JP2010013403A - Nfat signal inhibitor and nfat signal-inhibiting method - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a new NFAT (nuclear factor of activated T cells) signal inhibitor, and to provide an NFAT signal-inhibiting method by using the inhibitor. <P>SOLUTION: The NFAT signal inhibitor contains Tanacetum parthenium, an extract of the Tanacetum parthenium or parthenolide. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to a NFAT (nuclear factor of activated T cells) signal inhibitor and a NFAT signal inhibition method using the same.

  Nuclear factor of activated T cells (activated T cell nuclear factor, hereinafter abbreviated as NFAT) was discovered as a factor that activates transcription of interleukin-2 (Interleukin-2: IL-2), which is important for T cell activation. It was done. NFAT is activated by being dephosphorylated by the serine / threonine dephosphorylating enzyme calcineurin. Dephosphorylated NFAT has been reported to bind to an NFAT binding site on DNA and promote downstream gene transcription (see FIG. 1). Such an intracellular signal transduction system in which downstream gene transcription is promoted by NFAT is referred to as NFAT signal.

  Cyclosporin A (hereinafter abbreviated as CsA) and tacrolimus (hereinafter abbreviated as FK506) are known to inhibit the activation of the enzyme calcineurin. Therefore, CsA and FK506 are used as immunosuppressants that suppress T cell activation by inhibiting NFAT signals. Furthermore, CsA and FK506 are approved not only as transplanted immunosuppressive agents but also as therapeutic agents for rheumatoid arthritis, psoriasis, and atopic dermatitis that are known to involve the immune system.

  So far, NFAT has been considered as a transcription factor that acts only on the immune system. However, recent research has revealed that it is related not only to the immune system but also to muscle tissue formation by regulating the differentiation of myocardium and skeletal muscle, the formation of neural networks in the brain, and bone metabolism by regulating osteoblast differentiation. ing. Therefore, NFAT is expressed in many tissues and is now regarded as a “multifunctional transcription factor” that plays an important role.

  By inhibiting the NFAT signal, immunosuppressive action (for example, see Non-Patent Document 1), (heart) muscle hypertrophy suppression (for example, Non-Patent Document 2) and osteoclast differentiation inhibition action (for example, Non-Patent Document 3). For example). In addition, as described above, NFAT regulates the pathway for producing immune cytokine IL-2, so that NFAT signal inhibitor is a treatment for diseases considered to involve immune cytokines including autoimmune diseases. Or it is useful for prevention. Examples of such target diseases include insulin-dependent diabetes, infertility, arteriosclerosis, asthma, acute myocardial infarction, adult respiratory distress syndrome, peripheral vascular disease, sepsis, interstitial liver disease, multiple sclerosis and the like. Therefore, if a new NFAT signal inhibitor is found, it is expected that such an inhibitor is used as an immunosuppressant, a (heart) muscle hypertrophy inhibitor, a bone metabolic disease therapeutic agent, or the like.

Lee M and Park J, “Regulation of NFAT activation: a potential therapeutic target for immunosuppression” Mol Cells, 22: p. 1-7, 2006 Molkentin JD, Lu JR, Antonios CL, Markham B, Richardson J, Robbins J, Grant SR, and Olson EN, “A calcineurine-dependent transcribable 93”. 215-228, 1998 Takayanagi H, Kim S, Koga T, Nishina H, Isshiki M, Yoshi dan, T factor NFATc1 (NFAT2) integrated RANKL signaling in terminal differentiation of osteoclasts "Development Cell, 3: p. 889-901, 2002

An object of the present invention is to provide a novel NFAT signal inhibitor.
Furthermore, this invention aims at providing the NFAT signal inhibition method using the said NFAT signal inhibitor.

  In order to solve the above-mentioned problems, the present inventors constructed a system for evaluating the action on NFAT signal transmission, and comprehensively analyzed the NFAT signal inhibitory action for various plants or compounds using the system. As a result, a plant and a compound having a new NFAT signal inhibitory action were found. Based on this finding, the present invention has been completed.

The present invention is an NFAT signal inhibitor comprising at least one selected from the group consisting of feverfew, feverfew extract, and parthenolide.
Furthermore, the present invention relates to a method for inhibiting NFAT signal, which comprises using the NFAT signal inhibitor for a target cell or tissue.

According to the present invention, a novel NFAT signal inhibitor can be provided.
Furthermore, according to this invention, the NFAT signal inhibition method using the said NFAT signal inhibitor can be provided.

