JP4516032B2 - Nucleic acid detection method and assay kit by hybridization - Google Patents

Description

  The present invention relates to a method for detecting a nucleic acid having a stem-loop structure, and more particularly to a method for detecting an amplification product by a LAMP method by a hybridization method.

  In order to detect a nucleic acid chain having a specific nucleic acid sequence, amplification is performed using a primer complementary to the detection target, and the presence or absence of amplification is confirmed by electrophoresis. A method of detecting using a complementary probe is generally known. The detection method using the probe has an advantage that the specificity of the amplification product can be confirmed again.

  The PCR (Polymerase Chain Reaction) method is generally known as a gene amplification technique (Non-Patent Document 1). However, a complicated temperature control device is required as a problem of the PCR method, and a template with a few base differences is used. On the other hand, it has been pointed out that a specific amplification reaction is difficult. Instead of this PCR method, a LAMP (Loop-mediated isothermal amplification) method has been developed as a gene amplification method that does not require complicated temperature control (Patent Document 1). The LAMP method sets four types of primers that recognize six regions of the target gene, mixes the strand displacement DNA synthase, the sample gene, and the substrate, and amplifies the gene at 60 to 65 ° C under isothermal conditions. Technology. As the reaction proceeds, a loop structure is formed, and repeated structures of various sizes having sequences complementary to each other on the same strand are formed. Compared with the PCR method, the LAMP method is advantageous in that a large amount of amplified product can be obtained in a short time, and is expected to be applied in a wide range of fields in the future.

  An amplification product obtained by the LAMP method has a stem-loop structure, and as a simple detection method thereof, a technique for measuring the white turbidity of the byproduct Mg pyrophosphate generated during the amplification process is effective. However, the method for measuring white turbidity has a problem that when non-specific amplification has occurred, there is a possibility that an erroneous determination is made, and that a plurality of target nucleic acids cannot be detected simultaneously.

Therefore, a method has been developed in which a single-stranded loop region present in the LAMP product is utilized and hybridization is detected with the probe nucleic acid using this region. For example, a probe nucleic acid that hybridizes to a single-stranded loop region is fluorescently labeled and the degree of fluorescence polarization is measured (Patent Document 2), and the 5 ′ end of a primer that hybridizes to the single-stranded loop region is used as an immobilized carrier Immobilization and observation of agglutination reaction (Patent Document 3), Probe nucleic acid hybridizing to single-stranded loop region is immobilized on a solid phase, and hybridization between probe and LAMP amplification product is fluorescent or electrochemical principle There is a detection method (Patent Document 4). However, the efficiency of hybridization between the LAMP product and the probe nucleic acid is low, and there are cases where there are problems in the measurement efficiency and accuracy.
Patent No. 3313358 JP 2002-272475 A JP 2002-345499 A JP 2005-143492 A Science, 230,1350-1354,1985

  In view of the above problems, an object of the present invention is to provide a detection method with improved hybridization efficiency in a method of detecting a nucleic acid chain having a stem-loop structure by hybridization with a probe nucleic acid.

  In order to solve the above-mentioned problems, the present inventors first examined the cause of the decrease in the hybridization efficiency between a nucleic acid having a stem-loop structure and a probe nucleic acid. As a result, nucleic acid strands that have a stem-loop structure, such as LAMP amplification products, can be used when the single-stranded loop portion shows a complex higher-order structure or when single-stranded loops that represent complementary sequences in the LAMP product It has been found that the efficiency of hybridization with a probe nucleic acid is reduced when it is likely to be bound, and the present invention has been completed.

  That is, according to the first aspect of the present invention, a target nucleic acid having a stem-loop structure, a part of the loop structure part being a detection sequence, a probe nucleic acid having a sequence complementary to the detection sequence, and Preparing a protected nucleic acid having a sequence complementary to the sequence of a portion other than the detection sequence in the loop structure portion, and binding the protected nucleic acid to the target nucleic acid to hybridize the target nucleic acid and a probe nucleic acid And a step of detecting a target nucleic acid bound to the probe nucleic acid is provided.

