ES2320814T3 - NUCLEIC ACID SYNTHESIS PROCEDURE. - Google Patents

Abstract

The present invention relates to an oligonucleotide having a novel structure and a method of synthesizing nucleic acid by using the same as a primer. This oligonucleotide is provided at the 5'-side of the primer with a nucleotide sequence substantially the same as a region synthesized with this primer as the origin of synthesis. The present invention realizes synthesis of nucleic acid based on an isotheratal reaction with a simple constitution of reagents. Further, the presents invention provides a method of synthesizing highly specific nucleic acid on the basis of this methods of synthesizing nucleic acid.

Description

Nucleic acid synthesis procedure.

Technical field

The present invention relates to a synthesis procedure of a nucleic acid composed of a specific nucleotide sequence, which is useful as a procedure of nucleic acid amplification.

Technique (background)

An analysis procedure based on the complementarity of a nucleotide sequence of an acid Nucleic can analyze genetic traits directly. By consequently, this analysis is a very powerful means for identification of genetic diseases, cancer formation, microorganisms, etc. In addition, the gene itself is the object of the detection, and in some cases procedures can be omitted difficult and time-consuming such as cultivation.

However, the detection of a target gene present in a very small amount in a sample is generally not easy so amplification of the target gene itself or its detection signal is necessary. As a method to amplify a target gene, the PCR (polymerase chain reaction) procedure is known ( Science , 230, 1350-1354, 1985). Currently, the PCR procedure is the most popular procedure as an in vitro nucleic acid amplification technique. This procedure is firmly established as an excellent detection procedure by virtue of high sensitivity based on the effect of exponential amplification. In addition, since the amplification product can be recovered as DNA, this procedure is widely applied as an important support tool for genetic engineering techniques such as gene cloning and structural determination. However, in the PCR procedure there are the following notable problems: a special temperature controller is necessary for practice; the exponential progress of the amplification reaction causes a problem in quantification; and the samples and reaction solutions are easily contaminated from the outside by allowing mistakenly mixed nucleic acids to function as a template.

When the genomic information accumulates, it has began to attract attention the analysis of the polymorphism of a nucleotide only (SNP). The detection of SNPs by PCR is possible by designing a primer so that its sequence of nucleotides contain the SNP. That is, if a sequence of Complementary nucleotide primer is present or cannot be deduct by determining whether or not a reaction product is present. However, once a complementary string is synthesized by mistake in the PCR by chance, this product works as a mold in the next reaction, thus producing a result wrong. In practice, it is said that strict PCR control it is difficult with the difference of only one base given at the end of the primer. Therefore, it is necessary to improve the specificity in order to apply PCR to the detection of SNPs.

On the one hand, in practice a method of nucleic acid synthesis by a ligase is also used. The CSF procedure (ligase chain reaction; Laffler TG; Garrino JJ; Marshall RL; Ann. Biol. Clin . (Paris), 51: 9, 821-6, 1993) is based on the reaction in which they hybridize two adjacent probes with a target sequence and are linked together by a ligase. The two probes may not bind in the absence of the target nucleotide sequence, and therefore, the presence of the bound product is indicative of the target nucleotide sequence. Because the CSF procedure also requires temperature control to separate a complementary chain from a mold, the same problem arises as in the PCR procedure. For CSF, a procedure to improve specificity has also been published by adding the step of providing a gap between adjacent probes and filling the gap with a DNA polymerase. However, what can be expected in this modified procedure is only specificity, and there remains the problem that temperature control is required. In addition, the use of the additional enzyme leads to an increase in cost.

A procedure called the SDA procedure (chain shift amplification) is also known [ Proc. Natl Acad. Sci. USA , 89, 392-396, 1992] [ Nucleic Acid. Res ., 20, 1691-1696, 1992] as a DNA amplification procedure having a complementary sequence of the target sequence as a template. In the SDA procedure, a special DNA polymerase is used to synthesize a complementary chain that starts from a complementary primer on the 3 'side of a given nucleotide sequence, while displacing a double stranded chain, if any, in the 5 'side of the sequence. In the present specification, the simple expression "side 5 '" or "side 3'" refers to that of a chain that serves as a template. Because the double stranded chain on the 5 'side is displaced by a newly synthesized complementary chain, this technique is called the SDA procedure. The essential temperature change step in the PCR procedure can be eliminated in the SDA procedure by previously inserting a restriction enzyme recognition sequence into a hybridized sequence as a primer. That is, a dent generated by a restriction enzyme gives a 3'-OH group that acts as the origin of the complementary chain synthesis, and the previously synthesized complementary chain is released as a single stranded chain by chain shift synthesis. and then used again as a template for the following complementary chain synthesis. Thus, the complicated control of the essential temperature in the PCR procedure is not required in the SDA procedure.

       \ newpage
    

US 5,744,311 describes procedures for chain shift amplification (SDA) isothermal that can be performed over a broad temperature range using restriction endonucleases thermophilic It is described that the use of thermophilic endonucleases Increases the efficiency of the SDA reaction.

EP 0678582 describes procedures to detect, immobilize or locate extension products of the primer of an SDA reaction in real time by simultaneous generation of secondary amplification products that do not interfere with the Primary SDA reaction.

However, in the SDA procedure, you must use the restriction enzyme that generates a dent in addition to the DNA polymerase chain shift type. This requirement of Additional enzyme is an important cause of the higher cost. Further, because the restriction enzyme is going to be used not for splitting of both double-stranded chains if not for introduction of a dent (that is, excision of only one of the chains), must a dNTP derivative such as α-thio-dNTP as a substrate for the synthesis to make the other chain digestion resistant with the enzyme Therefore, the amplification product by the SDA has a different structure from that of nucleic acid natural, and there is a limit for cleavage with enzymes from restriction or application of the amplification product to the gene cloning In relation to this too, it is a cause Important for the highest cost. In addition, when the procedure of SDA applies to an unknown sequence, there is the possibility of that the same nucleotide sequence as the sequence of restriction enzyme recognition used to introduce a dent, may be present in a region that is going to synthesize In this case, it is possible to prevent synthesizing a complete complementary chain.

NASBA (nucleic acid sequence based amplification, also called the TMA / transcription mediated amplification procedure) is known as a nucleic acid amplification procedure in which complicated temperature control is not necessary. NASBA is a reaction system in which DNA is synthesized by DNA polymerase in the presence of target RNA as a template with a probe that has a T7 promoter added to it, and the product is formed with a second probe in a chain double stranded, followed by transcription by T7 RNA polymerase with the double stranded chain formed as a template to amplify a large amount of RNA ( Nature , 350, 91-92, 1991). The NASBA requires some stages of thermal denaturation until the double stranded DNA has been completed, but the subsequent transcriptional reaction by the T7 RNA polymerase takes place under isothermal conditions. However, a combination of a plurality of enzymes such as reverse transcriptase, RNase H, DNA polymerase and T7 RNA polymerase is essential, and this is unfavorable for cost as is SDA. In addition, because it is complete to set the conditions for a plurality of enzymatic reactions, this procedure has barely been extended as a general analytical procedure. In known nucleic acid amplification reactions, problems such as complicated temperature control and the need for plural enzymes as described above remain.

For these known reactions of nucleic acid synthesis, there are few publications of an attempt to further improve the efficiency of nucleic acid synthesis without sacrificing specificity or cost. For example, in a procedure called RCA (rolling circle amplification), it was shown that single-stranded DNA that had a series of nucleotide sequences complementary to a closed probe could be synthesized continuously in the presence of a target nucleotide sequence (Paul M. Lizardi et al., Nature Genetics , 13, 225-232, July, 1998). In the RCA, a closed probe is used that has a special structure in which each of the 5 'and 3' ends of a single oligonucleotide constitute an adjacent probe in the CSF. Then, the continuous complementary chain synthesis reaction is activated with the closed probe as a template that binds and cycles in the presence of a target nucleotide sequence, by combining with a polymerase that catalyzes the chain-type chain shift reaction. complementary that is synthesized. Thus a single stranded nucleic acid is formed that has a structure of a series of regions each consisting of the same nucleotide sequence. Then a primer is hybridized with this single stranded nucleic acid to synthesize its complementary chain and thus a high degree of amplification is achieved. However, the problem of the need for a plurality of enzymes still remains. In addition, the activation of the complementary chain synthesis depends on the binding reaction of two adjacent regions, and its specificity is basically the same as in the CSF.

For the purpose of supplying the 3'-OH group, there is a known procedure in which a nucleotide sequence is provided at the 3 'end with a complementary sequence thereof and a hairpin loop is formed at the end ( Gene , 71 , 29-40, 1988). The synthesis of the complementary chain with the target sequence itself as a template begins in the hairpin loop to form a single stranded nucleic acid composed of the complementary nucleotide sequence. For example, in WO 9601327 a structure is achieved in which hybridization occurs in the same chain at the end to which a complementary nucleotide sequence has been linked. However, in this procedure, the stage in which the end cancels the base pairing with the complementary chain and the base pairing in the same chain is reconstituted is essential. It is believed that this stage takes place depending on a state of subtle equilibrium at the end of mutually complementary nucleotide sequences that involves base pairing. That is, a steady state of equilibrium is used between base pairing with a complementary chain and base pairing in the same chain, and the only chain that hybridizes with the nucleotide sequence in the same chain serves as the origin of the synthesis of a complementary chain. Therefore, it is considered that strict reaction conditions must be set to achieve high reaction efficiency. In addition, in this prior art, the primer itself forms a loop structure. Therefore, once a primer dimer has been formed, the amplification reaction is automatically initiated regardless of whether or not a target nucleotide sequence is present, and thus a nonspecific synthetic product is formed. This can be a serious problem. In addition, the formation of the primer dimer and subsequent consumption of the primer by the unspecific synthetic reaction leads to a reduction in the amplification efficiency of the desired reaction.

In addition, there is a publication in which a region that did not serve as a template for DNA polymerase, to achieve a hybridization of the 3 'end structure with the same chain (document EP713922). This post also has the same problem that WO 9601327 above, regarding the use of dynamic equilibrium at the end or the possibility of reaction non-specific synthetic due to the formation of a dimer primer. In addition, a special region that does not serve as a mold should be prepared for DNA polymerase as primer.

In addition, in different reactions of signal amplification in which the NASBA principle applies described above, an oligonucleotide is often used that has a fork structure at its end to supply a region double-stranded promoter (document JP-A-5-211873). Without However, these techniques are not what allow the supply successive group 3'-OH for the synthesis of a complementary chain In addition, a loop structure of fork that has a 3 'end hybridized on the same chain, with the purpose of obtaining a template of DNA transcribed by RNA polymerase, in the document JP-A-10-510161 (WO96 / 17079). In this procedure, the mold is amplified using RNA transcription and reverse transcription of RNA to DNA. Without However, in this procedure, the reaction system cannot be constitute without the combination of a plurality of enzymes.

Disclosure of the invention

The object of the present invention is provide a nucleic acid synthesis procedure based In a new beginning. A more specific objective is to provide a procedure capable of performing nucleic acid synthesis It depends on the sequence efficiency with low costs. That is to say, An object of the present invention is to provide a method capable of achieving synthesis and amplification of nucleic acid by a single enzyme, even under reaction conditions isothermal Another object of the present invention is to provide a nucleic acid synthesis procedure that can achieve a high specificity difficult to achieve in the reaction principle known nucleic acid synthesis as well as a procedure of nucleic acid amplification applying said procedure synthetic.

The authors of the present invention focus their attention to the fact that the use of a polymerase that catalyzes Synthesis of chain chain displacement type complementary, it is useful for the synthesis of nucleic acid that does not It depends on the complicated temperature control. That DNA Polymerase is an enzyme used in SDA and RCA. But nevertheless, even if such an enzyme is used, another enzyme of reaction to deliver the 3'-OH group as origin of the synthesis in known media based on primers, such as SDA.

In these circumstances, the authors of the present invention examined the supply of the group 3'-OH from a point of view completely different from the known procedure. As a result, the authors of the present invention found that using an oligonucleotide that It had a special structure, the 3'-OH group can be supplied without any additional enzymatic reaction, completing thus the present invention. That is, the present invention is refers to a nucleic acid synthesis procedure, to a nucleic acid amplification method applying said nucleic acid synthesis procedure and to a new group of primers that allow such procedures, as follows:

1. A set of primers for the synthesis of a nucleic acid that has complementary complementary chains united in a single chain chain, comprising the following elements:

i) a first oligonucleotide primer that it comprises at least two regions F2 and F1c, in which F1c is attached next to 5 'of F2, and in which

F2 is a region that has a sequence of complementary nucleotides of an arbitrary region F2c in an acid nucleic template that has a specific nucleotide sequence, Y

F1c is a region that have substantially the same nucleotide sequence as an F1c region located on the side 5 'of the F2c region in the template nucleic acid that has a specific nucleotide sequence;

ii) a second oligonucleotide primer having a nucleotide sequence complementary to an arbitrary region R2c in a complementary chain synthesized with the first oligonucleotide as the origin of the synthesis that has a sequence of specific nucleotides;

iii) a first outer primer having a complementary nucleotide sequence of an F3c region located in the 3 'side of the F2c region in the nucleic acid that serves as mold;

iv) a second outer primer having a complementary nucleotide sequence of an R3c region located in the 3 'side of the arbitrary R2c region in the complementary chain synthesized with the first oligonucleotide as the origin of the synthesis.

       \ newpage
    

2. The set of primers according to the Embodiment 1 above, wherein the second oligonucleotide primer it has a region R1c, in which R1c is attached to the 5 'side of R2, and in which

R1c is a region that has substantially the same nucleotide sequence as an R1c region located on the side 5 'of the R2c region in the template nucleic acid that has a specific nucleotide sequence.

