total factor, acquired factors, aging, etc., muscle wasting is characterized by a gradual loss of muscle mass, muscle weakness, especially skeletal muscle or veterinary muscle and heart muscle.

More specifically, the muscle refers to tendons, muscles, and tendons collectively, muscle function or muscle function refers to the ability to exert a force by the contraction of the muscle, the muscle to the maximum contraction force to overcome the resistance Muscle strength that can be exerted; Muscle endurance, the ability to indicate how long or how many times a muscle can repeat contraction and relaxation at a given weight; And quickness, which is the ability to exert a strong force in a short time. The muscle function is dominated by the liver and is proportional to muscle mass. The term "improving muscle function" of the present invention means improving muscle function in a more positive direction.

The composition for preventing and treating muscle diseases or improving muscle function of the present invention may contain decanal alone or one or more active ingredients exhibiting similar functions with decanal. Inclusion of additional components may further enhance the muscle function improving effect of the composition of the present invention. When the ingredient is added, skin safety, ease of formulation, and stability of the active ingredients may be considered.

The pharmaceutical composition of the present invention may comprise a pharmaceutically acceptable salt of decanal. As used herein, the term “pharmaceutically acceptable” refers to a physiologically acceptable and normally does not cause an allergic or similar reaction when administered to a human, wherein the salt is a pharmaceutically acceptable free acid. Acid addition salts formed by acid) are preferred.

The pharmaceutically acceptable salt of the decanal may be an acid addition salt formed using an organic acid or an inorganic acid, and the organic acid may be, for example, formic acid, acetic acid, propionic acid, lactic acid, butyric acid, isobutyric acid, trifluoroacetic acid, malic acid, Maleic acid, malonic acid, fumaric acid, succinic acid, succinic acid monoamide, glutamic acid, tartaric acid, oxalic acid, citric acid, glycolic acid, glucuronic acid, ascorbic acid, benzoic acid, phthalic acid, salicylic acid, anthranilic acid, dichloroacetic acid, aminooxyacetic acid, benzenesulfonic acid , p-toluenesulfonic acid or methanesulfonic acid. Inorganic acids include, for example, hydrochloric acid, bromic acid, sulfuric acid, phosphoric acid, nitric acid, carbonic acid or boric acid. The acid addition salt may preferably be in the form of hydrochloride or acetate, more preferably in the form of hydrochloride.

The above-mentioned acid addition salts may be prepared by either a) mixing the decanal and acid directly, b) dissolving and mixing it in a solvent or hydrous solvent, or c) placing the decanal in an acid in a solvent or submerged solvent and mixing them. It is prepared by a general salt preparation method.

In addition to the above, salts that can be additionally salted are gabar salt, gabapentin salt, pregabalin salt, nicotinate, adipate salt, hemimalonate, cysteine salt, acetylcysteine salt, methionine salt, arginine salt, lysine salt, ornithine salt Aspartate.

In addition, the pharmaceutical composition for preventing and treating muscle diseases of the present invention may further include a pharmaceutically acceptable carrier.

Pharmaceutically acceptable carriers may further include, for example, carriers for oral administration or carriers for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid and the like. Carriers for parenteral administration may also include water, suitable oils, saline, aqueous glucose, glycols, and the like. In addition, stabilizers and preservatives may be further included. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Other pharmaceutically acceptable carriers may be referred to those described in the following documents (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

The pharmaceutical composition of the present invention can be administered to any mammal, including humans. For example, it can be administered orally or parenterally, parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal , Intranasal, intestinal, topical, sublingual or rectal administration.

The pharmaceutical composition of the invention may be formulated into a formulation for oral administration or parenteral administration according to the route of administration as described above. When formulated, one or more buffers (e.g. saline or PBS), antioxidants, bacteriostatic agents, chelating agents (e.g. EDTA or glutathione), fillers, extenders, binders, adjuvants (e.g. aluminum hydroxide) Side), suspending agents, thickening humectants, disintegrants or surfactants, diluents or excipients.

Solid form preparations for oral administration include tablets, pills, powders, granules, solutions, gels, syrups, slurries, suspensions or capsules, and the like, and the solid form may include at least one excipient in the pharmaceutical composition of the present invention, for example , Starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol, cellulose , Methyl cellulose, sodium carboxymethylcellulose and hydroxypropylmethyl-cellulose or gelatin may be prepared by mixing. For example, tablets or sugar tablets can be obtained by combining the active ingredient with a solid excipient and then grinding it, adding suitable auxiliaries and then processing the granule mixture.

