JP2009051741A - Nfat signal inhibitor and nfat signal inhibition method - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a new nuclear factor of activated T cells (NFAT) signal inhibitor which can inhibit NFAT signal. <P>SOLUTION: This NFAT signal inhibitor comprises at least one selected from the group consisting of at least plant selected from Dolichandrone spthacea, Cocculus orbiculatus, and Siegesbeckia orientalis L., the extract of the plant, and an ingredient contained in the extract, as an active ingredient. The NFAT signal inhibitor of the present invention can be applied to various fields such as external preparations, pharmaceutical compositions, cosmetics and foods. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a NFAT (nuclear factor of activated T cells) signal inhibitor and a method for inhibiting NFAT signal, which comprise a plant, a plant extract or a component contained in a plant extract as an active ingredient.

  Nuclear factor of activated T cells (hereinafter abbreviated as NFAT) was discovered as a factor that activates the transcription of Interleukin-2 (IL-2), which is important for T cell activation, and is an immunosuppressant cyclosporine. It has been reported that the transcriptional activity is regulated by serine / threonine phosphatase calcineurin which is a target of A (hereinafter abbreviated as CsA) and tacrolimus (hereinafter abbreviated as FK506) (FIG. 2). reference). That is, CsA and FK506 suppress T cell activation by inhibiting the NFAT signal. CsA and FK506 are approved not only as transplant immunosuppressants but also as therapeutic agents for rheumatoid arthritis, psoriasis, and atopic dermatitis, which are known to be involved in the immune system. A system in which such NFAT binds to an NFAT binding sequence (“NFAT site” in FIG. 2) to promote transcription of a gene downstream from the NFAT binding sequence is referred to as “NFAT signal”.

  NFAT has been considered as a factor that acts only on the immune system because of its discovery. However, recent studies have not limited to the immune system, but include the formation of muscle tissue by regulating the differentiation of the myocardium and skeletal muscle, and the neural network in the brain. It has been recognized as a "multifunctional transcription factor" that plays an important role in many organs such as formation and bone metabolism by regulating osteoblast differentiation.

  The role of the NFAT signal in the living body is as described above. By inhibiting the NFAT signal, immunosuppressive action (Non-patent document 1), psoriasis treatment (Non-patent document 2), atopic dermatitis treatment (Non-patent document) Reference 3), (heart) muscle hypertrophy suppression (Non-patent document 4), possibility as an anti-rheumatic drug (Non-patent document 5), hair growth action (Non-patent document 6) and osteoclast differentiation inhibitory action (non-patent document) Reference 7) is reported to be expected. In addition, as described above, since NFAT is mediated by a pathway that produces the immune cytokine IL-2, NFAT signal inhibitors are used to treat diseases that are thought to involve immune cytokines including autoimmune diseases. Useful for prevention. Examples of such diseases include various cancers, various leukemias, various hepatitis, various infections, systemic lupus erythematosus, inflammatory bowel diseases (ulcerative colitis, Crohn's disease), multiple sclerosis, insulin-dependent diabetes mellitus, digestion Ulcer, septic shock, tuberculosis, infertility, arteriosclerosis, Behcet's disease, asthma, nephritis, acute bacterial meningitis, acute myocardial infarction, acute pancreatitis, acute viral encephalitis, adult respiratory distress syndrome, bacterial pneumonia, chronic pancreatitis, peripheral Examples include vascular disease, sepsis, interstitial liver disease, localized ileitis, and multiple sclerosis. Therefore, if a new NFAT signal inhibitor is identified, an immunosuppressive agent, a psoriasis therapeutic agent, an atopic dermatitis therapeutic agent, a (cardiac) muscle hypertrophy inhibitor, an anti-rheumatic agent, a bone metabolic disease therapeutic agent, and the above New medical uses such as those listed are expected. In addition, if a NFAT signal inhibitor is newly identified, quasi-drugs and cosmetics as hair growth promoters are expected.