3. A kit for the synthesis of a nucleic acid which has complementary chains alternately joined in a single chain, which includes the following elements:

i) a first oligonucleotide primer that it comprises at least two regions F2 and F1c, in which F1c is linked next to 5 'of F2, and in which

F2 is a region that has a sequence of complementary nucleotides of an arbitrary region F2c in an acid nucleic template that has a specific nucleotide sequence, Y

F1c is a region that has substantially the same nucleotide sequence as an F1c region located on the side 5 'of the F2c region in the template nucleic acid that has a specific nucleotide sequence;

ii) a second oligonucleotide primer that has a nucleotide sequence complementary to an R2c region arbitrary in a complementary string synthesized with the first oligonucleotide as the origin of the synthesis that has a specific nucleotide sequence;

iii) a first outer primer having a complementary nucleotide sequence of an F3c region located in the 3 'side of the F2c region in the nucleic acid that serves as mold;

iv) a second outer primer having a complementary nucleotide sequence of an R3c region located in the 3 'side of the arbitrary R2c region in the complementary chain synthesized with the first oligonucleotide as the origin of the synthesis.

v) a DNA polymerase that catalyzes the reaction of chain offset type of the complementary chain that synthesizes; Y

vi) a nucleotide that serves as a substrate for element v).

4. A procedure to synthesize an acid nucleic that has alternately linked complementary chains in a single chain chain, which includes:

A) mix the following components i) to vi) With the sample nucleic acid as a template:

i) a first oligonucleotide primer that it comprises at least two regions F2 and F1c, in which F1c is linked next to 5 'of F2, and in which

F2 is a region that has a sequence of complementary nucleotides of an arbitrary region F2c in an acid nucleic template that has a specific nucleotide sequence, Y

F1c is a region that has substantially the same nucleotide sequence as an F1c region located on the side 5 'of the F2c region in the template nucleic acid that has a specific nucleotide sequence;

ii) a second oligonucleotide primer having a nucleotide sequence complementary to an R2c region arbitrary in a complementary string synthesized with the first oligonucleotide as the origin of the synthesis, which has a specific nucleotide sequence;

iii) a first outer primer having a complementary nucleotide sequence of an F3c region located in the 3 'side of the F2c region in the nucleic acid that serves as mold;

iv) a second outer primer having a complementary nucleotide sequence of an R3c region located in the 3 'side of the arbitrary R2c region in the complementary chain synthesized with the first oligonucleotide as the origin of the synthesis.

v) a DNA polymerase that catalyzes the reaction of chain offset type of the complementary chain that synthesizes; Y

vi) a nucleotide that serves as a substrate for item v); Y

B) incubate the mixture at a temperature such that the nucleotide sequence that constitutes the first and second oligonucleotide primers can form base pairing stable with the mold.

       \ newpage
    

The nucleic acid that has sequences of complementary nucleotides linked alternately in a chain single chain as the object of synthesis of the present invention, means a nucleic acid that has nucleotide sequences mutually complementary joined side by side in a single chain chain. In addition, it must contain a sequence of nucleotides to form a loop between complementary chains. In the present invention, this sequence is called the sequence loop former The nucleic acid synthesized herein invention is composed substantially of chains mutually complementary joined by the loop forming sequence. In In general, a chain not separated into 2 or more molecules after dissociation of base pairing is called a chain single chain regardless of whether partially or not base pairing. The complementary nucleotide sequence it can form base pairing in the same chain. A product of intramolecular base mating, which can be obtained allowing the nucleic acid to have nucleotide sequences complementary joined alternately in a single chain in accordance with the present invention, to form pairing of bases in the same chain, gives a region that constitutes a chain seemingly double-stranded and a loop that does not involve pairing of bases.

That is, the nucleic acid that has sequences of complementary nucleotides joined alternately in a single chain chain according to the present invention, contains complementary nucleotide sequences capable of hybridizing in the same chain, and its hybridized product can be defined as an acid single stranded nucleic constituting a loop that does not imply base mating on a bent hinge portion. A nucleotide that has a complementary nucleotide sequence in it It can hybridize with the loop that does not involve base pairing. The loop forming sequence may be a sequence of arbitrary nucleotides The loop forming sequence is capable of base pairing so that the synthesis of a chain begins complementary to displacement, and preferably is provided with a distinguishable sequence from a sequence of nucleotides located in the other region, in order to achieve the specific hybridization. For example, in a preferred embodiment, the loop forming sequence contains substantially the same nucleotide sequence that an F2c (or R2c) region located in the 3 'side of a region (i.e. F1c or R1c) derived from acid nucleic as a template and hybridized in the same chain.

In the present invention, substantially the same nucleotide sequence, is defined as follows. That is to say, when a complementary string synthesized with a certain sequence as a hybrid template with a target nucleotide sequence to give the origin of the complementary chain that is synthesized, this particular sequence is substantially the same as the target nucleotide sequence. For example, substantially the same sequence that F2 includes not only absolutely the same nucleotide sequence that F2 if not also a sequence of nucleotides capable of functioning as a template giving a sequence of nucleotides capable of hybridizing with F2 and acting as the origin of the complementary string that is synthesized.

The term "hybridize" herein invention means the formation of a double stranded structure of nucleic acid by base pairing based on the law of Watson-Crick Therefore, even if a nucleic acid chain that forms base pairing be a single chain, hybridization occurs if the sequences of complementary intramolecular nucleotides are paired by bases. In the present invention, hybridization and hybridization have the same meaning as the nucleic acid forms a double-stranded structure by base pairing.

The number of nucleotide sequence pairs complementary constituting the nucleic acid according to the present invention is at least 1. According to a desired mode of The present invention may be 2 or more. In this case theoretically there is no upper limit to the number of sequence pairs of complementary nucleotides that constitute the nucleic acid. When the nucleic acid as a synthetic product of the present invention is constituted by a plurality of groups of complementary nucleotide sequences, this nucleic acid is composed of repeated identical nucleotide sequences.

The nucleic acid that has the sequences of complementary nucleotides linked alternately in a chain single chain synthesized by the present invention, may not have the same structure as natural nucleic acid. It is known that yes a nucleotide derivative is used as a substrate when synthesized the nucleic acid by action of a DNA polymerase, you can synthesize a nucleic acid derivative. Nucleotide derivative used includes nucleotides labeled with a radioisotope or derivatives of nucleotides labeled with a binding ligand such as biotin or digoxin. These nucleotide derivatives can be used to mark derivatives of nucleic acid as a product. Alternatively, if fluorescent nucleotides are used as a substrate, the acid Nucleic as a product, it can be a fluorescent derivative. Further, This product can be DNA or RNA. Which form is determined by a combination of the structure of a primer, the type of polymerization substrate and polymerization reagents to carry out the polymerization of the nucleic acid.

The synthesis of the nucleic acid that has the structure described above, can be started using a DNA polymerase that has chain shifting activity and the nucleic acid that is provided at its 3 'end with an F1 region able to hybridize with a part of F1c in the same chain and that after the hybridization of the F1 region with F1c, is capable of forming a loop which contains an F2c region capable of base pairing. There is many publications on the chain synthesis reaction complementary in which a hairpin loop is formed and the own sample sequence as a mold, while in the present invention, the part of the hairpin loop is provided with a region that is capable of base mating, and there is a new characteristic in the use of this region in the synthesis of the chain complementary. By using this region as the origin of the synthesis, a complementary chain is previously moved synthesized with the sample sequence itself as a template. After, a region R1c (arbitrary region) located at the 3 'end of the scroll chain is in a state ready for the base pairing. A region that has a sequence complementary to this R1c hybridized with it, giving as result the formation of the nucleic acid (2 molecules) that has a nucleotide sequence that extends from F1 to R1c and its complementary chain alternately linked by the sequence loop former Said arbitrary region such as the R1c region above, can be selected arbitrarily with the condition of that can hybridize with a polynucleotide that has a sequence of complementary nucleotides of this region, and that a chain complementary synthesized with the polynucleotide as the origin of the synthesis necessarily has functions for the present invention.

In the present invention, the expression is used "nucleic acid". The nucleic acid in the present invention It generally includes both DNA and RNA. However, the acid nucleic whose nucleotide is replaced by an artificial derivative or the modified nucleic acid of natural DNA or RNA is also included in the nucleic acid of the present invention, provided that function as a template for the synthesis of the complementary chain.  The nucleic acid of the present invention in general is contained in a biological sample. The biological sample includes animal, plant or microbial tissues, cells, cultures and excretions, or extracts thereof. The biological sample of the present invention includes parasitic genomic DNA or RNA intracellular, such as virus or mycoplasma. The nucleic acid of the The present invention can be obtained from nucleic acid contained in said biological sample. For example, cDNA synthesized from of the mRNA, or the nucleic acid amplified based on the acid nucleic obtained from the biological sample, is a typical example of nucleic acid of the present invention.

The characteristic nucleic acid of the present invention which is provided at its 3 'end with a region F1 capable to hybridize with an F1c part in the same chain and which after hybridization of the F1 region with F1c is capable of forming a loop that contains an F2c region capable of base pairing, it can be Get by different procedures. In the realization more preferred, the chain synthesis reaction can be used complementary using an oligonucleotide having the following structure, to give the structure.

That is, the oligonucleotide useful herein invention, consists of at least two following regions X2 and X1c, in which X1c is attached to the 5 'side of X2.

X2: a region that has a sequence of complementary nucleotides of an X2c region in the nucleic acid which has a specific nucleotide sequence.

X1c: a region that has substantially the same nucleotide sequence as an X1c region located on the side 5 'of the X2c region in the nucleic acid having a sequence of specific nucleotides

Here, the nucleic acid that has a sequence of specific nucleotides by which the structure is determined of the oligonucleotide of the invention, refers to the nucleic acid which serves as a template, when the oligonucleotide of the present invention is used as a primer. In the event that the detection of nucleic acid is based on the synthesis procedure of the present invention, the nucleic acid having a sequence of specific nucleotides is a detection target or an acid nucleic obtained from the detection target. The nucleic acid that has a specific nucleotide sequence refers to acid nucleic in which at least a part of the sequence of Nucleotides are revealed or predictable. The sequence part of disclosed nucleotides is the X2c region and the X1c region located in its side 5 '. It can be assumed that these 2 regions are contiguous or They are located apart from each other. Through the relationship of relative positions of the two, the state of a loop is determined formed after nucleic acid self-hybridization as a product The distance between the two is preferably not very separated from each other, so that the nucleic acid as product undergo self-hybridization preferably against intermolecular hybridization. By consequently, the ratio of positions of the two preferably is that they are contiguous at a distance normally from 0 to 100 bases. However, in the formation of a loop by self-hybridization described below can be the case, it would be disadvantageous for the formation of a loop in a desired state, that the two are too close between yes. In the loop, a structure is necessary for hybridization of a new oligonucleotide and to easily initiate the reaction of chain shift of the synthesis of a complementary chain  with said oligonucleotide as the origin of the synthesis. Plus preferably, the distance between region X2c and region X1c located on the 5 'side of X2c is designed to be between 0 and 100 bases, more desirably from 10 to 70 bases. This numerical value shows a length that excludes X1c and X2. The number of bases that they constitute the part of a loop is that of its length plus a region corresponding to X2.

The terms both "same" and "complementary" used for sequence characterization nucleotide constituting the oligonucleotide based on the present invention does not mean that they are totally the same or absolutely complementary. That is, the same sequence as a certain sequence includes complementary sequences of nucleotide sequences capable of hybridizing with a given sequence. On the other hand, the complementary sequence means a sequence capable of hybridizing under restrictive conditions to give a 3 'end that serves as the origin of the chain synthesis complementary.

Normally, regions X2 and X1c that constitute the oligonucleotide of the present invention for the nucleic acid having a specific nucleotide sequence, They are located contiguously without overlapping. If there is one common part in both nucleotide sequences, the two may be partially overlapping Because X2 must work as a primer, there should always be a 3 'end. Moreover, X1c must give the function of a primer as described below, by 3 'end of a complementary chain synthesized with acid nucleic as a template, and therefore must be arranged in the 5 'end. The complementary chain obtained with this oligonucleotide as the origin of the synthesis, serves as a template for the synthesis of the complementary chain in the reverse direction in the next stage, and finally the oligonucleotide part of the The present invention is copied as a mold in a complementary chain. The 3 'end generated by copy has the nucleotide sequence X1, which hybridizes with X1c in the same chain to form a loop.

In the present invention, the oligonucleotide means the one that satisfies the 2 requirements, that is, must be able form the pairing of complementary bases and give a group -OH that serves as the origin of the synthesis of the complementary chain in the 3 'end. Therefore, its main chain is not necessarily limited to that by phosphodiester bonds. By example, it may be composed of a phosphothioate derivative that has S instead of O as the main chain or a nucleic acid peptide based on peptide bonds. The bases can be those capable of mating complementary bases. In the nature, there are 5 bases, that is A, C, T, G and U, but the base It can be an analog such as bromodeoxyuridine. Oligonucleotide used in the present invention preferably works not only as the origin of the synthesis if not also as a mold for the synthesis of the complementary chain. The term polynucleotide in The present invention includes oligonucleotides. The term "polynucleotide" is used in the case where the length of string is not limited while the term "oligonucleotide" is used to refer to a polymer of nucleotides that have a relatively long chain length short.