In addition to simple excipients, lubricants such as magnesium styrate talc are also used. Liquid preparations for oral use include suspensions, solutions, emulsions, or syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, or preservatives, in addition to water or liquid paraffin, which are commonly used simple diluents. .

In addition, in some cases, crosslinked polyvinylpyrrolidone, agar, alginic acid or sodium alginate may be added as a disintegrant, and may further include an anticoagulant, a lubricant, a humectant, a perfume, an emulsifier, a preservative, and the like. .

When administered parenterally, the pharmaceutical compositions of the present invention may be formulated according to methods known in the art in the form of injections, transdermal and nasal inhalants with suitable parenteral carriers. Such injections must be sterile and protected from contamination of microorganisms such as bacteria and fungi. Examples of suitable carriers for injections include, but are not limited to, solvents or dispersion media comprising water, ethanol, polyols (e.g., glycerol, propylene glycol and liquid polyethylene glycols, etc.), mixtures thereof and / or vegetable oils Can be. More preferably, suitable carriers include Hanks solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanol amine or sterile water for injection, 10% ethanol, 40% propylene glycol and 5% dextrose Etc. can be used. In order to protect the injection from microbial contamination, various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like may be further included. In addition, the injection may in most cases further comprise an isotonic agent such as sugar or sodium chloride.

In the case of transdermal administrations, ointments, creams, lotions, gels, external preparations, pasta preparations, linen preparations, air rolls and the like are included. As used herein, "transdermal administration" refers to the topical administration of the pharmaceutical composition to the skin to deliver an effective amount of the active ingredient contained in the pharmaceutical composition into the skin.

In the case of inhaled dosages, the compounds used according to the invention may be pressurized packs or by means of suitable propellants, for example dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. It can be delivered conveniently from the nebulizer in the form of an aerosol spray. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve to deliver a metered amount. For example, gelatin capsules and cartridges for use in an inhaler or insufflator can be formulated to contain a mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour, a prescription generally known in all pharmaceutical chemistries.

The pharmaceutical composition for preventing and treating muscle diseases of the present invention can provide a desirable muscle disease prevention and treatment effect when it contains an effective amount of decanal. In the present invention, the "effective amount" refers to an amount that exhibits a higher response than the negative control, and preferably an amount sufficient to improve muscle function. Deccanal may be included in the pharmaceutical composition of the present invention from 0.01 to 99.99%, the balance may be occupied by a pharmaceutically acceptable carrier. The effective amount of decanal included in the pharmaceutical composition of the present invention will vary depending on the form in which the composition is commercialized and the like.

The total effective amount of the pharmaceutical composition of the present invention may be administered to a patient in a single dose, and may be administered by a fractionated treatment protocol that is administered in multiple doses for a long time. It is important to administer all of the above factors in such a way that the maximum effect can be obtained in a minimum amount without side effects, which can be easily determined by those skilled in the art.

The pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the extent of the disease. Parenteral administration is preferably to be administered in an amount of preferably 0.01 to 50 mg, more preferably 0.1 to 30 mg per kg of body weight per day based on the decanal, and oral administration per day based on decanal It can be administered in one to several times to be administered in an amount of preferably 0.01 to 100 mg, more preferably 0.01 to 10 mg per kg body weight. However, the dose of decanal is determined in consideration of various factors such as the age, weight, health condition, sex, severity of the disease, diet and excretion rate, as well as the route and frequency of treatment of the pharmaceutical composition. In view of this, one of ordinary skill in the art will be able to determine the appropriate effective dosage of the decanal for a particular use for the prevention and treatment of muscle disease. The pharmaceutical composition according to the present invention is not particularly limited to its formulation, route of administration and method of administration as long as the effect of the present invention is shown.

The pharmaceutical composition for preventing or treating muscle diseases of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy or biological response modifiers.

The pharmaceutical composition for preventing or treating muscle diseases of the present invention may also be provided in the formulation of an external preparation containing decanal as an active ingredient.

When the pharmaceutical composition for preventing or treating muscle diseases of the present invention is used as an external preparation for skin, it is additionally used as a fatty substance, an organic solvent, a dissolving agent, a thickening agent and a gelling agent, an emollient, an antioxidant, a suspending agent, a stabilizer, and a foaming agent. ), Fragrance, surfactant, water, ionic emulsifier, nonionic emulsifier, filler, metal ion sequestrant, chelating agent, preservative, vitamin, blocking agent, wetting agent, essential oil, dye, pigment, hydrophilic active agent, lipophilic active agent Or any other ingredient commonly used in external preparations for skin, such as lipid vesicles. The ingredients may also be introduced in amounts generally used in the field of dermatology.