  According to the second aspect of the present invention, a LAMP amplification product having a stem-loop structure and a part of the loop structure part being a detection sequence, a probe nucleic acid having a sequence complementary to the detection sequence, and the above A step of preparing a protected nucleic acid having a sequence complementary to the sequence of a portion other than the detection sequence in the loop structure portion, binding the protected nucleic acid to the amplification product, and hybridization between the amplification product and the probe nucleic acid. And a step of detecting an amplification product bound to the probe nucleic acid, and a method for detecting an amplification product by the LAMP method is provided.

  Another aspect of the present invention provides a protected nucleic acid for the detection method. Furthermore, an assay kit comprising the protected nucleic acid and an appropriate buffer is provided.

  According to the present invention, a nucleic acid chain having a stem-loop structure can be efficiently hybridized with a probe nucleic acid, and detection accuracy can be improved.

  Hereinafter, the present invention will be described in detail. In the present specification, a nucleic acid to be detected is referred to as a target nucleic acid, and its base sequence is referred to as a target sequence. A solution that can be used for the detection method of the present invention and can contain the target nucleic acid is referred to as a sample solution.

  The target nucleic acid in the present invention has a stem-loop structure. Here, the stem-loop structure means a structure containing a complementary sequence portion in a nucleic acid strand, a double-stranded portion formed by hybridization of that portion, and a loop-like single-stranded portion therebetween. A nucleic acid having such a stem-loop structure is also formed, for example, when single-stranded DNA or RNA is self-hybridized, but the most typical example is formed as an amplification product by the LAMP method.

  In the method of the present invention, the target nucleic acid (or amplification product) is detected by hybridizing with the probe nucleic acid, but the sequence for hybridizing with the probe nucleic acid in the target nucleic acid (or amplification product) is detected. It shall be called. Accordingly, the probe nucleic acid has a sequence complementary to the detection sequence.

  The LAMP method is a method of amplifying a target nucleic acid present in a sample using a plurality of primers and a strand displacement type DNA polymerase. There are various methods for detecting an amplification product. In the present invention, detection is performed using a probe nucleic acid as described above.

  Hereinafter, an outline of the LAMP method will be described. In the LAMP method, as shown in FIG. 1, the F3 region, the F2 region, and the F1 region are defined in order from the 5 ′ end side to the target nucleic acid, and the B3c region, the B2c region, and the B1c region are sequentially arranged from the 3 ′ end side. Is specified. Then, the target nucleic acid is amplified using four kinds of primers as shown in FIG. The F1c, F2c, F3c, B1, B2, and B3 regions indicate regions in the complementary strands of the F1, F2, F3, B1c, B2c, and B3c regions, respectively.

  The four types of primers used to amplify nucleic acids in the LAMP method are (1) having the same sequence as the F2 region on the 3 ′ end side and complementary to the F1 region on the 5 ′ end side. A FIP primer having a sequence; (2) an F3 primer comprising the same sequence as the F3 region; (3) a sequence complementary to the B2c region on the 3 ′ end side and the B1c region on the 5 ′ end side; A BIP primer having the same sequence; and (4) a B3 primer comprising a sequence complementary to the B3c region. In general, the FIP primer and the BIP primer are called inner primers, and the F3 primer and the B3 primer are called outer primers.

  When LAMP amplification is performed using the above four types of primers, an intermediate product having a dumbbell structure as shown in FIG. 2 is generated. FIP and BIP primers bind to the F2c and B2c regions in the single-stranded loop, and the extension reaction proceeds from the 3 'end of the primer and the 3' end of the intermediate product itself. For details, see Japanese Patent No. 3313358.

  Furthermore, in the LAMP method, a primer called a loop primer can be used in addition to the above four types of primers. The loop primer is designed to anneal between the F2-F1 regions and between the B2-B1 regions as shown in FIG. When designed in this way, the loop primer anneals to a single-stranded loop that is different from the single-stranded loop to which the FIP and BIP primers bind, as shown in Fig. 4, thereby increasing the synthesis starting point of the LAMP reaction. And the LAMP amplification reaction can be performed efficiently. For details, refer to WO2002 / 024902.

  The amplification product obtained by the LAMP method outlined above can be advantageously hybridized by using a single-stranded loop structure portion sequence. For this reason, as shown in FIG. 5, the detection sequence and FP region for hybridizing with the probe nucleic acid are defined between the F1 region and the F2 region (including the F2 region). Similarly, a BP region that is a detection sequence is defined between the B2 region and the B1 region (including the B2 region). As the detection sequence, any one of FP, FPc, BP, and BPc regions may be used, or two or more may be used.