Lee M and Park J, "Regulation of NFAT activation: a potential therapeutic target for immunosuppression" Mol Cells, 22: 1-7, 2006 Feldman S, "Advances in psoriasis treatment" Dermatol Online J, 6: 4, 2000 Hultsch T, "Immunomodulation and safety of topical calcineurin inhibitors for the treatment of atopic dermatitis" Dermatology, 211: 2, 2005 Molkentin JD, Lu JR, Antos CL, Markham B, Richardson J, Robbins J, Grant SR, and Olson EN, "A calcineurin-dependent transcriptional pathway for cardiac hypertrophy" Cell, 93: 215-228, 1998 Urushibara M, Takayanagi H, Koga T, Kim S, Isobe M, Morishita Y, Nakagawa T, Loeffler M, Kodama T, Kurosawa H, and Taniguchi T, "Antirheumatic drug, leflunomide, inhibits osteoclastgenesis by interfering with RANKL-stimulated induction of NFATc1 "Arthritis and Rheumatism, 50: 794-804, 2004 Gafter-Gvili A, Sredni B, Gal R, Gafter U, and Kalechman Y, "Cyclosporin A-induced hair growth in mice is associated with inhibition of calcineurin-dependent activation of NFAT in follicular keratinocytes" Am J Physiol Cell Physiol, 284: C1593-C603, 2003 Takayanagi H, Kim S, Koga T, Nishina H, Isshiki M, Yoshida H, Saiura A, Isobe M, Yokochi T, Inoue J, Wagner EF, Mak TW, Kodama T, and Taniguchi T, "Induction and activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in termial differentiation of osteoclasts "Developmental Cell, 3: 889-901, 2002

  Therefore, the present invention aims to provide a novel NFAT signal inhibitor and a NFAT signal inhibition method using the novel NFAT signal inhibitor, which can be used for external preparations, pharmaceutical compositions, cosmetics, foods and the like. To do.

  As a result of intensive studies to solve the above problems, the inventors of the present invention newly constructed a system for evaluating the action on NFAT signal transduction, and comprehensively exhibits NFAT signal inhibitory action on various plants using the system. As a result of analysis, the present inventors have succeeded in identifying a plant having an NFAT signal inhibitory action and completed the present invention.

  That is, the NFAT signal inhibitor according to the present invention is selected from the group consisting of at least one plant selected from Doricandrone spatacare, Nekonohige, Aotsukirafuji and Tsukumenamomi, an extract of the plant and components contained in the extract. At least one kind is an active ingredient.

  In particular, the NFAT signal inhibitor according to the present invention includes an aqueous alcohol extract of the fruit of Doricandrone spatacare, an aqueous alcohol extract of the flowers and branches of the bearded beard, an aqueous alcohol extract of a spruce of Aotsuki-rafuji, and a whole plant of Tsukushimenamomi It is preferable to contain an aqueous alcohol extract as the extract. Here, examples of the alcohol extract include 95% ethanol extract.

  By contacting the above-described NFAT signal inhibitor with a target cell or tissue, the NFAT signal in the cell or tissue can be inhibited.

  The NFAT signal inhibitor according to the present invention can suppress transcription that is positively controlled by NFAT. Therefore, the NFAT signal inhibitor according to the present invention is useful as a candidate substance such as an immunosuppressive agent, a therapeutic agent for psoriasis, a therapeutic agent for atopic dermatitis, a (cardiac) muscle hypertrophy inhibitor and an antirheumatic drug. The NFAT signal inhibitor according to the present invention can be safely used because it contains a natural substance as an active ingredient.

Hereinafter, the present invention will be described in detail.
The NFAT signal inhibitor according to the present invention is at least one selected from the group consisting of at least one plant selected from Doricandrone spatacare, Neko no bee, Aotsukiraji and Tsukushima Namomi, an extract of the plant and components contained in the extract. The seed is an active ingredient. Here, Doricandrone spatacare is a plant that has the scientific name Dolichandrone spthacea (LF) K. Schun, and is classified into the genus Cranaceae. A cat mustache is a plant that has the scientific name Orthosiphon aristatus (Blume) Hig and is classified in the family Lamiaceae. Aotsuki-rafuji is a plant that has the scientific name Cocculus orbiculatus (Thunb.) DC and is classified into the family Azalea. Tsukushimamenomi is a plant that has the scientific name Siegesbeckia orientalis L. and is classified into the family Asteraceae.

  The NFAT signal inhibitory action of the NFAT signal inhibitor according to the present invention can be evaluated using the NFAT signal inhibition rate as an index. As an example, in the licandronone spatacare extract, the NFAT signal inhibition rate is 40.7%. In the feline beard extract, the NFAT signal inhibition rate is 67.3%. In the Aotsuki rafu extract, the NFAT signal inhibition rate is 44.1%. In the Tsukushima Namomi extract, the NFAT signal inhibition rate is 66.7%. In short, the NFAT signal inhibition rate means the rate of decrease in transcriptional activity when the extract is allowed to act on the transcriptional activity due to NFAT when the extract is not acted upon.