When the pharmaceutical composition for preventing or treating muscle diseases of the present invention is provided as an external preparation for skin, it may be a formulation such as, but not limited to, ointment, patch, gel, cream or spray.

In addition, the present invention provides a decanal compound represented by the following formula (Decanal) compound or a pharmaceutically acceptable salt thereof as an active ingredient provides a health functional food composition for preventing or improving muscle diseases. Details of the decanal are as described above.

[Formula 1]

In addition, the present invention provides a health functional food composition for promoting muscle differentiation, muscle regeneration or muscle strengthening comprising a decanal compound represented by Formula 1 below or a pharmaceutically acceptable salt thereof as an active ingredient. Details of the decanal are as described above.

[Formula 1]

Specifically, according to an embodiment of the present invention, in the mice fed high fat diet containing decanal, the extremity muscle strength was significantly increased, it can be seen that the muscle fiber diameter of the mouse significantly increased. there was. That is, the decanal of the present invention can increase the extremity muscle strength of the mouse by strengthening the muscle, and can improve the muscle loss and muscle weakness according to the high fat diet.

The food composition of the present invention includes all forms such as functional food, nutritional supplement, health food, food additives and feed, and includes animals such as humans or livestock. It is for eating. Food compositions of this type can be prepared in various forms according to conventional methods known in the art.

The food composition according to the present invention can be prepared in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and processed foods (e.g. canned fruit, canned foods, jams, marmalade, etc.), fish, meat and processed foods (e.g. hams, sausages) Cornbread, etc.), breads and noodles (e.g. udon, soba noodles, ramen, spagate, macaroni, etc.), fruit juices, various drinks, cookies, malts, dairy products (e.g. butter, cheese), edible vegetable oils, margarine It can be prepared by adding the decanal of the present invention to vegetable protein, retort food, frozen food, various seasonings (eg, miso, soy sauce, sauce, etc.). In addition, as a nutritional supplement is not limited to this can be prepared by adding the decanal of the present invention to capsules, tablets, pills, and the like. In addition, as a health functional food, but not limited to, for example, by making the decanal itself of the present invention in the form of tea, juice and drinks to be liquefied, granulated, encapsulated and powdered to drink (healthy drink) It can be ingested. In addition, in order to use the decanal of the present invention in the form of a food additive, it can be prepared in powder or concentrate form. In addition, it can be prepared in the form of a composition by mixing with the decanal of the present invention and known active ingredients known to be effective in preventing muscle diseases and improving muscle function.

When the decanal of the present invention is used as a health beverage, the health beverage composition may contain various flavors or natural carbohydrates as additional components, as in general beverages. The above-mentioned natural carbohydrates include monosaccharides such as glucose and fructose; Disaccharides such as maltose and sucrose; Polysaccharides such as dextrin, cyclodextrin; Sugar alcohols such as xylitol, sorbitol, and erythritol. Sweeteners include natural sweeteners such as taumartin, stevia extract; Synthetic sweeteners such as saccharin and aspartame; The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the composition of the present invention.

In addition, the decanal of the present invention may be contained as an active ingredient of the food composition for preventing muscle diseases and improving muscle function, the amount is not particularly limited to an amount effective to achieve the action for preventing muscle diseases and improving muscle function. It is preferably from 0.01 to 100% by weight relative to the total weight of the total composition. The food composition of the present invention may be prepared by mixing with decanal together with other active ingredients known to be effective in the composition for preventing muscle diseases and improving muscle function.

In addition to the above, the health food of the present invention is various nutrients, vitamins, electrolytes, flavors, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloidal thickeners, pH regulators, stabilizers, preservatives, Glycerin, alcohol or carbonation agent, and the like. In addition, the health food of the present invention may contain a flesh for preparing natural fruit juice, fruit juice beverage, or vegetable beverage. These components can be used independently or in combination. The proportion of such additives is not critical but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

In addition, the present invention provides a cosmetic composition for improving muscle function comprising a decanal compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient. Details of the decanal are as described above.

[Formula 1]

The cosmetic composition is not particularly limited, but may be used externally or ingested orally.