  When the detection sequence is defined in this way, as shown in FIG. 6, a stem-loop structure having a single-stranded loop region containing the detection sequence is formed in the LAMP product. Since the detection sequence is single-stranded, a complicated operation of changing from double-stranded to single-stranded prior to hybridization is unnecessary, and the efficiency of hybridization can also be improved.

  However, the efficiency may still be low in this hybridization, and problems may occur in measurement efficiency, accuracy, and the like. One of the causes is that the loop portion in the stem-loop structure forms a complex higher order structure in the solution and cannot hybridize with the probe nucleic acid.

  Furthermore, in the LAMP method, there are a large number of loop parts consisting of complementary sequences in the amplification product, so the loop parts are bound to each other, and the amplification product must hybridize with the probe nucleic acid to be originally bound. There is a case that cannot be done. For example, in the loop of the LAMP amplification product shown in FIG. 6, (a) and (b), (c) and (d) have mutually complementary sequences. Therefore, when the loop portion is long or when the GC content is high, single-stranded loops showing complementary sequences are bonded to each other, which can be a factor for reducing the reaction efficiency with the probe.

  Therefore, in the present invention, a protected nucleic acid having a sequence complementary to the sequence of a portion other than the detection sequence in the loop structure portion is used, and the target nucleic acid and the probe nucleic acid are bound to the target nucleic acid. And target nucleic acid bound to the probe nucleic acid is detected.

  When detecting an amplification product of the LAMP method, a protected nucleic acid having a sequence complementary to a sequence other than the detection sequence in the loop structure portion in the amplified product is used, and the protected nucleic acid is bound to the amplified product, The amplification product and the probe nucleic acid are hybridized to detect the amplification product bound to the probe nucleic acid.

  The protected nucleic acid is a nucleic acid having a sequence complementary to the sequence of a portion other than the detection sequence of the loop structure portion in the target nucleic acid. The protected nucleic acid for the LAMP product is a nucleic acid having a sequence complementary to the sequence of a portion other than the detection sequence of the loop structure portion in the amplification product.

  A specific example of the protected nucleic acid for the LAMP amplification product is a nucleic acid having a sequence complementary to the arrowed portion in FIG. Detected from the F1c region, a first protected nucleic acid having a sequence complementary to the sequence from the F1 region to the detection sequence between the complementary portions F1 region and F1c region at both ends of the loop, or between the B1 region and B1c region A second protection nucleic acid having a sequence complementary to the sequence up to the sequence, a third protection nucleic acid having a sequence complementary to the sequence from the B1 region to the detection sequence, and a sequence complementary to the sequence from the B1c region to the detection sequence It can be classified into a fourth protected nucleic acid having a sequence.

  For example, in FIG. 7A, the first protected nucleic acid is a nucleic acid complementary to the sequence between the F1-FP regions, and the second protected nucleic acid is a nucleic acid complementary to the sequence between the FP-F1c regions. . In FIG. 7 (b), the first protected nucleic acid is a nucleic acid complementary to the sequence between the F1-FPc regions, and the second protected nucleic acid is a nucleic acid complementary to the sequence between the FPc-F1c regions. Similarly, in FIG. 7 (c), the third protected nucleic acid is a nucleic acid complementary to the sequence between B1-BP regions, and the fourth protected nucleic acid is a nucleic acid complementary to the sequence between BP-B1c regions. It is. In FIG. 7 (d), the third protected nucleic acid is a nucleic acid complementary to the sequence between the B1-BPc regions, and the fourth protected nucleic acid is a nucleic acid complementary to the sequence between the BPc-B1c regions.

  By introducing the above-described protected nucleic acid into a single-stranded loop region, it is possible to avoid binding between single-stranded loops showing complementary sequences. Furthermore, the higher order structure of the single-stranded loop structure can be solved. By these, it is ensured that the detection sequence in the loop structure is in a single-stranded state, and the hybridization efficiency with the probe nucleic acid can be improved.

  For example, when the detection sequence is an FP region, in addition to the protected nucleic acid of FIG. 7 (a), the protected nucleic acid of FIG. 7 (b) can be used. In this case, the effect of solving the higher-order structure of the single-stranded loop structure cannot be expected, but the complementary single-stranded loops showing the sequence can be avoided. However, if the protective strands in FIGS. 7 (a) and 7 (b) are used simultaneously, the protected nucleic acids are bound to each other, which may hinder binding to the amplification product. It is preferred to use a protected nucleic acid. The same applies when FPc, BP, or BPc is used as the detection sequence.

