WO2018128482A1 - Composition, comprising cymene or pharmaceutically acceptable salt thereof as active ingredient, for preventing or treating muscle disease - Google Patents

Abstract

The present invention relates to a composition for preventing or treating a muscular disease or improving muscle function, comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.

Description

A composition for preventing or treating muscle diseases comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient

This application claims the priority of Korean Patent Application No. 10-2017-0002508, filed January 6, 2017, the entirety of which is a reference of the present application.

The present invention relates to a composition for preventing or treating muscle diseases, comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.

In Korea, the elderly population accounted for 7.2% of the total population in 2000 and entered an aging society. In 2050, the aged population is expected to enter an aging society (more than 20%). Muscle mass in humans decreases with age (10-15% at 50-70 years, and more than 30% at 70-80 years), thereby weakening muscle strength and muscle function, called sarcopenia. do. Geriatric muscular dystrophy is a major cause of limiting the independent living of the elderly by inducing activity disorder and gait disorder. In addition, myopathy lowers metabolic rate, increases insulin resistance, promotes type 2 diabetes, and increases the risk of hypertension and cardiovascular disease by three to five times. Currently, no drug has been approved for the treatment of myopathy, and drug repositioning technology is being developed to apply myostatin inhibitor or other FDA-approved drugs to myopathy.

Muscles are divided into skeletal muscles, cardiac muscles, and smooth muscles, and skeletal muscles are the most abundant tissues in the human body, accounting for 40 to 45% of body weight. Skeletal muscles attach to bones through the tendons, creating bone movement or force. One muscle is made up of numerous myofibers, which in turn are made up of numerous myofibers composed of actin and myosin. When actin and myosin overlap each other, they shorten or lengthen the muscles, causing the entire muscle to contract and relax. An increase in myofibril size means an increase in myofiber thickness, resulting in an increase in muscle.

The types of muscle fibers that make up muscle are classified into Type I, Type IIA and Type IIB by the metabolic process and contraction rate that produce ATP. Type I muscle fibers are slow in contraction and contain a large number of myoglobin and mitochondria, making them suitable for continuous, low-intensity aerobic activity. Type II muscle fibers have a red color and are also called red muscles, and soleus is typical. On the other hand, 'Type IIB muscle fibers' are very short but have high strength for anaerobic exercise due to their high contraction speed. They are white due to the low content of myoglobin, and the gastrocnemius is one of them. Type IIA muscle fibers have the intermediate characteristics of the two muscle fibers mentioned above, and the rectus femoris. As the body ages, not only the composition of Type I and II muscle fibers varies by muscle area, but all types of muscle fibers decrease.

Skeletal muscles have the characteristics of being regenerated and maintained according to the environment, but these characteristics are lost with age, and consequently, as aging progresses, muscle mass is reduced and muscle strength is also lost. Signaling systems involved in the growth and regeneration of muscle include signaling mediated by insulin like growth factor 1 (IGF-1) / AKT to regulate protein synthesis. The activation of IGF-1 receptor (IGF-1R) in the muscle cell membrane increases AKT phosphorylation through IRS1 and PI3K phosphorylation, and the latter activates mTORC phosphorylation. Activation of mTORC increases the phosphorylation of ribosomal protein S6 kinase beta-1 (p70S6K1), which increases mRNA translation and increases the activity of eukaryotic translation initiation factor 4 G (eIF4G), and eukaryotic translation initiation factor 4E binding protein Phosphorylate 1 (4E-BP1) protein. eIF4G and 4E-BP1 are involved in the formation of the eIF4F complex, that is, eIF4G binds to eIF4A and eIF4E to form the eIF4F complex, while phosphorylation of 4E-BP1 inhibits its binding to eIF4E, leading to an increase in free eIF4E. do. The latter combines with other translation initiation factors (eIF4G and eIF4A) to form an eIF4F complex, which in turn promotes translation initiation by stabilizing ribosomal structures, ultimately increasing protein synthesis (Bodine et al., Akt / mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo.Nature cell biology, 3, 1014-1019, 2001).

In addition, AKT phosphorylation stimulates muscle fiber growth by increasing eIF2B expression through glycogen synthase kinase 3 (GSK3) and also inhibits muscle loss by inhibiting the expression of forkhead box O (FOXO), a proteolytic transcription factor. Muscle loss is regulated by signaling mediated by receptors of the TGF-β family, including myostatin, transforming growth factor beta (TGF-β), and activin. Binding of the ligand to the TGF-β type II receptor phosphorylates the type I receptor, the latter phosphorylates the smad 2/3 complex and eventually activates FOXO. The latter increases gene expression of muscle-specific ubiquitin-ligase, muscle RING-finger protein-1 (MURF1) and Muscle Atrophy F-Box (MAFbx) / atrogin-1, which attach ubiquitin to the lysine site of the target protein. Promote proteolysis and eventually induce muscle loss (Gumucio et al., Atrogin-1, MuRF-1, and sarcopenia. Endocrine, 43, 12-21, 2013).

There is a continuing need for the search for a substance having excellent muscle function regulating activity and which can be safely applied. However, a lot of natural ingredients derived from natural products have not been developed as a muscle function improving composition. Therefore, the present inventors have attempted to develop a food material that is effective in improving muscles and improving muscle loss by inhibiting the degradation of muscle proteins and promoting synthesis in natural products with few side effects.

An object of the present invention is to provide a pharmaceutical composition for preventing or treating muscle diseases, promoting muscle differentiation, muscle regeneration or muscle strengthening comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.

Still another object of the present invention is to provide a functional food composition for preventing or improving muscle function, promoting muscle differentiation, muscle regeneration or strengthening muscle, comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient. It is to provide a feed composition.

Still another object of the present invention is to provide a cosmetic composition for improving muscle function, including cymene or a pharmaceutically acceptable salt thereof as an active ingredient.