  Here, NFAT signal inhibition means reducing the transcription promoting activity by NFAT by acting directly or indirectly on NFAT. The method for measuring the NFAT signal inhibitory action is not particularly limited, and examples thereof include a reporter assay using a host in which a known NFAT binding sequence and a plasmid having a reporter gene downstream of the NFAT binding sequence are introduced (FIG. 1). Since the activity of NFAT depends on calcium ions, the reporter assay is performed under conditions where calcium ions are allowed to flow into the host. The reporter gene is not particularly limited, and any reporter gene conventionally used in the field of biochemical experiments can be used. For example, examples of the reporter gene include a luciferase gene, a β-glucuronidase gene (GUS gene), and a green fluorescent protein gene (GFP gene).

  Examples of the NFAT binding sequence include oligonucleotides composed of sequences to which NFAT binds, for example, a base sequence such as GGAGGAAAAACTGTTTCATACAGAAGGCGT (pNFAT-Luc, Stratagene, SEQ ID NO: 1). In the above-described plasmid, a plurality of sets of such NFAT binding sequences may be linked and introduced. By linking and using a plurality of NFAT binding sequences, the transcription promoting activity by NFAT can be measured with higher sensitivity.

  The above-described NFAT signal inhibition rate is a value calculated from the above-described reporter assay.

  In particular, the NFAT signal inhibitor according to the present invention should include whole grass, leaves, bark, branches, fruits, roots, etc. in at least one plant selected from Doricandrone spatacare, Nekonohige, Aotsukirafuji and Tsukumenamomi. it can. Or it is preferable that the NFAT signal inhibitor based on this invention contains what grind | pulverized and used the whole plant, the leaf, the bark, the branch, the fruit, or the root of the said plant.

  Moreover, it is preferable that the NFAT signal inhibitor which concerns on this invention uses the fruit of Doricandrone spatacare, the flower and branch of a cat beard, the sprout of Aotsuki-rafuji, and the whole plant of Tsukushimamenomi. When a plant extract is used as an active ingredient as the NFAT signal inhibitor according to the present invention, the plant extract is extracted at room temperature or under heating, or extracted using an extractor such as a Soxhlet extractor. Is obtained. In the present invention, the plant extract means various solvent extracts obtained by the above extraction method, diluted solutions thereof, concentrated solutions thereof or dried powders thereof.

  As an extraction solvent used for obtaining a plant extract, either a polar solvent or a nonpolar solvent can be used. Examples of the extraction solvent include water; alcohols such as methanol, ethanol, propanol and butanol; polyhydric alcohols such as propylene glycol and butylene glycol; ketones such as acetone and methyl ethyl ketone; esters such as methyl acetate and ethyl acetate; Chain and cyclic ethers such as tetrahydrofuran and diethyl ether; Polyethers such as polyethylene glycol; Hydrocarbons such as squalane, hexane, cyclohexane and petroleum ether; Aromatic hydrocarbons such as toluene; Dichloromethane, chloroform, dichloroethane, etc. And halogenated hydrocarbons; and carbon dioxide. Alternatively, a mixture obtained by combining two or more of the above solvents can be used as the extraction solvent.

  When a plant extract is used as an active ingredient as the NFAT signal inhibitor according to the present invention, the extraction solvent is preferably aqueous alcohol, and particularly preferably 95% ethanol. As the NFAT signal inhibitor according to the present invention, the above plant extract can be used as it is, but the extract can be used after being diluted, concentrated or lyophilized and then prepared into a powder or paste. . In addition, an extract obtained by removing the inert impurities from the extract by subjecting the extract of the plant or the like to a separation technique such as chromatographic liquid-liquid distribution can also be used. In the NFAT signal inhibitor according to the present invention, among the plurality of plants shown in Table 2, one kind of plant or a plant extract thereof may be used as an active ingredient. It is good also as an active ingredient by mixing a thing.

  Since the NFAT signal inhibitor according to the present invention reduces the transcription promoting activity by NFAT, it can inhibit NFAT signal in cells and tissues. Specifically, the NFAT signal in the cell or tissue can be inhibited by bringing the NFAT signal inhibitor according to the present invention described above into contact with the cell or tissue as a target. Thereby, in the cells and tissues, various gene expressions caused by NFAT signals can be suppressed at the transcription level.