The cosmetic composition of the present invention contains a decanal as an active ingredient and, together with a dermatologically acceptable excipient, a basic cosmetic composition (cleanser such as cosmetic water, cream, essence, cleansing foam and cleansing water, pack, body oil), color cosmetic composition (Foundation, lipstick, mascara, makeup base), hair product composition (shampoo, rinse, hair conditioner, hair gel) and soap and the like.

The excipients include, but are not limited to, emollients, skin penetration enhancers, colorants, fragrances, emulsifiers, thickeners and solvents. In addition, fragrances, pigments, fungicides, antioxidants, preservatives and moisturizing agents may be further included, and may include thickeners, inorganic salts, synthetic polymer materials and the like for the purpose of improving the properties. For example, when the face wash and the soap are manufactured with the cosmetic composition of the present invention, the decanal may be easily added to the face wash and the soap base. In the case of preparing the cream, it may be prepared by adding decanal or a salt thereof to a cream base of a general oil-in-water type (O / W). To this, synthetic or natural materials, such as proteins, minerals, vitamins, etc., for the purpose of improving physical properties, such as flavors, chelating agents, pigments, antioxidants, and preservatives, may be added.

The content of decanal contained in the cosmetic composition of the present invention is not limited thereto, but is preferably 0.001 to 10% by weight, more preferably 0.01 to 5% by weight based on the total weight of the composition. If the content is less than 0.001% by weight, the desired anti-aging or anti-wrinkle effect may not be expected, and when the content is more than 10% by weight, there may be difficulty in preparing a safety or formulation.

In addition, the present invention provides a composition for animal feed for preventing or treating muscle diseases, comprising a decanal compound represented by Formula 1 below or a pharmaceutically acceptable salt thereof as an active ingredient. Details of the decanal are as described above.

[Formula 1]

The feed composition may include a feed additive. The feed additive of the present invention corresponds to a feed supplement in the Feed Control Act.

As used herein, the term "feed" may refer to any natural or artificial diet, one meal, or the like, or a component of the one meal, for the animal to eat, ingest, and digest.

The kind of the feed is not particularly limited, and may be used a feed commonly used in the art. Non-limiting examples of the feed may include plant feeds such as cereals, fruits, food processing by-products, algae, fibres, pharmaceutical by-products, oils, starches, gourds or grain by-products; And animal feeds such as proteins, minerals, fats and oils, minerals, fats and oils, single cell proteins, zooplankton or foods. These may be used alone or in combination of two or more thereof.

In addition, the feed additive may additionally contain a carrier that is acceptable to the unit animal. In the present invention, the feed additive may be added as it is, or a known carrier, stabilizer, or the like. If necessary, various nutrients such as vitamins, amino acids, minerals, antioxidants, and other additives may be added. Powders, granules, pellets, suspensions and the like may be in a suitable state. In the case of supplying the feed additive of the present invention, the unit animal may be supplied alone or mixed with feed.

Hereinafter, the present invention will be described in detail by way of examples. However, these examples are intended to illustrate the present invention in more detail, and the scope of the present invention is not limited to these examples.

[ Example ]

Example  One. Mouse myoblasts  Used Decanal Muscle loss suppression  efficacy

1-1. Myotube  Check thickness change

(1) Cell culture

Mouse myoblast cell lines (C2C12 cells) were purchased from ATCC (Manassas, VA, USA) and used. The purchased cells were incubated in 37, 5% CO ₂ incubator using 10% feta bovine serum (FBS) media and used in the experiment. When the cells became 80% confluent, they were differentiated into myotubes using 2% Horse serum (HS) media. Two days from the 4 th day of differentiation, dexamethasone (50 μM) and decanal (100 μM) were treated together.

(2) Giemsa-wright staining

The cells were washed twice with Phosphate buffered saline (PBS) and fixed for 10 minutes with 100% methanol. When the fixation was completed, the resultant was dried for 10 minutes at room temperature, and then stained for 30 minutes by dropping Giemsa-wright staining solution (Seoul, Asan Pharmaceutical) that specifically stained myotubes.

(3) Myotube thickness measurement

Stained myotubes were photographed at X20 magnification using a fluorescence microscope (IX 71, Olympus) and analyzed using image J software (USA). Six sections of each well were randomly selected and micrographed, and at least 100 myotube thicknesses were analyzed from each well (3 replicates / Group).