  After the protection nucleic acid is bound to the target nucleic acid (or amplification product) in advance, the probe nucleic acid and the target nucleic acid (or amplification product) may be hybridized, or the probe nucleic acid and the target nucleic acid (or amplification product) may be hybridized. A protective nucleic acid may be added simultaneously to the hybridization. In the case where the detection sequence is not designed in the F region or the B region, a protective nucleic acid that binds to all the single-stranded regions can be added.

  Furthermore, another aspect of the present invention provides a protected nucleic acid for use in the above method. Furthermore, an assay kit containing the protected nucleic acid and an appropriate buffer is provided.

<Sample sample>
Samples targeted by the present invention are not particularly limited, and examples include blood, serum, leukocytes, urine, stool, semen, saliva, tissue, biopsy, oral mucosa, cultured cells, sputum and the like collected from individuals. Can be used. Individuals may be humans, non-human animals and plants, and microorganisms such as viruses, bacteria, bacteria, yeasts, and mycoplasmas. Nucleic acid components are extracted from these specimen samples to prepare a sample solution for use in a target nucleic acid detection test. The extraction method is not particularly limited, and for example, a commercially available nucleic acid extraction method QIAamp (manufactured by QIAGEN), Sumitest (manufactured by Sumitomo Metals), or the like can be used.

<Probe nucleic acid>
The probe nucleic acid is a probe showing a sequence complementary to a detection sequence. The probe may be unlabeled or labeled with a fluorescent substance such as Cy5, Cy3, FITC or rhodamine, or a luminescent substance such as luminol, lucigenin or an acridinium ester derivative, depending on the detection method. Or labeled with a hapten or an enzyme. Further, in order to immobilize the probe nucleic acid on the solid phase, it may be modified with a reactive functional group such as amino group, carboxyl group, hydrosyl group, thiol group or sulfone group, or a substance such as avidin or biotin.

  Examples of the solid phase include nitrocellulose membrane, nylon membrane, microtiter plate, glass, silicon, electrode, magnet, bead, plastic, latex, synthetic resin, natural resin, and optical fiber.

  One or more detection sequences that bind to the probe nucleic acid are designed in the target nucleic acid (in the LAMP product). When two or more detection sequences are designed, depending on the detection method, an unlabeled probe and a labeled probe, A probe immobilized on a phase and an unimmobilized probe may be used simultaneously. For example, in sandwich hybridization using a probe nucleic acid for capture and a labeled probe nucleic acid for detection, the labeled probe nucleic acid floats in the solution and hybridizes with the detection sequence. After floating and hybridizing with a detection sequence, it is immobilized on a solid phase or immobilized on a solid phase in advance.

  Furthermore, the probe nucleic acid may constitute a DNA chip. A DNA chip is a device in which probe nucleic acids are immobilized at high density on a glass or silicon substrate, and is a device capable of examining the sequence information of many genes at once. The fluorescence detection method, which is currently the mainstream method, is a method in which a sample gene labeled with fluorescence is reacted with a probe on a chip and detected using a highly sensitive fluorescence analyzer. As another detection method, a current detection type DNA chip has also been developed. In this method, after hybridization of the probe nucleic acid immobilized on the electrode and the target nucleic acid, an intercalating agent that specifically reacts with double-stranded DNA is added, and an electrochemical signal obtained from the intercalating agent is measured. It is. Electrochemical DNA chips do not require labeling and are not expected to be expensive devices for detection, and thus are expected as second-generation DNA chips (see, for example, JP-A-5-199898).

<Hybridization reaction conditions>
Hybridization of the target nucleic acid and the probe nucleic acid is performed under appropriate conditions. Appropriate conditions vary depending on the type and structure of the target product, the type of base contained in the detection sequence, and the type of probe nucleic acid, but for example, in an ionic strength range of 0.01 to 5 and in a pH range of 10 to 10. Do. In the reaction solution, dextran sulfate which is a hybridization accelerator, salmon sperm DNA, bovine thymus DNA, EDTA, a surfactant and the like may be added. The reaction temperature is, for example, in the range of 10 ° C. to 90 ° C., and the reaction efficiency may be increased by stirring or shaking. For washing after the reaction, for example, a buffer solution having an ionic strength of 0.01 to 5 and a pH of 5 to 10 may be used.