Still another object of the present invention is a method for preventing or treating muscle diseases, the method for promoting muscle differentiation, muscle regeneration, or muscle strengthening, comprising administering to or administering to a subject a pharmaceutical composition comprising cymene or a salt thereof as an active ingredient. To provide a way.

Still another object of the present invention is to provide a method for preventing or treating muscle diseases, promoting muscle differentiation, muscle regeneration or muscle strengthening of a composition comprising cymene or a salt thereof as an active ingredient.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

The present invention provides a pharmaceutical composition for preventing or treating muscle diseases comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.

According to an aspect of the present invention, the composition may increase the expression of p-4E-BP1 or p-p70S6K1 protein.

According to an aspect of the present invention, the composition may reduce the expression of a MuRF1 (Muscle Ring-Finger Protein) or MaFbx (Muscle atrophy F-box).

According to one aspect of the invention, the muscle disease may be a muscle disease due to muscle function decline, muscle reduction, muscle wasting or muscle degeneration.

According to one preferred aspect of the present invention, the muscle disease is atony, muscular atrophy, muscular dystrophy, myasthenia, cachexia, rigid spinesyndrome, muscular dystrophy At least one selected from the group consisting of sclerosis (amyotrophic lateral sclerosis), Charcot-Marie-Tooth disease, and sarcopenia.

In addition, the present invention provides a pharmaceutical composition for promoting muscle differentiation, muscle regeneration or muscle strengthening comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a health functional food composition for preventing muscle diseases or improving muscle function, including cymene or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention provides a health functional food composition for promoting muscle differentiation, muscle regeneration or muscle strengthening comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention provides a composition for animal feed for preventing or improving muscle diseases, including cymene or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention provides a composition for promoting animal differentiation, muscle regeneration or muscle strengthening comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.

In another aspect, the present invention provides a cosmetic composition for improving muscle function comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.

In addition, the present invention provides a method for preventing or treating muscle diseases, comprising administering to or administering to a subject a pharmaceutical composition comprising cymene or a salt thereof as an active ingredient.

The present invention also provides a method for promoting muscle differentiation, muscle regeneration, or muscle strengthening, comprising administering to or administering to a subject a composition comprising cymene or a salt thereof as an active ingredient.

In addition, the present invention provides a use for preventing or treating muscle diseases of a composition comprising cymene or a salt thereof as an active ingredient.

The present invention also provides the use of cymene or a salt thereof as an active ingredient to promote muscle differentiation, muscle regeneration or muscle strengthening.

The present invention relates to a composition for preventing or treating muscle diseases, or improving muscle function, comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient, wherein the cymen is used to increase muscle protein synthesis and muscle mass in muscle cells. Can increase the expression of proteins related to the protein and inhibit the expression of enzymes involved in muscle protein degradation from the mRNA level, so muscle differentiation, muscle regeneration, and muscle mass increase in muscle diseases caused by muscle function decline, muscle wasting or muscle degeneration. Through it can exhibit a muscle strengthening effect, it can inhibit muscle reduction, can be used for preventing or treating muscle diseases, muscle differentiation, muscle regeneration and muscle mass increase or muscle function improvement.

1 shows the thickness change of myotube in mouse myoblasts. FIG. 1A is a microscopic image of Giemsa-wright stained root canal cells, and FIG. 1B is a result of measuring the diameter of the root canal cells, and each value is the mean ± standard error of three crystals in three independent wells. P <0.05 indicates statistical significance.

Figure 2 shows the expression changes of molecules related to protein degradation and synthesis in mouse myoblasts treated with cymene. FIG. 2A shows the protein levels of p-4E-BP1, Total 4E-BP1, p-p70S6K1, and Total p70S6K1, and FIG. 2B shows gene expression levels of MaFbx and MuRF1. Each value is the mean ± standard error of three determinations in three independent wells. P <0.05 indicates statistical significance.

Figure 3 is a result of confirming the increase in muscle strength by the intake of cimen from the body weight (A), hanging time (B) and grip force (C) of the high fat diet group (HFD) and cymen intake group (Cymene) mice.

The present inventors completed the present invention by confirming that an alkylbenzene-based compound, cymene, is effective in muscle enhancement and muscle loss improvement by inhibiting the degradation of muscle protein and promoting synthesis.

In the present invention, "muscle" refers to tendons, muscles, and tendons in general, "muscle function" means the ability to exert a force by contraction of muscles, muscles can exert maximum contraction force to withstand resistance Muscle strength, which is the ability to be present, muscle endurance, which is how long or how many times a muscle can repeat contraction and relaxation, and quickness, which is the ability to exert a strong force in a short time. These muscle functions are subjective to the liver, proportional to muscle mass, and "muscle improvement" means better muscle function.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for preventing or treating muscle diseases comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.

Specifically, Cymen is an alkylbenzene-based compound, the structural formula is C ₁₀ H ₁₄ , molecular weight is 134.21 g / mol. The cymens include isomers of o-cymene, m-cymene and p-cymene represented by the following Chemical Formulas 1, 2 and 3, respectively, Para isomers are particularly preferred, but are not limited thereto. Specifically, p-cymene (p-cymene) is a component of the essential oil, Nigella Sativa (Black Seed), Thymus zygis (Thyme white, thyme white), Origanum vulgare (Oregano, Oregano), Thymus vulgaris (Thyme, thyme) ), Cinnamomum camphora (Camphor, camphor), Trachyspermum ammi (Ajowan, ok Wan), Croton eluteria (Cascarilla, Kasuga GW), Cuminum It is mainly found in plants such as cyminum (Cumin), Satureja (Savory), Capsicum annuum (Pepper, pepper), Monarda (Bee balm), etc. 1-methyl-4- (1-methylethyl) benzene, 4 -isopropyltoluene, 4-methylcumene, paracymene has a nickname.