Hereinafter, the present invention will be described in detail.
The present inventors screened extracts having an NFAT signal inhibitory action using various plants and extracts thereof. As a result, it was found that feverfew and feverfew extract have NFAT signal inhibitory action. Furthermore, it has been found that parthenolide contained in the extract also shows a similar NFAT signal inhibitory action.
The NFAT signal inhibitor according to the present invention comprises at least one selected from the group consisting of feverfew, feverfew extract, and parthenolide.

  Feverfew is a plant whose scientific name is Tanacetum parthenium and is classified into the family Asteraceae. Feverfew has been conventionally used as a component such as a supplement, and has been reported to prevent rheumatism and arthritis. The present inventors have newly clarified that feverfew has an NFAT signal inhibitory action this time.

  The NFAT signal inhibitor according to the present invention may include whole feverfew grass, leaves, bark, branches, fruits or roots as they are, or whole plants, leaves, bark, branches, fruits or the like of the plant. It may be used by crushing roots or the like. In the present invention, it is preferable to use feverfew leaves. Furthermore, the feverfew used in the present invention preferably contains parthenolide described below.

  In the present invention, when a feverfew extract is used, the method for obtaining the extract is not particularly limited, but it is obtained by extracting a plant at room temperature or under heating or by using an extraction instrument such as a Soxhlet extractor. It is preferable.

As the extraction solvent (solvent) used for obtaining the feverfew extract, either a polar solvent or a nonpolar solvent can be used. Examples of the extraction solvent include water; alcohols such as methanol, ethanol, propanol and butanol; polyhydric alcohols such as propylene glycol and butylene glycol; ketones such as acetone and methyl ethyl ketone; esters such as methyl acetate and ethyl acetate; Chain and cyclic ethers such as tetrahydrofuran and diethyl ether; Polyethers such as polyethylene glycol; Hydrocarbons such as squalane, hexane, cyclohexane and petroleum ether; Aromatic hydrocarbons such as toluene; Dichloromethane, chloroform, dichloroethane, etc. And halogenated hydrocarbons; and carbon dioxide. The above extraction solvents may be used alone or as a mixture of two or more.
In the present invention, the extraction solvent is preferably an aqueous alcohol, particularly preferably 99.5% by mass ethanol.
In the present invention, there are no particular limitations on the extraction time and extraction temperature for obtaining the feverfew extract.

  In the present invention, the extract may be used as it is, or the extract may be used after being diluted, concentrated or lyophilized and then prepared into a powder or paste. In the present invention, the feverfew extract includes various solvent extracts obtained by the extraction method as described above, a diluted solution thereof, a concentrated solution thereof or a dried powder thereof. In addition, it is possible to use the extract obtained by subjecting the extract to a separation technique such as chromatographic liquid-liquid distribution and removing inactive impurities from the extract. Further, an appropriate liquid or solid excipient or extender such as titanium oxide, calcium carbonate, distilled water, lactose, starch or the like may be added to the above extract and used as an NFAT signal inhibitor. In this case, the amount of the extract in the NFAT signal inhibitor is not particularly limited, but the extract is preferably contained in a solid content concentration of 0.0001 to 1% by mass, and 0.001 to 1% by mass. Is more preferable, and 0.01 to 1% by mass is more preferable.

  The feverfew extract used in the present invention preferably contains parthenolide described below.

Next, parthenolide will be described.
Parthenolide is a compound that has been conventionally known to have a cancer metastasis inhibitory effect, a rheumatism, an arthritis preventive effect, and the like, and is a compound represented by the following formula.

  The present inventors have found for the first time that parthenolide has an NFAT signal inhibitory action.

In the present invention, as the parthenolide, an artificially synthesized one or an extract extracted from a natural product such as feverfew may be used.
The NFAT signal inhibitor according to the present invention preferably contains parthenolide. The amount of parthenolide in the NFAT signal inhibitor is not particularly limited, but the concentration is preferably 1 to 100 μM, more preferably 10 to 100 μM.

In the NFAT signal inhibitor according to the present invention, feverfew, its extract, and parthenolide may be used alone or in combination.
More preferably, the NFAT signal inhibitor according to the present invention contains an alcoholic extract of parthenolide or feverfew leaves.

