JP2009051740A - Nfat signal inhibitor and nfat signal inhibition method - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a new nuclear factor of activated T cells (NFAT) signal inhibitor which can inhibit NFAT signal. <P>SOLUTION: This NFAT signal inhibitor comprises at least one selected from the group consisting of at least plant selected from plants listed in plant name columns of the Table, the extract of the plant, and an ingredient contained in the extract, as an active ingredient. The NFAT signal inhibitor of the present invention can be applied to various fields such as external preparations, pharmaceutical compositions, cosmetics and foods. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a NFAT (nuclear factor of activated T cells) signal inhibitor and a method for inhibiting NFAT signal, which comprise a plant, a plant extract or a component contained in a plant extract as an active ingredient.

  Nuclear factor of activated T cells (hereinafter abbreviated as NFAT) was discovered as a factor that activates the transcription of Interleukin-2 (IL-2), which is important for T cell activation, and is an immunosuppressant cyclosporine. It has been reported that the transcriptional activity is regulated by serine / threonine phosphatase calcineurin which is a target of A (hereinafter abbreviated as CsA) and tacrolimus (hereinafter abbreviated as FK506) (FIG. 2). reference). That is, CsA and FK506 suppress T cell activation by inhibiting the NFAT signal. CsA and FK506 are approved not only as transplant immunosuppressants but also as therapeutic agents for rheumatoid arthritis, psoriasis, and atopic dermatitis, which are known to be involved in the immune system. A system in which such NFAT binds to an NFAT binding sequence (“NFAT site” in FIG. 2) to promote transcription of a gene downstream from the NFAT binding sequence is referred to as “NFAT signal”.

  NFAT has been considered as a factor that acts only on the immune system because of its discovery. However, recent studies have not limited to the immune system, but include the formation of muscle tissue by regulating the differentiation of the myocardium and skeletal muscle, and the neural network in the brain. It has been recognized as a "multifunctional transcription factor" that plays an important role in many organs such as formation and bone metabolism by regulating osteoblast differentiation.

  The role of the NFAT signal in the living body is as described above. By inhibiting the NFAT signal, immunosuppressive action (Non-patent document 1), psoriasis treatment (Non-patent document 2), atopic dermatitis treatment (Non-patent document) Reference 3), (heart) muscle hypertrophy suppression (Non-patent document 4), possibility as an anti-rheumatic drug (Non-patent document 5), hair growth action (Non-patent document 6) and osteoclast differentiation inhibitory action (non-patent document) Reference 7) is reported to be expected. In addition, as described above, since NFAT is mediated by a pathway that produces the immune cytokine IL-2, NFAT signal inhibitors are used to treat diseases that are thought to involve immune cytokines including autoimmune diseases. Useful for prevention. Examples of such diseases include various cancers, various leukemias, various hepatitis, various infections, systemic lupus erythematosus, inflammatory bowel diseases (ulcerative colitis, Crohn's disease), multiple sclerosis, insulin-dependent diabetes mellitus, digestion Ulcer, septic shock, tuberculosis, infertility, arteriosclerosis, Behcet's disease, asthma, nephritis, acute bacterial meningitis, acute myocardial infarction, acute pancreatitis, acute viral encephalitis, adult respiratory distress syndrome, bacterial pneumonia, chronic pancreatitis, peripheral Examples include vascular disease, sepsis, interstitial liver disease, localized ileitis, and multiple sclerosis. Therefore, if a new NFAT signal inhibitor is identified, an immunosuppressive agent, a psoriasis therapeutic agent, an atopic dermatitis therapeutic agent, a (cardiac) muscle hypertrophy inhibitor, an anti-rheumatic agent, a bone metabolic disease therapeutic agent, and the above New medical uses such as those listed are expected. In addition, if a NFAT signal inhibitor is newly identified, quasi-drugs and cosmetics as hair growth promoters are expected.

Lee M and Park J, "Regulation of NFAT activation: a potential therapeutic target for immunosuppression" Mol Cells, 22: 1-7, 2006 Feldman S, "Advances in psoriasis treatment" Dermatol Online J, 6: 4, 2000 Hultsch T, "Immunomodulation and safety of topical calcineurin inhibitors for the treatment of atopic dermatitis" Dermatology, 211: 2, 2005 Molkentin JD, Lu JR, Antos CL, Markham B, Richardson J, Robbins J, Grant SR, and Olson EN, "A calcineurin-dependent transcriptional pathway for cardiac hypertrophy" Cell, 93: 215-228, 1998 Urushibara M, Takayanagi H, Koga T, Kim S, Isobe M, Morishita Y, Nakagawa T, Loeffler M, Kodama T, Kurosawa H, and Taniguchi T, "Antirheumatic drug, leflunomide, inhibits osteoclastgenesis by interfering with RANKL-stimulated induction of NFATc1 "Arthritis and Rheumatism, 50: 794-804, 2004 Gafter-Gvili A, Sredni B, Gal R, Gafter U, and Kalechman Y, "Cyclosporin A-induced hair growth in mice is associated with inhibition of calcineurin-dependent activation of NFAT in follicular keratinocytes" Am J Physiol Cell Physiol, 284: C1593-C603, 2003 Takayanagi H, Kim S, Koga T, Nishina H, Isshiki M, Yoshida H, Saiura A, Isobe M, Yokochi T, Inoue J, Wagner EF, Mak TW, Kodama T, and Taniguchi T, "Induction and activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in termial differentiation of osteoclasts "Developmental Cell, 3: 889-901, 2002

  Therefore, the present invention aims to provide a novel NFAT signal inhibitor and a NFAT signal inhibition method using the novel NFAT signal inhibitor, which can be used for external preparations, pharmaceutical compositions, cosmetics, foods and the like. To do.