[Formula 1]

[Formula 2]

[Formula 3]

In addition, within the range having the same efficacy as the above-mentioned cimen, it may include cymen hydrate, cymen derivative, and the like, and may also include a solvent compound or stereoisomer thereof.

The method for obtaining cymen is not particularly limited, and may be isolated from plants containing cymen, chemically synthesized using a known production method, or commercially available.

The composition according to the invention can increase the expression of p-4E-BP1 or p-p70S6K1 protein.

In addition, the composition according to the present invention can reduce the expression of the MuRF1 (Muscle Ring-Finger Protein) or MaFbx (Muscle atrophy F-box). Specifically, representative molecules related to protein synthesis include p70S6K1, 4E-BP1, and eIF members, and these three molecules are regulated by higher mTORCs. Activation of mTORc phosphorylates p70S6K1 and activated p70S6K1 phosphorylates 40S ribosomal protein S6 to increase mRNA translation. Activation of mTORC also increases the activity of eIF4G and simultaneously phosphorylates 4E-BP1, both molecules involved in forming the eIF4F complex. That is, eIF4G binds to eIF4A and eIF4E to form an eIF4F complex, while when 4E-BP1 is phosphorylated, its binding ability with eIF4E is inhibited to increase the free eIF4E. The latter combines with other translation initiation factors (eIF4G and eIF4A) to form an eIF4F complex, which in turn promotes translation initiation by stabilizing ribosomal structures, ultimately increasing protein synthesis. MAFbx / Atrogin-1 and MuRF1 are muscle-specific ubiquitin-ligase, and are representative proteins that promote protein degradation and induce muscle reduction by attaching ubiquitin to the lysine site of the target protein, and the composition of the present invention is MuRF1 (Muscle). By reducing the expression of Ring-Finger Protein or MaFbx (Muscle atrophy F-box), muscle loss can be inhibited.

In the present invention, "muscle disease" is a disease reported in the art as a muscle disease caused by muscle function decrease, muscle loss, muscle wasting or muscle degeneration, and specifically, the muscle disease is atony, muscular atrophy. (muscular atrophy), muscular dystrophy, myasthenia gravis, cachexia, rigid spinesyndrome, amyotrophic lateral sclerosis, Charcot-Marie-Tooth disease Tooth disease) and sarcopenia may be any one or more selected from the group consisting of, but is not limited thereto. In addition, the muscle wasting or degeneration occurs due to the whole factor, acquired factors, aging, etc., muscle wasting is characterized by a gradual loss of muscle mass, weakening and degeneration of the muscle, in particular skeletal or veterinary and heart muscle.

The pharmaceutical composition for preventing or treating muscle diseases according to the present invention is not particularly limited as long as it contains cymen or a pharmaceutically acceptable salt thereof. Preferably, the dose of cymen is in a concentration of 0.1 μM to 1000 μM. It may include, but is not limited thereto. At this time, if the cement is less than the concentration range, there is a problem that the protein synthesis and degradation activity in muscle cells is lowered, so that it is difficult to exert the effect of preventing or treating muscle diseases, and if the cement is exceeded the concentration range, including cytotoxic There may be toxicity concerns.

The pharmaceutical composition for preventing or treating muscle diseases according to the present invention is in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, oral formulations, external preparations, suppositories, and sterile injectable solutions, respectively, according to conventional methods. It may be formulated and used, and may include suitable carriers, excipients or diluents commonly used in the manufacture of pharmaceutical compositions for formulation.

The carrier or excipient or diluent may be lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicide, cellulose, methyl cellulose, undetermined. And various compounds or mixtures including vaginal cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil and the like.

When formulated, it may be prepared using conventional diluents or excipients, such as fillers, weights, binders, wetting agents, disintegrating agents, surfactants.

Solid preparations for oral administration may be prepared by mixing at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin and the like in the cymen. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.

Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, preservatives, etc., in addition to commonly used simple diluents such as water and liquid paraffin. .

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used. As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol gelatin and the like can be used.

The preferred dosage of the pharmaceutical composition for preventing or treating muscle diseases according to the present invention depends on the patient's condition, weight, degree of disease, drug form, route of administration, and duration, and may be appropriately selected by those skilled in the art. However, for the desired effect, it may be administered at 0.0001 to 2,000 mg / kg, preferably at 0.001 to 2,000 mg / kg. Administration may be once a day or may be divided several times. However, the scope of the present invention is not limited by the above dosage.

The pharmaceutical composition for preventing or treating muscle diseases according to the present invention can be administered to mammals such as rats, mice, livestock, humans by various routes. All modes of administration may be administered, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection.

In addition, the present invention provides a pharmaceutical composition for promoting muscle differentiation, muscle regeneration or muscle strengthening comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient. Details of the cement are as described above.

Muscle growth can occur by increasing the fiber size and / or by increasing the number of fibers. The growth of the muscle can be measured by A) increase in wet weight, B) increase in protein content, C) increase in number of muscle fibers, and D) increase in diameter of muscle fibers. An increase in muscle fiber growth can be defined as an increase in diameter when the diameter is defined as the shortening of the ellipsoid in cross section. Useful therapeutic agents include, but are not limited to, wetting gain, protein content, and / or in animals with muscle degeneration at least 10% compared to control animals previously treated similarly (ie, animals with degenerated muscle tissue not treated with muscle growth compounds). Increasing the diameter by at least 10%, more preferably at least 50%, and most preferably at least 100%. Compounds that increase growth by increasing the number of muscle fibers are useful as therapeutic agents when they increase the number of muscle fibers in diseased tissues by at least 1%, more preferably at least 20%, and most preferably at least 50%. These percentage values are relative to the basal level in untreated and disease-free comparative mammals or when the compound is administered locally and in contrast to disease-free muscle.