  Since the NFAT signal inhibitor according to the present invention reduces the transcription promoting activity by NFAT, it can be used as a therapeutic or preventive agent for symptoms and diseases caused by the enhanced transcription promoting activity by NFAT. Symptoms and diseases resulting from the enhanced transcription promoting activity by NFAT include immune system diseases, psoriasis, atopic dermatitis, myopathy including myocardium, rheumatism, bone metabolic diseases, various cancers, various leukemias, various hepatitis, Various infections, systemic lupus erythematosus, inflammatory bowel disease (ulcerative colitis, Crohn's disease), multiple sclerosis, insulin-dependent diabetes, peptic ulcer, septic shock, tuberculosis, infertility, arteriosclerosis, Behcet's disease, Asthma, nephritis, acute bacterial meningitis, acute myocardial infarction, acute pancreatitis, acute viral encephalitis, adult respiratory distress syndrome, bacterial pneumonia, chronic pancreatitis, peripheral vascular disease, sepsis, interstitial liver disease, localized ileitis, Examples include multiple sclerosis. Therefore, the NFAT signal inhibitor according to the present invention can be used as an immunosuppressant, a psoriasis therapeutic agent, a (cardiac) muscle hypertrophy inhibitor, an anti-rheumatic drug, a bone metabolic disease therapeutic agent, and the like.

  When the NFAT signal inhibitor according to the present invention is used for pharmaceutical purposes, the dosage form is not particularly limited, but for example, solid preparations such as powders, granules, capsules, pills, tablets, liquids, suspensions, Examples thereof include liquid agents such as emulsions. When the NFAT signal inhibitor according to the present invention is used as a pharmaceutical composition for oral administration, in addition to the NFAT signal inhibitor, generally used according to the form of the oral administration agent, an excipient, a disintegrant, and a binder , Lubricants, surfactants, alcohols, water, water-soluble polymers, sweeteners, flavoring agents, acidulants and the like, and can be produced according to conventional methods. Examples of the pharmaceutical composition for oral administration include an immunosuppressant, a psoriasis therapeutic agent, a (heart) muscle hypertrophy inhibitor and an anti-rheumatic drug.

  In addition, when the NFAT signal inhibitor according to the present invention is used as a skin drug or quasi-drug, the dosage form is not particularly limited. For example, an ointment, a liquid agent, an extract , Lotions and emulsions. In addition to the plant extract, the pharmaceutical or quasi-drug is optionally combined with pharmaceutically acceptable carriers such as auxiliaries, stabilizers, wetting agents, emulsifiers, absorption enhancers and surfactants. Can be blended. Examples of the pharmaceutical composition for skin include a therapeutic agent for atopic dermatitis.

  On the other hand, when the NFAT signal inhibitor according to the present invention is used as a cosmetic, the dosage form is not particularly limited. For example, a water-in-oil or oil-in-water emulsified cosmetic, cream , Lotions, gels, foams, essences, foundations, packs, sticks and powders. In addition to plant extracts, the cosmetics include oils, surfactants, ultraviolet absorbers, alcohols, chelating agents, pH adjusters, preservatives, thickeners, which are commonly used as cosmetic ingredients. Pigments, fragrances, various skin nutrients, and the like can be combined in any combination. Specifically, the external preparation for skin according to the present invention includes medicinal ingredients blended in skin cosmetics, for example, ultraviolet absorbers such as fine particle zinc oxide, titanium oxide, persol MCX, and persol 1789, and vitamins such as ascorbic acid. , Humectants such as sodium hyaluronate, petrolatum, glycerin, urea, hormones, and other whitening ingredients such as kojic acid, arbutin, placenta extract, lucinol, chemistry represented by steroids, arachidonic acid metabolites, histamine, etc. Transmitter production / release inhibitors (indomethacin, ibuprofen), anti-inflammatory agents such as receptor antagonists, anti-androgen agents, vitamin A acid, royal jelly extract, sebum secretion inhibitors such as royal jelly acid, tocopherol nicotinate, alprostadil , Peripheral blood such as isoxsuprin hydrochloride and torazoline hydrochloride Circulating agents such as dilators and carbon dioxide with peripheral vasodilator, minoxidil, carpronium chloride, red pepper tincture, vitamin E derivatives, ginkgo biloba extract, assembly extract, etc., cell activators such as pentadecanoic acid glyceride, nicotinamide, Bactericides such as hinokitiol, L-menthol and isopropylmethylphenol, drugs such as glycyrrhizic acid and its derivatives or salts, ceramide and ceramide-like compounds, and the like can be added.