<Detection method>
Any method can be used for detecting the target nucleic acid hybridized to the probe nucleic acid. Specific examples are described below.

  As a first detection method, there is a method using an intercalating agent that binds to a double strand of a nucleic acid. The probe nucleic acid is modified with a reactive functional group such as an amino group, carboxyl group, hydrosyl group, thiol group, or sulfone group, a substance such as hapten, avidin, or biotin, and immobilized on a solid phase. After the protected nucleic acid is hybridized to the target nucleic acid, it is hybridized with the probe nucleic acid on the solid phase. Thereafter, the presence or absence of hybridization between the probe nucleic acid and the target nucleic acid is detected from the signal of the intercalating agent.

  The intercalating agent is not particularly limited as long as it has photochemical activity or electrochemical activity. For example, ethidium, ethidium bromide, acridine, aminoacridine, acridine orange, proflavine, eribeticine, actinomycin D, donomycin, mitomycin C, Hoechst 33342, Hoechst 33258, aclarubicin, DAPI, adriamycin, epirubicin, aclacinomycin, etc. Can be used. Other usable intercalating agents include those described in JP-A-62-282599.

  In addition, when an electrochemical change is detected using an electrode, in addition to the above-described substance in which the intercalating agent itself is reversible with respect to the redox reaction, a substance that causes an electrically reversible redox reaction is used. A metal complex contained as a central metal, that is, a metallointercalator can be used. Examples of such metallointercalators include tris (phenanthroline) zinc complex, tris (phenanthroline) ruthenium complex, tris (phenanthroline) cobalt complex, di (phenanthroline) zinc complex, di (phenanthroline) ruthenium complex, di (phenanthroline) cobalt. Complexes, bipyridine platinum complexes, terpyridine platinum complexes, phenanthroline platinum complexes, tris (bipyridyl) zinc complexes, tris (bipyridyl) ruthenium complexes, tris (bipyridyl) cobalt complexes, di (bipyridyl) zinc complexes, di (bipyridyl) ruthenium complexes And di (bipyridyl) cobalt complex.

Further, when nucleic acid is detected using an electrode, an intercalating agent that generates electrochemiluminescence can also be used. Such an intercalating agent is not particularly limited, and examples thereof include luminol, lucigenin, pyrene, diphenylanthracene and rubrene. Electrochemiluminescence by these intercalating agents is obtained by using an enhancer such as luciferin derivatives such as firefly luciferin and dehydroluciferin, phenols such as phenylphenol and chlorophenol, or naphthols. It is possible to enhance.

  In the case of an optically active intercalating agent, the difference in signal between the intercalating agent alone and when bound to the double strand is measured as absorbance, fluorescence, luminescence, quenching, fluorescence polarization, circular dichroism, etc. There is a detection method based on optical information, or a method of detecting changes in the absorption wavelength, fluorescence wavelength, emission wavelength, and quenching wavelength of an intercalating agent bonded to a double strand.

  In the case of an electrochemically active intercalator, it is detected by measuring the redox current of the central metal or intercalator itself.

  As a second detection method, there is a method of sandwich-hybridizing a probe nucleic acid immobilized on a solid phase with a labeled (1) probe nucleic acid or (2) a protected nucleic acid. The method of sandwich hybridizing the labeled probe nucleic acid of (1) is a method in which both the labeled probe nucleic acid and the unlabeled protected nucleic acid are hybridized to the target nucleic acid and then hybridized with the probe nucleic acid on the solid phase. is there. The method of sandwich hybridizing labeled protected nucleic acid of (2) is that the labeled nucleic acid is not used, but the protected nucleic acid is directly labeled and hybridized to the target nucleic acid, and then hybridized with the probe nucleic acid on the solid phase. It is a method to make it. In the case of (2), the protected nucleic acid also serves as a labeled probe nucleic acid for detection.