  As a result of intensive studies to solve the above problems, the inventors of the present invention newly constructed a system for evaluating the action on NFAT signal transduction, and comprehensively exhibits NFAT signal inhibitory action on various plants using the system. As a result of analysis, the present inventors have succeeded in identifying a plant having an NFAT signal inhibitory action and completed the present invention.

  That is, the NFAT signal inhibitor according to the present invention is contained in at least one plant selected from the plant species listed in the plant name (Japanese name) column of Table 1 below, the plant extract and the extract. The active ingredient is at least one selected from the group consisting of the above ingredients.

  In particular, the NFAT signal inhibitor according to the present invention preferably contains, as the extract, an alcohol extract of the site described in the column of the extraction site in Table 1. The NFAT signal inhibitor according to the present invention preferably contains an extract obtained by extracting the site described in the column of extraction site in Table 1 with the solvent described in the column of extraction solvent in Table 1. .

  By contacting the above-described NFAT signal inhibitor with a target cell or tissue, the NFAT signal in the cell or tissue can be inhibited.

  The NFAT signal inhibitor according to the present invention can suppress transcription that is positively controlled by NFAT. Therefore, the NFAT signal inhibitor according to the present invention is useful as a candidate substance such as an immunosuppressive agent, a therapeutic agent for psoriasis, a therapeutic agent for atopic dermatitis, a (cardiac) muscle hypertrophy inhibitor and an antirheumatic drug. The NFAT signal inhibitor according to the present invention can be safely used because it contains a natural substance as an active ingredient.

Hereinafter, the present invention will be described in detail.
The NFAT signal inhibitor according to the present invention includes at least one plant selected from the plant species listed in the plant name (Japanese name) column of Table 2 below, an extract of the plant, and a component contained in the extract The active ingredient is at least one selected from the group consisting of

  In Table 2, in addition to the plant name (Japanese name) (including scientific name and classification), the extraction site and the extraction solvent, the NFAT signal inhibition rate measured by the method described later is described. In short, the NFAT signal inhibition rate means the rate of decrease in transcriptional activity when the extract is allowed to act on the transcriptional activity due to NFAT when the extract is not acted upon.

  Here, NFAT signal inhibition means reducing the transcription promoting activity by NFAT by acting directly or indirectly on NFAT. The method for measuring the NFAT signal inhibitory action is not particularly limited, and examples thereof include a reporter assay using a host in which a known NFAT binding sequence and a plasmid having a reporter gene downstream of the NFAT binding sequence are introduced (FIG. 1). reference). Since the activity of NFAT depends on calcium ions, the reporter assay is performed under conditions where calcium ions are allowed to flow into the host. The reporter gene is not particularly limited, and any reporter gene conventionally used in the field of biochemical experiments can be used. For example, examples of the reporter gene include a luciferase gene, a β-glucuronidase gene (GUS gene), and a green fluorescent protein gene (GFP gene).

  Examples of the NFAT-binding sequence include an oligonucleotide consisting of a sequence to which NFAT binds, for example, a base sequence such as GGAGGAAAAACTGTTTCATACAGAAGGCGT (pNFAT-Luc, Stratagene: SEQ ID NO: 1). In the above-described plasmid, a plurality of sets of such NFAT binding sequences may be linked and introduced. By linking and using a plurality of NFAT binding sequences, the transcription promoting activity by NFAT can be measured with higher sensitivity.

  In addition, the NFAT signal inhibition rate shown in Table 2 is a value calculated from a reporter assay using the above-described luciferase gene.

  In particular, the NFAT signal inhibitor according to the present invention can include whole plants, leaves, bark, branches, fruits, roots, and the like in each plant shown in Table 2 above. Or it is preferable that the NFAT signal inhibitor based on this invention contains what grind | pulverized and used the whole plant, the leaf, the bark, the branch, the fruit, or the root of the said plant.

  Moreover, it is preferable to use the site | part described in the column of the extraction site | part in each plant shown in said Table 2 for the NFAT signal inhibitor which concerns on this invention. When a plant extract is used as an active ingredient as the NFAT signal inhibitor according to the present invention, the plant extract is extracted at room temperature or under heating, or extracted using an extractor such as a Soxhlet extractor. Is obtained. In the present invention, the plant extract means various solvent extracts obtained by the above extraction method, diluted solutions thereof, concentrated solutions thereof or dried powders thereof.