  The NFAT signal inhibitor according to the present invention can suppress the transcriptional activation of various genes that are positively regulated by NFAT. Therefore, the NFAT signal inhibitor according to the present invention is useful, for example, as an immunosuppressive agent, a (heart) muscle hypertrophy inhibitor, a bone metabolic disease therapeutic agent, and the like. Moreover, since the NFAT signal inhibitor based on this invention contains what originates in a natural substance as an active ingredient, there exists an advantage also in safety | security.

In the present invention, the NFAT signal means that NFAT activated in the cytoplasm binds to the NFAT binding site (binding sequence) in the nucleus, so that the gene located downstream of the NFAT binding site positively regulates transcription. It refers to a series of signal transduction systems (see FIG. 1).
In the present invention, inhibiting NFAT signal means acting directly or indirectly on NFAT to suppress activation of transcription by NFAT.
Furthermore, the NFAT binding sequence refers to an oligonucleotide having a base sequence to which NFAT can bind. For example, a base sequence such as GGAGGAAAAAACTGTTTCATACAGAAGGCGT (pNFAT-Luc, manufactured by Stratagene) is known.

  The method for measuring the NFAT signal inhibitory action is not particularly limited. A measuring method can be mentioned (see FIG. 2). The reporter gene to be used is not particularly limited, and any reporter gene conventionally used in the field of biochemical experiments can be used. For example, examples of the reporter gene include a luciferase gene, a β-glucuronidase gene (GUS gene), a green fluorescent protein gene (GFP gene), and the like. The NFAT binding sequence on the plasmid is not limited to the known NFAT binding sequence as described above. Alternatively, a known NFAT binding sequence as described above may be used as one set, and multiple sets may be linked and introduced. By linking and using a plurality of NFAT binding sequences, the transcription promoting activity by NFAT can be measured with higher sensitivity. In addition, since the activity of NFAT depends on the intracellular calcium ion concentration, the reporter assay is preferably performed under conditions that allow calcium ions to flow into the host.

  The NFAT signal inhibitory action can be evaluated using the NFAT signal inhibition rate as an index. The NFAT signal inhibition rate refers to the rate of decrease in transcriptional activity when a sample sample is added to the transcriptional activity due to NFAT in a system where no sample sample is added.

Since the NFAT signal inhibitor according to the present invention suppresses transcriptional activation by NFAT, it can inhibit NFAT signal in cells and tissues. Specifically, by directly or indirectly contacting the above-described NFAT signal inhibitor according to the present invention with a cell or tissue such as a human or animal, the NFAT signal in the cell or tissue can be inhibited. it can. Thereby, in the cell or tissue, various gene expressions caused by the NFAT signal can be suppressed at the transcription level.
Since the NFAT signal inhibitor according to the present invention can suppress the activation of transcription by NFAT, it is also useful as a therapeutic agent or preventive agent for various symptoms and diseases caused by enhancement of transcription activity by NFAT. . Examples of such symptoms and diseases include insulin-dependent diabetes mellitus, infertility, arteriosclerosis, asthma, acute myocardial infarction, adult respiratory distress syndrome, peripheral vascular disease, sepsis, interstitial liver disease, multiple sclerosis, etc. Can be mentioned. Therefore, the NFAT signal inhibitor according to the present invention is useful as an immunosuppressive agent, a (heart) muscle hypertrophy inhibitor, a bone metabolic disease therapeutic agent, and the like.

  When the NFAT signal inhibitor according to the present invention is used for pharmaceutical purposes, the dosage form is not particularly limited, but for example, solid preparations such as powders, granules, capsules, pills, tablets, liquids, suspensions, Examples thereof include liquid agents such as emulsions. When the NFAT signal inhibitor according to the present invention is used as a pharmaceutical composition for oral administration, in addition to the NFAT signal inhibitor, excipients, disintegrants, binders generally used depending on the form of the oral administration agent, Lubricants, surfactants, alcohols, water, water-soluble polymers, sweeteners, flavoring agents, acidulants, and the like can be added and produced according to conventional methods. Examples of the pharmaceutical composition for oral administration include immunosuppressive agents, (heart) muscle hypertrophy inhibitors, bone metabolic disease therapeutic agents, and the like.

  In addition, when the NFAT signal inhibitor according to the present invention is used as a skin drug or quasi-drug, the dosage form is not particularly limited. For example, ointments, liquids, extracts, Lotion agents and emulsions can be mentioned. In addition to plant extracts and parthenolides, pharmaceutically acceptable carriers such as auxiliaries, stabilizers, wetting agents, emulsifiers, absorption enhancers and surfactants are optionally added to the drug or quasi-drug. Can be combined in combination.