Muscle regeneration refers to the process by which new muscle fibers are formed from myoblasts. Useful therapeutic agents for regeneration increase the number of new fibers at least about 1%, more preferably at least 20%, and most preferably at least 50%, as described above.

Myocyte differentiation refers to the induction of muscle developmental programs that specify components of muscle fibers such as contractile organs (myofibril). Useful therapeutic agents for differentiation may comprise at least about 10%, more preferably at least 50%, and most preferably at least 100% of all myofiber components in diseased tissues, as compared to equivalent tissues in similarly treated control animals. Increase.

Specifically, according to one embodiment of the present invention, when treated with cymen to mouse myoblasts reduced by dexamethasone (dexamethasone), it can be seen that the myotubes of the mouse myoblasts (myotube) significantly increased. That is, the cymen of the present invention can suppress muscle loss and promote muscle growth by increasing the thickness of myotubes in mouse myoblasts.

In addition, when cymen treatment to mouse myoblasts reduced by dexamethasone significantly increases the expression of p-4E-BP1 and p-p70S6K proteins involved in protein synthesis, and is a protein that induces muscle loss. It can be seen that significantly reduced the expression of MuRF1 and Mafbx / atrogin1. That is, the simen of the present invention can increase the amount of muscle by increasing the phosphorylation of 4E-BP1 and p70S6K protein in mouse myoblasts and inhibiting MuRF1 and Mafbx / atrogin1 gene expression.

The present invention also provides a health functional food composition for preventing muscle diseases or improving muscle function, including cymene or a pharmaceutically acceptable salt thereof as an active ingredient. Specific details of the cymen and muscle diseases are as described above.

In addition, the present invention provides a health functional food composition for promoting muscle differentiation, muscle regeneration or muscle strengthening comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient. Details of the cement are as described above.

In the health functional food for improving muscle function according to the present invention, when the cymen is used as an additive of the health functional food, it may be added as it is or used with other foods or food ingredients, and may be appropriately used according to a conventional method. have. The mixed amount of the active ingredient can be appropriately determined depending on the purpose of use, such as prevention, health or treatment.

Formulations of dietary supplements may be in the form of powders, granules, pills, tablets, capsules, as well as in the form of general foods or beverages.

There is no restriction | limiting in particular in the kind of said food, The foodstuff which can add the said substance is a dairy product including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, ice cream, etc. , Various soups, beverages, teas, drinks, alcoholic beverages and vitamin complexes, etc., may include all foods in a conventional sense.

In general, in the manufacture of food or beverage, the cement may be added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on 100 parts by weight of the raw material. However, in the case of long-term intake for health and hygiene or for health control, the amount may be below the above range, and the present invention has no problem in terms of safety in terms of using fractions from natural products. The above amount can also be used.

The beverage in the health functional food according to the present invention may contain various flavors or natural carbohydrates, etc. as an additional ingredient, as in general drinks. The above-mentioned natural carbohydrates may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose and polysaccharides such as dextrin and cyclodextrin, sugar alcohols such as xylitol, sorbitol and erythritol. As the sweetening agent, natural sweetening agents such as tautin and stevia extract, synthetic sweetening agents such as saccharin and aspartame, and the like can be used. The ratio of the natural carbohydrate may be about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the beverage according to the present invention.

In addition to the health functional foods for improving muscle function according to the present invention, various nutritional supplements, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloid thickeners, pH regulators, stabilizers And preservatives, glycerin, alcohols, carbonated beverages used in carbonated drinks. In addition, the composition for improving sleep of the present invention may contain fruit flesh for the production of natural fruit juice, fruit juice beverage and vegetable beverage. These components can be used independently or in combination. The ratio of such additives is not limited, but is generally selected from the range of 0.01 to 0.1 parts by weight relative to 100 parts by weight of the health functional food of the present invention.

In addition, the present invention provides a composition for animal feed for preventing or improving muscle diseases, including cymene or a pharmaceutically acceptable salt thereof as an active ingredient. Details of the cement are as described above.

In addition, the present invention provides a composition for promoting animal differentiation, muscle regeneration or muscle strengthening comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient. Details of the cement are as described above.

The livestock is preferably one kind of livestock selected from the group consisting of cattle, pigs, chickens, ducks, goats, sheep and horses, but is not limited thereto.

The feed composition may include a feed additive. The feed additive of the present invention corresponds to a feed supplement in the Feed Control Act.

As used herein, the term "feed" may refer to any natural or artificial diet, one meal, or the like, or a component of the one meal, for the animal to eat, ingest, and digest.

The kind of the feed is not particularly limited, and may be used a feed commonly used in the art. Non-limiting examples of the feed may include plant feeds such as cereals, fruits, food processing by-products, algae, fibres, pharmaceutical by-products, oils, starches, gourds or grain by-products; And animal feeds such as proteins, minerals, fats and oils, minerals, fats and oils, single cell proteins, zooplankton or foods. These may be used alone or in combination of two or more thereof.

In addition, the feed additive may additionally contain a carrier that is acceptable to the unit animal. In the present invention, the feed additive may be added as it is, or a known carrier, stabilizer, or the like. If necessary, various nutrients such as vitamins, amino acids, minerals, antioxidants, and other additives may be added. Powders, granules, pellets, suspensions and the like may be in a suitable state. In the case of supplying the feed additive of the present invention, the unit animal may be supplied alone or mixed with the feed.

In another aspect, the present invention provides a cosmetic composition for improving muscle function comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient. Details of the cement are as described above.

The cosmetic composition of the present invention contains a cimen as an active ingredient and, together with a dermatologically acceptable excipient, a basic cosmetic composition (washing agents such as cosmetics, creams, essences, cleansing foams and cleansing water, packs, body oils), color cosmetic compositions ( Foundations, lipsticks, mascara, makeup bases), hair product compositions (shampoos, rinses, hair conditioners, hair gels) and soaps.