As a result, the thickness of myotube was significantly reduced in control cells (Dexa) compared to normal cells (Basal), and decanal treatment was visually confirmed to increase the thickness of myotube reduced by dexamethasone again (FIG. 1A). Deccanal treatment also increased 74% of myotube thickness, which was significantly reduced by dexamethasone, even after quantification using image J software (FIG. 1B). Therefore, decanal increases the thickness of myotube in mouse myoblasts, inhibits muscle loss and promotes muscle growth.

Example  2. Identify the mechanism of action

2-1. Trizol  RNA separation and RT- using method PCR  (reverse transcription-polymerase chain reaction)

334 μl of Trizol solution was added per 1 * 107 cells of mouse myoblasts, and then centrifuged at 4, 12,000 xg for 10 minutes. After transferring the supernatant to a new tube, 67 μl of chloroform was added and shaken vigorously. Again, the supernatant was transferred to a new tube and isopropanol was added so that the ratio of the supernatant to isopropanol was 1: 1. Shake vigorously 10 times and leave at room temperature for 15 minutes, centrifuge at 12,000 xg, 4 minutes for 10 minutes, remove supernatant, add 1 ml of 70% ethanol to the remaining precipitate, and centrifuge at 7,500 xg, 4 minutes for 5 minutes. Separated. After removing ethanol, the tube containing the RNA precipitate was dried at room temperature for 15 minutes, and the RNA pellet was dissolved using nuclease free water. Using a UV / VIS spectrophotometer (Beckman coulter, DU730) was measured the concentration of RNA samples extracted at 260 nm and 280 nm wavelength, and the integrity of the RNA samples were confirmed by agarose gel electrophoresis.

RNA samples extracted from mouse myoblasts were synthesized by reverse transcription using oligo dT primer and superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA). PCR was performed using 5 'and 3' flanking sequences of the gene cDNA to be amplified as a template and cDNA obtained through reverse transcription. The primer sequences used are shown in [Table 1]. 1 μl of the amplified PCR product was electrophoresed on 1% agarose gel to confirm DNA bands.

gene	primer	Sequence (5 '→ 3')	Annealing  Temperature (℃)	PCR  Product (bp)
MaFbx (synonym: atrogin-1)	F	GTCCAGAGAGTCGGCAAGTC	63	141
	R	GTCGGTGATCGTGAGACCTT
MuRF1 (synonym: TRAM63)	F	ACATCTACTGTCTCACGTGT	58	106
	R	TGTCCTTGGAAGATGCTTTG
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH)	F	GTGATGGCATGGACTGTGGT	55	163
	R	GGAGCCAAAAGGGTCATCAT

2-2. Western blotting

500 μL of 100 mM Tris-HCl, pH 7.4, 5 mM EDTA, 50 mM sodium pyrophosphate, 50 mM NaF, 100 mM orthovanadate, 1% Triton X-100, in each well from which media was removed to perform western blotting in cells Add and harvest lysis buffer containing 1 mM phenylmethanesulfonyl fluoride, 2 μg / mL aprotinin, 1 μg / mL pepstatin A, and 1 μg / mL leupeptin, harvest, centrifuge at 1,300 xg, 4 min for 20 min Proteins were quantified according to the method (Bio-Rad). 40 μg of protein was electrophoresed on SDS polyacrylamide gel and then transferred to nitrocellulose membranes (Amersham, Buckinghamshire, UK). Membrane was washed three times for 10 minutes using tris-buffered saline and tween 20 solution (TBS-T) and then blocked for 60 minutes using 10% skim milk. Membrane was added to the primary antibody diluted at a ratio of 1: 1,000, shaked gently at 4 ° C, incubated for 12 hours, washed with TBS-T, and the membrane was again diluted at a ratio of 1: 2,000. Incubated for 60 minutes and washed. At this time, the primary antibody is Foxo, phospho-foxo (p-foxo), S6K1, phopho-S6K1 (p-S6K1), 4EB-P1, phospho-4EBP-1 and GAPDH (Cell Signaling Technology, Beverly, MA, USA ) Was used. Finally, the proteins were visualized on an X-ray film using an ECL Western blot detection kit (RPN2106, Amersham, Arlington Heights, IL, USA). Bands visualized on the X-ray film were scanned and quantified using Quantity One analysis software (Bio-Rad).