  On the other hand, when the NFAT signal inhibitor according to the present invention is used as a cosmetic, the shape is not particularly limited. For example, a water-in-oil or oil-in-water emulsified cosmetic, cream, lotion , Gels, foams, essences, foundations, packs, sticks and powders. In addition to the NFAT signal inhibitor of the present invention, the cosmetics include oils, surfactants, ultraviolet absorbers, alcohols, chelating agents, pH adjusters, preservatives, potentiators commonly used as cosmetic ingredients. A sticky agent, pigments, a fragrance, various skin nutrients, and the like can be combined in any combination. Specifically, the external preparation for skin according to the present invention contains medicinal ingredients blended in skin cosmetics, for example, ultraviolet absorbers such as fine particle zinc oxide, titanium oxide, persol MCX, persol 1789, vitamins such as ascorbic acid, Moisturizers such as sodium hyaluronate, petrolatum, glycerin, urea, hormonal agents, and other whitening ingredients such as kojic acid, arbutin, placenta extract, lucinol, chemical transmission represented by steroids, arachidonic acid metabolites, histamine, etc. Substance production / release inhibitors (indomethacin, ibuprofen), anti-inflammatory agents such as receptor antagonists, anti-androgen agents, vitamin A acid, royal jelly extract, sebum secretion inhibitors such as royal jelly acid, tocopherol nicotinate, alprostadil, Peripheral blood vessels such as isoxsuprine hydrochloride and tolazoline hydrochloride Tonicity and carbon dioxide gas with peripheral vasodilatory effect, minoxidil, carpronium chloride, red pepper tincture, vitamin E derivative, ginkgo biloba extract, cell extract, etc., cell activators such as pentadecanoic acid glyceride, nicotinamide, Bactericides such as hinokitiol, L-menthol and isopropylmethylphenol, drugs such as glycyrrhizic acid and its derivatives or salts, ceramide and ceramide-like compounds, and the like can be added and blended.

When the NFAT signal inhibitor according to the present invention is used as a medicine, quasi-drug or cosmetic, the amount of plant extract and parthenolide is calculated as a dry product, and is usually a drug, quasi-drug or It is preferably 0.00001 to 5% by weight, particularly 0.0001 to 0.1% by weight of the total composition of the cosmetic. Moreover, when using the NFAT signal inhibitor based on this invention as a pharmaceutical, it is desirable that the application quantity of a plant extract and a parthenolide shall be 0.01 mg-1 g / day as a solid content remainder in a normal adult. In addition, although the skin external preparation which concerns on this invention changes with content of an active ingredient, for example, 1-20 mg per 1 cm < ² > of skin surfaces in the case of cream form and ointment form, and 1-20 mg is similarly used in the case of liquid preparation Is preferred.

  When the NFAT signal inhibitor according to the present invention is used as a cosmetic, pharmaceutical or quasi-drug, for example, powder such as chalk, talc, fuller's earth, kaolin, starch, rubber, colloidal silica sodium polyacrylate; Oils or oily substances such as vegetable oils, silicone oils; emulsifiers such as sorbitan trioleate, sorbitan tristearate, glycerol monooleate, polymeric silicone surfactants; preservatives such as para-hydroxybenzoate esters; butylhydroxytoluene Anti-oxidants such as glycerol, sorbitol, 2-pyrrolidone-5-carboxylate, dibutyl phthalate, gelatin, polyethylene glycol and other wetting agents; Buffers such as lactic acid with a base such as triethanolamine or sodium hydroxide Surfactants such as glycerin fatty acid ester, sorbitan fatty acid ester, sucrose fatty acid ester, alkyl glucoside; waxes such as beeswax, ozokerite wax, paraffin wax; thickener; activity enhancer; coloring agent; Can be used in appropriate combinations as needed.

  EXAMPLES Hereinafter, although this invention is demonstrated further in detail based on an Example, this invention is not limited to this.

  In order to verify the NFAT signal inhibitory action, the following evaluation system was used to verify the NFAT signal inhibitory action of the feverfew extract and commercially available parthenolide (Sigma-Aldrich, composition:> 90%).

Example 1
(1) Preparation of feverfew extract 80 g of dried feverfew (Germany) is taken, 800 mL of 99.5% by mass ethanol is added, and after standing at room temperature for 3 days, it is filtered and extracted (640 mL, evaporation residue) Min 0.55 w / v%). The solvent was retained under reduced pressure from the extract with a rotary evaporator, and 3.5 g of the obtained solid content was dissolved in 99.5% by mass ethanol (adjusted to a solid content concentration of 10 w / v%).