  The labeling substance used here can be determined according to the detection method performed thereafter. For example, it is labeled with an electrode active substance, a fluorescent substance, a luminescent substance, an electrochemiluminescent substance, an enzyme, an enzyme substrate, a hapten, an antigen, an antibody, a radioisotope, and hybridized with a target nucleic acid. Substances that cannot detect signals directly, such as the above-mentioned haptens, use enzyme-linked anti-hapten antibodies such as enzyme-linked avidin to turbidity, absorbance, fluorescence, luminescence, quenching, fluorescence polarization, circularity of substances due to enzyme reactions. The gene is detected indirectly by measuring optical information such as dichroism or measuring electrical activity.

  As a third detection method, a probe nucleic acid to which an insoluble carrier such as a natural polymer carrier, a synthetic polymer carrier, a metal colloid, or a magnetic particle is immobilized is hybridized to a target nucleic acid hybridized with a protective nucleic acid, and then aggregated. There is a method to observe the reaction.

  As a fourth detection method, a probe nucleic acid is labeled with an electrode active material, a fluorescent material, a luminescent material, an electrochemiluminescent material, an enzyme, an enzyme substrate, a hapten, an antigen, an antibody, a radioisotope, etc., and a protected nucleic acid is hybridized. There is a method of hybridizing to a target nucleic acid. The feature of the fourth detection method is that the probe nucleic acid is not immobilized on the solid phase but suspended in the solution. The presence or absence of hybridization between the target nucleic acid and the probe nucleic acid indicates the change in signal before and after binding to the duplex, such as turbidity, absorbance, fluorescence, luminescence, quenching, fluorescence polarization, and circular dichroism. Detect based on.

  In the detection method of the present invention, when the probe nucleic acid constitutes a DNA chip, it is desirable that the apparatus can be miniaturized and the detection operation can be simplified. When the probe nucleic acid constitutes a DNA chip, it can be detected by a current detection method, a fluorescence detection method, or the like.

  In the case of the current detection method, detection is generally carried out according to the first detection method using an intercalating agent that binds to the double strand of the nucleic acid. An electrode is placed on a glass or silicon substrate, and a probe nucleic acid is immobilized on the electrode. The number of electrodes and the arrangement pattern can be appropriately designed by those skilled in the art as needed. Moreover, you may use a counter electrode or a reference electrode like other general electrochemical detection methods.

  The electrode used here is not particularly limited, for example, gold, gold alloy, silver, platinum, mercury, nickel, palladium, silicon, germanium, gallium, tungsten, and other simple metals and alloys thereof, Alternatively, carbon such as graphite and glassy carbon, or oxides and compounds thereof can be used.

  Subsequently, the target nucleic acid hybridized with the unlabeled protected nucleic acid is hybridized with the probe nucleic acid immobilized on the substrate. Thereafter, an electrochemically active intercalating agent is added, and the presence or absence of the target nucleic acid is detected from the electrochemical signal of the intercalating agent.

  In electrochemical measurement, for example, a potential higher than the potential at which the intercalating agent electrochemically reacts is applied, and the reaction current value derived from the intercalating agent is measured. At this time, the potential may be swept at a constant speed, applied with a pulse, or a constant potential may be applied. At the time of measurement, the current and voltage may be controlled using a device such as a potentiostat, a digital multimeter, and a function generator.

  The intercalating agent that enters the double strand is an electrochemically active substance such as Hoechst 33258, acridine orange, quinacrine, donomycin, metallointercalator, bisintercalator such as bisacridine, trisintercalator, polyintercalator, etc. It is possible to use. Furthermore, these intercalators can be modified with an electrochemically active metal complex such as ferrocene or viologen.

  In the case of the fluorescence detection method, generally, according to the second detection method, a probe nucleic acid or a protected nucleic acid is labeled with a fluorescent dye such as Cy5, Cy3, FITC, rhodamine, etc., and a target nucleic acid is sandwich-hybridized, and the fluorescent dye There is a method of labeling a target nucleic acid by using a primer labeled with dNTP or dNTP, and then hybridizing with a probe nucleic acid immobilized on a solid phase. The binding between the target nucleic acid and the probe nucleic acid on the solid phase is performed using an appropriate detection device corresponding to the type of label.