As a result, the amount of p-4EBP1 and p-p70S6K1 proteins related to protein synthesis was significantly decreased in control cells (Dexa), whereas the expression of MaFbx / atrogin1 and MuRF1, which are proteolytic genes, were significantly decreased. Increased by. Deccanal treatment significantly increased the amount of p-4EBP1 and p-p70S6K proteins reduced by dexamethasone, while significantly reducing the expression of MuRF1 and MaFbx / atrogin1 [Figure 2]. Therefore, decanal may be involved in ultimately increasing muscle mass by increasing 4E-BP1 and p70S6K1 protein phosphorylation in mouse myoblasts and suppressing MuRF1 and MaFbx / atrogin1 gene expression.

Example  3. Mouse strength test

3-1. Experimental diet preparation and breeding of laboratory animals

Twenty five-week-old male C57BL / 6N mice (mating, Korea) were adapted to a laboratory environment for one week as a commercial rodant chow, and then three groups (Chow, HFD, and Decanal) according to the ingot method. ) Were randomly placed and bred for 10 weeks. The obesity induction diet used in this study was a high fat diet (HFD: 40% fat calorie, 17 g lard + 3% corn oil / 100 g diet) and was supplemented with decanal supplement (decanal-supplemented high). fat diet, Decanal) was prepared to have the same composition as HFD but contained 0.2% decanal. Chow fed a commercial rodent chow. Deccanal was purchased from Sigma-Aldrich. The experimental dietary table is shown in Table 2 below.

ingredient	High fat control diet ( HFD ) (g / kg diet)	Decanal Supplementary diet ( Decanal ) (g / kg diet)
Casein	200	200
DL-Methionine	3	3
Corn starch	111	107
Sucrose	370	370
cellulose	50	50
Corn oil	30	30
Laad	170	170
Vitamin complex	12	12
Mineral complex	42	42
Choline Bitartrate	2	2
cholesterol	10	10
tert-butyhydroquinone	0.04	0.04
Decanal	-	2
Total (g)	1,000	1,000
Fat (% calories)	39.0	39.0
Total calories, kJ / kg diet	19,315	19,315

3-2) Decanal  Of mouse by ingestion Limb strength  increase

In order to confirm the change in the extremity muscle of the mouse caused by the decanal intake, the time of hanging the mouse on the rotation cage cap was measured.

As a result, as shown in Figure 3, the result of ingesting the high-fat diet for 10 weeks, compared to the Chow group, the hanging time (latency to fall) (holding impulse) (weight 3) All of 3b) was significantly increased. On the other hand, in the case of decanal intake group (latency to fall) (holding impulse) (latency to fall) (FIG. And 159% significantly increased.

3-3) Immunohistochemical staining of muscle tissue

Muscle tissues of the mice were extracted and fixed in 10% formalin, and then stained with hematoxylin and eosin (H & E) and observed using an optical microscope (IX71, Olympus, JPN). Photos were taken using a digital camera (DP71, Olympus, JPN) and muscle fiber diameters were measured using an image Jay program.

As a result, as shown in Figure 4, the muscle fiber diameter of the Rectus femoris (FIG. 4A), soleus (FIG. 4B), gastrocnemius (FIG. 4C) muscle significantly reduced the intake of Chow than the intake of Chow, decane In the case of mice fed the eggs, the high fat diet was significantly increased compared to the control group. In other words, decanal can be seen that the effect of improving the muscle loss and muscle weakness of mice fed a high-fat diet is very excellent.

3-4) Statistical Analysis

Statistical analysis of all data was performed using the statistical package for the social sciences (SPSS version 21.0, IBM, Armonk, NY, USA) PC package. Significant differences between groups were verified by ANOVA.

Hereinafter, a preparation example of a composition containing an extract of the present invention will be described, but the present invention is not intended to be limited thereto but only to be described in detail.

Formulation Example 1 Preparation of Powder

Decanal 20 mg

Lactose Carb 100 mg

Talc 10 mg

The above ingredients were mixed and filled in an airtight cloth to prepare a powder.

Formulation Example 2: Preparation of Tablet

Decanal 10 mg

Corn starch 100 mg

Lactose Carb 100 mg

Magnesium stearate 2mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

Formulation Example 3: Preparation of Capsule

Decanal 10 mg

3 mg of microcrystalline cellulose

Lactose carb 14.8 mg

Magnesium Stearate 0.2 mg

After mixing the above components, it was filled in gelatin capsules according to the conventional method for producing a capsule to prepare a capsule.