  As an extraction solvent used for obtaining a plant extract, either a polar solvent or a nonpolar solvent can be used. Examples of the extraction solvent include water; alcohols such as methanol, ethanol, propanol and butanol; polyhydric alcohols such as propylene glycol and butylene glycol; ketones such as acetone and methyl ethyl ketone; esters such as methyl acetate and ethyl acetate; Chain and cyclic ethers such as tetrahydrofuran and diethyl ether; Polyethers such as polyethylene glycol; Hydrocarbons such as squalane, hexane, cyclohexane and petroleum ether; Aromatic hydrocarbons such as toluene; Dichloromethane, chloroform, dichloroethane, etc. And halogenated hydrocarbons; and carbon dioxide. Alternatively, a mixture obtained by combining two or more of the above solvents can be used as the extraction solvent.

  When a plant extract is used as the active ingredient as the NFAT signal inhibitor according to the present invention, the extraction solvent is preferably an aqueous alcohol, and the solvent described in the column of the extraction solvent in Table 2 is particularly preferably used. As the NFAT signal inhibitor according to the present invention, the above plant extract can be used as it is, but the extract can be used after being diluted, concentrated or lyophilized and then prepared into a powder or paste. . In addition, an extract obtained by removing the inert impurities from the extract by subjecting the extract of the plant or the like to a separation technique such as chromatographic liquid-liquid distribution can also be used. In the NFAT signal inhibitor according to the present invention, among the plurality of plants shown in Table 2, one kind of plant or a plant extract thereof may be used as an active ingredient. It is good also as an active ingredient by mixing a thing.

  Since the NFAT signal inhibitor according to the present invention reduces the transcription promoting activity by NFAT, it can inhibit NFAT signal in cells and tissues. Specifically, the NFAT signal in the cell or tissue can be inhibited by bringing the NFAT signal inhibitor according to the present invention described above into contact with the cell or tissue as a target. Thereby, in the cells and tissues, various gene expressions caused by NFAT signals can be suppressed at the transcription level.

  Since the NFAT signal inhibitor according to the present invention reduces the transcription promoting activity by NFAT, it can be used as a therapeutic or preventive agent for symptoms and diseases caused by the enhanced transcription promoting activity by NFAT. Symptoms and diseases resulting from the enhanced transcription promoting activity by NFAT include immune system diseases, psoriasis, atopic dermatitis, myopathy including myocardium, rheumatism, bone metabolic diseases, various cancers, various leukemias, various hepatitis, Various infections, systemic lupus erythematosus, inflammatory bowel disease (ulcerative colitis, Crohn's disease), multiple sclerosis, insulin-dependent diabetes, peptic ulcer, septic shock, tuberculosis, infertility, arteriosclerosis, Behcet's disease, Asthma, nephritis, acute bacterial meningitis, acute myocardial infarction, acute pancreatitis, acute viral encephalitis, adult respiratory distress syndrome, bacterial pneumonia, chronic pancreatitis, peripheral vascular disease, sepsis, interstitial liver disease, localized ileitis, Examples include multiple sclerosis. Therefore, the NFAT signal inhibitor according to the present invention can be used as an immunosuppressant, a psoriasis therapeutic agent, a (cardiac) muscle hypertrophy inhibitor, an anti-rheumatic drug, a bone metabolic disease therapeutic agent, and the like.

  When the NFAT signal inhibitor according to the present invention is used for pharmaceutical purposes, the dosage form is not particularly limited, but for example, solid preparations such as powders, granules, capsules, pills, tablets, liquids, suspensions, Examples thereof include liquid agents such as emulsions. When using the NFAT signal inhibitor according to the present invention as a pharmaceutical composition for oral administration, in addition to the NFAT signal inhibitor, excipients, disintegrating agents, binders generally used according to the form of the oral administration agent, Lubricants, surfactants, alcohols, water, water-soluble polymers, sweeteners, flavoring agents, acidulants, and the like can be added and produced according to conventional methods. Examples of the pharmaceutical composition for oral administration include an immunosuppressant, a psoriasis therapeutic agent, a (heart) muscle hypertrophy inhibitor and an anti-rheumatic drug.

  In addition, when the NFAT signal inhibitor according to the present invention is used as a skin drug or quasi-drug, the dosage form is not particularly limited, but for example, ointments, liquids, extracts, Lotion agents and emulsions can be mentioned. In addition to the plant extract, the pharmaceutical or quasi-drug is optionally combined with pharmaceutically acceptable carriers such as auxiliaries, stabilizers, wetting agents, emulsifiers, absorption enhancers and surfactants. Can be blended. Examples of the pharmaceutical composition for skin include a therapeutic agent for atopic dermatitis.