The oligonucleotide according to the present invention has a chain length such that it is capable of giving base pairing with a complementary chain and maintain the specificity needed in the given environment in the different nucleic acid synthesis reactions described below. Specifically, it is composed of 5 to 200 base pairs, plus preferably 10 to 50 base pairs. Chain length of a primer that recognizes the known polymerase that catalyzes the synthetic sequence-dependent nucleic acid reaction it has at least about 5 bases, so that the length of the chain of the part that hybridizes must be longer than this. In addition, statistically a length of 10 bases or more is desired with  in order to expect specificity as a nucleotide sequence. By another part, the preparation of a nucleotide sequence too long by chemical synthesis is difficult, and therefore the chain length described above has been illustrated as a desired interval The length of the chain illustrated here is refers to the length of the chain of a part that hybridizes with a complementary chain As described below, the oligonucleotide according to the present invention can hybridize finally with at least 2 regions individually. By consequently, it should be understood that the length of the chain illustrated here is the chain length of each region that constitutes the oligonucleotide

In addition, the oligonucleotide according to the present invention can be labeled with a known marker substance. The marker substance includes binding ligands such as digoxin and biotin, enzymes, fluorescent substances and luminescent substances, and radioisotopes. The substitution techniques of a base comprising an oligonucleotide with a fluorescent analog are also known (WO95 / 05391, Proc. Natl. Acad. Sci . USA, 91, 6644-6640, 1994).

Other oligonucleotides according to the present invention, they can also be linked to a solid phase. Alternatively, an arbitrary part of the oligonucleotide can be label with a binding ligand such as biotin, and it can be immobilize indirectly by means of a union couple such as immobilized avidin. When the immobilized oligonucleotide is used as the origin of the synthesis, the nucleic acid, as a product of synthetic reaction, is captured by the solid phase, thus facilitating their separation The separated product can be detected by a specific indicator of nucleic acid or by hybridization with a marking probe The target nucleic acid fragments are also can recover by digesting the product with enzymes of arbitrary restriction.

The term "mold" used herein invention means nucleic acid that serves as a template for synthesize a complementary chain. A complementary chain that it has a nucleotide sequence complementary to that of the template it has the meaning like that of a chain that corresponds to the mold, but the relationship between the two is simply relative. That is to say, a synthesized string like the complementary string can work  Again as a mold. That is, the complementary chain can Become a mold.

The oligonucleotide useful in the present invention It is not limited to the 2 regions described above and may contain An additional region. Although X2 and X1c are arranged in the 3 'and 5' ends respectively, can be interposed between them an arbitrary sequence. For example, there may be a site of restriction enzyme recognition, a promoter recognized by RNA polymerase, or DNA encoding ribozymes. Using it as a restriction enzyme recognition sequence, acid nucleic that has an alternately complementary sequence united in a single chain chain, as a synthetic product of the present invention, can be cleaved into nucleic acids double-stranders of the same length. By arranging a promoter sequence recognized by RNA polymerase, the product synthetic of the present invention serves as a mold to allow subsequent transcription in RNA. Also providing DNA that encodes ribozyme, a system is achieved in which the product of transcription is self-cleaved. These nucleotide sequences additional are those that work after formed in a chain double-stranded Therefore, when the nucleic acid single chain in accordance with the present invention has formed a loop, these sequences do not work. They don't work until the nucleic acid has elongated and hybridized in the absence of a loop, with a chain that has a nucleotide sequence complementary.

       \ newpage
    

When a promoter is combined with the oligonucleotide based on the present invention in a direction that allows transcription of the synthesized region, the reaction product based on the present invention in which the same nucleotide sequence is repeated, achieves a transcription system very effective. By combining this system with an appropriate expression system, translation into a protein is also feasible. That is, the system can be used for protein transcription and translation in bacteria or animal cells or in vitro .

The oligonucleotide of the present invention that It has the structure described above, it can be synthesized chemically Alternatively, the nucleic acid can be split off, p. ex. with restriction enzymes, and modify so that is composed of, or linked in, the nucleotide sequence described before.

The basic principle of the reaction to lead to perform the synthesis using the useful oligonucleotide described above combined with the DNA polymerase that has the activity of chain shift, in the acid synthesis reaction nucleic according to the present invention, is described with reference to figures 5 to 6. The oligonucleotide described above (first oligonucleotide, FA in Fig. 5) hybridizes to X2 (corresponding to F2) with the nucleic acid as a template, for provide the origin of the synthesis of the complementary chain. In fig. 5, a complementary chain synthesized from FA as the origin of the synthesis is displaced by chain synthesis complementary (described below) from a primer outer (first outer primer, F3), to form a chain single chain (fig. 5-A). When later it takes out the synthesis of the complementary chain of the chain resulting complementary, the 3 'end of the nucleic acid synthesized as a complementary chain in fig. 5-A has a nucleotide sequence complementary to the first oligonucleotide of the present invention. That is, because the 5 'end of the first oligonucleotide of The present invention has the same sequence as an X1c region (corresponding to F1c), the 3 'end of the nucleic acid as well synthesized has a complementary sequence X1 (F1). Fig. 5 shows that the complementary chain synthesized from second oligonucleotide, R1, as the origin of the synthesis shifts by the synthesis of the complementary chain by the second primer R3 exterior as the origin of the synthesis. Once the part of 3 'end is ready for base pairing by this displacement, X1 (F1) at the 3 'end hybridizes with X1c (F1c) in the same chain, and the elongation reaction develops with himself as a mold (Fig. 5-B). After, X2c (F2c) located at its 3 'end is left as a loop that does not imply base pairing. X2 (F2) in the first oligonucleotide of according to the present invention, hybridizes with this loop, and is synthesizes a complementary chain with said first oligonucleotide as the origin of the synthesis (Fig. 5-B). A product of the complementary chain synthesis reaction with the product previously synthesized as a mold, is displaced by the chain shift reaction, so that it is ready for base pairing.

By the basic constitution using a type of oligonucleotide according to the present description and a arbitrary reverse primer capable of carrying out the synthesis of nucleic acid when a complementary chain is used as a template synthesized with said oligonucleotide as a primer, it can be obtained a plurality of synthetic nucleic acid products as shown in fig. 6. As can be seen in fig. 6, (D) is the desired nucleic acid product of the invention having the complementary nucleotide sequence alternately linked in a single chain chain. Once converted into a chain single chain for a treatment such as denaturation thermal, the other product (E) again serves as a mold to form (D). If the product (D) as a nucleic acid in the form of a chain double-stranded becomes a single-stranded chain by thermal denaturation, hybridization occurs within the same chain with a high probability without forming the chain original double stranded. This is because a complementary chain having the same melting temperature (Tf) undergoes reaction intramolecular preferably against the reaction intermolecular Each single chain obtained from the product (D) hybridized on the same chain hybridized on the same chain and returns to state of (B), and each chain also gives a molecule of (D) and (E) respectively. Repeating these stages, it can be synthesized successively the nucleic acid that has the sequences of complementary nucleotides linked alternately in a chain single chain. The mold and the product formed in cycle 1 increase exponentially, thus making the reaction very effective.

To achieve the state of fig. 5 (A), the complementary string initially synthesized, at least in the part  in which the hybrid inverse primer must be ready for base pairing. This stage can be achieved through a arbitrary procedure That is, a separate preparation is made. first outer primer (F3), which hybridizes with the first mold in an F3c region on the 3 'side of the F2c region in which the first oligonucleotide of the present invention hybridizes. Yes this first primer is used as the origin of the synthesis to synthesize a complementary chain by means of a polymerase that catalyzes the Synthesis of chain chain displacement type complementary, the complementary chain synthesized from F2c how the origin of the synthesis in the invention shifts, and how result the region R1c to be hybridized with R1 is prepared to than this list for base pairing (Fig. 5). Using the chain shift reaction, the reaction so far can pass in isothermal conditions.

When an external primer is used, the synthesis a Starting from the outer primer (F3) should be started after synthesis from F2c. In the simplest procedure, the concentration of the inner primer becomes greater than the concentration of the outer primer. Specifically, the primers they are normally used with a concentration difference of 2 to 50 times, preferably 4 to 10 times, so that the reaction It may take place as expected. In addition, the melting temperature (Tf) of the outer primer is set to be less than the Tf of X1 (corresponding to F1 and R1) on the inner primer, so that Synthesis time can be controlled. That is, (primer outer F3: F3c) \ leq (F2c / F2) \ leq (F1c / F1) or (outer primer  / region on the 3 'side in the mold) \ leq (X2c: X2) \ leq (X1c: X1). Here, the reason for (F2c / F2) \ leq (F1c / F1) is for the hybridization between F1c / F1 before hybridization of F2 with the loop. Hybridization between F1c / F1 is an intramolecular reaction and therefore it can take place preferentially with probability high. However, it is significant to consider the Tf in order to give more convenient reaction conditions. Normally they should consider similar conditions even when designing a reverse primer. Using this relationship, you can achieve statistically ideal reaction conditions. If others are set conditions, the melting temperature (Tf) can be calculated theoretically by a combination of the length of a chain complementary to hybridization and the bases that constitute the base pairing. Therefore, experts in the field they can obtain the preferred conditions based on the description of this specification.

In addition, the phenomenon called contiguous stacking can also be applied to control the moment of hybridization of the outer primer. Contiguous stacking is a phenomenon in which an oligonucleotide that is not able to hybridize independently, is made to be capable of hybridization after being contiguous to the part of the double stranded chain (Chiara Borghesi-Nicoletti et al., Bio Techniques , 12 , 474-477 (1992)). That is, the outer primer is designed to be contiguous with F2c (X2c) and not capable of hybridizing independently. By doing this, hybridization of the outer primer does not occur until F2c (X2c) does not hybridize, and thus F2c (X2c) hybridization occurs preferentially. Based on this principle, the examples show the adjustment of the nucleotide sequence of an oligonucleotide necessary as a primer for a series of reactions. This stage can also be achieved by denaturation with heat or with a helicase DNA.

If the nucleic acid mold that has F2c (X2c) is RNA, the state of Fig. 5- (A) can also be achieved by a different procedure For example, if this RNA chain is decomposes, R1 is ready for base pairing. That is to say, F2 hybridizes with F2c in the RNA and synthesizes a chain complementary as DNA by reverse transcriptase. RNA which serves as a mold is broken down by denaturation with alkali or by enzymatic treatment with a ribonuclease that acts on the RNA in a double stranded DNA / RNA chain so that the DNA synthesized from F2 is formed in a single chain chain. For the enzyme to selectively break down the RNA in a chain double stranded DNA / RNA, ribonuclease activity can be used of RNase H or some reverse transcriptases. In this way, the reverse primer can hybridize with R1c which is capable of mating of bases. Therefore, the outer primer becomes unnecessary to make R1c ready for base pairing.

Alternatively, the activity of reverse transcriptase chain shift for the chain displacement by an external primer as has described before. In this case, a system of reaction by reverse transcriptase alone. That is, using RNA as a template, through a reverse transcriptase you can synthesize a complementary chain from F2 that hybridizes with F2c in the mold, and synthesize a complementary chain from the outer primer F3 as the origin of the synthesis that hybridizes with F3c located on the 3 'side of F2c, and simultaneously displace the complementary chain previously synthesized. When the reverse transcriptase performs the synthesis reaction of a complementary chain with DNA as a template, all reactions of synthesis of complementary chains, including the synthesis of a complementary chain with R1 as the origin of the synthesis that hybridized with R1c in the complementary chain displaced as a template, the synthesis of a complementary chain with R3 as the origin of the  synthesis that hybridizes with R3c located on the 3 'side of R1c and the simultaneous displacement reaction, go through the reverse transcriptase. The transcriptase cannot be expected inverse present the chain shift activity of DNA / RNA under the given reaction conditions, and can be combined a DNA polymerase that has the displacement activity of chain described before. The way to obtain a first nucleic acid single stranded RNA as template as described above, It constitutes a preferred mode of the present invention. For other part, if a DNA polymerase such as Bca DNA polymerase is used which has both chain shift activity and Reverse transcriptase activity, not just the synthesis of a first single stranded nucleic acid from RNA, if not also the subsequent reaction with DNA as a template, may take place similar by the same enzyme.

The reaction system described above implies different variations inherent in the present invention using the reverse primer that has a specific structure. The variation More effective is described below. That is, the oligonucleotide constituted as described in [5] is used as the primer reverse in the most advantageous way of the present invention. He oligonucleotide in [5] is an oligonucleotide in which regions arbitrary R2c and R1c in a complementary chain synthesized with F2 as a primer, are X2c and X1c, respectively. Through the use of said reverse primer, a series of reactions occur for form a loop and to synthesize and shift a string complementary to this loop, both in the homosense chain and in the antisense (direct side and reverse side). As a result, the reaction efficiency for nucleic acid synthesis that has complementary nucleotide sequences alternately united in a single chain chain in accordance with this invention, it improves a lot while a series of these reactions It is practicable in isothermal conditions. Hereinafter, this mode is described in more detail with reference to figures 1 to 3 in which this mode is summarized.

In the following way, 2 types of oligonucleotides based on the present invention. For the explanation, these are called FA and RA. The regions that constitute FA and RA are the following:

X2 X1c FA F2 F1c RA R2 R1c

Here, F2 is a nucleotide sequence complementary to an F2c region in the nucleic acid as the template.  R2 is a nucleotide sequence complementary to an R2c region arbitrary contained in a complementary string synthesized with F2 as primer. F1c and R1c are arbitrary nucleotide sequences located downstream of F2c and R2c, respectively. The distance between F2 and R2 can be arbitrary. Even if its length is approximately 1 kbp, sufficient synthesis is feasible in suitable conditions, although depending on the synthetic capacity of DNA polymerase to perform the synthesis of a chain complementary. Specifically, when DNA polymerase is used Bst, the desired product is synthesized with certainty if the distance between F2 and R2c is 800 bp, preferably 500 bp or less. At temperature cycle involving PCR, the reduction in Enzyme activity by the stress of temperature change is considers that it reduces the efficiency of the synthesis of a sequence of long nucleotides In a preferred mode of the present invention, no the temperature cycle is required in the amplification stage of nucleic acid, and thus the synthesis and amplification of a even long nucleotide sequence can be achieved with certainty.