When the NFAT signal inhibitor according to the present invention is used as a medicine, quasi-drug or cosmetic, the amount of plant extract is usually calculated as a dry product, and is usually a drug, quasi-drug or cosmetic. The total composition is preferably 0.00001 to 5% by weight, more preferably 0.0001 to 0.1% by weight. Moreover, when using the NFAT signal inhibitor which concerns on this invention as a pharmaceutical, it is desirable that the application quantity of a plant extract is 0.01 mg-1 g / day as a solid content residual amount in a normal adult. The external preparation for skin according to the present invention varies depending on the content of the active ingredient. For example, in the case of a cream or ointment, 1 to ²⁰ mg per 1 cm ² of the skin surface, and in the case of a liquid preparation, 1 to ²⁰ mg is also used. It is preferable to do this.

  When the NFAT signal inhibitor according to the present invention is used as a cosmetic, pharmaceutical or quasi-drug, for example, powder such as chalk, talc, fuller's earth, kaolin, starch, rubber, colloidal silica sodium polyacrylate; Oils or oily substances such as vegetable oils, silicone oils; emulsifiers such as sorbitan trioleate, sorbitan tristearate, glycerol monooleate, polymeric silicone surfactants; preservatives such as para-hydroxybenzoate esters; butylhydroxytoluene Antioxidants such as glycerol, sorbitol, 2-pyrrolidone-5-carboxylate, dibutyl phthalate, gelatin, polyethylene glycol and other wetting agents; buffers such as lactic acid with a base such as triethanolamine or sodium hydroxide; Guri Surfactants such as serine fatty acid esters, sorbitan fatty acid esters, sucrose fatty acid esters, alkyl glucosides; waxes such as beeswax, ozokerite wax, paraffin wax; thickeners; activity enhancers; coloring agents; Can be used in appropriate combinations as needed.

Hereinafter, the present invention will be described more specifically with reference to examples. However, the technical scope of the present invention is not limited to these examples.
[Example 1] Production of plant extract In this example, as shown below, four types of extracts were produced from four types of plants.
(1) Manufacture of licandronone / spatakea extract 10 g of drikandrone / spatakea fruit (Vietnam), add 100 mL of 95% ethanol, extract at room temperature for 7 days, filter, concentrate and extract the filtrate 1.3 g of product was obtained. The evaporation residue was 1.0 w / v%.
(2) Manufacture of Nekono Beard Extract Take 10g of Nekono Beard Flower and Branch (Vietnam), add 100mL of 95% ethanol, extract at rest at room temperature for 7 days, filter, concentrate the filtrate and extract 2 0.1 g was obtained. The evaporation residue was 1.0 w / v%.
(3) Manufacture of Aotsuki-rafuji extract 10g of Aotsuki-rafuji sprout (Vietnam) was added, 100mL of 95% ethanol was added, extracted after standing at room temperature for 7 days, filtered, and the filtrate was concentrated to obtain an extract. . The evaporation residue was 1.0 w / v%.
(4) Manufacture of Tsukushima Namomi Extract 10 g of Tsukushima Namomi Whole Plant (Vietnam) is added, 100 mL of 95% ethanol is added, and after standing at room temperature for 7 days, filtered, the filtrate is concentrated and extracted. Got. The evaporation residue was 1.0 w / v%.

  As described above, in Example 1, four types of plant extracts were prepared as shown in (1) and (4).

[Example 2] NFAT signal inhibitory effect In this example, an evaluation system for verifying the NFAT signal inhibitory effect was constructed, and NFAT signals for the four types of plant extracts produced in Example 1 using the evaluation system. The inhibitory effect was verified.
(1) Materials and methods for evaluation systems
Cell culture In the above evaluation system, human kidney (HEK293) cells were purchased from ATCC (American Type Culture Collection) and used. HEK293 cells were cultured in DMEM (High glucose, 10% heat-inactivated FBS) at 37 ° C. and 5% CO ₂ .

Plasmid, Transfection In the above evaluation system, HEK293 cells transfected with plasmid pNFAT-Luc (Stratagene) having firefly luciferase introduced downstream of the NFAT binding sequence was used. Specifically, pNFAT-luc (STRATAGENE) in which a firefly luciferase gene was introduced downstream of a quadruple NFAT binding sequence was transfected into HEK293 cells for evaluation of NFAT transcriptional activity. In order to eliminate variation due to transfection efficiency, pRL-CMV (Promega) into which Renilla luciferase was introduced downstream of the CMV promoter was simultaneously transfected in order to correct the signal derived from firefly luciferase.

