KR101721022B1 - Composition for comprising adipic acid for improving skin wrinkle or enhancing skin elasticity - Google Patents

Abstract

The present invention relates to a composition for improving skin wrinkles and improving elasticity containing adipic acid as an active ingredient, and more particularly to a cosmetic composition for improving wrinkles, an external preparation for skin, and food composition containing adipic acid as an active ingredient, and a cosmetic composition for improving skin elasticity, an external preparation for skin, and food composition containing adipic acid as an active ingredient.

Description

[0001] The present invention relates to a composition for improving skin wrinkles and skin elasticity comprising adipic acid as an active ingredient,

The present invention relates to a composition for improving skin wrinkles and improving elasticity containing adipic acid as an active ingredient, and more particularly to a cosmetic composition for improving wrinkles containing adipic acid as an active ingredient, an external preparation for skin, a food composition, An external preparation for skin, a food composition, and a pharmaceutical composition containing an adipic acid and adipic acid as an active ingredient.

The skin consists largely of epidermis, dermis, and hypodermis. The epidermis, especially the stratum corneum, which is the outermost layer of the epidermis, acts as a skin barrier to inhibit the loss of moisture and electrolytes from the skin. While the dermis, through the synthesis of collagen and elastin, maintains the elasticity of the skin and supports the structure. In other words, collagen and elastin are the main proteins produced in fibroblasts, which are involved in the mechanical durability of the skin, the binding force and elasticity of the tissue. Collagen forms a variety of isoforms depending on its morphology and structural characteristics. There are 28 types of collagen isotypes in human tissues, including collagen types 1, 3. 6. 7. 13, 14, 17 are known. Collagen types 1 and 3 form the epidermal component of the dermis, while collagen type 7 is the main constituent of the dermal and epidermal junctions.

In skin connective tissue, type 1 collagen is the most abundant of extracellular matrix proteins, and other proteins such as elastin, fibronectin, integrin, fibrin, and proteoglycans exist. The newly synthesized procollagen is hydroxylated at the proline and lysine amino acid residues, and the three strands are twisted into the extracellular space. Here, procollagen is formed by procollagen proteinase to form a collagen protein only when both ends are cut off. The latter forms microfibril in a triple helix configuration, and microfibril forms a leucine-rich small proteoglycans To form a fibril. As a result, these fibrils are gathered together to form collagen fibers that provide the binding force and elasticity of the skin.

Skin aging is known to be caused by a decrease in collagen content, which is the protein that occupies most of the collagen in skin dermal tissue. Since collagen gives skin tension and strength, collagen reduction has a very deep relationship with skin aging and wrinkle formation have. Skin aging is largely divided into endogenous aging by physiological aging and photoaging caused by continuous exposure to ultraviolet radiation (UV). Repeated exposure to ultraviolet light results in increased collagenase and denaturation and destruction of collagen fibers, reducing skin elasticity and promoting the production of wrinkles.

Recent advances in medical technology have led to increased interest in skin care and health as life expectancy has been extended and quality of life has been improved and the desire for a healthy and beautiful life has increased. Various cosmetic functional cosmetics have been developed to maintain healthy skin. Especially, researches for prevention of skin wrinkle formation, mitigation and improvement have been actively carried out. In addition, recently, cosmetic ingredients reach skin dermis and there is a limitation in supplying nutrients. As a result of the change in perception that ingestion of nutrients or functional ingredients to the skin can provide a skin cosmetic enhancement effect, Research to excavate materials is also being actively pursued.

The present applicant has also researched the development of a food or cosmetic material which is effective in reducing wrinkles by inhibiting the action of collagenase in natural products with low side effects and promoting the synthesis of collagen. As a result, it was confirmed that adipic acid, which has been used only for the purpose of an acidity controlling agent, has an effect of improving skin elasticity and reducing skin wrinkles, and completed the present invention.

Accordingly, the present inventors completed the present invention by developing a cosmetic composition for improving wrinkles or skin elasticity, an external preparation for skin and a food composition containing adipic acid as an active ingredient.

Accordingly, an object of the present invention is to provide a cosmetic composition for improving wrinkles, an external preparation for skin and a food composition containing adipic acid as an active ingredient.

It is still another object of the present invention to provide a cosmetic composition for enhancing skin elasticity, an external preparation for skin and a food composition containing adipic acid as an active ingredient.

In order to achieve the above object, the present invention provides a cosmetic composition for improving wrinkles containing adipic acid as an active ingredient.

According to another preferred embodiment of the present invention, the adipic acid may be contained in an amount of 0.0001 to 20% by weight based on the total weight of the cosmetic.

According to another preferred embodiment of the present invention, the composition of the present invention is effective to any one or more of effects selected from the group consisting of an increase in procollagen secretion amount, promotion of collagen biosynthesis, reduction of expression of MMP-1 gene and inhibition of skin stratum corneum formation It can be something to have.

According to another preferred embodiment of the present invention, the cosmetic composition of the present invention is used as a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nutrition lotion, a massage cream, It can be any one selected from the group consisting of essence, pack, mask pack, mask sheet, soap, shampoo, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, milky lotion, press powder, loose powder and eye shadow have.

According to another preferred embodiment of the present invention, the composition of the present invention may further comprise a cosmetically acceptable carrier.

According to another preferred embodiment of the present invention, the composition of the present invention may further comprise a skin wrinkle improving component or a skin elasticity improving component. The skin wrinkle improving component or skin elasticity enhancing component may be specifically selected from the group consisting of vitamin C, retinoic acid, TGF, protein from animal placenta, betulinic acid and chlorella extract.

The present invention also provides a composition for external application for skin for improving wrinkles containing adipic acid as an active ingredient.

The present invention also provides a food composition for improving wrinkles containing adipic acid as an active ingredient.

According to another preferred embodiment of the present invention, the food of the present invention may be made into any one form selected from the group consisting of tablets, granules, powders, capsules, liquid solutions and rings.

The present invention also provides a pharmaceutical composition for improving wrinkles containing adipic acid as an active ingredient.

The present invention also provides a cosmetic composition for enhancing skin elasticity, an external preparation for skin, a food composition and a pharmaceutical composition containing adipic acid as an active ingredient.

The present invention provides a cosmetic composition for improving wrinkles containing adipic acid as an active ingredient, an external preparation for skin and a food composition, a cosmetic composition for enhancing elasticity containing adipic acid as an active ingredient, an external preparation for skin and a food composition. The composition containing adipic acid has an effect of increasing the amount of procollagen secretion, promoting collagen biosynthesis, decreasing expression of MMP-1 gene, and inhibiting skin skin layer thickening, thereby being effective in improving skin wrinkles or skin elasticity.