First, F2 in FA hybridizes with nucleic acid as a mold and used as the origin of the synthesis of a chain complementary. The subsequent reaction steps until Fig. 1 (4) are the same as previously described in mode basic (Fig. 5) in the present invention. The hybridized sequence as F3 in Fig. 1 (2) is the first outer primer described before. A DNA polymerase is used to carry out the chain shift type synthesis of a chain complementary with this primer as the origin of the synthesis, of so that the complementary string synthesized from FA is moves and is ready for base pairing.

When R2c is ready for pairing bases in (4), the second RA oligonucleotide as a reverse primer hybridizes therein in the R2c / R2 combination. The synthesis of a complementary chain with this site as the origin of the synthesis elapses until the chain reaches F1c at the 5 'end of FA. After this synthesis reaction of a complementary chain, the second outer primer R3 for hybrid displacement in the same to synthesize a complementary chain, during which the chain shift also elapses so that the chain complementary synthesized from RA as the origin of the synthesis shifts. In the complementary chain thus displaced, RA is located on its 5 'side and a complementary sequence of FA It is located at its 3 'end.

On the 3 'side of the single stranded nucleic acid thus displaced, there is a complementary F1 sequence of F1c in the same chain F1 hybridizes rapidly with F1c in the same molecule to start the synthesis of a complementary chain. When he 3 '(F1) end hybridizes with F1c in the same chain, a loop containing F2c. As is evident from Fig. 2- (7), the part of this loop remains ready for pairing of bases. The first FA oligonucleotide of the invention having a complementary nucleotide sequence of F2c hybridizes with the part of this loop and acts as the origin of the synthesis of a chain complementary (7). The synthesis of a complementary chain to from the loop elapses at the same time as the product of reaction in the synthesis of the complementary chain previously started from F1. As a result, the complementary chain synthesized with itself as a mold prepares for mating of bases again at the 3 'end. This 3 'end is provided of a region R1 capable of hybridizing with R1c in the same chain, and preferably hybridize both due to the rapid reaction intramolecular The same reaction as the reaction described before starting from the 3 'end synthesized with FA as a mold also It takes place in this region. As a result, the nucleic acid that has the complementary nucleotide sequences attached alternatively in the same single chain chain according to the The present invention continues to extend from R1 as the starting point at the 3 'end, by successive synthesis of a complementary chain and its subsequent displacement. Because that R2c is always contained in the loop formed by the intramolecular hybridization of R1 of the 3 'end, the second oligonucleotide (RA) provided with R2 hybridizes with the loop in the 3 'end in the subsequent reaction.

When attention is paid to nucleic acid synthesized as a complementary chain from the oligonucleotide which hybridizes with the loop in the elongated single stranded nucleic acid with itself as a mold, acid synthesis also takes place nucleic that has complementary complementary nucleotide sequences alternatively in the single chain chain according to the present invention That is, the synthesis of a chain Complementary from the loop is completed when it reaches RA, p. eg, in Fig. 2- (7). Then when the nucleic acid displaced by this synthesis of nucleic acid begins the synthesis of the chain complementary (Fig. 3- (8)), the reaction reaches the loop that was before the origin of the synthesis, and the displacement. In this way, the nucleic acid that has started to synthesize from the loop also scrolls, and as result, R1 is obtained from the 3 'end capable of hybridizing in the same chain (Fig. 3- (10)). This R1 of the 3 'end hybridizes with R1c in the same chain to start the synthesis of the chain complementary. This reaction is the same as in Fig. 2- (7), except that F is used instead of R. Therefore, the structure shown in Fig. 3- (10) can function as a new acid nucleic that continues the lengthening and formation again nucleic acid.

The nucleic acid synthesis reaction, initiated from the nucleic acid shown in Fig. 3- (10), produces elongation from F1 of the 3 'end as the origin of the synthesis, as opposed to the reaction described above. Is that is, in the present invention, when a nucleic acid is elongated, the reaction continues to continue supplying a nucleic acid new that starts elongation separately. In addition, when lengthens the chain, gives rise to a plurality of forming sequences loop not only at the end but also on the same chain. When these loop-forming sequences are ready for base pairing by the synthetic displacement reaction chain, an oligonucleotide hybridized therein to serve as a base for the formation reaction of a new nucleic acid. In addition, effective amplification is achieved by the synthetic reaction starting not only in the end but also in the chain. He second RA oligonucleotide based on the present invention is combines as a reverse primer as described above, so that elongation occurs and subsequent formation of an acid new nucleic In addition, in the present invention, the acid itself newly formed nucleic lengthens and results in the subsequent formation of a new nucleic acid. A series of these continues theoretically permanently reactions to achieve a very effective nucleic acid amplification. In addition, the reaction in The present invention can be carried out under conditions isothermal

Reaction products so accumulated have a structure that has a nucleotide sequence between F1 and R1 and its complementary sequence joined alternately therein. However, both ends of the repeating unit have a region consisting of the successive nucleotide sequence F2-F1 (F2c-F1c) and R2-R1 (R2c-R1c). For example, in the Fig. 3- (9), the sequences (R2-F2c) - (F1-R2c) - (R1-F1c) - (F2-R2c) they are joined in this order from the 5 'side. This is because the amplification reaction based on the present invention elapses according to the principle that the reaction starts from of F2 (or R2) with an oligonucleotide as the origin of the synthesis and then a complementary chain is lengthened by the reaction synthetic from F1 (or R1) with the 3 'end as the origin of the synthesis

Here, in the most preferred mode, the FA and RA oligonucleotides according to the present invention as oligonucleotides that hybridize with the part of a loop. But nevertheless, even if these oligonucleotides that have a Limited structure, the amplification reaction according to the The present invention can be carried out using an oligonucleotide. able to start the synthesis of a complementary chain from of the loop That is, the elongation of the 3 'end, once displaced by a complementary chain synthesized from loop, give the part of a loop again. Because the acid nucleic that has complementary complementary nucleotide sequences alternatively in a single chain chain it is always used as Mold in the complementary chain synthesis starting from the loop, it is evident that the desired nucleic acid can be synthesized in the present invention However, the nucleic acid thus synthesized performs the synthesis of a complementary chain forming a loop after displacement, but there is no 3 'end available for the subsequent formation of a loop, and therefore cannot function as a new mold. Therefore, in this case, the product, unlike the nucleic acid that begins to synthesized by FA or RA, cannot be expected to be amplified exponentially. For this reason, an oligonucleotide that has the FA or RA structure is useful for a very effective acid synthesis nucleic based on the present invention.

A series of these reactions go through addition of the following components to the nucleic acid single chain as a mold and then incubating the mixture to a temperature such that the nucleotide sequence constituting FA and RA can form stable base pairing with its sequence of complementary nucleotides while maintaining the enzymatic activity.

- 4 types of oligonucleotides:

quad

FA, (first oligonucleotide)

quad

RA, (second oligonucleotide)

quad

first outer primer F3, and

quad

second outer primer R3,

- DNA polymerase to perform the synthesis of chain shift type, complementary chain,

- an oligonucleotide that serves as a substrate for DNA polymerase.

       \ vskip1.000000 \ baselineskip
    

Therefore, the cycle of temperature as in the PCR. Stable base pairing to which reference is made herein, it refers to a state wherein at least a part of an oligonucleotide present in the reaction system, can give rise to the synthesis of the chain complementary. For example, the desired condition to produce the stable base pairing is set at a lower temperature than the melting temperature (Tf). In general, the melting temperature (Tf) the temperature at which 50% of acids is considered nuclei that have nucleotide sequences mutually Complementary are paired by bases. The adjustment to the melting temperature (Tf) or lower, is not an essential condition in the present invention, but it is one of the reaction conditions that must be considered to achieve high efficiency in the synthesis. If the nucleic acid to be used as a template is a double stranded chain, the nucleic acid must be prepared, at least in the region with which the oligonucleotide hybridizes, for the base pairing. For this, in general the thermal denaturation, and this can be carried out only one once as a pretreatment before starting the reaction.

This reaction is carried out in the presence of a buffer that gives an adequate pH to the enzymatic reaction, salts necessary for hybridization or to maintain activity enzyme catalytic, a protective agent for the enzyme and if necessary, a regulator for the melting temperature (Tf). As a buffer it can be used, e.g. ex. Tris-HCl that it has a buffering action in a range of neutral to slightly alkaline The pH is adjusted depending on the DNA Polymerase used. As salts, KCl, NaCl, are suitably added (NH 4) 2 SO 4 etc. to maintain the activity of the enzyme and regulate the melting temperature (Tf) of the acid nucleic. The protective agent for the enzyme uses serum albumin Bovine or sugars. In addition, dimethylsulfoxide is generally used (DMSO) or formamide as a regulator of melting temperature (Tf). By using the melting temperature regulator (Tf), it can regulate oligonucleotide hybridization under conditions of limited temperature In addition, betaine (N, N, N-trimethylglycine) or a salt of Tetralkylammonium, are also effective in improving the effectiveness of chain displacement, by virtue of its iso-stabilization. By adding betaine in an amount of 0.2 to 3.03 M, preferably 0.5 to 1.5 M to the reaction solution, it can be wait for its promoter action in nucleic acid amplification of the present invention. Because these regulators of the melting temperature act to reduce the melting temperature, these conditions that give adequate restriction and reactivity, are determined empirically considering the concentration of salts, reaction temperature, etc.

An important feature of this invention is that a series of reactions do not occur unless the relationship of positions of a plurality of regions is maintained. Through this feature, the prevention of nonspecific synthetic reaction accompanied by nonspecific synthesis of complementary chain. That is, even if I know something about nonspecific reaction, minimizes the possibility that the product serves as a starting material in the next stage of amplification. In addition, the regulation of the course of reactions through many regions gives rise to the possibility that a detection system capable of being arbitrarily established strict identification of the desired product in sequences of analogous nucleotides

This feature can be used to detect mutations in a gene In the mode of the invention in which it is used the outer primer, 4 primers are used, ie 2 primers outer and 2 primers consisting of the oligonucleotides of The present invention. That is, except that the 6 regions contained in the 4 nucleotides work as designed, the reaction Synthetic of the present invention does not advance. In particular, they are important the sequences of the 3 'end of each oligonucleotide as the origin of the synthesis of the complementary chain and the end 5 'of region X1c when the complementary chain serves as Origin of the synthesis Therefore, these important sequences They are designed to correspond to a mutation to be detected  and the synthetic reaction product of the present invention is observe so that the presence can be thoroughly analyzed or absence of a mutation, such as a deletion or insertion of base, or genetic polymorphism such as SNP. Specifically, it they design bases that are believed to have a mutation or polymorphism, of so that they correspond to the proximity of the 3 'end of a oligonucleotide as the origin of chain synthesis complementary, or its 5 'end, when a complementary chain is The origin of the synthesis. If there is a mismatch in the 3 'end as the origin of the synthesis of the complementary chain or in its proximity, the chain synthesis reaction Complementary nucleic acid is significantly inhibited. In the present invention, a high degree of reaction of amplification unless the structure of the ends of a product in the initial reaction resulting in repeated reactions. By consequently, even if erroneous synthesis occurs, the synthesis of the complementary chain that constitutes the reaction of amplification is always interrupted in any of the stages, and thus a high degree of amplification reaction does not occur in presence of an erroneous mating. As a result, the mismatch effectively inhibits the reaction of amplification, and finally results in an accurate result. Is say, it can be said that the acid amplification reaction nucleic based on the present invention, has a very mechanism Complete to check the nucleotide sequence. These features are an advantage that can hardly be expected, for example, in the PCR procedure in which the reaction of Amplification is carried out in only 2 regions.

The X1c region that characterizes the oligonucleotide used in the present invention, can serve as the origin of the synthesis after synthesizing a complementary sequence, and this complementary sequence hybridized with sequence X1 in it freshly synthesized chain, so that the reaction occurs synthetic with itself as a mold. Therefore, even if it forms the so-called primer dimer, which is often problematic In the prior art, this oligonucleotide does not form a loop. By consequently, the nonspecific amplification attributable to the dimer of the primer theoretically cannot occur, and thus the present oligonucleotide contributes to an improvement in the specificity of the reaction.

In addition, the outer primers shown as F3 (Fig. 1- (2)) or R3 (Fig. 2- (5)) are combined so that the series of reactions described above can be carried out under conditions isothermal That is, the present invention provides a nucleic acid amplification procedure that has complementary sequences alternately linked in a chain single chain, comprising the stages shown in article 9 previous. In this procedure, the conditions of temperature at which stable hybridization occurs between F2c / F2, between R2c / R2, between F1c / F1 and between R1c / R1, and preferably set so that F3c / F3 and R3c / R3 hybridize by the phenomenon of contiguous stacking facilitated by hybridization of F2c / F2 and R2c / R2, respectively.

In the present invention, the terms are used "synthesis" and "amplification" of the nucleic acid. The nucleic acid synthesis in the present invention means the elongation of the nucleic acid from an oligonucleotide that It serves as the origin of the synthesis. If not only this occurs synthesis if not also the formation of another nucleic acid and the elongation reaction of this nucleic acid formed occurs continuously, a series of these reactions is called comprehensively amplification.

The single stranded nucleic acid that is provided at its 3 'end with an F1 region capable of hybridizing with an F1c part in the same chain and that after hybridization of the F1 region with F1c in the same chain, is capable of forming a loop containing an F2c region capable of base pairing is an important element of the present invention. Said single stranded nucleic acid can also be provided according to the following principle. That is, the synthesis of a complementary chain is allowed to proceed based on a primer having the following structure. 5 '- [region X1 that hybridizes with the region X1c located in the primer] - [loop-forming sequence ready for base pairing] - [region X1c] - [region having a complementary sequence of a
mold] -3 '.