  Transfection was performed using LipofectAMINE 2000 reagent (Invitrogen) according to the instruction manual. The medium was changed 8 hours after transfection and incubated overnight. Thereafter, the plant extract produced in Example 1 was added (0.5 vol%), and 1 μM Ionomycin was added 1 hour later. After 8 hours, a luciferase reporter assay was performed. Ionomycin is an ionophore specific to calcium ions and is known as a drug that allows calcium ions to flow into cells. The addition of Ionomycin activates calcineurin, a calcium ion-dependent phosphatase, and the transcriptional activity of NFAT increases accordingly, indicating that this system is suitable for searching for NFAT signal activation inhibitors. Conceivable.

Luciferase reporter assay The luciferase reporter assay was performed using Dual-Glo Luciferase Assay System (Promega) according to the instruction manual. That is, after removing the medium, Dual-Glo luciferase reagent diluted 2-fold with PBS was added, stirred, and firefly luciferase activity was measured 20 minutes later. Thereafter, an equal amount of Dual-Glo Stop & Glo reagent was added and stirred, and then Renilla luciferase activity was measured. The luciferase activity was measured using MiniLumat LB 9506 (EG & G BERTHOLD), and the amount of luminescence by luciferase was quantitatively detected. In both cases, the measurement time for luciferase activity was 2 seconds.

Calculation of NFAT signal inhibition rate All NFAT transcriptional activity (firefly luciferase activity) was corrected by dividing by the Renilla luciferase activity introduced for transfection efficiency correction. Thereafter, the NFAT signal inhibition rate was calculated by the following formula.
NFAT signal inhibition rate (%) = 100− (test sample and Ionomycin added group−unstimulated group) / (Ionomycin only added group−unstimulated group) × 100
Based on the above calculation, it is possible to calculate how much the test sample inhibited NFAT signal activation by Ionomycin stimulation.

Results When the NFAT signal inhibition rate by the four plant extracts produced in Example 1 was calculated, the NFAT signal inhibition rate by the licandronone spatacare extract produced in Example 1 (1) was 40.7. %, The inhibition rate of NFAT signal by the extract of the cat beard produced in Example 1 (2) is 67.3%, and the inhibition rate of NFAT signal by the extract of Aotsuki-rafuji produced in Example 1 (3) is 44.1. The NFAT signal inhibition rate by the Tsukushima Namomi extract produced in Example 1 (4) was 66.7%.

  It was revealed that all four plant extracts produced in Example 1 inhibit the NFAT signal. That is, the four types of plant extracts produced in Example 1 can all suppress transcription that is positively controlled by NFAT. Therefore, the four types of plant extracts produced in Example 1 are all excellent NFAT signal inhibitors, such as immunosuppressants, psoriasis therapeutic agents, atopic dermatitis therapeutic agents, (heart) muscle hypertrophy inhibitor, and It was identified as a candidate substance such as an anti-rheumatic drug.

It is a schematic block diagram of the reporter assay mentioned as an example of the method of measuring NFAT signal inhibitory action. It is a schematic block diagram of an NFAT signal showing the binding between NFAT and an NFAT binding site and the promotion of gene transcription downstream thereof.

Claims (7)

  NFAT signal inhibitor comprising as an active ingredient at least one selected from the group consisting of at least one plant selected from Doricandrone spatacare, Neko-no-hige, Aotsuki-rafuji and Tsukushima Namomi, an extract of the plant and components contained in the extract .   The extract is at least selected from a hydroalcoholic extract of the fruit of Doricandronae sputacare, a hydroalcoholic extract of the flowers and branches of the cat beard, a hydroalcoholic extract of a spruce of Aotsuki-rafuji, and an aqueous alcoholic extract of the whole plant of Tsukumenamomi. The NFAT signal inhibitor according to claim 1, which is one kind of extract.   The NFAT signal inhibitor according to claim 2, wherein the alcohol extract is a 95% ethanol extract.   A method for inhibiting NFAT activity, comprising contacting a target cell or tissue with the NFAT signal inhibitor according to any one of claims 1 to 3.   A pharmaceutical composition comprising the NFAT signal inhibitor according to any one of claims 1 to 3 as an active ingredient.   A cosmetic composition comprising the NFAT signal inhibitor according to any one of claims 1 to 3 as an active ingredient.   An external preparation containing the NFAT signal inhibitor according to any one of claims 1 to 3 as an active ingredient.

Images