  On the other hand, when the NFAT signal inhibitor according to the present invention is used as a cosmetic, the dosage form is not particularly limited. For example, a water-in-oil or oil-in-water emulsified cosmetic, cream, Examples include lotions, gels, foams, essences, foundations, packs, sticks and powders. In addition to plant extracts, the cosmetics include oils, surfactants, ultraviolet absorbers, alcohols, chelating agents, pH adjusters, preservatives, thickeners, which are commonly used as cosmetic ingredients. Pigments, fragrances, various skin nutrients, and the like can be combined in any combination. Specifically, the external preparation for skin according to the present invention has medicinal ingredients blended in skin cosmetics, for example, ultraviolet absorbers such as fine particle zinc oxide, titanium oxide, persol MCX, persol 1789, vitamins such as ascorbic acid, Moisturizers such as sodium hyaluronate, petrolatum, glycerin and urea, hormones, and other whitening ingredients such as kojic acid, arbutin, placenta extract, lucinol, steroids, arachidonic acid metabolites, and histamine Substance production / release inhibitors (indomethacin, ibuprofen), anti-inflammatory agents such as receptor antagonists, anti-androgen agents, vitamin A acid, royal jelly extract, sebum secretion inhibitors such as royal jelly acid, tocopherol nicotinate, alprostadil, Peripheral blood vessels such as isoxsuprine hydrochloride and trazoline hydrochloride Tonic agents and carbon dioxide with peripheral vasodilatory action, minoxidil, carpronium chloride, red pepper tincture, vitamin E derivatives, ginkgo biloba extract, assembly extract and other blood circulation promoters, cell activating agents such as pentadecanoic acid glyceride and nicotinic acid amide, Bactericides such as hinokitiol, L-menthol and isopropylmethylphenol, drugs such as glycyrrhizic acid and its derivatives or salts, ceramide and ceramide-like compounds can be added and blended.

When the NFAT signal inhibitor according to the present invention is used as a medicine, quasi-drug or cosmetic, the amount of plant extract is usually calculated as a dry product, and is usually a drug, quasi-drug or cosmetic. The total composition is preferably 0.00001 to 5% by weight, more preferably 0.0001 to 0.1% by weight. Moreover, when using the NFAT signal inhibitor which concerns on this invention as a pharmaceutical, it is desirable that the application quantity of a plant extract shall be 0.01 mg-1 g / day as a solid content remainder in a normal adult. The external preparation for skin according to the present invention varies depending on the content of the active ingredient. For example, in the case of cream or ointment, 1 to ²⁰ mg per 1 cm ² of the skin surface, and in the case of liquid preparation, 1 to ²⁰ mg is also used. Is preferred.

  When the NFAT signal inhibitor according to the present invention is used as a cosmetic, pharmaceutical or quasi-drug, for example, powder such as chalk, talc, fuller's earth, kaolin, starch, rubber, colloidal silica sodium polyacrylate; Oils or oily substances such as vegetable oils, silicone oils; emulsifiers such as sorbitan trioleate, sorbitan tristearate, glycerol monooleate, polymeric silicone surfactants; preservatives such as para-hydroxybenzoate esters; butylhydroxytoluene Antioxidants such as glycerol, sorbitol, 2-pyrrolidone-5-carboxylate, dibutyl phthalate, gelatin, polyethylene glycol and other wetting agents; buffers such as lactic acid with a base such as triethanolamine or sodium hydroxide; Guri Surfactants such as serine fatty acid esters, sorbitan fatty acid esters, sucrose fatty acid esters, alkyl glucosides; waxes such as beeswax, ozokerite wax, paraffin wax; thickeners; activity enhancers; coloring agents; Can be used in appropriate combinations as needed.

  Hereinafter, the present invention will be described more specifically with reference to examples. However, the technical scope of the present invention is not limited to these examples.

[Example 1] Production of plant extract In this example, as shown below, 60 types of extracts were produced from 58 types of plants.
(1) Manufacture of extract of Hichamodoki 10 g of Himetsumodoki root (Nepal) was taken, 100 mL of 95% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 89 mL of extract. The extract was concentrated with an evaporator, and ethanol was added to dissolve in 30 mL. The evaporation residue was 0.6 w / v%.
(2) Manufacture of Monkey Jack Extract 10 g of Monkey Jack bark (Nepal) was taken, 100 mL of 95% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 94 mL of an extract. The evaporation residue was 2.0 w / v%.

(3) Manufacture of Quyrantes arbomarginata extract 10 g of whole plant of Querantes arbomarginata (Nepal) was added, 100 mL of 95% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 82 mL of extract. . The evaporation residue was 0.6 w / v%.
(4) Manufacture of Kawara Mugwort Extract 10 g of Kawara Mugwort flower (origin of origin) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 72 mL of an extract. The evaporation residue was 1.8 w / v%.

(5) Production of licorice extract 10 g of licorice root (origin of origin) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 78 mL of an extract. The evaporation residue was 3.1 w / v%.
(6) Production of hop extract 10 g of hop flower (origin of origin) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 47 mL of an extract. The evaporation residue was 2.8 w / v%.
(7) Manufacture of turmeric extract 10 g of turmeric roots (origin of origin) were taken, 100 mL of 50% ethanol was added, and the mixture was left standing at room temperature for 7 days, followed by filtration to obtain 87 mL of an extract. The evaporation residue was 0.9 w / v%.

(8) Production of mulberry extract 1
10 g of mulberry root (origin of origin) was taken, 100 mL of 50% ethanol was added, and the mixture was left standing at room temperature for 7 days, followed by filtration to obtain 79 mL of an extract. The evaporation residue was 1.4 w / v%.
(9) Mulberry extract production 2
10 g of mulberry leaves (origin of unknown origin) were taken, 100 mL of 50% ethanol was added, and the mixture was extracted by standing at room temperature for 7 days, followed by filtration to obtain 77 mL of an extract. The evaporation residue was 2.1 w / v%.