As a region that has a sequence complementary to a mold, two sequences of nucleotides, that is, a nucleotide sequence (FA primer) complementary to F1 and a sequence (primer RA) complementary to R1c. The nucleotide sequence that constitutes the nucleic acid to be synthesized contains a nucleotide sequence that is extends from region F1 to region R1c and a sequence of nucleotides that extends from the R1 region that has a complementary nucleotide sequence of this sequence of nucleotides of the F1c region. X1c and X1 capable of hybridizing in the inside the primer, they can be arbitrary sequences. Without However, in a region between the FA and RF primers, the sequence of the region X1c / X1 preferably becomes different.

First, the synthesis of a complementary chain is carried out by the FA primer from the F1 region in the template nucleic acid. Then, the R1c region in the synthesized complementary chain is prepared for base pairing, with which the other primer hybridizes to form the origin of the complementary chain synthesis. The 3 'end of the complementary chain synthesized at this stage has a nucleotide sequence complementary to that of the FA primer that constitutes the 5' end of the initially synthesized chain, whereby it is provided at its 3 'end of the region X1 which hybridizes with the X1c region in the same chain to form a loop. Thus, the characteristic 3 'end structure is provided in accordance with the present invention, and the subsequent reaction constitutes the reaction system shown previously as the most preferred mode. The oligonucleotide that hybridizes with the part of the loop is provided at its 3 'end of the region X2 complementary to the region X2c located in the loop and its 5' end of the region X1. In the pre-reaction system, the FA and RA primers were used to synthesize a complementary template of the template nucleic acid, thus giving a loop structure to the 3 'end of the nucleic acid. In this procedure, the characteristic terminal structure of the present invention is provided by short primers. On the other hand, in this way, the set of a nucleotide sequence constituting a loop is provided as a primer, and synthesis of this primer is necessary.
longer.

If a nucleotide sequence is used that contains restriction enzyme recognition regions such as reverse primer, can be constituted a different way according with the present invention. The reaction with a reverse primer that contains a restriction enzyme recognition sequence It is specifically described with reference to Fig. 6. When has completed Fig. 6- (D), a dent is generated by an enzyme  of restriction corresponding to a recognition site of restriction enzymes in the reverse primer. Type reaction chain shift of the complementary chain that synthesized starts from this dent as the origin of the synthesis. Because the reverse primers are located in both ends of a double stranded nucleic acid constituting (D), the complementary chain synthesis reaction is also Start from both ends. Although it is basically based on the SDA procedure described in the prior art, the sequence of nucleotides that serves as a template has a structure that has alternately linked complementary nucleotide sequences, so that the nucleic acid synthesis system is constituted unique to the present invention. A part that serves should be designed as a complementary chain of the reverse primer to form the dent to incorporate a dNTP derivative so that it is done nuclease resistant to prevent chain cleavage double stranded by restriction enzyme.

You can also insert a promoter for the RNA polymerase in the reverse primer. The transcript from Both ends in Fig. 6- (D) are performed using an RNA polymerase that recognizes this promoter in this case too similar to the previous way in which the procedure of SDA

The synthesized nucleic acid is a chain single chain, but it is composed of complementary sequences partial, and therefore most of these sequences are paired by bases. By using this feature, you Can detect the synthesized product. Carrying out the nucleic acid synthesis procedure according to the present invention, in the presence of a fluorescent pigment as a double stranded chain specific intercalator such as bromide ethidium, SYBR green I or PicoGreen, a higher density is observed of fluorescence when increasing the product. By following it, the synthesis reaction can be plotted in real time in a system closed. The application of this has also been considered type of detection system to the PCR procedure, but it He thinks there are many problems because the product signal cannot distinguish itself from the signals of primer dimers etc. Without However, when this system is applied to this invention, the possibility of growing nonspecific base pairing is very low, and therefore can be expected simultaneously high Sensitivity and low noise. Like the use of the interleaver double stranded chain specific, the transfer of fluorescence energy for a procedure of performing a detection system in a uniform system.

The method of the invention of synthesis of nucleic acid is supported by DNA polymerase that catalyzes the chain shift type reaction for the synthesis of complementary chain During the reaction described above, also a reaction stage is included that does not necessarily require chain shift type polymerase. However, for simplify in a constitutional reagent and from a point of view economically, it is advantageous to use a type of DNA polymerase. Of this type The following enzymes are known from DNA polymerase. Also I know can use several mutants of these enzymes in the present invention, provided they have both the activity dependent on the sequence for the synthesis of the complementary chain such as the chain shift activity. The mutants that are referenced in this document, include those that have just a structure that gives rise to the required catalytic activity of the enzyme, or those with activity modifications catalytic, stability or thermostability, for example, mutations in amino acids

Bst DNA polymerase

(exo-) Bca DNA polymerase

Klenow fragment of DNA polymerase I

Vent DNA polymerase

(exo-) Vent DNA polymerase (Vent DNA polymerase deficient in exonuclease activity)

Deep Vent DNA polymerase

(exo-) Deep Vent DNA polymerase (DNA polymerase Deep Vent deficient in exonuclasa activity)

Phage DNA polymerase \ ph29

MS-2 phage DNA polymerase

Z-Taq DNA polymerase (Takara Shuzo Co., Ltd.)

KOD DNA polymerase (Toyobo Co., Ltd.)

       \ vskip1.000000 \ baselineskip
    

Among these enzymes, Bst DNA polymerase and the (exo-) Bca DNA polymerase are particularly convenient enzymes because they have a certain degree of thermostability and high activity catalytic The reaction of this invention can be carried out in isothermal form in a preferred embodiment, but due to the adjustment of melting temperature (Tf) etc., it is not always possible to use desired temperature conditions for the stability of the enzyme. Therefore, one of the desired conditions is that the Enzyme is thermostable. Although the isothermal reaction is feasible, thermal denaturation can be carried out to provide the nucleic acid as a first template, and with respect to this also, the use of a thermostable enzyme extends the test protocol selection.

Vent (exo-) DNA polymerase is an enzyme that has both chain displacement activity and a high degree of thermostability. It is known that the complementary chain synthesis reaction that involves the displacement of the chain by DNA polymerase, is promoted by the addition of a chain binding protein (Paul M. Lizardi et al., Nature Genetics , 19, 225-232, July, 1998). This action is applied to the present invention, and by adding the binding protein to a chain, the effect of promoting the synthesis of the complementary chain can be expected. For example, gene 32 of T4 is effective as a chain binding protein for Vent (exo-) DNA polymerase.

For DNA polymerase that does not have 3'-5 'exonuclease activity, there is a known phenomenon in which the synthesis of the complementary chain does not stop at the 5' end of a template, resulting in the generation of a projection of a base. In the present invention, this phenomenon is not preferred because when the synthesis of the complementary chain reaches the end, the sequence of the 3 'end leads to the beginning of the next synthesis of the complementary chain. However, since there is a high probability that the DNA polymerase will add a base "A" to the 3 'end, the sequence can be selected so that the synthesis from the 3' end begins at "A", so that no problem if the dATP adds an additional base erroneously. In addition, even if the 3 'end protrudes during the synthesis of the complementary strand, the exonuclease 3'? 5 'activity can be used to digest the protruding end to make it a blunt end. For example, since natural Vent DNA polymerase has this activity,
This enzyme can be used as a mixture with Vent (exo-) DNA polymerase in order to solve this problem.

The different reagents necessary for the process of the invention of nucleic acid synthesis or amplification can be pre-packaged and provided in the form of a kit. Specifically, a kit for the present invention is provided, comprising different types of oligonucleotides necessary as primers for the synthesis of the complementary chain and as external primers for displacement, dNTP as a substrate for the synthesis of the complementary chain, a DNA polymerase for Carry out the complementary chain shift type synthesis, a buffer that gives the appropriate conditions for the enzymatic reaction, and if necessary, reagents for the detection of the products of the synthesis reaction. In particular, the addition of reagents is necessary during the reaction in a preferred mode of the present invention, and therefore the reagents necessary for a reaction are supplied after pipetting into the reaction vessel, so that the reaction can Start by adding only one sample. By the constitution of a system in which the reaction product can be detected in situ in a reaction vessel using a luminescent signal or a fluorescent signal, it is not necessary to open and close the vessel after the reaction. This is very convenient to prevent contamination.

The nucleic acid that has sequences of complementary nucleotides linked alternately in a chain single chain, synthesized according to the present invention It has, for example, the following utility. The first feature that is used as an advantage results from the structure special that have complementary sequences in a molecule. This feature can be expected to facilitate detection. Is that is, there is a known system to detect nucleic acid in the that its signal varies depending on the base pairing with a complementary nucleotide sequence. For example, by combination with the procedure of using a specific interleaver double-stranded chain as a detector as described above, it can achieve a detection system that makes full use of the Characteristics of the synthetic product of the present invention. Yes the product of the synthesis reaction of the present invention is denatures heat once in said detection system and returns to the original temperature, hybridization occurs intramolecular preferably, thus allowing the sequences complementary produce base pairing quickly. Yes there are nonspecific reaction products, they have no sequences complementary in the molecule, so that after separating them by denaturation in 2 or more molecules, they cannot return immediately to the original double-stranded chain. By providing the thermal denaturation stage before detection, can be reduce the noise that accompanies the nonspecific reaction. Whether uses non-heat resistant DNA polymerase, the stage of thermal denaturation has the meaning of termination of the reaction, and therefore it is advantageous to control the reaction temperature

The second characteristic is to always form a loop capable of base pairing. The structure of a loop capable of base pairing is shown in Fig. 4. How can see in Fig. 4, the loop is composed of the sequence of nucleotides F2c (X2c) that can hybridize using the primer and a nucleotide sequence that intervene between F2c-F1c (X1c). The sequence between F2c-F1c (or between X2c-X1c in a most universally) is a nucleotide sequence derived from mold. Therefore, if a probe that has a sequence of complementary nucleotides hybridize with this region, detection Specific mold is feasible. In addition, this region is always ready for base pairing, and therefore, is not necessary thermal denaturation before hybridization. Sequence of nucleotides that constitutes a loop in the reaction product amplification in the present invention, may have a length arbitrary Therefore, if hybridization with a probe, a region to be hybridized with the primer and a region to be hybridized with the probe, to prevent their competition, so that they can be constituted ideal reaction conditions.

In accordance with a preferred mode of the present invention, in a single nucleic acid chain there is a large number of loops capable of base pairing. This means that a large number of probes can hybridize with a molecule of nucleic acid to allow very sensitive detection. Thus you can achieve not only the improvement of sensitivity but also a nucleic acid detection procedure based on a special reaction principle such as aggregation. For example, a probe immobilized on fine particles such as polystyrene latex to the reaction product herein invention, and the aggregation of latex particles to as the hybridization of the product with the probe progresses. The highly sensitive and quantitative observation is feasible by Optical measurement of aggregation concentration. Because you can also see the aggregation with the naked eye, you can also it may constitute a reaction system that does not use a device optical measurement

In addition, the reaction product of the present invention by allowing many markers to be attached per molecule of nucleic acid, allows chromatographic detection. In the countryside of the immunoassay, in practice an analytical procedure is used (immunochromatography) using a chromatographic medium that uses a visually detectable marker. This procedure is based on the principle that an analyte is interposed between an antibody immobilized on a chromatographic medium and a labeled antibody, and the unreacted labeled component is washed off. He reaction product of the present invention makes this principle be applicable to nucleic acid analysis. I mean, I know prepares a marked probe towards the part of the loop and freezes on a chromatographic medium to prepare a capture probe for capture, thus allowing analysis in the middle chromatographic As a capture probe a sequence can be used complementary to the part of the loop. Since the product of reaction of the present invention has a large number of loops, the product joins a large number of probes marked to give a visually recognizable signal.

The reaction product according to the present invention that always gives a region as a capable loop of base pairing, allows a wide variety of others detection systems For example, a system of detection using surface plasmon resonance using a immobilized probe for this part of the loop. Also, if a probe for the part of the loop is marked with a specific interleaver double-stranded chain, an analysis of more sensitive fluorescence. Alternatively, it can also be used positively the capacity of the nucleic acid synthesized by the present invention, to form a loop capable of pairing bases on the sides both 3 'and 5'. For example, a loop is designed so that it has a common nucleotide sequence between one type normal and an anomalous type, while the other loop is designed to generate a difference between them. A system can be constituted characteristic analytic in which the presence of a gene using the probe for the common part while the presence  An anomaly is confirmed in the other region. Because the nucleic acid synthesis reaction according to the present invention can also run isothermally, an advantage very important is that you can perform the analysis in real time by means of a general fluorescent photometer. Until now it was known the nucleic acid structure that hybridizes in the same chain. Yes However, the nucleic acid that has nucleotide sequences complementary joined alternately in a single chain obtained by the present invention, is new in that it contains a large number of loops capable of base pairing with others oligonucleotides

On the other hand, a large number of loops given for the reaction product according to the present invention, They can be used as probes. For example, on a DNA chip, the Probes should accumulate with high density in a limited area. Without However, in the present technology, the number of oligonucleotides that can be immobilized in a certain area is limited. Therefore, by using the reaction product of the present invention, a large number of probes can be immobilized capable of hybridization, with a high density. That is, the reaction product according to the present invention can be immobilize in the form of probes on a DNA chip. After the amplification, the reaction product can be immobilized by any technique known in the art, or the oligonucleotide immobilized is used as the oligonucleotide in the reaction of amplification of the present invention, resulting in the generation of the immobilized reaction product. Through the use of the probe so immobilized, a large number of Sample DNA in a limited area, and as a result you can Expect high signals.