FIG. 1 is a graph showing the amount of procollagen secreted from human skin fibroblasts (-UVB: control group not treated with UVB, + UVB: control group treated with UVB, AA: test group treated with adipic acid after UVB irradiation, VitC: Control group treated with vitamin C after UVB irradiation, AA + VitC: Experimental group treated with adipic acid and vitamin C after UVB irradiation).
2 is an electrophoresis photograph and a graph showing the amounts of procollagen and MMP-1 gene expressed in human fibroblasts.
FIG. 3 is a graph showing weight gain (A and B) and dietary intake amounts (C and D) of a mouse consuming an experimental diet.
4 is a graph showing moisture content (A), moisture evaporation amount (B), elasticity (C), and erythema index (D) of mouse skin tissues consumed in the experimental diet.
Fig. 5 is a photograph of the dorsal skin tissue of a mouse ingested with an experimental diet.
FIG. 6 is a photograph (A) and a graph (B) showing the degree of wrinkling of the skin tissue such as a mouse ingested with the experimental diet.
Fig. 7 is a graph (A) and a photograph (B) showing the skin thickness of a mouse ingested with the experimental diet.
8 is an electrophoresis photograph and graph showing changes in collagen and MMPs gene expression in tissues such as mouse treated with adipic acid.

Hereinafter, the present invention will be described in more detail.

As described above, the use of adipic acid for regulating the acidity has been known, but no research has been conducted on the skin elasticity enhancement and skin wrinkle reduction effect.

The composition containing adipic acid provided by the present invention is effective for increasing the amount of procollagen secretion, promoting collagen biosynthesis, decreasing expression of MMP-1 gene, and inhibiting skin skin layer thickening, thereby improving skin wrinkles or skin elasticity .

Accordingly, the present invention provides a cosmetic composition for improving wrinkles containing adipic acid as an active ingredient.

Adipic acid is a carboxyl-based compound which is contained in sugar beet and gambir, and includes adipic acid, adipic acid, 1,4-butanedicarboxylic acid; 1,6-hexanedioic acid; acifloctin; acinetten; adipinic acid; hexanedioic acid; It is also called octafluorohexanedioic acid. The adipic acid of the present invention can be obtained by extraction, isolation and purification from various plants including adipic acid.

The Cas No. of adipic acid is 124-04-9, the structural formula is C ₆ H ₁₀ O ₄ , and the molecular weight is 146.1 g / mol. The specific structure thereof is shown in the following formula (1). Adipic acid is a flammable substance and can be electrostatically charged in a dry place by vortexing, air transport, injection, and the like. It decomposes in heat and produces corrosive chemical gases and toxic substances containing valeric acid and other substances.

[Chemical Formula 1]

Adipic acid is registered as a food additive having the use of an "acidity modifier" in the domestic food cycle, and is also registered as an acidity modifier in the Food and Color Additive Database of the US FDA. Adipic acid is added to baking powder as a yeast acidic additive and is also added to the concentrate powder of fruit flavored juice and bottle drinks. It can also be used to improve the melting characteristics and texture of processed cheese and cheese spreads. Adipic acid can be added to produce a foam in the egg whites and can be used as a gel-forming agent in jams and jellies. Adipic acid has been added to food as a buffer and neutralizing agent, and is used as a raw material for pharmaceuticals and as a perfume fixing agent.

The known physiological activities of adipic acid have been reported to be anti-chitosanic and anti-hypertensive. Adipic acid has been reported to improve the ketosis induced by long-chain and short-chain monocarboxylic acids in rats. In a clinical study in patients with hypertension, amlodipine adipate intake for 8 weeks improved blood pressure. However, up to now, the effect of improving adipic acid skin elasticity and reducing skin wrinkles has not been known.

Through several experiments, the safety of adipic acid is known to some extent. LD _{50 values} obtained by administration of adipic acid by various methods such as inhalation, intravenous injection, oral administration and intraperitoneal injection are shown in [Table 1], and oral administration of 11,000 mg / kg body weight Respectively.

Adipic acid toxicity report materials End point Animal species Route of administration Volume Toxic effect Resources TDL0 Rat oral- 140 g / kg / week (intermittent) And mobility, diarrhea, weight loss or weight gain reduction FAO Nutrition Meetings Report Series, 40, 1 (1967) LD50 Rat Abdominal cavity 275 mg / kg Drowsiness (overall suppressed activity), other changes, bleeding H.J. Horn et al., Agric. Food Chem, 5: 759-762,1957. LD50 mouse oral- 1,900 mg / kg Gastrointestinal tract change H.J. Horn et al., Agric. Food Chem, 5: 759-762,1957. LD50 mouse Intravenous 680 mg / kg Effects on seizures or seizure thresholds, bleeding H.J. Horn et al., Agric. Food Chem, 5: 759-762,1957. LD50 rabbit oral- > 11 g / kg No detailed reporting IuV, Novikov. et al., Gigiena i sanitariia, 9: 72-75, 1983. TDL0 Rat oral- 140 g / kg / week (intermittent) And mobility, diarrhea, weight loss or weight gain reduction FAO Nutrition Meetings Report Series, 40, 1 (1967)

(Reference: Tox-Info System, Food and Drug Safety Evaluation Institute)

In the 20-24 female CD-1 albino mice that were mated, adipic acid was administered daily from 6 to 15 days after pregnancy, and there was no embryotoxic or teratogenic effect in the study. No growth adverse reaction was observed when the test group consisting of 17-20 female rats were kept for 28 days in a diet containing adipic acid at dose levels equivalent to 0, 10, 20, and 40 mg / kg. The test group consisting of 18 male rats had normal growth rates except for the high-dose group in which the growth rate was reduced when the diet containing adipic acid at dose levels equivalent to 0, 200, 400, 800 mg / day for 5 weeks was maintained.

In addition, no significant abnormality of the chromosome was observed when the lung cultures of human embryos (WI - 38) were grown in the presence of adipic acid (2, 20, 200 μg / ml) and positive control and negative control compounds. In a subacute study, adipic acid was administered at doses of 3.75, 37.5, and 375 mg / kg / day for 5 consecutive days, and bone marrow cell chromosomal abnormalities were not observed.

Adipic acid has been reported to be excreted in the urine as it is metabolized only partially after ingestion in the human body and unchanged in the remainder. For example, there is a report that residues of adipic acid were not detected in tissues sacrificed three days after ingesting 0.75 g of adipic acid for 4 weeks and stopping the ingestion of the rats. Adipic acid has been reported to be metabolized to succinic acid and acetic acid via beta oxidation and then to metabolism to other normal intermediate metabolites and metabolites detected in the urine after feeding radioactive adipic acid to fasting experimental rats , Glutamic acid, lactic acid, betacetoadipic acid, and citric acid.