Formulation Example 4 Preparation of Injection

Decanal 10 mg

Mannitol 180 mg

Sterile distilled water for injection 2974 mg

Monohydrogen phosphate 26 mg

After mixing the above components, it was prepared in the above ingredient content per ampoules (2 mL) according to the conventional method for preparing injections.

Formulation Example 5 Preparation of Liquid

Decanal 10 mg

Isomerized sugar 10 mg

Mannitol 5 mg

Purified water

Lemon flavor

The above components are dissolved in purified water according to a conventional preparation method, dissolved in purified water, and then lemon juice is added in an appropriate amount. After adjusting to 100 mL in total, sterilized and filled in a brown bottle to prepare a liquid formulation.

Formulation Example 6 Preparation of Health Functional Food

Decanal 10 mg

Vitamin mixture proper amount

70 μg of Vitamin A Acetate

Vitamin E 1.0 mg

Vitamin B ₁ 0.13 mg

Vitamin B ₂ 0.15 mg

Vitamin B ₆ 0.5 mg

0.2 μg of vitamin B ₁₂

Vitamin C 10 mg

10 μg biotin

Nicotinic Acid 1.7 mg

Folate 50 ㎍

Calcium Pantothenate 0.5mg

Mineral mixture

Ferrous Sulfate 1.75 mg

Zinc Oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium monophosphate 15 mg

Dibasic calcium phosphate 55 mg

Potassium citrate 30 mg

Calcium Carbonate 100 mg

Magnesium chloride 24.8 mg

Although the composition ratio of the above-mentioned vitamin and mineral mixtures is mixed with a component suitable for a health food in a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional health food manufacturing method. The granules may be prepared and used for preparing a health food composition according to a conventional method.

Formulation Example 7 Preparation of Health Beverage

Decanal 10 mg

15 g of vitamin C

100 g of vitamin E (powder)

Iron lactate 19.75 g

3.5 g of zinc oxide

Nicotinamide 3.5 g

0.2 g of vitamin A

0.25 g of vitamin B ₁

0.3 g of vitamin B ₂

Purified Water Quantification

After mixing the above components according to a conventional healthy beverage production method, and then stirred and heated at 85 ℃ for about 1 hour, the resulting solution is filtered and obtained in a sterilized 2 L container sealed sterilization and then refrigerated and stored in the present invention For the preparation of healthy beverage compositions.

Although the composition ratio is mixed with a component suitable for a favorite beverage in a preferred embodiment, the composition ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and usage.

Hereinafter, an example of preparation of a cosmetic composition containing an extract of the present invention will be described, but the present invention is not intended to be limited thereto, but is intended to be described in detail.

Preparation Example 1: Nutrients (Milk Lotion)

Deccanal 2.0 wt%

Squalane 5.0 wt%

Beeswax 4.0 wt%

Polysorbate60 1.5 wt%

Sorbanthesquioleate 1.5 wt%

0.5% by weight of liquid paraffin

Caprylic / Capric Triglycerides 5.0 wt%

Glycerin 3.0 wt%

Butylene Glycol 3.0 wt%

Propylene Glycol 3.0 wt%

Carboxy vinyl polymer 0.1 wt%

0.2% by weight of triethanolamine

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for nutritional longevity in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

Preparation Example 2: Softener (Skin Lotion)

Deccanal 2.0 wt%

Glycerin 3.0 wt%

Butylene glycol 2.0% by weight

Propylene Glycol 2.0 wt%

Carboxy vinyl polymer 0.1 wt%

PEG 12 nonylphenylether 0.2% by weight

Polysorbate 80 0.4% by weight

Ethanol 10.0 wt%

Triethanolamine 0.1% by weight

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed and formulated in a preferred embodiment with a component suitable for a relatively softening longevity, the compounding ratio may be arbitrarily modified, and can be prepared according to the manufacturing method in the general cosmetic field.

Preparation Example 3 Nutrition Cream

Deccanal 2.0 wt%

Polysorbate 60 1.5% by weight

Sorbitan sesquioleate 0.5% by weight

PEG60 Cured Castor Oil 2.0% by weight

10% by weight of liquid paraffin

Squalane 5.0 wt%

Caprylic / Capric Triglycerides 5.0 wt%

Glycerin 5.0 wt%

Butylene glycol 3.0% by weight

Propylene Glycol 3.0 Weight%

Triethanolamine 0.2% by weight

Preservative

Pigment amount

Spices

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for nourishing cream in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

Preparation Example 4 Massage Cream

Deccanal 1.0 wt%

Beeswax 10.0 weight%

Polysorbate 60 1.5% by weight

PEG 60 Cured Castor Oil 2.0% by weight

Sorbanthesquioleate 0.8 wt%

40.0% by weight of liquid paraffin

Squalane 5.0 wt%

Caprylic / Capric Triglyceride 4.0 wt%

Glycerin 5.0 wt%

Butylene glycol 3.0% by weight

Propylene Glycol 3.0 Weight%

Triethanolamine 0.2% by weight

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a massage cream in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a manufacturing method in the general cosmetic field.