(10) Production of birch extract 10 g of birch bark (made in China) was added, 100 mL of 50% ethanol was added, and the mixture was allowed to stand at room temperature for 7 days, followed by filtration to obtain 80 mL of an extract. The evaporation residue was 1.5 w / v%.
(11) Manufacture of burdock extract 10g of burdock seed (made in China) was added, 100mL of 50% ethanol was added, and after standing extraction at room temperature for 7 days, filtration was performed to obtain 72mL of extract. The evaporation residue was 1.7 w / v%.

(12) Manufacture of peanut extract 10 g of peanut rhizome (made in China) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 78 mL of extract. The evaporation residue was 2.1 w / v%.
(13) Production of Daio Extract 10 g of Daio rhizome (made in China) was taken, 100 mL of 50% ethanol was added, and after standing extraction at room temperature for 7 days, filtration was performed to obtain 77 mL of an extract. The evaporation residue was 5.5 w / v%.

(14) Production of forsythia extract 10 g of forsythia fruit (made in China) was added, 100 mL of 50% ethanol was added, and after standing extraction at room temperature for 7 days, filtration was performed to obtain 81 mL of extract. The evaporation residue was 1.4 w / v%.
(15) Manufacture of Kokuboku Extract 10 g of Kokuboku bark (made in China) was added, 100 mL of 50% ethanol was added, and after standing extraction at room temperature for 7 days, filtration was performed to obtain 82 mL of the extract. The evaporation residue was 1.2 w / v%.

(16) Manufacture of Toshikimi extract 10 g of Toshikimi fruit (made in China) was taken, 100 mL of 50% ethanol was added, and after standing extraction at room temperature for 7 days, filtration was performed to obtain 80 mL of the extract. The evaporation residue was 2.2 w / v%.
(17) Production of Ammacro extract 10 g of Ammacro fruit (made in China) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 87 mL of the extract. The evaporation residue was 3.3 w / v%.

(18) Production of Itachigaya Extract 10 g of Itachigaya whole plant (made in China) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 80 mL of an extract. The evaporation residue was 2.5 w / v%.
(19) Production of nutmeg extract 10 g of nutmeg seed (made in China) was added, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 89 mL of extract. The evaporation residue was 0.6 w / v%.

(20) Manufacture of extract of spinach 10 g of spinach flower (made in China) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 77 mL of extract. The evaporation residue was 2.2 w / v%.
(21) Production of myrrh extract 10 g of myrra resin (made in China) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 85 mL of extract. The evaporation residue was 1.3 w / v%.

(22) Manufacture of goat squid extract 10 g of goat squid flowers (made in China) were added, 100 mL of 50% ethanol was added, and after standing extraction at room temperature for 7 days, filtration was performed to obtain 65 mL of extract. The evaporation residue was 2.9 w / v%.
(23) Manufacture of Senshinren Extract 10 g of Sensenren whole plant (made in China) was taken, 100 mL of 50% ethanol was added, and after standing extraction at room temperature for 7 days, filtration was performed to obtain 71 mL of extract. The evaporation residue was 0.9 w / v%.

(24) Manufacture of Seika Ryu extract 10 g of Seika Ryu shoot (from China) was added, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 74 mL of an extract. The evaporation residue was 1.9 w / v%.
(25) Manufacture of a shouma extract 10 g of shouma rhizome (made in China) was taken, 100 mL of 50% ethanol was added, and after standing extraction at room temperature for 7 days, it filtered and 80 mL of extract was obtained. The evaporation residue was 2.7 w / v%.

(26) Production of Himeuzu extract 10 g of Himezu tuber (made in China) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 81 mL of extract. The evaporation residue was 4.6 w / v%.
(27) Manufacture of bald pea extract 10 g of bald pea root (from China) was added, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 77 mL of extract. The evaporation residue was 1.8 w / v%.

(28) Manufacture of honey beetle extract 10 g of honey beetle fruit (made in China) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 79 mL of extract. The evaporation residue was 0.6 w / v%.
(29) Manufacture of Kyokatsu Extract 10 g of Kyokatsu Rhizome (from China) was added, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 74 mL of an extract. The evaporation residue was 2.4 w / v%.

(30) Manufacture of Zenko extract 10 g of Zenko root (made in China) was added, 100 mL of 50% ethanol was added, and the mixture was left standing at room temperature for 7 days, followed by filtration to obtain 77 mL of an extract. The evaporation residue was 1.4 w / v%.
(31) Production of Ezomura Azalea Azalea Extract 10 g of Ezomura azalea leaves (from China) was taken, 100 mL of 50% ethanol was added, and the mixture was allowed to stand at room temperature for 7 days, followed by filtration to obtain 71 mL of extract. The evaporation residue was 2.4 w / v%.