Brief description of the drawings

fig. 1 is an illustration of a part (1) a (4) of the reaction principle in a preferred mode of the present invention;

fig. 2 is an illustration of a part (5) a (7) of the reaction principle in a preferred mode of the present invention;

fig. 3 is an illustration of a part (8) a (10) of the reaction principle in a preferred mode of the present invention;

fig. 4 is an illustration of the structure of a loop formed by the single stranded nucleic acid according to the present invention;

fig. 5 is an illustration of a part (A) to (B) in a basic mode of the present invention;

fig. 6 is an illustration of a part (C) a (D) in a basic mode of the present invention;

fig. 7 is a drawing that shows the relationship of positions of each nucleotide sequence that constitute a oligonucleotide in the target nucleotide sequence of M13mp18;

fig. 8 is a photograph that shows the result of agarose electrophoresis of a product obtained by the single-stranded nucleic acid synthesis procedure with M13mp18 as a mold according to the present invention.

Street 1:

XIV size marker

Street 2:

M13mp19 1 fmol cDNA

Street 3:

No target

fig. 9 is a photograph that shows the result of agarose gel electrophoresis of a product digested by restriction enzymes obtained in Example 1, by nucleic acid synthesis reaction according to the present invention.

Street 1:

XIV size marker

Street 2:

BamHI digestion of the product purified

Street 3:

product digestion with PvuII purified

4th Street:

digestion with product HindIII purified

fig. 10 is a photograph that shows the result of agarose gel electrophoresis of a product obtained by the process of the invention of acid synthesis single stranded nucleic, using M13mp18 as a template in the presence of betaine 0, 0.5, 1 and 2 indicate the concentration (M) of betaine added to the reaction solution. N indicates control negative, and -21 indicates the concentration of 10-21 mol of DNA mold;

fig. 11 is a drawing that shows the relationship of positions of each nucleotide sequence that constitute a oligonucleotide in a target nucleotide sequence obtained from HBV;

fig. 12 is a photograph that shows the result of agarose gel electrophoresis of a product obtained by the process of the invention of acid synthesis single stranded nucleic, in which it was used as a template VHB-M13mp18 integrated in M13mp18.

Street 1:

XIV size marker

Street 2:

HBV-M13mp19 1 cDNA fmol

Street 3:

No target

fig. 13 is a photograph showing the result of agarose gel electrophoresis of a product denatured with alkali obtained by the procedure of invention of single stranded nucleic acid synthesis

Street 1:

fragment digested with phage HindIII lambda

Street 2:

The reaction product of example 1

Street 3:

The reaction product of example 3

fig. 14 is a photograph showing the result of agarose gel electrophoresis of a product obtained by the process of the invention of acid synthesis single-stranded nucleic, in which the concentration of M13mp18 as target. The upper and lower photographs show the reaction result for 1 and 3 hours respectively

Street 1:

M13mp18 1x10 -15 mol / tube cDNA

Street 2:

M13mp18 1x10 -16 mol / tube cDNA

Street 3:

M13mp18 1x10 17 mol / tube cDNA

4th Street:

M13mp18 1x10 18 mol / tube cDNA

Street 5:

M13mp18 1x10 -19 mol / tube cDNA

6th Street:

M13mp18 1x1020 mol / tube cDNA

7th Street:

M13mp18 1x10-21 mol / tube cDNA

Street 8:

M13mp18 1x10-22 mol / tube cDNA

9th Street:

no target

10th Street:

XIV size marker

fig. 15 is a drawing that shows the position of a mutation and the relationship of positions in each region with respect to to a sequence (target) of target nucleotides. The underlined guanine it is replaced by adenine in the mutant;

fig. 16 is a photograph showing the result of agarose gel electrophoresis of a product of according to the amplification reaction of the present invention,

M:

100 bp scale (New England Biolabs)

N:

without mold (purified water)

WT:

M13mp18 wild mold 1 fmol

MT:

M13mp18 mutant mold 1 fmol

fig. 17 is a drawing that shows the relationship of positions of each nucleotide sequence that constitute a oligonucleotide in a nucleotide sequence encoding mRNA Diana;

fig. 18 is a photograph showing the result of agarose gel electrophoresis of a product obtained by the process of the invention of acid synthesis single stranded nucleic using mRNA as a target.

       \ vskip1.000000 \ baselineskip
    

Best way to carry out the invention Example 1 Amplification of a region in M13mp18

The acid synthesis procedure was attempted nucleic that has alternately linked complementary chains in a single chain chain according to the present invention, using M13mp18 as a mold. In this experiment 4 classes were used of primers, that is, M13FA, M13RA, M13F3 and M13R3. M13F3 and M13R3 they were the first and second outer primers for the displacement of the first and second nucleic acid obtained respectively with the first M13FA oligonucleotide and the second M13RA oligonucleotide as the origin of the synthesis. Because the outer primers are primers that serve as the origin of the synthesis of the complementary chain after synthesis with M13FA (or M13RA), these were designed to hybridize with a region adjacent to M13FA (or M13RA) using the phenomenon of adjoining stacking. In addition, the concentrations of these primers  highs were set, so that the hybridization of M13FA (or M13RA).

The nucleotide sequence that constitutes each primer is as shown in the sequence list. The structural characteristics of the primers are summarized to continuation. In addition, the relationship of the positions of each region regarding the sequence (target) of target nucleotides is shown in fig. 7.

Primer: region on the 5 'side / region on the side 3'

M13FA: The same as the F1c region in the chain complementary synthesized by M13FA / complementary to the F2c region in M13mp18

M13RA: The same as the R1c region in the chain complementary synthesized by M13RA / complementary to the R2c region in the complementary chain synthesized by M13FA

M13F3: Complementary F3c contiguous to the 3 'side of the F2c region in M13mp18

M13R3; Supplementary R3c contiguous to the 3 'side of the F2c region in the complementary chain synthesized by M13FA

Through said primers, the acid is synthesized nucleic in which a region that extends from F1c to R1c in M13mp18, and its complementary nucleotide sequence, are alternatively linked by a loop forming sequence which contains F2c in a single chain. The composition of a reaction solution by the acid synthesis procedure nucleic by these primers according to the invention, show below.

Composition of the reaction solution (in 25 \ mul)

20 mM Tris-HCl pH 8.8

10 mM KCl

(10 mM NH 4) 2 SO 4

6 mM MgSO 4

0.1% Triton X-100

5% dimethylsulfoxide (DMSO)

0.4 mM dNTP

Primers:

M13FA / SEQ ID NO: 1 800 nM

M13RA / SEQ ID NO: 2 800 nM

M13F3 / SEQ ID NO: 3 200 nM

M13R3 / SEQ ID NO: 4 200 nM

Diana: M13mp18 cDNA / SEQ ID NO: 5

       \ newpage
    

Reaction: The dissolution of the previous reaction it was heated at 95 ° C for 5 minutes, and the target was denatured in a single chain chain. The reaction solution was transferred to ice water, and 4 U of Bst DNA polymerase (New England Biolabs) and the mixture was reacted at 65 ° C for 1 h. After reaction, the reaction was terminated at 80 ° C for 10 minutes and transferred again to ice water.

Reaction confirmation: 1 µl was added loading buffer at 5 µl of the reaction solution above, and the sample underwent electrophoresis for 1 hour at 80 mV in 2% agarose gel (0.5% TBE). As a weight marker Molecular XIV (100 bp scale, Boehringer Mannheim) was used. The gel after electrophoresis it was stained with SYBR green I (Molecular Probes, Inc.) to confirm nucleic acid. The results are shown in Fig. 8. The respective streets correspond to the following samples.

1. XIV size marker

2. M13mp18 1 fmol cDNA

3. without target.

On lane 3, no band was confirmed except that the unreacted primers were stained. In lane 2 in the presence of the target, the products were confirmed as a low molecular weight band scale, as a dyed stain at high molecular weight and as a band that hardly experiences electrophoresis in the gel. Among the low molecular weight bands, the bands in the vicinity of 290 bp and 450 bp are in accordance with the products calculated in the synthetic reaction of this invention, that is, double stranded chains of SEQ ID NOS: 11 and 12 (corresponding to double stranded chains formed as shown in Figs. 2- (7) and 2- (10)) and a single stranded chain of SEQ ID NO: 13 (corresponding to the long single stranded chain in Fig. 3- (9)) , and in this way it was confirmed that the reaction proceeded as expected. It was thought that the electrophoresis results of the high molecular weight blur pattern and the band that did not undergo electrophoresis had been obtained because this reaction was basically a continuous reaction that allowed variable molecular weights in the reaction product and also because the product has a complicated structure that have a partially single chain chain and a complex
double-stranded

       \ vskip1.000000 \ baselineskip
    

Example 2 Confirmation of reaction products by digestion with restriction enzymes

In order to clarify the structure of the nucleic acid that has complementary nucleotide sequences joined together in a single chain chain, obtained in the Example 1, the digestion of the products was carried out with restriction enzymes. If the fragments are theoretically generated for its digestion with restriction enzymes and simultaneously the high molecular weight blur pattern and the band disappear that does not experience electrophoresis as seen in Example 1, then you can think that none of these products are the nucleic acid that has complementary complementary sequences alternatively in a single stranded chain synthesized according with the present invention.

Reaction solutions (200 µl) of 8 tubes in Example 1 were pooled and purified by treatment with phenol and precipitation with ethanol. The resulting precipitates recovered and re-dissolved in 200 µl of buffer TE, and 10 µl of aliquot was digested at 37 ° C for 2 hours with the restriction enzymes BamHI, PvuII and HindIII, respectively. The digested product was subjected to electrophoresis for 1 hour at 80 mV in 2% agarose gel (0.5% TBE). How molecular marker Super Ladder-Low was used (scale 100 bp) (Gensura Laboratories, Inc.). After the electrophoresis the gel was stained with SYBR green I (Molecular Probes, Inc.) to confirm nucleic acid. The results are shown in Fig. 9. The respective streets correspond to the following samples.

1. XIV size marker

2. BamHI digestion of the product purified

3. PvuII digestion of the product purified

4. Digestion with HindIII of the product purified

It is believed that the nucleotide sequences that constitute the relatively short amplification products are those of SEQ ID NOS: 13, 14, 15 and 16. From these sequences of nucleotides, the calculated size of each fragment digested with Restriction enzymes is as shown in Table 1. "L" in the table indicates that its position in electrophoresis does not is set because L is a fragment that contains a loop (single chain chain).

TABLE 1 Restriction enzyme digestion fragments of amplification products

one

Because almost all bands before the digestion was changed to estimated bands, it was confirmed that Target reaction products had been amplified. Further, it was also shown that there were no or less products nonspecific

Example 3 Promotion of the amplification reaction by adding betaine

An experiment was conducted to examine the betaine effect (N, N, N-trimethylglycine, Sigma) added to the acid amplification reaction solution nucleic. The synthesis of nucleic acid that has chains complementary joined alternately in a single chain according to the invention it was carried out using M13mp18 as mold similar to Example 1, in the presence of betaine in Different concentrations The primers used in the experiment were identical to those used in Example 1. The amount of DNA mold was 10-21 mol (M13mp18) and water was used as a control negative. Betaine was added in concentrations of 0, 0.5, 1 and 2 M to the reaction solution. The composition of the solution of The reaction is shown below.

Composition of the reaction solution (in 25 \ mul)

20 mM Tris-HCl pH 8.8

4 mM MgSO 4

0.4 mM dNTP

10 mM KCl

(10 mM NH 4) 2 SO 4

0.1% Triton X-100

Primers:

M13FA / SEQ ID NO: 1 800 nM

M13RA / SEQ ID NO: 2 800 nM

M13F3 / SEQ ID NO: 3 200 nM

M13R3 / SEQ ID NO: 4 200 nM

Diana: M13mp18 cDNA / SEQ ID NO: 5

Polymerase, reaction conditions and conditions for electrophoresis were identical to those described in Example 1

The results are shown in Fig. 10. In the reaction in the presence of betaine in concentrations of 0.5 or 1.0 M, The amount of amplification product increased. Also, if your concentration increased to 2.0 M, no amplification was observed. By therefore, it was shown that the amplification reaction was promoted in the presence of betaine with an appropriate concentration. It is believed that the reason that the amount of amplification product decrease when the concentration of betaine was 2 M was that the Tf It decreased too much.

Example 4 HBV gene sequence amplification

The process of the invention of nucleic acid synthesis in which cDNA of M13mp18 that had a partial sequence of the HBV gene integrated into the same. In the experiment, 4 classes of HB65FA primers were used (SEQ ID NO: 6), HB65RA (SEQ ID NO: 7), HBF3 (SEQ ID NO: 8) and HBR3 (SEQ ID NO: 9). HBF3 and HBR3 were external primers for the displacement of the first nucleic acid obtained respectively with HB65FA and BB65RA as the origin of the synthesis. Because the outer primers are primers that serve as the origin of the synthesis of the complementary chain after synthesis with HB65FA (or HB65RA), these were designed to hybridize with a region next to HB65FA (or HB65RA), using the stacking phenomenon adjacent. In addition, the concentrations of these primers were fixed. high so that hybridization preferentially occurred with HB65FA (or HB65RA). The target sequence (430 bp) in this example, obtained from the HBV integrated in M13mp18, is shown in SEQ ID NO: 10.

The nucleotide sequence that constitutes each primer is shown in the sequence list. The characteristics Structural of each primer are summarized below. Besides, the relationship of positions of each region with respect to the sequence (target) of target nucleotides, is shown in Fig. 11.

Primer: region on the 5 'side / region on the side 3'

HB65FA: The same as the F1c region in the chain complementary synthesized by HB65FA / complementary to the region F2c in HBV-M13mp18

HB65RA: The same as the R1c region in the chain complementary synthesized by HB65RA / complementary to the region R2c in the complementary chain synthesized by HB65FA

HBF3: Complementary F3c contiguous to the 3 'side of the F2c region in HBV-M13mp18

HBR3; Supplementary R3c contiguous to the 3 'side of the F2c region in the complementary chain synthesized by HB65FA

Through said primers, the acid is synthesized nucleic in which a region that extends from F1c to R1c in M13mp18 (HBV-M13mp18) that has a sequence partial of the HBV gene integrated into it, and its sequence of complementary nucleotides, are alternately linked by a loop-forming sequence that contains F2c in a string single chain. The reaction was carried out under the same conditions. than in Example 1, except that the primers described were used before, and the reaction solution was analyzed by electrophoresis in agarose. The results are shown in Fig. 12. The respective streets correspond to the following samples.