The excipients include, but are not limited to, emollients, skin penetration enhancers, colorants, fragrances, emulsifiers, thickeners and solvents. In addition, fragrances, pigments, fungicides, antioxidants, preservatives and moisturizing agents may be further included, and may include thickeners, inorganic salts, synthetic polymer materials and the like for the purpose of improving the properties. For example, in the case of preparing the face wash and the soap with the cosmetic composition of the present invention, it can be easily prepared by adding the cimen to the usual face wash and the soap base. When the cream is prepared, it can be prepared by adding cymen or a salt thereof to a cream base of a general oil-in-water type (O / W). To this, synthetic or natural materials, such as proteins, minerals, vitamins, etc., for the purpose of improving physical properties, such as flavors, chelating agents, pigments, antioxidants, and preservatives, may be added. Although the content of cymen contained in the cosmetic composition of the present invention is not limited thereto, it is preferably 0.001 to 10% by weight, more preferably 0.01 to 5% by weight based on the total weight of the composition. If the content is less than 0.001% by weight, the desired anti-aging or anti-wrinkle effect may not be expected, and when the content is more than 10% by weight, there may be difficulty in preparing a safety or formulation.

In addition, the present invention provides a method for preventing or treating muscle diseases, promoting muscle differentiation, muscle regeneration or muscle strengthening, comprising administering or taking a pharmaceutical composition comprising cymene or a salt thereof as an active ingredient to an individual. to provide.

The present invention also provides a use for preventing or treating muscle diseases, promoting muscle differentiation, muscle regeneration or muscle strengthening of a composition comprising cymene or a salt thereof as an active ingredient.

As described above, the composition comprising the simen of the present invention or a pharmaceutically acceptable salt thereof as an active ingredient increases muscle function by increasing 4E-BP1 and p70S6K1 protein phosphorylation in myoblasts and inhibiting MuRF1 and MaFbx / atrogin1 gene expression. In muscle diseases caused by deterioration, muscle wasting or muscle degeneration, muscle differentiation, muscle regeneration, and muscle mass increase can be shown to strengthen muscle strength, and can inhibit muscle loss, for preventing or treating muscle diseases, and promoting muscle differentiation. , Muscle regeneration and muscle mass increase or muscle function improvement.

Hereinafter, preferred examples are provided to aid in understanding the present invention. However, the following examples are merely provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.

[ Example ]

Preparation . Cell culture

Mouse myoblast cell lines (C2C12 cells) were purchased from ATCC (Manassas, VA, USA), and the cells were purchased at 37 ° C., 5% CO using 10% fetal bovine serum media (Gibco-BRL). Incubated in ₂ incubators. When the cultured cells became 80% confluent, they were differentiated into myotubes using 2% horse serum media (Gibco-BRL).

Example  One.

Two days from the 4 th day of differentiation, 50 μM of dexamethasone (dexa; Sigma) and 100 μM of p-cymene (CAS Number 99-87-6, Sigma) were treated together.

Comparative example  One.

Dexamethasone (dexamethasone, dexa; Sigma) 50 μM was treated in the same manner as in Example 1.

Experimental Example  1. Mouse Myoblasts  Of used cement Muscle loss  Inhibitory effect

(One) Giemsa -Wright staining

The myotube according to Example 1 was washed twice with PBS (Phosphate buffered saline) and fixed with 100% methanol for 10 minutes. When the fixation was completed, the resultant was dried for 10 minutes at room temperature and then stained for 30 minutes by dropping Giemsa-wright staining solution (Asan Pharmaceutical, Seoul) that specifically stained myotubes.

(2) Myotube  Thickness measurement

The stained myotubes were taken at X20 magnification using a fluorescence microscope (IX 71, Olympus) and analyzed using image J software (USA). Six sections of each well were randomly selected and micrographed, and at least 100 myoblast thicknesses were analyzed from each well (3 replicates / Group).

As a result, as shown in FIG. 1A, in Comparative Example 1, the thickness of myotube was significantly reduced compared to that of normal cells (Basal), and in Example 1 treated with cement, myotube thickness decreased by dexamethasone was increased again. It could be visually confirmed. In addition, as shown in Figure 1B, even in the numerical results by using the image J software, it was confirmed that when treated with cymen, myotube thickness reduced by dexamethasone significantly increased by 39%. From this, cymen was found to increase the thickness of myotube in mouse myoblasts, inhibit muscle loss and promote muscle growth.

Experimental Example  2. Identify the mechanism of action

(One) Trizol  RNA isolation and RT- PCR  (reverse transcription-polymerase chain reaction)

334 μl of Trizol solution was added per 1 X 10 ⁷ cells of mouse myoblasts, and then centrifuged at 12,000 X g for 10 minutes. After transferring the supernatant to a new tube, 67 μl of chloroform was added and vortexed. Again, the supernatant was transferred to a new tube and isopropanol was added so that the ratio of the supernatant to isopropanol was 1: 1. Shake vigorously 10 times and leave at room temperature for 15 minutes, centrifuge for 10 minutes at 12,000 X g, 4 ℃, remove the supernatant, add 1 ml of 70% ethanol to the remaining precipitate, and then at 7,500 X g, 4 ℃ Centrifuge for 5 minutes. After removing ethanol, the tube containing the RNA precipitate was dried at room temperature for 15 minutes, and the RNA pellet was dissolved using nuclease free water. Using a UV / VIS spectrophotometer (Beckman coulter, DU730) was measured the concentration of RNA samples extracted at 260 nm and 280 nm wavelength, and the integrity of the RNA samples were confirmed by agarose gel electrophoresis.