(32) Manufacture of diatomaceous earth extract 10 g of whole diatomaceous earth (produced in China) was added, 100 mL of 50% ethanol was added, and the mixture was left standing at room temperature for 7 days, followed by filtration to obtain 61 mL of an extract. The evaporation residue was 2.4 w / v%.
(33) Manufacture of Taiwan Komatsu Eggle Extract Take 10 g of dried pigment (Chinese product) in the leaf of Taiwan Komatsu, add 100 mL of 50% ethanol, leave at room temperature for 7 days, and filter to obtain 87 mL of extract. It was. The extract was concentrated with an evaporator, and ethanol was added to dissolve in 11 mL. The evaporation residue was 0.7 w / v%.

(34) Manufacture of Chestnut trash extract 10 g of Chestnut berries (Chinese) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 79 mL of extract. The evaporation residue was 3.4 w / v%.
(35) Manufacture of Shiny extract 10 g of Shinyi flower bud (Chinese product) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 77 mL of an extract. The evaporation residue was 1.4 w / v%.

(36) Manufacture of extract of Bergenia pulprascens 10g of whole plant of Bergenia pulprascens (Chinese), add 100mL of 50% ethanol, extract at rest at room temperature for 7 days, filter and extract 74 mL was obtained. The evaporation residue was 1.3 w / v%.
(37) Production of ginseng extract 10 g of ginseng root (produced in China) was added, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 73 mL of an extract. The evaporation residue was 1.5 w / v%.

(38) Manufacture of akebi extract 10 g of akebi stem (made in China) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 70 mL of extract. The evaporation residue was 1.4 w / v%.
(39) Production of Locon Extract 10 g of Locon stem (made in China) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 71 mL of extract. The evaporation residue was 1.5 w / v%.

(40) Production of Oguruma Extract 10 g of Oguruma cedar flowers (from China) were added, 100 mL of 50% ethanol was added, and the mixture was allowed to stand at room temperature for 7 days, followed by filtration to obtain 62 mL of an extract. The evaporation residue was 1.6 w / v%.
(41) Manufacture of Himalayan Beetle Extract 10 g of Himalayan beetle stalk (produced in China) was added, 100 mL of 50% ethanol was added, and the mixture was allowed to stand at room temperature for 7 days, followed by filtration to obtain 32 mL of extract. The extract was concentrated using an evaporator, and ethanol was added to dissolve the extract in 4 mL. The evaporation residue was 0.6 w / v%.

(42) Manufacture of oyster extract 10 g of oyster root (made in China) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 83 mL of an extract. The evaporation residue was 0.7 w / v%.
(43) Manufacture of pepper extract 1
10 g of pepper fruit (from China) was taken, 100 mL of 50% ethanol was added, and the mixture was allowed to stand at room temperature for 7 days, followed by filtration to obtain 84 mL of an extract. The evaporation residue was 0.6 w / v%.

(44) Manufacture of pepper extract 2
10 g of immature fruit spikelets (produced in China) were taken, 100 mL of 50% ethanol was added, and the mixture was allowed to stand at room temperature for 7 days, followed by filtration to obtain 88 mL of the extract. The evaporation residue was 0.9 w / v%.
(45) Manufacture of Kouhon Extract 10 g of Kouhon rhizome (made in China) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 80 mL of the extract. The evaporation residue was 2.1 w / v%.

(46) Production of duinin extract 10 g of duinin fruit (from China) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 87 mL of an extract. The extract was concentrated with an evaporator, and ethanol was added to dissolve in 29 mL. The evaporation residue was 0.7 w / v%.
(47) Manufacture of Ikari Grass Extract 10 g of Ikari grass leaves (made in China) was taken, 100 mL of 50% ethanol was added, and the mixture was left to stand at room temperature for 7 days, followed by filtration to obtain 66 mL of extract. The evaporation residue was 1.4 w / v%.

(48) Manufacture of extract of juniper cucumber 10 g of juniper root (manufactured in China) was taken, 100 mL of 50% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 84 mL of extract. The evaporation residue was 2.3 w / v%.
(49) Manufacture of American Salamander Extract 10 g of American salmon bark (produced in the United States) was taken, 100 mL of 95% ethanol was added, and after standing at room temperature for 7 days, filtration was performed to obtain 80 mL of the extract. The evaporation residue was 0.8 w / v%.

(50) Manufacture of Sebahienso extract 9 g of Sebahienso whole plant (Chinese) was taken, 100 mL of 50% ethanol was added, extracted at 85 ° C for 3 hours, filtered, and the filtrate was concentrated and extracted. 1.6 g of product was obtained. The evaporation residue was 1.0 w / v%.
(51) Manufacture of Troloaoi extract 6.7 g of Troloaia root (made in China) was taken, 100 mL of 50% ethanol was added, extracted at 85 ° C. for 3 hours, filtered, and the filtrate was concentrated to extract 1. 2 g was obtained. The evaporation residue was 1.0 w / v%.

(52) Manufacture of Nardostachys chinensis extract 9 g of Naldstax chinensis corms (China), add 100 mL of 50% ethanol, extract at 85 ° C for 3 hours, filter, concentrate the filtrate and extract 0.8 g was obtained. The evaporation residue was 1.0 w / v%.
(53) Manufacture of extract of lupus tefrodes Take 6.7g of lupus tefrodes leaves (from China), add 100mL of 50% ethanol, extract at 85 ° C for 3 hours, filter and concentrate the filtrate. 0.8 g of extract was obtained. The evaporation residue was 1.0 w / v%.