Preparation Example 4 Pack

Deccanal 1.0 wt%

Polyvinyl alcohol 13.0 wt%

Sodium Carboxymethylcellulose 0.2% by weight

Glycerin 5.0 wt%

Allantoin 0.1 wt%

Ethanol 6.0 wt%

PEG 12 nonylphenyl ether 0.3% by weight

Polysorbate60 0.3 wt%

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a pack in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a manufacturing method in the general cosmetic field.

Preparation Example 6 Gel

Deccanal 0.5 wt%

0.05% by weight of ethylenediamine sodium acetate

Glycerin 5.0 wt%

Carboxy vinyl polymer 0.3 wt%

Ethanol 5.0 wt%

PEG 60 Cured Castor Oil 0.5% by weight

0.3% by weight of triethanolamine

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a gel in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

The blending ratio is a relatively suitable composition for the cosmetic composition in a preferred embodiment, but can be applied to cosmetics of various uses, including other color cosmetics, according to the efficacy that can be applied to a thin coating on the human body, that is, It can be used for manufacturing as an ointment, and the compounding ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and usage.

The foregoing description of the present invention is intended for illustration, and it will be understood by those skilled in the art that the present invention may be easily modified in other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not restrictive.

Claims (12)

1. A pharmaceutical composition for preventing or treating muscle diseases comprising a decanal compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

   [Formula 1]

   
2. The method of claim 1,

   The composition is characterized in that to increase the expression of p-4E-BP1 or p-p70S6K1 protein

   Pharmaceutical composition for preventing or treating muscle diseases.
3. The method of claim 1,

   The composition is characterized by reducing the expression of the mucle ring-finger protein (MuRF1) or muscle atrophy F-box (MaFbx)

   Pharmaceutical composition for preventing or treating muscle diseases.
4. The method of claim 1,

   The compound is characterized in that it is included in the composition at a concentration of 0.1 to 1000μM

   Pharmaceutical composition for preventing or treating muscle diseases.
5. The method of claim 1,

   The muscle disease is characterized in that the muscle disease due to muscle function decline, muscle reduction, muscle wasting or muscle degeneration

   Pharmaceutical composition for preventing or treating muscle diseases.
6. The method according to any one of claims 1 to 5,

   The muscle diseases include atony, muscular atrophy, muscular dystrophy, myasthenia, cachexia, rigid spinesyndrome, amyotrophic lateral sclerosis , At least one selected from the group consisting of rigid spinse syndrome, Charcot-Marie-Tooth disease, and sarcopenia.

   Pharmaceutical composition for preventing or treating muscle diseases.
7. Decanal compound represented by the formula (1) or a health functional food composition for preventing or improving muscle diseases comprising a food acceptable salt thereof as an active ingredient.

   [Formula 1]

   
8. A pharmaceutical composition for promoting muscle differentiation, muscle regeneration, or muscle strengthening, comprising a decanal compound represented by Formula 1 or a food acceptable salt thereof as an active ingredient.

   [Formula 1]

   
9. A health functional food composition for promoting muscle differentiation, muscle regeneration, or muscle enhancement, comprising a decanal compound represented by Formula 1 or a food acceptable salt thereof as an active ingredient.

   [Formula 1]

   
10. A decanal compound represented by the following formula (1) or a cosmetic composition for improving muscle function comprising a cosmetically acceptable salt thereof as an active ingredient.

    [Formula 1]

    
11. Decanal compound represented by the formula (1) or a composition for animal feed for preventing or treating muscle diseases comprising an acceptable salt thereof as an active ingredient.

    [Formula 1]

    
12. The method of claim 11,

    The livestock is a cattle, pigs, chickens, ducks, goats, sheep and horses, characterized in that one of the cattle selected from the group consisting of

    Livestock feed compositions for the prevention or treatment of muscle diseases

Images