Therefore, administration of adipic acid at a low concentration, specifically 0.001 to 3000 mg / kg, more preferably 0.001 to 1500 mg / kg, is insignificant in toxicity or does not exist, so that the cosmetic composition, external preparation for skin, .

As used herein, the term "improvement of skin wrinkles" means maintaining or enhancing the ability of skin to be associated with wrinkles and elasticity. Collagen (collagen) and elastin (elastin), which are the collagen fibers of the skin dermis layer, play a key role in maintaining skin elasticity. Collagen biosynthesis is affected by internal and external skin. Specifically, the skin cells are reduced in cellular activity due to natural aging, and collagen fibers are decreased. When extreme ultraviolet rays are irradiated as an external factor, or when active oxygen generated by stress or the like causes thiol (-SH) To increase the expression of collagen and elastase, thereby increasing the wrinkles of the skin and reducing the elasticity, thereby aging the skin.

The adipic acid contained in the cosmetic composition described in the present invention may be contained in an amount of 0.0001 to 20% by weight based on the total weight of the cosmetic. Less than 0.0001% by weight of adipic acid in cosmetics may be less effective in improving wrinkles due to the small amount of adipic acid, and more than 20% by weight of adipic acid may exhibit the conventionally known toxicity.

The composition of the present invention may be one having at least one effect selected from the group consisting of an increase in procollagen secretion amount, promotion of collagen biosynthesis, reduction of expression of MMP-1 gene, and inhibition of skin stratum corneum formation.

According to one embodiment of the present invention, the amount of procollagen and procollagen type I C-peptide (PIP) secreted into the extracellular matrix by treating the drug with irradiation of ultraviolet rays to human skin fibroblasts was measured. As a result, As shown, the amount of procollagen secretion was significantly reduced in UV irradiated control cells (+ UVB) compared to normal cells (-UVB). In the cells treated with adipic acid with ultraviolet irradiation, control cells + UVB), the amount of collagen was significantly increased by 18%. On the other hand, in the cells treated with adipic acid with vitamin C, the amount of collagen was significantly increased by 50% as compared with the control cells (+ UVB), which was treated with only vitamin C (+ 27%) or adipic acid Which was higher than the amount of collagen observed in one cell (see Fig. 1).

According to one embodiment of the present invention, the expression of collagen type 1α1 and α2 and collagen type 3α1 was significantly increased in the adipic acid-supplemented group compared to the + UVB-treated group, and the expression of MMP-1a and -1b, MMP- And MMP-9 gene expression was significantly decreased (see FIG. 8). Thus, adipic acid can increase collagen protein synthesis in subcutaneous tissues and inhibit degradation of collagen fibers, thereby alleviating wrinkle formation caused by ultraviolet irradiation.

According to one embodiment of the present invention, the change in the expression level of procollagen and MMP-1 gene after treatment of the drug with human skin fibroblasts is shown in FIG. 2. As a result, adipic acid has a significantly reduced pro- The expression of collagen was significantly increased while the expression of MMP-1 gene significantly increased by ultraviolet light was significantly reduced. The gene expression regulating activity of adipic acid was similar to that of vitamin C (see FIG. 2).

The term "cosmetic composition" used in the present invention is a composition containing the above-mentioned compound, and the formulation can be in any form. Examples of such formulations include cosmetic preparations made using the above composition, such as creams such as nutritional creams, eye creams, massage creams, cleansing creams, lotions such as packs, nutritional lotions, essences, softening longevity, A foundation, a makeup base, and the like, and may be manufactured and commercialized in any form of these formulations in order to achieve the object of the present invention, and the present invention is not limited to these examples. Further, the cosmetic composition according to the present invention can be formulated into a usual cosmetic preparation method.

Specifically, the cosmetic composition of the present invention can be used as a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nutrition lotion, a massage cream, a nutrition cream, a moisturizing cream, a hand cream, And may be any one selected from the group consisting of soap, shampoo, cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, milky lotion, press powder, loose powder and eye shadow.

The cosmetic composition of the present invention may further comprise a cosmetically acceptable carrier, and it is possible to apply the usual ingredients to be blended with the general skin cosmetic composition as needed.

Specifically, the cosmetic composition of the present invention may further comprise a transdermal penetration enhancer. As used herein, the term transdermal penetration enhancer is a composition that allows a desired component to penetrate into vascular cells of the skin at a high absorption rate. But are not limited to, other phospholipid components, liposomal components, and the like, preferably used in lecithin cosmetics.

As the oil which can be mainly used as an oil component, at least one selected from vegetable oil, mineral oil, silicone oil and synthetic oil can be used. More specifically, there may be mentioned mineral oil, cyclomethicone, squalane, octyldodecyl myristate, olive oil, Vitisviniferase seed oil, macadamia nut oil, glyceryl octanoate, castor oil, ethylhexyl isononanoate, Chicone, cyclopentasiloxane, sunflower seed oil and the like can be used.

Further, 0.1 to 5% by weight of a surfactant, a higher alcohol and the like may be added to reinforce the emulsifying ability. As such surfactants, conventional surfactants such as nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, phospholipids and the like can be used. Specific examples thereof include sorbitan sesquiunorate, polysorbate 60 Sorbitan stearate, sorbitan stearate, sucrose stearate / sucrose cocoate, glyceryl stearate / polyethylene glycol-100 Stearate, cetearyl-6 olivate, arachidyl alcohol / behenyl alcohol / arachidyl glucoside. Polypropylene glycol-26-butes-26 / polyethylene glycol-40 hydrogenated castor oil, and the like. As the higher alcohol, an alcohol having 12 to 20 carbon atoms such as cetyl alcohol, stearyl alcohol, octyldodecanol, isostearyl alcohol, etc. may be used alone or in admixture of one or more.

In order to control the viscosity or hardness of the water phase, 0.001 to 5% by weight of at least one thickening agent such as carbomer, xanthan gum, bentonite, magnesium aluminum silicate, cellulose gum, dextrin palmitate and the like may be further added.

In addition, the cosmetic composition of the present invention may contain, if necessary, a medicinal ingredient such as higher fatty acids and vitamins, an ultraviolet screening agent, an antioxidant (butylhydroxyanisole, gallic acid propylate, eicosorbic acid, tocopheryl acetatide, (Triethanolamine, citric acid, citric acid, sodium citrate, malic acid, citric acid, etc.), preservatives (methylparaben, butylparaben, propylparaben, phenoxyethanol, imidazolidinyl urea, chlorphenesin and the like) And the like), a humectant (glycerin, sorbitol, propylene glycol, butylene glycol, hexylene glycol, diglycerin, etc.), sodium hydrogen carbonate , Betaine, glycereth-26, methylglucose-20, etc.), lubricant, and the like.