  As an application example of the nucleic acid detection method according to the present invention, single nucleotide mutations (Single Nucleotide Polymorphisms: SNPs) of the target nucleic acid sequence were detected. In this example, human SAA1 gene was used as the sample nucleic acid, and T / C SNP present in the SAA1 promoter region was detected. FIG. 8 shows the positive strand of the human SAA1 gene, and the sequence portion of each primer is indicated by an arrow. The part surrounded by the dotted line shows the sequence of the protected nucleic acid. Although the portion surrounded by the solid line is the detection sequence portion, in this embodiment, the minus strand is used as the detection sequence. Therefore, the portion surrounded by the solid line in FIG. 8 is a probe sequence complementary to the detection sequence.

  Here, the FIP primer includes an F1c portion and an F2 portion, and the BIP primer includes a B1c portion and a B2 portion. An arbitrary sequence may be inserted between them, or it may not be inserted. In FIG. 8, in the F region, the portion to which c is added (namely, F1c) uses the reverse strand of the sequence shown in FIG. 8, and in the B region, the portion to which c is not added (namely, B2 and B3) is shown. This means that the reverse strand of the sequence shown in 8 is used.

  Primers were designed so that the detection sequence containing the single nucleotide mutation site was located in the single-stranded loop, and amplified by the LAMP method. The single-stranded loop part (including the B2 region) containing the detection sequence has 47 bases. A protected nucleic acid that binds to the single-stranded loop side containing the detection sequence was added to the LAMP amplification product and hybridized with the probe nucleic acid immobilized on the gold electrode. Thereafter, SNPs present in the LAMP amplification product were detected using a current detection method.

<Detection sequence>
CTGCCAGGGAACGGTGG
<Synthetic nucleotide primer>
SAA1 F3 primer GTCTCCTGCCCTGACAGC
SAA1 FIP primer CAGTGGTTTCTTCATCCCG (F1c) -CAGGCACATCTTGTTCCCTC (F2)
SAA1 B3 primer ACTCCTTGGTGTGCTCCTC
SAA1 BIP primer GGAAGGCTCAGTATAAATAGCA (B1c) -GTGCTGTAGCTGAGCTGCG (B2)
<Protected nucleic acid>
GGACCCGCAGCTCAGCTACAGCAC

<LAMP reaction solution>
The LAMP reaction solution had the following composition.

Sterile ultra-pure 1.5μL
Bst DNA Polymerase 1μL
Buffer 12.5μL
Tris ・ HCl pH8.0 40mM
KCl 20mM
MgSO4 16mM
(NH4) 2SO4 20mM
Tween20 0.2%
Betaine 1.6M
DNTP 2.8mM
F3 primer (10μM) 0.5μL
B3 primer (10 μM) 0.5 μL
FIP primer (10μM) 4μL
BIP primer (10μM) 4μL
Template (purified human genome) 1μL
Total 25 μL

<Amplification reaction by LAMP method>
The amplification reaction was performed at a temperature of 63 ° C. and for a time of 1.5 hours. The amplification product was confirmed by agarose electrophoresis. Furthermore, a solution to which sterilized ultrapure was added instead of the genome at the time of preparation of the LAMP reaction solution was also subjected to electrophoresis at the same time to confirm whether or not contamination occurred.
For the type of SNP present in the promoter region, a genome that was found to be a T / T homotype as a result of sequencing was used.

<Preparation of probe nucleic acid-immobilized electrode>
The base sequence of the probe nucleic acid is shown below.

Negative probe GACTATAAACATGCTTTCCGTGGCA
Match T probe CCACCGTTCCCTGGCAG
Mismatch C probe CCACCGCTCCCTGGCA
For negative probes, match T probes, and mismatch C probes, 3′SH modified probes were used. The negative probe shows a sequence unrelated to the SAA1 gene sequence.

  The probe was immobilized on the gold electrode by utilizing the strong chemical bond between thiol and gold. A probe solution containing a thiol-modified probe was spotted on a gold electrode, allowed to stand for 1 hour, immersed in a 1 mM mercaptohexanol solution, and washed with a 0.2 × SSC solution. Spots were assigned to three electrodes for the same probe. After cleaning, the substrate was cleaned with ultrapure water and air-dried to obtain a probe-immobilized electrode substrate.