(54) Manufacture of physalis extract 6.7 g of physalis whole plant (Chinese) was added, 100 mL of 50% ethanol was added, extracted at 85 ° C. for 3 hours, filtered, and the filtrate was concentrated to extract 0 0.8 g was obtained. Evaporation residue 1.0 w / v%.
(55) Manufacture of coconut tree extract 6.7 g of coconut tree flower (made in China) was taken, 100 mL of 50% ethanol was added, extracted at 85 ° C. for 3 hours, filtered, and the filtrate was concentrated to extract 1. 3 g was obtained. The evaporation residue was 1.0 w / v%.

(56) Manufacture of Hangesho extract 6.7 g of Hangesho whole plant (Chinese) was taken, 100 mL of 50% ethanol was added, extracted at 85 ° C. for 3 hours, filtered, and the filtrate was concentrated and extracted. 1.2 g of product was obtained. The evaporation residue was 1.0 w / v%.
(57) Manufacture of tsukunukitogiri extract 6.7g of tsukinukitogiri whole plant (China) was taken, 100mL of 50% ethanol was added, extracted at 85 ° C for 3 hours, filtered, and the filtrate was concentrated. As a result, 1 g of an extract was obtained. The evaporation residue was 1.0 w / v%.

(58) Manufacture of the extract of Salvia and Pruzebarskii Take 5 g of Salvia and Pruzebarskii root (from China), add 100 mL of 50% ethanol, extract at 85 ° C for 3 hours, filter, and filtrate Was concentrated to obtain 0.5 g of an extract. The evaporation residue was 1.0 w / v%.
(59) Manufacture of Himekouzo extract Extract 5 g of Himekozo branch (from China), add 100 mL of 50% ethanol, extract at 85 ° C. for 3 hours, filter, concentrate the filtrate to obtain 0.5 g of extract. Obtained. The evaporation residue was 1.0 w / v%.

(60) Manufacture of Fusu Extract 6.7 g of Fu fruit (Chinese) was taken, 100 mL of 50% ethanol was added, extracted at 85 ° C. for 3 hours, filtered, and the filtrate was concentrated to extract 0. 6 g was obtained. The evaporation residue was 1.0 w / v%.

  As described above, in Example 1, 60 types of plant extracts were prepared as shown in (1) to (60).

[Example 2] NFAT signal inhibitory effect In this example, an evaluation system for verifying the NFAT signal inhibitory effect was constructed, and the NFAT signals for 60 plant extracts produced in Example 1 using the evaluation system. The inhibitory effect was verified.

(1) Materials and methods for evaluation systems
Cell culture In the above evaluation system, human kidney (HEK293) cells were purchased from ATCC (American Type Culture Collection) and used. HEK293 cells were cultured in DMEM (High glucose, 10% heat-inactivated FBS) at 37 ° C. and 5% CO ₂ .

Plasmid, Transfection In the above evaluation system, HEK293 cells transfected with plasmid pNFAT-Luc (Stratagene) having firefly luciferase introduced downstream of the NFAT binding sequence was used. Specifically, pNFAT-luc (STRATAGENE) in which a firefly luciferase gene was introduced downstream of a quadruple NFAT binding sequence was transfected into HEK293 cells for evaluation of NFAT transcriptional activity. In order to eliminate variation due to transfection efficiency, pRL-CMV (Promega) into which Renilla luciferase was introduced downstream of the CMV promoter was simultaneously transfected in order to correct the signal derived from firefly luciferase.

  Transfection was performed using LipofectAMINE 2000 reagent (Invitrogen) according to the instruction manual. The medium was changed 8 hours after transfection and incubated overnight. Thereafter, the plant extract produced in Example 1 was added (0.5 vol%), and 1 μM Ionomycin was added 1 hour later. After 8 hours, a luciferase reporter assay was performed. Ionomycin is an ionophore specific to calcium ions and is known as a drug that allows calcium ions to flow into cells. The addition of Ionomycin activates calcineurin, a calcium ion-dependent phosphatase, and the transcriptional activity of NFAT increases accordingly, indicating that this system is suitable for searching for NFAT signal activation inhibitors. Conceivable.

Luciferase reporter assay The luciferase reporter assay was performed using Dual-Glo Luciferase Assay System (Promega) according to the instruction manual. That is, after removing the medium, Dual-Glo luciferase reagent diluted 2-fold with PBS was added, stirred, and firefly luciferase activity was measured 20 minutes later. Thereafter, an equal amount of Dual-Glo Stop & Glo reagent was added and stirred, and then Renilla luciferase activity was measured. The luciferase activity was measured using MiniLumat LB 9506 (EG & G BERTHOLD), and the amount of luminescence by luciferase was quantitatively detected. In both cases, the measurement time for luciferase activity was 2 seconds.