In addition, the cosmetic composition of the present invention further comprises a substance capable of supplementally providing an essential nutrient to the skin, and preferably it may contain an auxiliary agent including, but not limited to, a natural flavor, a cosmetic flavor, have.

In addition, the cosmetic composition of the present invention may further comprise a skin wrinkle improving component or a skin elasticity improving component. The specific skin wrinkle improving component or skin elasticity enhancing component may be at least one selected from the group consisting of vitamin C, retinoic acid, TGF, protein from animal placenta, betulinic acid and chlorella extract, and most preferably, Vitamin C < / RTI >

In one embodiment of the present invention, when vitamin C and adipic acid were treated together, the amount of procollagen was increased by 50%, but when vitamin C was treated alone, it was 27% and when adipic acid alone was treated, it was 18% Showed an increase in procollagen secretion. These results, when assigned to the call informal, show that synergistic effects are exhibited when adipic acid and vitamin C are treated together.

The present invention provides a composition for external application for skin for improving wrinkles containing adipic acid as an active ingredient.

The composition for external use of the present invention is used for the purpose of improving the wrinkles of the skin, preventing and delaying the generation of wrinkles, and is not particularly limited in its formulation. Examples thereof include softening longevity, The composition may be a cosmetic composition having a formulation of a cream, a nutritional cream, a pack, a mask pack, a mask sheet, a gel or a skin adhesive type cosmetic composition and may also be a transdermal dosage form such as lotion, ointment, gel, cream, patch, have.

Further, in the external preparation for each formulation, components other than the above-mentioned essential components can be mixed and selected without difficulty by those skilled in the art depending on the formulation or purpose of use of the other external preparation.

The present invention provides a food composition for improving wrinkles containing adipic acid as an active ingredient.

The food composition of the present invention may be prepared in any one form selected from the group consisting of tablets, granules, powders, capsules, liquid solutions and rings. The food composition according to the present invention can be formulated in the form of powders, liquids, tablets, soft capsules, granules, tea bags, instant tea or drinks containing adipic acid as an active ingredient. The content of adipic acid as an active ingredient can be appropriately determined depending on the intended use (for prevention or improvement). Generally, the amount of adipic acid contained in the food composition may be 0.1 to 90% by weight based on the total weight of the food. However, in the case of long-term consumption intended for health and hygiene purposes or for health control purposes, the amount may be less than the above range. In addition, the food composition according to the present invention may contain other ingredients which can give a synergistic effect to the main effect, such as vitamin C, such as vitamin C, in addition to adipic acid, to the extent that the main effect of the present invention is not impaired A wrinkle improving compound or a green tea extract, a mulberry extract, a licorice extract, a bark extract, a bamboo extract, a golden extract, and a wild ginseng extract.

The food composition formulated in this form can be added directly to the food or used together with other food or food ingredients, and can be suitably used according to conventional methods. Examples of food products include dairy products including drinks, meat, sausage, bread, biscuits, rice cakes, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gums, ice cream, soups, , Dairy products and dairy products, and all health functional foods in the ordinary sense are included.

When the food composition of the present invention is a drink, it contains adipic acid as an essential ingredient in the indicated ratio. There are no particular restrictions on other ingredients used for the purpose of producing other drink products, and various flavoring agents Natural carbohydrates and the like as additional components. Examples of such natural carbohydrates include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose and the like; And polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol and erythritol. Natural flavors and synthetic flavors and the like can be used as the flavors other than those described above. The ratio of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the composition of the present invention.

In addition, the food composition of the present invention can be used as a flavoring agent such as various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, coloring agents and thickening agents (cheese, chocolate etc.), pectic acid and its salts, Salts, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in carbonated beverages and the like. In addition, the inventive food composition of the present invention may contain natural fruit juice and pulp for the production of fruit juice drinks and vegetable drinks. These components may be used independently or in combination. The proportion of such additives is not so critical, but is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of the adipic acid of the present invention.

The present invention provides a pharmaceutical composition for improving wrinkles containing adipic acid as an active ingredient.

The compound of the present invention has an effect of inhibiting aging of cells due to inhibition of cell senescence by UV and formation of reactive oxygen species and promoting the expression of extracellular matrix proteins in skin cells, Or as a pharmaceutical composition for improving skin wrinkles.

The amount of the pharmaceutical composition for improving wrinkles or skin elasticity used in the present invention should be a pharmaceutically effective amount. As used herein, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and the effective dose level will vary depending on the species and severity, The type of virus being infected, the activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and rate of release, the duration of the treatment, factors including co-administered drugs and other well known factors in the medical field. Effective amounts may vary depending on the route of treatment, the use of excipients, and the likelihood of use with other agents, as will be appreciated by those skilled in the art.

The pharmaceutical compositions for improving wrinkles or improving skin elasticity of the present invention may be formulated into pharmaceutical formulations using methods well known in the art so as to provide rapid, sustained or delayed release of the active ingredient after administration to the mammal . In the preparation of the formulations, it is preferred that the active ingredient is mixed with or diluted with the carrier, or enclosed in a carrier in the form of a container.

Therefore, the pharmaceutical composition for wrinkle improvement or skin elasticity enhancement of the present invention can be formulated in the form of oral, granule, tablet, capsule, suspension, emulsion, syrup or aerosol, May be formulated and used, and may further comprise suitable carriers, excipients or diluents conventionally used in the preparation of the composition.

Examples of carriers, excipients and diluents that can be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant is usually used.

In addition, the pharmaceutical composition of the present invention can be added to the skin during the preparation of quasi-drugs for the purpose of inhibiting skin aging or improving skin wrinkles. When the pharmaceutical composition of the present invention is used as a quasi-drug additive, the compound may be added as it is or may be used together with other quasi-drugs or quasi-drugs, and may be appropriately used according to a conventional method. The amount of the active ingredient to be mixed can be suitably determined according to the intended use (prevention, health or therapeutic treatment). Preferably, the quasi-drug may be a disinfectant cleaner, a shower foam, a gagrin, a wet tissue, a detergent soap, a hand wash, a humidifier filler, a mask, an ointment agent, a coating agent or a filter filler.

The present invention also provides a cosmetic composition for enhancing skin elasticity, an external preparation for skin and a food composition containing adipic acid as an active ingredient.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Human skin fibroblasts  Effect of Adipic Acid on Wrinkles

1-1) Cell culture

Normal human dermal fibroblasts (neonatal foreskin) were purchased from ATCC (Manassas, VA, USA). The cells were cultured in a 5% CO ₂ incubator at 37 ° C using a fibroblast growth medium (Promo Cell, Heidelberg).