RNA samples extracted from mouse myoblasts were synthesized by reverse transcription using oligo dT primers and superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA). PCR was performed using 5 'and 3' flanking sequences of the gene cDNA to be amplified as a template and cDNA obtained through reverse transcription, and the primer sequences used are shown in Table 1 below. 1 μl of the amplified PCR product was electrophoresed on a 1% agarose gel to confirm the DNA band.

Gene description	Primers	Sequences (5 '→ 3')	Annealing temperature (℃)	PCR product (bp)
MaFbx (synonym: atrogin-1)	F	GTCCAGAGAGTCGGCAAGTC	63	141
	R	GTCGGTGATCGTGAGACCTT
MuRF1 (synonym: TRAM63)	F	CTGAGCTGAGTAACTGCATC	60	147
	R	AGAGGGTGTCAAACTTCTGA
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH)	F	GTGATGGCATGGACTGTGGT	55	163
	R	GGAGCCAAAAGGGTCATCAT

(2) Western blotting

500 μL of 100 mM Tris-HCl, pH 7.4, 5 mM EDTA, 50 mM sodium pyrophosphate, 50 mM NaF, 100 mM orthovanadate, 1% Triton X-100, in each well from which media was removed to perform western blotting in cells Add and harvest lysis buffer containing 1 mM phenylmethanesulfonyl fluoride, 2 μg / mL aprotinin, 1 μg / mL pepstatin A, and 1 μg / mL leupeptin, harvest, centrifuge at 1,300 X g, 4 ° C for 20 minutes, and Protein was quantified according to Bradford method (Bio-Rad). 40 μg of protein was electrophoresed on SDS polyacrylamide gel and then transferred to nitrocellulose membranes (Amersham, Buckinghamshire, UK). Membrane was washed three times for 10 minutes using tris-buffered saline and tween 20 solution (TBS-T) and then blocked for 60 minutes using 10% skim milk. Membrane was added to the primary antibody diluted at a ratio of 1: 1,000, shaked gently at 4 ° C, incubated for 12 hours, washed with TBS-T, and the membrane was again diluted with a secondary antibody at a ratio of 1: 2,000. Incubate for 60 minutes and wash together. In this case, p70S6K1, phopho-p70S6K1 (p-p70S6K1), 4E-BP1, phospho-4E-BP1 (p-4E-BP1) and GAPDH (Cell Signaling Technology, Beverly, MA, USA) were used as primary antibodies. . Finally, the proteins were visualized on an X-ray film using an ECL Western blot detection kit (RPN2106, Amersham, Arlington Heights, IL, USA). Bands visualized on the X-ray film were scanned and quantified using Quantity One analysis software (Bio-Rad).

Figure 2 is a graph showing the change in the expression of the protein-related synthesis and synthesis in mouse myoblasts treated with cymens. As shown in FIG. 2, in Comparative Example 1, the amount of p-4E-BP1 and p-p70S6K1 proteins related to protein synthesis was significantly reduced compared to normal cells (Basal) (FIG. 2A). Genes MaFbx / atrogin1 and MuRF1 expression can be seen to increase significantly (Fig. 2B). For Example 1 treated with cymene, the amount of p-4E-BP1 and p-p70S6K protein reduced by dexamethasone was significantly increased again (FIG. 2A), and the expression of MuRF1 and MaFbx / atrogin1 was significantly reduced. It can be confirmed (FIG. 2B). That is, it is thought that Shimen was involved in ultimately increasing muscle mass by increasing 4E-BP1 and p70S6K1 protein phosphorylation in mouse myoblasts and inhibiting MuRF1 and MaFbx / atrogin1 gene expression.

Experimental Example  3. Strengthening effect of cymen using mouse

3-1. Experiment method

1) Preparation of experimental diet and breeding of experimental animals

Sixteen-week-old male C57BL / 6N mice (mating, Korea) were acclimated to a laboratory environment for one week on a commercial rodant chow and then grouped into two groups (HFD group, Cymene group) according to the ovary method. 8 dogs were randomly placed and kept for 10 weeks. The obesity induction diet used in this experiment was a high fat diet (HFD: 40% fat calorie, 17 g lard + 3% corn oil / 100 g diet) and supplemented with cymene-supplemented high fat. diet, Cymene) had the same composition as HFD but contained 0.2% of cement (Table 2). Siemens was purchased from Sigma-Aldrich.

ingredient	High fat Control diet ( HFD ) (g / kg diet)	Cymene Supplementary diet (g / kg diet)
Casein	200	200
DL-Methionine	3	3
Corn starch	111	109
Sucrose	370	370
cellulose	50	50
Corn oil	30	30
Laad	170	170
Vitamin complex	12	12
Mineral complex	42	42
Choline Bitartrate	2	2
cholesterol	10	10
tert-butyhydroquinone	0.04	0.04
Test substance (cymen)	-	2
Total (g)	1,000	1,000

2) Limb strength  Four limb hanging test

In order to measure the limb muscle strength of the mouse, the time to hang upside down using the four feet of the mouse at the 10th week of breeding. The total number of seconds the mouse hangs upside down was measured three times in a cage equipped with a wire mesh cap (diameter <0.5 cm) (20 x 30 x 50 cm, Jeong-Bi P & P, Korea). He gave me more than 30 minutes of rest. The experimental results were obtained by multiplying the hanging time (seconds) by the weight (kg).

3) grip test

In order to measure the grip force of the mouse, grip strength was measured using the four feet of the mouse at 10 weeks of breeding. The grip force measuring device equipped with a wire mesh (20 x 10 cm) (Daejong Equipment Industry, Korea) measured the force (N) of the wire mesh of the mouse a total of five times, and at least 1 minute rest between measurements. Gave time. The experimental results were obtained by dividing the measured force (N) and weight (kg).

4) Statistical Analysis

Statistical analysis of all data was carried out using the statistical package for the social sciences (SPSS version 21.0, IBM, Armonk, NY, USA) PC package, and the analysis value was expressed as mean ± SEM, and the significant difference between groups was ANOVA. And verified.