Calculation of NFAT signal inhibition rate All NFAT transcriptional activity (firefly luciferase activity) was corrected by dividing by the Renilla luciferase activity introduced for transfection efficiency correction. Thereafter, the NFAT signal inhibition rate was calculated by the following formula.
NFAT signal inhibition rate (%) = 100− (test sample and Ionomycin added group−unstimulated group) / (Ionomycin only added group−unstimulated group) × 100
Based on the above calculation, it is possible to calculate how much the test sample inhibited NFAT signal activation by Ionomycin stimulation.

Results Table 3 shows the inhibition rates of NFAT signals by the 60 plant extracts produced in Example 1.

表３から判るように、実施例１で製造した６０種類の植物抽出物の全てにおいて、NFATシグナルを阻害することが明らかとなった。すなわち、実施例１で製造した６０種類の植物抽出物は、全てNFATにより正に制御される転写を抑制することができる。したがって、実施例１で製造した６０種類の植物抽出物は、全て優れたNFATシグナル阻害剤であり、例えば免疫抑制剤、乾癬治療剤、アトピー性皮膚炎治療剤、（心）筋肥大抑制剤及び抗リウマチ薬等の候補物質として同定されたこととなる。

As can be seen from Table 3, all of the 60 plant extracts produced in Example 1 were found to inhibit the NFAT signal. That is, all of the 60 plant extracts produced in Example 1 can suppress transcription that is positively controlled by NFAT. Therefore, the 60 plant extracts produced in Example 1 are all excellent NFAT signal inhibitors, such as immunosuppressants, psoriasis treatment agents, atopic dermatitis treatment agents, (heart) muscle hypertrophy inhibitors, and It was identified as a candidate substance such as an anti-rheumatic drug.

  In particular, from Table 3, 50% ethanol extract of mulberry root produced in Example 1 (8), 50% ethanol extract of rhubarb rhizome produced in Example 1 (13), Example 1 (21 50% ethanol extract of myrrh resin prepared in Example 1), 50% ethanol extract of goat squid flower prepared in Example 1 (22), 50% ethanol extract of rhizome of Kyoukatsu manufactured in Example 1 (29) Example 1 (30) 50% ethanol extract of radish root, 50% ethanol extract of pepper immature fruit prepared in Example 1 (44), Naldstakis chinensis prepared in Example 1 (52) Inhibition of NFAT signal was observed when a 50% ethanol extract of corm of corn and a 50% ethanol extract of Salvia pruzebalskiy root prepared in Example 1 (60) were used. It can be seen that it exceeds 70%. Therefore, the 50% ethanol extract of mulberry root produced in Example 1 (8), the 50% ethanol extract of radish rhizome produced in Example 1 (13), and produced in Example 1 (21) 50% ethanol extract of myrrh resin, 50% ethanol extract of goat squid flower produced in Example 1 (22), 50% ethanol extract of Kyokatsu rhizome produced in Example 1 (29), Example 1 (30) 50% ethanol extract of Zenko root, 50% ethanol extract of pepper immature fruit spikes prepared in Example 1 (44), 50 of Naldstachys chinensis corm 50 prepared in Example 1 (52) % Ethanol extract and 50% ethanol extract of Salvia pruzebarskii root prepared in Example 1 (60) have a better NFAT signal inhibitory action Could be identified as an NFAT signal inhibitor.

  Among them, a 50% ethanol extract of mulberry root produced in Example 1 (8), a 50% ethanol extract of goat squid flower produced in Example 1 (22), and produced in Example 1 (60) It can be seen that the inhibition rate of NFAT signal exceeds 80% when 50% ethanol extract of Salvia pruzebalskii root is used. Therefore, the 50% ethanol extract of mulberry root produced in Example 1 (8), the 50% ethanol extract of goat squid flower produced in Example 1 (22), and produced in Example 1 (60) The extracted 50% ethanol extract of the root of Salvia pruzebalskii could be identified as an NFAT signal inhibitor having a particularly excellent NFAT signal inhibitory action.

It is a schematic block diagram of the reporter assay mentioned as an example of the method of measuring NFAT signal inhibitory action. It is a schematic block diagram of an NFAT signal showing the binding between NFAT and an NFAT binding site and the promotion of gene transcription downstream thereof.

Claims (7)

At least one selected from the group consisting of at least one plant selected from the plant species listed in the column of plant names (Japanese names) in Table 1 below, an extract of the plant, and components contained in the extract. NFAT signal inhibitor as an active ingredient.

  2. The NFAT signal inhibitor according to claim 1, wherein the extract is an aqueous alcohol extract at a site described in the column of the extraction site in Table 1. 3.   2. The NFAT signal according to claim 1, wherein the extract is obtained by extracting the site described in the column of extraction site in Table 1 with the solvent described in the column of extraction solvent in Table 1. Inhibitor.   A method for inhibiting NFAT activity, comprising contacting a target cell or tissue with the NFAT signal inhibitor according to any one of claims 1 to 3.   A pharmaceutical composition comprising the NFAT signal inhibitor according to any one of claims 1 to 3 as an active ingredient.   A cosmetic composition comprising the NFAT signal inhibitor according to any one of claims 1 to 3 as an active ingredient.   An external preparation containing the NFAT signal inhibitor according to any one of claims 1 to 3 as an active ingredient.

Images