1-2) Measurement of procollagen type I C-peptide (PIP) concentration

To investigate the collagen biosynthesis performance, human fibroblasts were added to 12 well plates at a density of 1.0 × 10 ⁶ cells / well. Adipic acid and vitamin C were added at a concentration of 100 μM, respectively, and cultured in a CO ₂ incubator for 24 hours. After removing the medium from each well, the plate was washed once with PBS, and 1 ml of PBS was added thereto. Then, ultraviolet B (UVB) was irradiated at 20 mJ / cm ² . The PBS of each well was again replaced with the medium and cultured for 24 hours. The amount of procollagen secreted in the medium was measured using a procollagen type I C-peptide EIA kit (Takara Bio, Japan). The standard solution contained in the collagen measurement kit was diluted by concentration, absorbance was measured at 450 nm to prepare a standard concentration curve and the amount of collagen production was calculated.

1-3) RNA isolation and RT-PCR using the triazole method (reverse transcription-polymerase chain reaction)

After adding 334 μl of trizol solution per 1 × 10 ⁷ cells of human skin fibroblasts, they were changed and centrifuged at 12,000 × g for 10 minutes at 4 ° C. The supernatant was transferred to a new tube, and 67 μl of chloroform was added and vortexed. The supernatant was again transferred to a new tube and isopropanol was added so that the ratio of supernatant to isopropanol was 1: 1. After 10 h of shaking, the mixture was allowed to stand at room temperature for 15 minutes, centrifuged at 12,000 × g for 10 minutes at 4 ° C., and then the supernatant was removed. 1 ml of 70% ethanol was added to the remaining precipitate, And centrifuged for 5 minutes. After removing the ethanol, the tube containing the RNA precipitate was dried at room temperature for 15 minutes, and the RNA pellet was dissolved using water containing no nucleic acid degrading enzyme. The concentration of RNA samples extracted at 260 nm and 280 nm wavelengths was measured using a UV / VIS spectrophotometer (Beckman coulter, DU730) and agarose gel electrophoresis was performed to confirm the integrity of the RNA samples Respectively.

CDNAs were synthesized by using oligo dT primers and superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA) as a template for RNA samples extracted from human skin fibroblasts. PCR was carried out using the cDNA obtained from the reverse transcription as a template and the 5 'and 3' flanking sequences of the gene cDNAs to be amplified as primers. The primer sequences used herein were as shown in [Table 2] Same as. 1 μl of the amplified PCR product was electrophoresed on 1% agarose gel to confirm the DNA band.

 The primer sequence used for RT-PCR gene primer The base sequence (5 '- > 3') Annealing temperature
(° C) PCR
product
(bp) SEQ ID NO: Procollagen F TCTTCAAGCCATCCTGTGTG 60 168 One R GCGAGTCTGTGTTTTTGCAG 2 Metalloproteinase 1 (MMP-1) F ATGACATGAGTCCGGAGCAA 60 122 3 R TCATCTCCTGGGTCCCTTTC 4 Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) F GTGATGGCATGGACTGTGGT 55 203 5 R GGAGCCAAAAGGGTCATCAT 6

1-4) Results of measurement of changes in the amount of procollagen secretion

Collagen, the main protein that makes up the skin, is synthesized in the form of procollagen in fibroblasts in the skin dermis and then secreted into the extracellular matrix. Procollagen secreted into the extracellular matrix is broken down by the pro-collagen peptidase present on the cell surface and is formed into active collagen. Therefore, the activated collagen content can be measured by measuring the C-peptide content. As shown in FIG. 1, the amounts of procollagen and procollagen type I C-peptide (PIP) secreted into the extracellular matrix were measured by irradiating ultraviolet light to human skin fibroblasts, (+ UVB), the amount of procollagen secretion was significantly reduced compared to normal cells (-UVB). In the cells treated with adipic acid with ultraviolet irradiation, the amount of collagen was 18 %. On the other hand, in the cells treated with adipic acid with vitamin C, the amount of collagen was significantly increased by 50% as compared with the control cells (+ UVB), which was treated with only vitamin C (+ 27%) or adipic acid Which is higher than the amount of collagen observed in one cell (see FIG. 1). Thus, adipic acid increases the amount of collagen in human dermal fibroblasts, and this collagen-increasing effect is more effective when used with vitamin C.

1-5) Measurement results of pro-collagen and MMP-1 gene expression changes

As shown in FIG. 2, adipic acid significantly increased the expression of procollagen significantly decreased by ultraviolet rays, as shown in Fig. 2, when the changes of procollagen and MMP-1 gene expression were measured after treatment with human skin fibroblasts , Significantly decreased MMP-1 gene expression significantly increased by ultraviolet light. The gene expression regulating activity of adipic acid was similar to that of vitamin C (see FIG. 2). Thus, adipic acid may be involved in increasing collagen content, which is ultimately related to skin wrinkling, by inhibiting MMP-1 expression as well as increasing pro-collagen synthesis in ultraviolet irradiated human dermal fibroblasts.

Evaluation of adipic acid skin wrinkle, moisturizing and elasticity enhancement efficacy using mouse

2-1) Preparation of empirical formula, breeding of experimental animals and ultraviolet irradiation

The 5-week-old female albino hairless mouse (SKH-1) used in this experiment was purchased from Orient Bio (Korea) and subjected to a week of adaptation period with solid feed. The experimental animals were divided into 4 groups and 4 mice were assigned to each group. All experimental groups were divided into two groups: normal control group (UVB), ultraviolet irradiation group (UVB), adipic acid (AA) or vitamin C (VitC). During the breeding period, feed and water were freely consumed. The temperature was maintained at 22 ± 1 ° C, the humidity was maintained at 60 ± 5%, and the light period and the dark cycle were adjusted to 12 hours each day.

-UVB group and + UVB group received the purified diet prepared according to AIN-93 mouse diet composition (Reeves, PG et al., J Nutr, 123: 1939-1951, 1993) 0.2% adipic acid (Sigma-Aldrich) was added to the purified diet, and 0.2% vitamin C (Sigma-Aldrich) was added to the VitC group for AIN-93. The composition of the experimental diet is shown in [Table 3]. Diets were supplied daily with water between 10 am and 11 am, and the dietary intake was measured daily.

During the experimental period, UV rays were irradiated three times a week on the dorsal part of dull mice. The UV dose was 73 mJ / cm ² for the first week, 146 mJ / cm ^{2 for the second} week, 219 mJ / cm < ^{2 &} gt ;. During the breeding, weekly skin weight measurements and skin thickness measurements were taken. The skin thickness was measured using a digital micro caliper (Marathon Watch Company Ltd, Ontario, Canada) at the buttocks of the hairless mice. The calipers used in the measurement were able to measure up to 0.01 mm and had a control function to apply constant force to the thickness, and it was possible to measure the skin thickness under the same force.