(2) Evaluation method of NFAT signal inhibitory action Human kidney (HEK293) cells were purchased from ATCC (American Type Culture Collection) and used as host cells into which plasmids were introduced. HEK293 cells were cultured in DMEM (High glucose, 10% heat-inactivated FBS) at 37 ° C. and 5% CO ₂ .
A plasmid pNFAT-luc (manufactured by STRATAGENE) into which a quadruple NFAT binding sequence and a firefly luciferase gene as a reporter gene were introduced downstream thereof was introduced (transfected) into the human kidney (HEK293) cells.
In addition, in consideration of variation in transfection efficiency, plasmid pRL-CMV (Promega) in which a Renilla luciferase gene is introduced downstream of CMV promoter is also used to correct the signal intensity of firefly luciferase. ) Cells were transfected.
Transfection was performed using LipofectAMINE 2000 reagent (manufactured by Invitrogen).
The medium was changed 8 hours after transfection and incubated overnight.

  Thereafter, the feverfew extract (0.003% by mass) or commercially available parthenolide (30 μM) was added, and a sample to which 1 μM Ionomycin was added 1 hour later was prepared. Moreover, the sample which does not add feverfew extract or a commercially available parthenolide, and also does not add Ionmycin as a base control was created. Here, Ionomycin is an ionophore specific to calcium ions, and is known as a drug that causes calcium ions to flow into cells. Addition of Ionomycin activates calcineurin, which is a calcium ion-dependent phosphatase, and accordingly increases the transcriptional activity of NFAT.

  About the said sample, the luciferase reporter assay was performed 8 hours after the addition of Ionomycin. The luciferase reporter assay was performed using Dual-Glo Luciferase Assay System (Promega). Specifically, after removing the medium, Dual-Gluciferase reagent diluted 2-fold with PBS was added, stirred, and then firefly luciferase activity was measured 20 minutes later. Thereafter, an equal amount of Dual-Glo Stop & Glo reagent was added, and after stirring, Renilla luciferase activity was measured. The luciferase activity was measured using MiniLumat LB 9506 (EG & G BERTHOLD), and the amount of luminescence by luciferase was quantitatively detected. In both cases, the measurement time for luciferase activity was 2 seconds.

  The luciferase activity was measured in the same manner when neither feverfew extract or parthenolide was added to the human kidney (HEK293) cells.

  In all samples, the value of firefly luciferase activity was corrected by dividing by the value of Renilla luciferase activity introduced for transfection efficiency correction. Thereafter, the NFAT signal inhibition rate was calculated by the following formula.

NFAT signal inhibition rate (%) = 100−A / B × 100

A = (Luciferase activity value of sample added with NFAT inhibitor and Ionmycin) − (Luciferase activity value of base control)
B = (Luciferase activity value of sample added with only Ionmycin) − (Luciferase activity value of base control)

  As a result, the inhibition rate of NFAT signal by feverfew extract was 83.1%, and the inhibition rate of NFAT signal by parthenolide was 102.0%. From this result, it was revealed that feverfew extract and parthenolide inhibit the NFAT signal. In other words, feverfew extract and parthenolide were found to be excellent NFAT signal inhibitors that suppress transcription that is positively controlled by NFAT.

Example 2
A sample was prepared in the same manner as in Example 1 except that the concentration of feverfew extract or the concentration of parthenolide was changed as shown in Table 1.
For these samples, the NFAT signal inhibition rate was measured in the same manner as in Example 1. The obtained results are shown in Table 1.

  As a result, it was found that both feverfew extract and parthenolide are effective in inhibiting NFAT signal.

It is the schematic of NFAT signal which shows the mechanism of the coupling | bonding of NFAT and a NFAT binding site, and the gene transcription promotion of the downstream. It is the schematic showing an example of the reporter assay which measures NFAT signal inhibitory action.

Claims (4)

  An NFAT signal inhibitor comprising at least one selected from the group consisting of feverfew, feverfew extract, and parthenolide.   The NFAT signal inhibitor according to claim 1, wherein the extract of feverfew contains parthenolide.   A method for inhibiting NFAT signal, comprising using the NFAT signal inhibitor according to claim 1 for a target cell or tissue.   The method of inhibiting NFAT signal according to claim 3, wherein the NFAT signal inhibitor is brought into direct contact with the cell or tissue.

Images