1. XIV size marker

2. HBV-M13mp18 cDNA 1 fmol

3. Without target

Similar to Example 1, the products are confirmed only in the presence of the target as a band scale low molecular weight, such as diffuse high weight staining molecular and as a band that hardly experiences electrophoresis in the gel (lane 2). Among the low molecular weight bands, the bands in the vicinity of 310 bp and 480 bp agree with the products calculated in the synthetic reaction of this invention, is that is, double stranded chains of SEQ ID NOS: 17 and 18 and therefore It was confirmed that the reaction proceeded as expected. How I know described in the results in example 1, it was thought that electrophoresis results of the heavyweight blur pattern molecular and the band that did not undergo electrophoresis produced by the structure of the characteristic synthetic product of the present invention. From this experiment, it was confirmed that the present invention can be practiced even if use a different sequence (target) for amplification.

       \ vskip1.000000 \ baselineskip
    

Example 5 Confirmation of the sizes of the reaction products of synthesis

To confirm the structure of the nucleic acid synthesized according to the present invention, its length by electrophoresis under denaturing conditions alkaline 1 µl of alkaline loading buffer was added to 5 µl of each reaction solution in the presence of the target in the Example 1 or 4, and subjected to electrophoresis at 50 mA in gel 0.7% agarose (50 mM NaOH, 1 mM EDTA) for 14 hours. How molecular weight size marker, phage fragments were used lambda digested by HindIII. The gel after electrophoresis was neutralized with 1M Tris, pH 8, and stained with SYBR green I (Molecular Probes, Inc.) to confirm nucleic acid. The results are shown in Fig. 13. The respective streets They correspond to the following samples.

1. Lambda phage fragments digested by HindIII

2. The reaction product of Example 1

3. The reaction product of Example 4

When the reaction product was subjected to electrophoresis under alkaline denaturation conditions, it was able to confirm its size in a single-chain state. It was confirmed that The sizes of the main products in both Example 1 (street 2) as in Example 4 (street 3) were in the 2 kbases. In addition, it was revealed that the product had spread to have a size of at least 6 kbases or more within the range  Able to confirm by this analysis. In addition, another was confirmed time the bands that did not experience electrophoresis in non-denaturing conditions in Examples 1 and 4, are separated in a denatured state in single chain chains Individuals of smaller size.

       \ vskip1.000000 \ baselineskip
    

Example 6 Confirmation of the amplification that depends on the concentration of a target in the amplification of a region in M-13mp13

The influence of a concentration was observed variable of a target in the process of the invention of nucleic acid synthesis The process of the invention of nucleic acid synthesis was carried out therein conditions as in Example 1, except that the amount of cDNA of M13mp18 as target was 0 to 1 fmol and the reaction time was 1 hour or 3 hours Similar to Example 1, the sample was submitted  to 2% agarose gel electrophoresis (0.5% TBE) and stained with green I from SYBR (Molecular Probes, Inc.) to confirm the nucleic acid. As a molecular weight marker, XIV (scale 100 bp, Boehringer Mannheim). The results are shown in the Fig. 14 (upper: 1 hour of reaction, lower: 3 hours of reaction). The respective streets correspond to the following samples:

1: M13mp18 1x10 -15 mol / tube cDNA

2: M13mp18 1x10 -16 mol / tube cDNA

3: M13mp18 1x10 -17 mol / tube cDNA

4: M13mp18 1x10 18 mol / tube cDNA

5: M13mp18 1x10 -19 mol / tube cDNA

6: M13mp18 1x10 -20 mol / tube cDNA

7: M13mp18 1x10-21 mol / tube cDNA

8: M13mp18 1x10-22 mol / tube cDNA

9: no target

10: XIV size marker.

A common band appears between the respective streets at the bottom of the electrophoretic profile and shows unreacted stained primers. Regardless of time of reaction, no amplification product was observed in the absence of the Diana. A staining pattern was obtained, which depended on the target concentration, of the amplification product only in presence of the target. In addition, the amplification product could confirm with the lowest concentration when the time of reaction.

       \ vskip1.000000 \ baselineskip
    

Example 7 Detection of a point mutation (1) Preparation of M13mp18M (mutant)

The target DNA used was M13mp18 (wild) and M13mp18M (mutant). For the construction of mutant M13mp18FM, the LA PCR ™ in vitro mutagenesis kit (Takara Shuzo Co., Ltd.) was used to replace a nucleotide for the mutation. Then, the sequence was confirmed by sequencing. The sequence of the F1 region is shown below:

       \ newpage
    

Wild type: CCGGGGATCCTCTAGAGTCG (SEC ID : 19) Mutant: CCGGGGATCCTCTAGAGTCA (ID SEC Nº: 20)

       \ vskip1.000000 \ baselineskip
    

(2) Design of the primers

FA primers used for the wild type and the mutant were provided at the 5 'end of its F1c region with different nucleotide sequences, respectively. The position of the mutation and the relationship of positions of each region with respect to the sequence (target) of target nucleotides are shown in Fig. fifteen.

       \ vskip1.000000 \ baselineskip
    

(3) Amplification reaction

An experiment was conducted to examine whether the mold specific amplification reaction occurs using a combination of specific primers shown below, using M13mp18 (wild) and M13mp18M (mutant) as primers.

Set of primers for amplification of the wild type: FAd4, RAd4, F3, R3

Set of primers for amplification of the mutant: FAMd4, RAd4, F3, R3

The nucleotide sequence of each primer is The next:

FAd4: CGACTCTAGAGGATCCCCGGTTTTTGTTGTGTGGAATTGTGAGCGGAT (ID SEC Nº: twenty-one) FAMd4: TGACTCTAGAGGATCCCCGGTTTTTGTTGTGTGGAATTGTGAGCGGAT (ID SEC Nº: 22) RAd4: CGTCGTGACTGGGAAAACCCTTTTTGTGCGGGCCTCTTCGCTATTAC (ID SEC Nº: 2. 3) F3: ACTTTATGCTTCCGGCTCGTA (ID SEC Nº: 24) R3: GTTGGGAAGGGCGATCG (ID SEC Nº: 25)

       \ vskip1.000000 \ baselineskip
    

(4) Detection of point mutation in M13mp18

The composition of the reaction solution is the next:

2

1 fmol (2 µL) of M13mp18 or M13mp18M target at the reaction solution and heated to 95 ° C for 5 minutes, so that the target was denatured in a single chain chain. The reaction solution was transferred to ice water, and 1 µL (8 U) of the Bst DNA polymerase was added (NEW ENGLAND Biolab) and allowed to react for 1 h at 68 ° C or 68.5 ° C. After the reaction, the reaction was terminated at 80 ° C for 10 minutes, and the reaction solution was returned to transfer to ice water.

As shown in Fig. 16, when it was used FAd4 for the wild type as FA primer, amplification was observed effective only in the presence of the wild type mold. On the other hand, when FAMd4 was used for the mutant as an FA primer, the effective amplification was observed only in the presence of the type mold wild [sic.].

From the results described above, it showed that the point mutation could be detected effectively using the amplification reaction of the present invention.

       \ vskip1.000000 \ baselineskip
    

Example 8 MRNA amplification reaction as target

The process of the invention of nucleic acid synthesis using mRNA as target nucleic acid. To prepare the target mRNA, line LNCaP cells were mixed prostate cancer cell (No. in ATCC CRL-1740) expressing prostate specific antigen (PSA), with cells K562 of the chronic myeloid leukemia cell line (No. in ATCC CCL-243) as non-expressing cells, with 1: 10 6 to 100: 10 6, followed by extraction of total RNA using an RNeasy Mini kit from Qiagen (Germany). 4 classes were used of primers in the experiment, ie PSAFA, PSARA, PSAF3 and PSAR3. PSAF3 and PSAR3 are external primers for the displacement of the first nucleic acid obtained respectively with PSAFA and PSARA as the origin of the synthesis. In addition, the concentrations of these primers were set high so that Hybridization of PSAFA (or PSARA) occurred preferentially. The nucleotide sequences that constitute the respective primers They are as follows.

Primer:

PSAFA: TGTTCCTGATGCAGTGGGCAGCTTTAGTCTGCGGCGGTGTTCTG (ID SEC Nº: 26) PSARA: TGCTGGGTCGGCACAGCCTGAAGCTGACCTGAAATACCTGGCCTG (ID SEC Nº: 27) PSAF3: TGCTTGTGGCCTCTCGTG (ID SEC Nº: 28) PSAR3: GGGTGTGGGAAGCTGTG (ID SEC Nº: 29)

       \ vskip1.000000 \ baselineskip
    

The structural characteristics of the primers are summarized below. In addition, the relationship of positions of each primer with respect to the nucleotide sequence of the DNA encoding the target mRNA and the recognition sites of the restriction enzyme Sau3AI, are shown in Fig. 17.

Primer: region on the 5 'side / region on the side 3'

PSAFA: The same as the F1c region in the chain complementary synthesized by PSAFA / complementary to the F2c region in the target nucleotide sequence

PSARA: The same as the R1c region in the chain complementary synthesized by PSARA / complementary to the R2c region in the complementary chain synthesized by PSAFA

PSAF3: Complementary F3c contiguous to the 3 'side of the F2c region in the target nucleotide sequence

PSAR3; Supplementary R3c contiguous to the 3 'side of the R2c region in the complementary chain synthesized by PSAFA

The composition of a reaction solution for the process of the invention of nucleic acid synthesis is the next:

Composition of the reaction solution (in 25 \ mul)

20 mM Tris-HCl pH 8.8

4 mM MgSO 4

0.4 mM dNTP

10 mM KCl

(10 mM NH 4) 2 SO 4

0.1% Triton X-100

0.8 M betaine

5 mM DTT

PSAFA and PSARA 1600 nM primer

PSAF3 and PSAR3 200 nM primer

DNA polymerase Bst 8 U

Rever Tra Ace (Toyobo Co., Ltd., Japan) 100 OR

Total RNA 5 \ mug

       \ vskip1.000000 \ baselineskip
    

All ingredients were mixed on ice. In this experiment the mRNA (single stranded chain) was used as a target, and therefore the stage of making the single chain chain by Thermal denaturation is not necessary. The reaction led to carried out at 65 ° C for 45 minutes, and the reaction was terminated at 85 ° C for 5 minutes. After the reaction, they underwent 5 µl electrophoresis of the reaction solution in agarose at 2% and were detected with SYBR green I.

The results are shown in Table 18. The respective streets correspond to the following samples.

3

       \ vskip1.000000 \ baselineskip
    

In the absence of Bst DNA polymerase or Rever Tra Ace, could not get amplification product (lanes 1 to 4). In presence of both enzymes, an amplification product was detected (lanes 5 to 7) if the RNA obtained from LNCaP was present. It could detect RNA extracted from an LNCaP cell / 1 million cells K562 (6th street). When the amplification product was digested at the site of the Sau3AI restriction enzyme located in the inside the target, the product was digested into a fragment of calculated size (streets 8 and 9).

From the results described above, it confirmed that the desired reaction product can be obtained in the method of the invention of nucleic acid synthesis, including if RNA is used as the target.

       \ newpage
    

Industrial applicability

According to the new set of primers of according to the present invention and the synthesis procedure of nucleic acid using said set of primers, a nucleic acid synthesis procedure that has sequences of complementary nucleotides linked alternately in a chain single chain, without requiring any complicated control of the temperature. A complementary string synthesized with the set of primers based on the present invention, serves as the origin of the synthesis of a new complementary chain with the 3 'end of said chain synthesized as a mold. This is accompanied by formation of a loop that causes hybridization of a new primer, and a product of the chain synthesis reaction complementary to the chain previously synthesized as a mold, it again displaces the synthesis of the complementary chain to start from the loop and prepare for base pairing. He nucleic acid thus obtained, synthesized with itself as a template, it is combined, for example, with an acid synthesis procedure known nucleic such as SDA, to contribute to the improvement of The effectiveness of nucleic acid synthesis.

According to an additional preferred mode of the present invention, a new method of providing nucleic acid synthesis, which achieves the improvement of the effectiveness of known nucleic acid synthesis procedure, does not require complicated temperature control, you can expect achieve high amplification efficiency and can achieve high specificity That is, the set of primers based on the present invention, is applied to a mold chain and its chain complementary, so that you can successively synthesize the nucleic acid that has complementary complementary sequences alternatively in a single chain chain. This reaction theoretically continues until the starting materials are depleted necessary for the synthesis, and during this one the new nucleic acid whose synthesis has started from loop. Elongation from the oligonucleotide that has hybridized With the loop, it produces the chain shift to supply the 3'-OH group for acid elongation long single stranded nucleic (i.e. the nucleic acid that has a plurality of pairs of complementary chains joined in the same). On the other hand, the group 3'-OH of the chain long single chain produces the chain synthesis reaction complementary to itself as a mold, so that its lengthening, and during this a new chain moves Complementary whose synthesis has started from the loop. Said amplification reaction stage takes place under conditions. isothermal, while maintaining high specificity.

The oligonucleotides in the present invention, when two contiguous regions are arranged as designed, they can function as primers for the synthesis reaction of nucleic acid. This contributes significantly to the conservation of specificity For comparison, for example, with the PCR in which the nonspecific amplification reaction is starts by unspecific mating regardless of The desired position ratio of the two primers can be easily explain that in the present invention one can expect high specificity This feature can be used to detect SNP in a very sensitive and precise way.