After the end of the experiment, the animals were anesthetized and blood was collected and used for hematological analysis. The dorsal skin tissues were cut, some were stored in the freezer and used for molecular biology, and some were stored in 10% formalin solution Were used for immunohistochemical staining.

Experimentation table ingredient AIN-93G diet
(g / kg diet) Adipic acid supplement (AA)
(g / kg diet) Vitamin C supplement (VitC)
(g / kg diet) Casein 200 200 200 Maltodextrin 132 132 132 Corn starch 397.486 395.486 395.486 Sucrose 100 100 100 cellulose 50 50 50 Soybean oil 70 70 70 Vitamin complex 10 10 10 Mineral complex 35 35 35 Colin Beavertre 2.5 2.5 2.5 L-cystine 3 3 3 Tert-butyhydroquinone 0.014 0.014 0.014 Adipic acid - 2 - Vitamin C - - 2 Total (g) 1,000 1,000 1,000

2-2) Skin moisturizing, elasticity and erythema index measurement

The skin moisture content, water evaporation, elasticity and erythema index of the experimental animals were measured once at the end of the experiment using Corneometer ^® , Tewameter ^® , Cutometer ^® , and Mexameter ^® (CK Electronics GmbH). In the measurement, the numerical value obtained by lightly pressing a certain portion of the test animal or the like was recorded.

2-3) Measurement of wrinkles of skin tissue

The skin of hairless mice exposed to ultraviolet rays for 13 weeks was simulated with silicone rubber to measure the degree of wrinkle formation. A disk with a circular hole with a diameter of 1 cm was attached to the back part of the hairless mouse, and the mixture of the reagent for preparing the simulated plate was mixed and thinly spread on the back part of the hairless mouse, completely dried and then carefully peeled off the disk, Respectively. The temperature of the simulated plate was 20 ~ 23 ℃ and the humidity was 45 ~ 50%. The impression material (Epigem, Seoul, Korea) was used for simulating plate. Using the computerized image analyzer (Visioline VL650, CK electronic GmbH, Germany), the total wrinkle area, max wrinkle depth, mean depth and mean And length (mean length).

2-4) Immunohistochemical staining of skin tissue

The dorsal skin tissues of hairless mice were fixed and fixed in 10% formalin, followed by hematoxylin and eosin (H & E) staining. (ECLIPSE E600, Nikon, Japan) and photographed using a digital camera (DXM 1200F, Nickon, Japan).

2-5) RT-PCR analysis

The tissue was pulverized by adding 1 ml of the tripozol solution per 0.1 g of skin tissue, and centrifuged at 12,000 x g for 10 minutes at 4 ° C. The supernatant was transferred to a new tube, and then 200 μl of chloroform was added and vortexed. This process was repeated twice, then the supernatant was transferred to a new tube and isopropanol and supernatant were added at a ratio of 1: 1. After 10 h of shaking, the mixture was allowed to stand at room temperature for 15 minutes, and centrifuged at 12,000 × g for 10 minutes at 4 ° C. The supernatant was removed, 1 ml of 70% ethanol was added to the remaining precipitate, Gt; min. ≪ / RTI > After removing the ethanol, the tube containing the RNA precipitate was dried at room temperature for 15 minutes, and the RNA pellet was dissolved using nucleic acid-free water. The concentrations of RNA samples extracted at 260 nm and 280 nm wavelengths were measured using a UV / VIS spectrophotometer (Beckman coulter, DU730) and agarose gel electrophoresis was performed to confirm the integrity of the RNA samples Respectively.

(GIBCO BRL, Gaithersburg, Md., USA), and cDNA was synthesized by reverse transcription using the dT primer and superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA). PCR was carried out using 5 'and 3' flanking sequences of the gene cDNA to be amplified with the cDNA obtained through reverse transcription as a template as the primers. The primer sequences used in this case were as shown in [Table 4] Same as. 1 μl of the amplified PCR product was electrophoresed on 1% agarose gel to confirm the DNA band.

The primer sequence used for RT-PCR gene primer The base sequence (5 '- > 3') Annealing  Temperature
(° C) PCR
product
(bp) SEQ ID NO: Collagen type Ⅰ alpha 1 (Col1α1) F ggcaacagtcgcttcaccta 55 164 7 R agtccgaattcctggtctgg 8 Collagen type Ⅰ alpha 2 (Col1α2) F cggttctgttggtcctgttg 55 103 9 R acccctgtgccctttatcac 10 Collagen type Ⅲ alpha 1 (Col3α1) F taaccaaggctgcaagatgg 55 104 11 R accagtgcttacgtgggaca 12 Matrix metallopeptidase 1a (MMP-1a) F ccctgtgtttcacaacggag 55 133 13 R cctcagcttttcagccatca 14 Matrix metallopeptidase 1b (MMP-1b) F tttgctcatgcttttctgcc 55 146 15 R gaatgggagagtccaaggga 16 Matrix metallopeptidase 3 (MMP-3) F tgctggtatggagcttctgc 55 142 17 R catctccaacccgaggaact 18 Matrix metallopeptidase 9 (MMP-9) F gtggaccatgaggtgaacca 55 102 19 R actgcacggttgaagcaaag 20 Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) F ggagattgttgccatcaacg 55 122 21 R tgacaagcttcccattctcg 22

2-6) Measurement of body weight and dietary intake of reckless mice

As shown in FIG. 3, ultraviolet irradiation, adipic acid and vitamin C intake did not significantly affect body weight and dietary intake of reared mice (see FIG. 3).

2-7) Measurement of moisture content, elasticity and erythema index of ultraviolet irradiated mouse skin

As shown in FIG. 4, in the + UVB control group irradiated with ultraviolet rays for 13 weeks, the moisture content and elasticity of the skin tissue were decreased significantly compared to the UV group (-UVB), while the moisture evaporation and erythema index (See FIG. 4). In the case of adipic acid-supplemented group (AA), moisture content and elasticity were significantly increased by 88% and 83%, respectively, compared with the + UVB control group, 56% and 28%, respectively. The effect of adipic acid on skin tissue moisture, elasticity and erythema index was similar to that of vitamin C (see FIG. 5).

2-8) Changes in skin wrinkle formation in ultraviolet irradiated mice

To evaluate the effects of adipic acid intake on the degree of skin wrinkle formation, the wrinkle formation inhibitory effect of adipic acid-supplemented group (AA) irradiated with UVB for 13 weeks in hairless mice was compared with the control group (+ UVB) were photographed and compared. As shown in FIG. 6, the + UVB control group was visually observed to have fine wrinkles with a large number of coarse and deep wrinkles, compared with the normal UV group (-UVB), and the adipic acid- , The thickness and depth of the wrinkles were significantly decreased compared to the UVB control group, and it was confirmed that the wrinkles were improved in a similar manner to the skin conditions observed in the UV-unexposed UVB group (see FIG. 5).