3-2. Experiment result

Ximen  Of mouse by ingestion Strength gain  Confirm

As a result of the experiment, the body weight of the mice fed Shimen was significantly reduced by 19% than that of the mice fed the high fat diet (FIG. 3A). Shimen also significantly increased the holding impulse (FIG. 3B) and grip strength (FIG. 3C) of mice fed high fat diets, 169% and 36%, respectively. From this, it was found that Shimen exhibited very good strength-building effects in the high-fat diet-induced muscle loss animal model.

Hereinafter, a preparation example of a composition containing an extract of the present invention will be described, but the present invention is not intended to be limited thereto but only to be described in detail.

Formulation example  One. Powder  Produce

Ximen 20 mg

Lactose Carb 100 mg

Talc 10 mg

The above ingredients were mixed and filled in an airtight cloth to prepare a powder.

Formulation example  2. Preparation of Tablets

Cymen 10 mg

Corn starch 100 mg

Lactose Carb 100 mg

Magnesium stearate 2mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

Formulation example  3. Manufacture of capsule

Cymen 10 mg

3 mg of microcrystalline cellulose

Lactose carb 14.8 mg

Magnesium Stearate 0.2 mg

After mixing the above components, it was filled in gelatin capsules according to the conventional method for producing a capsule to prepare a capsule.

Formulation example  4. Preparation of Injectables

Cymen 10 mg

Mannitol 180 mg

Sterile distilled water for injection 2974 mg

Monohydrogen phosphate 26 mg

After mixing the above components, it was prepared in the above ingredient content per ampoules (2 mL) according to the conventional method for preparing injections.

Formulation example  5. Liquid  Produce

Cymen 10 mg

Isomerized sugar 10 mg

Mannitol 5 mg

Purified water

Lemon flavor

The above components are dissolved in purified water according to a conventional preparation method, dissolved in purified water, and then lemon juice is added in an appropriate amount. After adjusting to 100 mL in total, sterilized and filled in a brown bottle to prepare a liquid formulation.

Formulation example  6. Preparation of dietary supplements

Cymen 10 mg

Vitamin mixture proper amount

70 μg of Vitamin A Acetate

Vitamin E 1.0 mg

Vitamin B1 0.13 mg

Vitamin B2 0.15 mg

Vitamin B6 0.5 mg

0.2 μg of vitamin B12

Vitamin C 10 mg

10 μg biotin

Nicotinic Acid 1.7 mg

Folate 50 ㎍

Calcium Pantothenate 0.5mg

Mineral mixture

Ferrous Sulfate 1.75 mg

Zinc Oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium monophosphate 15 mg

Dibasic calcium phosphate 55 mg

Potassium citrate 30 mg

Calcium Carbonate 100 mg

Magnesium chloride 24.8 mg

Although the composition ratio of the above-mentioned vitamin and mineral mixtures is mixed with a component suitable for a health food in a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional health food manufacturing method. The granules may be prepared and used for preparing a health food composition according to a conventional method.

Formulation example  7. Manufacture of health drinks

Cemen 10 mg

15 g of vitamin C

100 g of vitamin E (powder)

Iron lactate 19.75 g

3.5 g of zinc oxide

Nicotinamide 3.5 g

0.2 g of vitamin A

0.25 g of vitamin B1

0.3 g of vitamin B2

Purified Water Quantification

After mixing the above components according to the conventional healthy beverage production method, and stirred and heated at 85 ℃ for about 1 hour, the resulting solution is filtered and obtained in a sterilized 2 L container, sealed sterilization and then refrigerated and stored Used to prepare the healthy beverage composition of the invention.

Although the composition ratio is mixed with a component suitable for a favorite beverage in a preferred embodiment, the composition ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and usage.

Hereinafter, an example of preparation of a cosmetic composition containing an extract of the present invention will be described, but the present invention is not intended to be limited thereto, but is intended to be described in detail.

Production Example  1. Nutritional Cosmetics ( Milk Croissant )

Ximen 2.0 wt%

Squalane 5.0 wt%

Beeswax 4.0 wt%

Polysorbate60 1.5 wt%

Sorbanthesquioleate 1.5 wt%

0.5% by weight of liquid paraffin

Caprylic / Capric Triglycerides 5.0 wt%

Glycerin 3.0 wt%

Butylene Glycol 3.0 wt%

Propylene Glycol 3.0 wt%

Carboxy vinyl polymer 0.1 wt%

0.2% by weight of triethanolamine

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for nutritional longevity in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

Production Example  2. Softening Cosmetics (Skin Lotion)

Ximen 2.0% by weight

Glycerin 3.0 wt%

Butylene glycol 2.0% by weight

Propylene Glycol 2.0 wt%

Carboxy vinyl polymer 0.1 wt%

PEG 12 nonylphenylether 0.2% by weight

Polysorbate 80 0.4% by weight

Ethanol 10.0 wt%

Triethanolamine 0.1% by weight

Preservatives, colorings, flavors

Purified water to 100% by weight

The above blending ratio is mixed composition of a component suitable for a flexible softener in a preferred embodiment, but the blending ratio may be arbitrarily modified, it can be prepared according to the manufacturing method in the general cosmetic field.