What characterizes the present invention, reace in that said reaction can be easily achieved with a very simple reagent constitution. For example, the oligonucleotides of the primer set of the present invention they have a special structure, but this is a problem of nucleotide sequence selection, and the substrate is a simple oligonucleotide In addition, in a preferred mode, the reaction it can pass through only a DNA polymerase that catalyzes the chain shift type chain reaction complementary that is synthesized. In addition, if the present invention is carried out with RNA as a template, such a DNA polymerase is used like Bca DNA polymerase that has so much activity of Reverse transcriptase as DNA polymerase activity type chain shift, so that all reactions Enzymatic can be carried out by a single enzyme. He reaction principle of getting a high degree of reaction of nucleic acid amplification by said reaction Simple enzymatic was not known. Even for the application of the present invention to a nucleic acid synthesis reaction known as the SDA, an additional enzyme is not necessary for your combination, and said simple combination with the oligonucleotides based on the present invention can be applied to different reaction systems Therefore, it can be said that the method of the invention of nucleic acid synthesis also It is advantageous with respect to cost.

As described above, the procedure of the invention of nucleic acid synthesis and the set of oligonucleotides for it, provide a new principle of simultaneous resolution of a plurality of difficult problems such as operability (control of the temperature), improved synthesis efficiency, economy and high specificity

<110> Eiken Kagaku Kabushiki Kaisha

         \ vskip0.400000 \ baselineskip
      

<120> Acid synthesis procedure nucleic.

         \ vskip0.400000 \ baselineskip
      

<130> E2-00IPCT

         \ vskip0.400000 \ baselineskip
      

<140>

         \ vskip0.400000 \ baselineskip
      

<141>

         \ vskip0.400000 \ baselineskip
      

<150> JP-1998-317476

         \ vskip0.400000 \ baselineskip
      

<151> 1998-11-09

         \ vskip0.400000 \ baselineskip
      

<160> 29

         \ vskip0.400000 \ baselineskip
      

<170> PatentIn Ver. 2.0

         \ vskip0.400000 \ baselineskip
      

<210> 1

         \ vskip0.400000 \ baselineskip
      

<211> 52

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 1

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

cgactctaga ggatccccgg gtacttttg ttgtgtggaa ttgtgagcgg at

\hfill

52

 \ hskip-.1em \ dddseqskip 

cgactctaga ggatccccgg gtacttttg ttgtgtggaa ttgtgagcgg at

 \ hfill 

52

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 2

         \ vskip0.400000 \ baselineskip
      

<211> 51

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220> Synthesized primer sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 2

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

acaacgtcgt gactgggaaa accctttttg tgcgggcctc ttcgctatta c

\hfill

51

 \ hskip-.1em \ dddseqskip 

acaacgtcgt gactgggaaa accctttttg tgcgggcctc ttcgctatta c

 \ hfill 

51

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 3

         \ vskip0.400000 \ baselineskip
      

<211> 21

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 3

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

actttatgct tccggctcgt a

\hfill

21

 \ hskip-.1em \ dddseqskip 

actttatgct tccggctcgt a

 \ hfill 

twenty-one

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 4

         \ vskip0.400000 \ baselineskip
      

<211> 17

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ newpage
      

         \ vskip0.400000 \ baselineskip
      

<400> 4

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

gttgggaagg gcgatcg

\hfill

17

 \ hskip-.1em \ dddseqskip 

gttgggaagg gcgatcg

 \ hfill 

17

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 5

         \ vskip0.400000 \ baselineskip
      

<211> 600

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> M13mp18 bacteriophage

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 5

         \ vskip1.000000 \ baselineskip
      

4

         \ vskip0.400000 \ baselineskip
      

<210> 6

         \ vskip0.400000 \ baselineskip
      

<211> 63

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 6

         \ vskip1.000000 \ baselineskip
      

5

         \ vskip0.400000 \ baselineskip
      

<210> 7

         \ vskip0.400000 \ baselineskip
      

<211> 43

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 7

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

gtggattcgc actcctcccg ctgatcggga cctgcctcgt cgt

\hfill

43

 \ hskip-.1em \ dddseqskip 

gtggattcgc actcctcccg ctgatcggga cctgcctcgt cgt

 \ hfill 

43

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 8

         \ vskip0.400000 \ baselineskip
      

<211> 16

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 8

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

gccacctggg tgggaa

\hfill

16

 \ hskip-.1em \ dddseqskip 

gccacctggg tgggaa

 \ hfill 

16

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 9

         \ vskip0.400000 \ baselineskip
      

<211> 22

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 9

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

ggcgagggag ttcttcttct ag

\hfill

22

 \ hskip-.1em \ dddseqskip 

ggcgagggag ttcttcttct ag

 \ hfill 

22

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 10

         \ vskip0.400000 \ baselineskip
      

<211> 430

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Hepatitis B virus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 10

         \ vskip1.000000 \ baselineskip
      

6

         \ vskip0.400000 \ baselineskip
      

<210> 11

         \ vskip0.400000 \ baselineskip
      

<211> 293

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 11

         \ vskip1.000000 \ baselineskip
      

7

         \ vskip0.400000 \ baselineskip
      

<210> 12

         \ vskip0.400000 \ baselineskip
      

<211> 293

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 12

         \ vskip1.000000 \ baselineskip
      

8

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 13

         \ vskip0.400000 \ baselineskip
      

<211> 459

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 13

         \ vskip1.000000 \ baselineskip
      

9

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 14

         \ vskip0.400000 \ baselineskip
      

<211> 458

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized sequence

         \ newpage
      

         \ vskip0.400000 \ baselineskip
      

<400> 14

         \ vskip1.000000 \ baselineskip
      

10

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 15

         \ vskip0.400000 \ baselineskip
      

<211> 790

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 15

         \ vskip1.000000 \ baselineskip
      

eleven

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 16

         \ vskip0.400000 \ baselineskip
      

<211> 789

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized sequence

         \ newpage
      

         \ vskip0.400000 \ baselineskip
      

<400> 16

         \ vskip1.000000 \ baselineskip
      

12

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 17

         \ vskip0.400000 \ baselineskip
      

<211> 310

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 17

         \ vskip1.000000 \ baselineskip
      

13

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 18

         \ vskip0.400000 \ baselineskip
      

<211> 465

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized sequence

         \ newpage
      

         \ vskip0.400000 \ baselineskip
      

<400> 18

14

         \ vskip0.400000 \ baselineskip
      

<210> 19

         \ vskip0.400000 \ baselineskip
      

<211> 20

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> M13mp18

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 19

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

ccggggatcc tctagagtcg

\hfill

20

 \ hskip-.1em \ dddseqskip 

ccggggatcc tctagagtcg

 \ hfill 

twenty

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 20

         \ vskip0.400000 \ baselineskip
      

<211> 20

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> mutant M13mp18

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 20

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

ccggggatcc tctagagtca

\hfill

20

 \ hskip-.1em \ dddseqskip 

ccggggatcc tctagagtca

 \ hfill 

twenty

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 21

         \ vskip0.400000 \ baselineskip
      

<211> 48

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 21

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

cgactctaga ggatccccgg tttttgttgt gtggaattgt gagcggat

\hfill

48

 \ hskip-.1em \ dddseqskip 

cgactctaga ggatccccgg tttttgttgt gtggaattgt gagcggat

 \ hfill 

48

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 22

         \ vskip0.400000 \ baselineskip
      

<211> 48

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 22

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

tgactctaga ggatccccgg tttttgttgt gtggaattgt gagcggat

\hfill

48

 \ hskip-.1em \ dddseqskip 

tgactctaga ggatccccgg tttttgttgt gtggaattgt gagcggat

 \ hfill 

48

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 23

         \ vskip0.400000 \ baselineskip
      

<211> 47

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 23

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

cgtcgtgact gggaaaaccc tttttgtgcg ggcctcttcg ctattac

\hfill

47

 \ hskip-.1em \ dddseqskip 

cgtcgtgact gggaaaaccc tttttgtgcg ggcctcttcg ctattac

 \ hfill 

47

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 24

         \ vskip0.400000 \ baselineskip
      

<211> 21

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 24

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

actttatgct tccggctcgt a

\hfill

21

 \ hskip-.1em \ dddseqskip 

actttatgct tccggctcgt a

 \ hfill 

twenty-one

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 25

         \ vskip0.400000 \ baselineskip
      

<211> 17

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 25

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

gttgggaagg gcgatcg

\hfill

17

 \ hskip-.1em \ dddseqskip 

gttgggaagg gcgatcg

 \ hfill 

17

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 26

         \ vskip0.400000 \ baselineskip
      

<211> 44

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 26

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

tgttcctgat gcagtgggca gctttagtct gcggcggtgt tctg

\hfill

44

 \ hskip-.1em \ dddseqskip 

tgttcctgat gcagtgggca gctttagtct gcggcggtgt tctg

 \ hfill 

44

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 27

         \ vskip0.400000 \ baselineskip
      

<211> 45

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ newpage
      

         \ vskip0.400000 \ baselineskip
      

<400> 27

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

tgctgggtcg gcacagcctg aagctgacct gaaatacctg gcctg

\hfill

45

 \ hskip-.1em \ dddseqskip 

tgctgggtcg gcacagcctg aagctgacct gaaatacctg gcctg

 \ hfill 

Four. Five

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 28

         \ vskip0.400000 \ baselineskip
      

<211> 18

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 28

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

tgcttgtggc ctctcgtg

\hfill

18

 \ hskip-.1em \ dddseqskip 

tgcttgtggc ctctcgtg

 \ hfill 

18

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 29

         \ vskip0.400000 \ baselineskip
      

<211> 17

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: artificially synthesized primer sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 29

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

gggtgtggga agctgtg

\hfill

17

 \ hskip-.1em \ dddseqskip 

gggtgtggga agctgtg

 \ hfill 

17

Claims (4)

1. A set of primers for the synthesis of a nucleic acid that has complementary complementary chains united in a single chain chain, comprising the following elements: i) a first oligonucleotide primer that it comprises at least two regions F2 and F1c, in which F1c is attached next to 5 'of F2, and in which F2 is a region that has a sequence of complementary nucleotides of an arbitrary region F2c in an acid nucleic template that has a specific nucleotide sequence, Y F1c is a region that have substantially the same nucleotide sequence as an F1c region located on the side 5 'of the F2c region in the template nucleic acid that has a specific nucleotide sequence; ii) a second oligonucleotide primer having a nucleotide sequence complementary to an arbitrary region R2c in a complementary chain synthesized with the first oligonucleotide as the origin of the synthesis, which has a sequence of specific nucleotides; iii) a first outer primer having a complementary nucleotide sequence of an F3c region located in the 3 'side of the F2c region in the nucleic acid that serves as a mold; iv) a second outer primer having a complementary nucleotide sequence of an R3c region located in the 3 'side of the arbitrary R2c region in the complementary chain synthesized with the first oligonucleotide as the origin of the synthesis. 2. The set of primers according to the claim 1, wherein the second oligonucleotide primer has a region R1c, in which R1c is attached to the 5 'side of R2, and in the that R1c is a region that has substantially the same nucleotide sequence as the R1c region located on the side 5 'of the R2c region in the complementary chain synthesized with the first oligonucleotide having a nucleotide sequence specific. 3. A kit for the synthesis of a nucleic acid which has complementary chains alternately joined in a single chain, which includes the following elements: i) a first oligonucleotide primer that it comprises at least two regions F2 and F1c, in which F1c is linked next to 5 'of F2, and in which F2 is a region that has a sequence of complementary nucleotides of an arbitrary region F2c in an acid nucleic template that has a specific nucleotide sequence, Y F1c is a region that has substantially the same nucleotide sequence as an F1c region located on the side 5 'of the F2c region in the template nucleic acid that has a specific nucleotide sequence; ii) a second oligonucleotide primer that has a nucleotide sequence complementary to an R2c region arbitrary in a complementary string synthesized with the first oligonucleotide as the origin of the synthesis, which has a sequence of specific nucleotides; iii) a first outer primer having a complementary nucleotide sequence of an F3c region located in the 3 'side of the F2c region in the nucleic acid that serves as a mold; iv) a second outer primer having a complementary nucleotide sequence of an R3c region located in the 3 'side of the arbitrary R2c region in the complementary chain synthesized with the first oligonucleotide as the origin of the synthesis. v) a DNA polymerase that catalyzes the reaction of chain offset type of the complementary chain that synthesizes; Y vi) a nucleotide that serves as a substrate for item v). 4. A procedure to synthesize an acid nucleic that has alternately linked complementary chains in a single chain chain, which includes: A) mix the following components i) to vi) With the sample nucleic acid as a template: i) a first oligonucleotide primer that it comprises at least two regions F2 and F1c, in which F1c is linked next to 5 'of F2, and in which F2 is a region that has a sequence of complementary nucleotides of an arbitrary region F2c in an acid nucleic template that has a specific nucleotide sequence, Y F1c is a region that has substantially the same nucleotide sequence as an F1c region located on the side 5 'of the F2c region in the template nucleic acid that has a specific nucleotide sequence; ii) a second oligonucleotide primer having a nucleotide sequence complementary to an R2c region arbitrary in a complementary string synthesized with the first oligonucleotide as the origin of the synthesis, which has a sequence of specific nucleotides; iii) a first outer primer having a complementary nucleotide sequence of an F3c region located in the 3 'side of the F2c region in the nucleic acid that serves as a mold; iv) a second outer primer having a complementary nucleotide sequence of an R3c region located in the 3 'side of the arbitrary R2c region in the complementary chain synthesized with the first oligonucleotide as the origin of the synthesis. v) a DNA polymerase that catalyzes the reaction of chain offset type of the complementary chain that synthesizes; Y vi) a nucleotide that serves as a substrate for element v); Y B) incubate the mixture at a temperature such that the nucleotide sequence that constitutes the first and second oligonucleotide primers can form base pairing stable with the mold.