As a result of the measurement of the degree of wrinkle formation by using a silicone rubber foil made of the squamous epithelium of the hairless mice subjected to UV irradiation for 13 weeks, the + UVB control group was found to have thicker and deeper wrinkles than the normal UV- , And the adipic acid-supplemented group showed remarkable improvement in the thickness and depth of the wrinkles, such that the deep wrinkles almost disappeared compared with the + UVB control group even though the same UV intensity was irradiated to the adipic acid group (See FIG. 6). The results of numerical analysis of the degree of wrinkle formation in the simulated plate using a computerized image analyzer showed that the total wrinkle area was 38%, the maximum wrinkle depth was 45%, the average wrinkle depth was 18%, and the average wrinkle area was 38% The length was significantly reduced by 37%, and the wrinkle-reducing effect of such adipic acid was similar to the wrinkle-reducing effect observed in vitamin C (see FIG. 7B). Therefore, it can be seen that the ingestion of adipic acid has an effect of remarkably suppressing the generation of wrinkles by ultraviolet irradiation.

2-9) Measurement of change in skin thickness of ultraviolet irradiated mice

As the photoaging due to ultraviolet light progresses, the formation of the stratum corneum increases to increase the thickness of the skin to increase the thickness of the skin to protect the dermal layer of the skin, and the thickening of the skin due to ultraviolet irradiation means that the skin damage due to photoaging is large J Molecular mechanism of skin aging Mech Ageing Dev 123: 801-810, 2002)

As a result of measuring the thickness of the back skin using a digital micro caliper on the last day of the experiment, it was confirmed that the skin thickness of the group supplemented with adipic acid was significantly reduced by 24% (See FIG. 7A). As a result of the H & E staining of skin tissues, skin thickening of skin was observed in + UVB control group compared with normal UV group (-UVB), and + UVB It was confirmed that the thickness of the thickened epidermal layer was significantly reduced as compared with the control group (see Fig. 7B).

2-10) Gene expression of ultraviolet irradiated mouse skin

Collagen types 1 and 3 are proteins that constitute cellular epilepsy components of the dermis, and type 1 collagen is present in the largest amount among extracellular matrix proteins present in skin connective tissue. Meanwhile, 23 types of MMPs catalyzing collagen degradation exist in mammals. MMP types 1, 3 and 9 are known to increase by ultraviolet rays. These three types of MMPs are enzymes that degrade collagen type 1 and 3 . While MMP-1 cleaves the middle of the collagen fibers, MMP-3 and MMP-9 are known to break down the cut collagen fibers.

+ UVB-treated group showed significantly decreased expression of collagen type 1α1 and α2, and collagen type 3α1 in skin tissue compared with normal UV-untreated group (-UVB), and MMP-1a and -1b, MMP-3 and MMP-9 gene expression was significantly increased. In the adipic acid-supplemented group, expression of collagen type 1α1 and α2 and collagen type 3α1 was significantly increased compared to the + UVB control, and expression of MMP-1a and -1b, MMP-3, and MMP-9 gene was significantly (See FIG. 8). Therefore, it is considered that adipic acid increases collagen protein synthesis in subcutaneous tissues and inhibits degradation of collagen fibers, thereby alleviating wrinkle formation caused by ultraviolet irradiation.

Skin wrinkle improvement effect and skin irritation sensory test

3-1) Formulation Examples and Comparative Examples

The composition of the nutritional cream containing adipic acid was prepared as shown in Table 5 below. Here, the unit of the component content is% by weight.

Composition of nutritional cream containing adipic acid number ingredient Example Comparative Example One Cetearyl alcohol 1.5 1.5 2 Glyceryl stearate 1.0 1.0 3 Polysorbate 60 1.2 1.2 4 Sorbitan sesquioleate 0.3 0.3 5 Cetyl octanoate 6.0 6.0 6 Squalane 8.0 8.0 7 Apricode kernel oil 4.0 4.0 8 Dimethicone 1.0 1.0 9 Butylene glycol 5.0 5.0 10 glycerin 4.0 4.0 11 Magnesium aluminum silicate 0.2 0.2 12 Xanthan gum 0.05 0.05 13 antiseptic a very small amount a very small amount 14 Purified water Balance Balance 15 Adipic acid 1.0 -

On the other hand, among the components identified by the respective component numbers in Table 5, the components 1 to 8 are first melted by heating at a temperature of 70 캜, then the components 9 to 13 are dissolved and dispersed in the component 14, . Thereafter, the emulsified product was cooled to a temperature of 56 캜, component 15 dissolved in the separated component 9 was added, stirred, and cooled at room temperature.

The comparative example of the above-mentioned formulation examples was set to be prepared by proceeding in the same manner as the other components except for adipic acid of component 15 and the production method.

3-2) Wrinkle improvement effect and skin irritation sensory test

In order to evaluate the skin wrinkle improving effect and the skin irritation of the cosmetic composition for improving skin wrinkles according to the present invention, a sensory test was performed using the nutritional cream prepared in the above-mentioned Formulation Examples and Comparative Examples.

Specifically, in order to measure the effect of improving the wrinkles of the skin when each of the nutritional creams of the formulating and comparative examples was applied to the skin, the nutritional cream (test group) of the formulation example was applied to 20 women over 20 years old on the left side of the face, On the right side of the face, the nutritional cream (control group) of the comparative example was continuously used for 12 weeks once a day.

In the sensory test, the effect of improving wrinkles on the skin was relatively evaluated based on the nutritional cream of the comparative example, and the sensory evaluation on the skin irritation was caused by the itching, And so on. The evaluation was carried out according to the blotting law standards of excellent (5 points), excellent (4 points), normal (3 points), poor (2 points) and very poor (1 point) Respectively. In Table 6, skin irritation represents the degree of no skin irritation.

Evaluation of skin irritation and wrinkle improvement effect number Skin irritation Wrinkle improvement effect Example Comparative Example Example Comparative Example One 4 5 5 4 2 5 5 5 5 3 5 4 5 3 4 3 4 4 3 5 4 4 5 4 6 5 5 5 5 7 4 4 4 4 8 4 4 4 4 9 5 5 5 4 10 4 4 4 4 11 5 5 5 4 12 5 5 5 5 13 3 4 4 3 14 4 4 4 5 15 5 4 4 5 16 4 4 4 4 17 5 5 5 4 18 5 5 5 3 19 5 5 5 5 20 4 4 4 3 Average 4.40 4.45 4.55 4.05

As shown in Table 6, the skin irritation evaluation score of the cosmetic composition of the formulation example according to the present invention was extremely good evaluated as 4.40, and it was confirmed that skin safety was excellent due to the low degree of skin irritation I could.