Production Example  3. Nutrition Cream

Ximen 2.0% by weight

Polysorbate 60 1.5% by weight

Solbitan Sesquioleate 0.5% by weight

PEG60 Cured Castor Oil 2.0% by weight

10% by weight of liquid paraffin

Squalane 5.0 wt%

Caprylic / Capric Triglycerides 5.0 wt%

Glycerin 5.0 wt%

Butylene glycol 3.0% by weight

Propylene Glycol 3.0 Weight%

Triethanolamine 0.2% by weight

Preservative

Pigment amount

Spices

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for nourishing cream in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

Production Example  4. Massage Cream

Ximen 1.0 wt%

Beeswax 10.0 weight%

Polysorbate 60 1.5% by weight

PEG 60 Cured Castor Oil 2.0% by weight

Sorbanthesquioleate 0.8 wt%

40.0% by weight of liquid paraffin

Squalane 5.0 wt%

Caprylic / Capric Triglyceride 4.0 wt%

Glycerin 5.0 wt%

Butylene glycol 3.0% by weight

Propylene Glycol 3.0 Weight%

Triethanolamine 0.2% by weight

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a massage cream in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a manufacturing method in the general cosmetic field.

Production Example  5. Pack

Ximen 1.0 wt%

Polyvinyl alcohol 13.0 wt%

Sodium Carboxymethylcellulose 0.2% by weight

Glycerin 5.0 wt%

Allantoin 0.1 wt%

Ethanol 6.0 wt%

PEG 12 nonylphenyl ether 0.3% by weight

Polysorbate60 0.3 wt%

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a pack in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a manufacturing method in the general cosmetic field.

Production Example  6. Gel

Cemen 0.5% by weight

0.05% by weight of ethylenediamine sodium acetate

Glycerin 5.0 wt%

Carboxy vinyl polymer 0.3 wt%

Ethanol 5.0 wt%

PEG 60 Cured Castor Oil 0.5% by weight

0.3% by weight of triethanolamine

Preservatives, colorings, flavors

Purified water to 100% by weight

Although the above-mentioned compounding ratio is mixed with a component suitable for a gel in a preferred embodiment, the compounding ratio may be arbitrarily modified, and can be prepared according to a conventional manufacturing method in the cosmetic field.

The blending ratio is a relatively suitable composition for the cosmetic composition in a preferred embodiment, but can be applied to cosmetics of various uses, including other color cosmetics, according to the efficacy that can be applied to a thin coating on the human body, that is, Ointment may be used for manufacturing, and the mixing ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, and usage.

Hereinafter, an example of preparing a livestock feed composition containing an extract of the present invention will be described, but the present invention is not intended to be limited thereto but merely to be described in detail.

Production Example  7. Preparation of feed additives

Composition 0.1-10%

Tricalcium phosphate 1-20%

Vitamin E 0.01 ~ 0.1%

Enzyme Powder 1 ~ 10%

Lactobacillus 0.1-10%

Glucose 20-90%

Production Example  8. Preparation of feed

Using the feed additive of Preparation Example 1 as an active ingredient, a feed was prepared as follows.

Feed additive 0.1 ~ 10% of Preparation Example 1

Bran 40-49.9%

Milo 21.20%

Soybean meal 20.00%

Fish Meal 3.00%

Molasses 4.00%

Mineral 1.53%

0.27% vitamin

The foregoing description of the present invention is intended for illustration, and it will be understood by those skilled in the art that the present invention may be easily modified in other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not restrictive.

Claims (17)

1. A pharmaceutical composition for preventing or treating muscle diseases comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.
2. The method of claim 1,

   The composition is a pharmaceutical composition for preventing or treating muscle diseases, characterized in that to increase the expression of p-4E-BP1 or p-p70S6K1 protein.
3. The method of claim 1,

   The composition is a pharmaceutical composition for preventing or treating muscle diseases, characterized in that the expression of MuRF1 (Muscle Ring-Finger Protein) or MaFbx (Muscle atrophy F-box) is reduced.
4. The method of claim 1,

   The muscle disease is a muscle disease prevention or treatment pharmaceutical composition, characterized in that the muscle disease due to muscle function decline, muscle reduction, muscle wasting or muscle degeneration.
5. The method according to any one of claims 1 to 4,

   The muscle diseases include atony, muscular atrophy, muscular dystrophy, myasthenia, cachexia, rigid spinesyndrome, amyotrophic lateral sclerosis A pharmaceutical composition for preventing or treating muscle diseases, characterized in that any one or more selected from the group consisting of Charcot-Marie-Tooth disease and sarcopenia.
6. A pharmaceutical composition for promoting muscle differentiation, muscle regeneration, or muscle strengthening comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.
7. Health functional food composition for preventing muscle diseases or improving muscle function comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.
8. Health functional food composition for promoting muscle differentiation, muscle regeneration or muscle enhancement comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.
9. Composition for animal feed for preventing or improving muscle diseases comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.
10. Composition for promoting livestock differentiation, muscle regeneration or muscle strengthening comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.
11. Cosmetic composition for muscle function improvement comprising cymene or a pharmaceutically acceptable salt thereof as an active ingredient.
12. A method for preventing or treating muscle diseases, comprising administering to or administering to a subject a pharmaceutical composition comprising cymene or a salt thereof as an active ingredient.
13. The method of claim 12,

    The muscle diseases include atony, muscular atrophy, muscular dystrophy, myasthenia, cachexia, rigid spinesyndrome, amyotrophic lateral sclerosis Method for preventing or treating muscle diseases, characterized in that any one or more selected from the group consisting of Charcot-Marie-Tooth disease and sarcopenia.
14. A method for promoting muscle differentiation, muscle regeneration, or muscle strengthening, comprising administering to or administering to a subject a composition comprising cymene or a salt thereof as an active ingredient.
15. Use for preventing or treating muscle diseases of a composition comprising cymene or a salt thereof as an active ingredient.
16. The method of claim 15,

    The muscle diseases include atony, muscular atrophy, muscular dystrophy, myasthenia, cachexia, rigid spinesyndrome, amyotrophic lateral sclerosis Use for preventing or treating muscle diseases, characterized in that any one or more selected from the group consisting of Charcot-Marie-Tooth disease and sarcopenia.
17. Use for promoting muscle differentiation, muscle regeneration or muscle strengthening of a composition comprising cymene or a salt thereof as an active ingredient.

Images