In addition, it was found that the effect of improving the wrinkles of the skin of the cosmetic composition of the formulation example was 4.55, which is much better than the comparative example.

INDUSTRIAL APPLICABILITY As described above, the present invention provides a cosmetic composition comprising adipic acid as an active ingredient. The cosmetic composition according to the present invention has no skin side effects and is excellent in improving wrinkles of skin, collagen synthesis effect and collagenase-degrading enzyme, and thus is very useful for improving wrinkles of skin. It is believed that the composition containing adipic acid of the present invention can be utilized as a material for functional cosmetics or health functional foods in the future.

[Production Example 1]

Manufacture of cosmetics

1-1) Manufacture of flexible lotion

A flexible lotion containing adipic acid as an active ingredient was prepared according to a conventional method.

Component Content (% by weight) Adipic acid 0.1, glycerin 3.0, butylene glycol 2.0, propylene glycol 2.0, carboxyvinyl polymer 0.1, ethanol 10.0, triethanolamine 0.1, preservative, trace pigment, trace flavor and trace amount of purified water Total 100.0

1-2) Manufacture of nutritional cream

A nutritional cream containing adipic acid as an active ingredient was prepared according to a conventional method. The component content is expressed as% by weight.

Propylene glycol 3.0, propylene glycol 3.0, propylene glycol 2.5, glycerin 5.0, glycerin 5.0, glycerin 5.0, sorbitan sesquioleate 0.5, liquid paraffin 10.0, squalane 5.0, caprylic / capric triglyceride 5.0, glycerin 5.0, Triethanolamine 0.2, preservative, trace pigment, trace flavor and trace amount of purified water

1-3) Preparation of mask pack composition and mask pack

A composition for a mask pack containing adipic acid as an active ingredient was prepared by a conventional method. The component content is expressed as% by weight.

0.1, cetearate -4 5.0, cholesterol 0.3, dicetylphosphate 0.4, concentrated glycerin 2.0, macadamia oil 10.0, carboxyvinyl polymer 0.4, carboxyvinyl polymer 0.4, polyvinylpyrrolidone 0.1, Gum 0.1, preservative 0.2, perfume 0.15. Purified water 68.05 Total 100.0

The mask pack composition thus prepared was impregnated into a nonwoven fabric (width x length, 10 x 10 cm) to prepare a mask pack product.

[Production Example 2]

Production of pharmaceutical preparations

2-1) Manufacture of powder

2 g of the adipic acid of the present invention

Lactose 1 g

The above components were mixed and packed in airtight bags to prepare powders.

2-2) Preparation of tablets

100 mg of the adipic acid of the present invention

Corn starch 100 mg

100 mg of milk

2 mg of magnesium stearate

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

2-3) Preparation of capsules

100 mg of the adipic acid of the present invention

Corn starch 100 mg

100 mg of milk

2 mg of magnesium stearate

After mixing the above components, the capsules were filled in gelatin capsules according to the conventional preparation method of capsules.

2-4) Preparation of rings

1 g of the adipic acid of the present invention

Lactose 1.5 g

Glycerin 1 g

0.5 g of xylitol

After mixing the above components, they were prepared so as to be 4 g per one ring according to a conventional method.

2-5) Preparation of granules

150 mg of the adipic acid of the present invention

Soybean extract 50 mg

200 mg of glucose

600 mg of starch

After mixing the above components, 100 mg of 30% ethanol was added and the mixture was dried at 60 캜 to form granules, which were then filled in a capsule.

[Production Example 3]

Manufacturing of food products

The functional food composition containing adipic acid was prepared by a conventional liquid preparation method with the same composition as each of the following formulation examples. The final volume is 100 ml for each liquid. This preparation example can be prepared not only as a liquid preparation but also tablets, powders, granules and the like by a usual production method.

Ingredient Amount (wt%) Adipic acid 100 mg, honey 1500 mg, vitamin C 50 mg, vitamin B 6 10 mg, nicotinamide 10 mg, royal jelly 80 mg, preservative, incense,

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> Composition for comprising adipic acid for improving skin wrinkle          or enhancing skin elasticity <130> PB15-12968 <160> 22 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Procollagen forward primer <400> 1 tcttcaagcc atcctgtgtg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Procollagen reverse primer <400> 2 gcgagtctgt gtttttgcag 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Metalloproteinase 1 forward primer <400> 3 atgacatgag tccggagcaa 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Metalloproteinase 1 reverse primer <400> 4 tcatctcctg ggtccctttc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Glyceraldehyde 3-phosphate dehydrogenase forward primer <400> 5 gtgatggcat ggactgtggt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Glyceraldehyde 3-phosphate dehydrogenase reverse primer <400> 6 ggagccaaaa gggtcatcat 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen type 1 alpha 1 forward primer <400> 7 ggcaacagtc gcttcaccta 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen type 1 alpha 1 reverse primer <400> 8 agtccgaatt cctggtctgg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen type 1 alpha 2 forward primer <400> 9 cggttctgtt ggtcctgttg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen type 1 alpha 2 reverse primer <400> 10 acccctgtgc cctttatcac 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen type 3 alpha 1 forward primer <400> 11 taaccaaggc tgcaagatgg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Collagen type 3 alpha 1 reverse primer <400> 12 accagtgctt acgtgggaca 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Matrix metallopeptidase 1a forward primer <400> 13 ccctgtgttt cacaacggag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Matrix metallopeptidase 1a reverse primer <400> 14 cctcagcttt tcagccatca 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Matrix metallopeptidase 1b forward primer <400> 15 tttgctcatg cttttctgcc 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Matrix metallopeptidase 1b reverse primer <400> 16 gaatgggaga gtccaaggga 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Matrix metallopeptidase 3 forward primer <400> 17 tgctggtatg gagcttctgc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Matrix metallopeptidase 3 reverse primer <400> 18 catctccaac ccgaggaact 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Matrix metallopeptidase 9 forward primer <400> 19 gtggaccatg aggtgaacca 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Matrix metallopeptidase 9 reverse primer <400> 20 actgcacggt tgaagcaaag 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Glyceraldehyde 3-phosphate dehydrogenase forward primer <400> 21 ggagattgtt gccatcaacg 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Glyceraldehyde 3-phosphate dehydrogenase reverse primer <400> 22 tgacaagctt cccattctcg 20

Claims (19)

delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete Which has adipic acid as an active ingredient and has at least one effect selected from the group consisting of an increase in procollagen secretion amount, promotion of collagen biosynthesis, reduction of expression of MMP-1 gene, and inhibition of skin skin layer thickening A food composition for improving elasticity.
18. The method of claim 17,
Wherein the food is prepared from any one selected from the group consisting of tablets, granules, powders, capsules, liquid solutions and rings. delete

Images