<Electrode arrangement>
1-3 electrode Negative probe
4-6 electrode match T probe
7-9 electrode mismatch C probe

<Hybridization of LAMP product to probe nucleic acid>
The sample nucleic acid used was the LAMP product amplified above. Immobilization of the probe nucleic acid prepared above with a sample in which only 2 × SSC salt is added to the LAMP product and a sample in which 2 × SSC salt and 1 × 10 ¹² copy / μl of protected nucleic acid are added. A hybridization reaction was performed by spotting 0.2 μl each on an electrode substrate and allowing to stand at 55 ° C. for 40 minutes. Thereafter, it was immersed in a 0.2 × SSC solution at 45 ° C. and lightly washed with ultrapure water. This electrode was immersed in a phosphate buffer containing 50 μM Hoechst 33258 solution as an intercalating agent for 15 minutes, and then the oxidation current response of Hoechst 33258 molecules was measured.

<Result>
The result of current measurement is shown in FIG. When comparing the current value of the LAMP product to which the protected nucleic acid was not added and the LAMP product to which the protected strand was added, for the LAMP product to which the protected nucleic acid was not added, there was almost no increase in the current value associated with the hybridization. For the added LAMP product, a marked increase in current value was observed. After hybridization, the electrode was immersed in a 0.2 × SSC solution at 45 ° C., so that there was almost no increase in current value from the match T probe and the mismatch C probe with a single base difference. From this, it was clarified that a sequence having a single base difference can be identified by appropriately selecting the probe sequence conditions, hybridization conditions, and washing conditions. The region amplified in this example is the promoter region of the gene, and the complex higher-order structure of the single-stranded loop region containing the detection sequence may have reduced the efficiency of hybridization with the probe. It was presumed that the addition of the protected nucleic acid solved the higher-order structure of the single-stranded loop and increased the hybridization efficiency between the probe and the detection sequence.

The arrangement | positioning figure of each area | region on a target nucleic acid. The figure which shows the amplification intermediate product of a LAMP method, and the annealing position of a primer. FIG. 5 is a layout diagram of loop primer regions on a target nucleic acid. The figure which shows the amplification intermediate product of a LAMP method, and the annealing position of a primer. FIG. 6 is a layout diagram of detection regions on a target nucleic acid. Schematic diagram of four types of single-stranded loop regions formed in the LAMP product. The schematic diagram which shows arrangement | positioning of the protection nucleic acid in four types of single stranded loop region parts formed in a LAMP product. The figure which shows the area | region setting of the detection sequence and protection nucleic acid in an Example. The figure which shows the result of an Example.

Claims (6)

A target nucleic acid having a stem-loop structure, a part of the loop structure part being a detection sequence, a probe nucleic acid having a sequence complementary to the detection sequence, and a part other than the detection sequence in the loop structure part Providing a protected nucleic acid having a sequence complementary to the sequence;
A target nucleic acid comprising: hybridizing the protected nucleic acid to the target nucleic acid, performing hybridization between the target nucleic acid and a probe nucleic acid, and detecting the target nucleic acid hybridized with the probe nucleic acid. Detection method.   The protected nucleic acid for use in the detection method according to claim 1, which has a sequence complementary to the sequence of a portion other than the detection sequence in the loop structure portion of the target nucleic acid. LAMP amplification product having a stem-loop structure and a part of the loop structure part being a detection sequence, a probe nucleic acid having a sequence complementary to the detection sequence, and a sequence of a part other than the detection sequence in the loop structure part Providing a protected nucleic acid having a sequence complementary to
LAMP method comprising: hybridizing the protected nucleic acid to the amplification product, performing hybridization between the amplification product and a probe nucleic acid, and detecting the amplification product hybridized with the probe nucleic acid. A method for detecting amplification products.   The protected nucleic acid for use in the detection method according to claim 3, which has a sequence complementary to the sequence of a portion other than the detection sequence in the loop structure portion of the amplification product. In the loop structure present in the LAMP amplification product, the protected nucleic acid has complementary sequence portions at both ends of the loop as F1 region and F1c region, or B1 region and B1c region,
A first protection nucleic acid having a sequence complementary to the sequence from the F1 region to the detection sequence, a second protection nucleic acid having a sequence complementary to the sequence from the F1c region to the detection sequence, a sequence from the B1 region to the detection sequence 5. At least one selected from the group consisting of a third protected nucleic acid having a sequence complementary to and a fourth protected nucleic acid having a sequence complementary to the sequence from the B1c region to the detection sequence. The protected nucleic acid according to 1. A part of the loop structure portion of the target nucleic acid having a stem-loop structure is used as a detection sequence, and a protective nucleic acid having a sequence complementary to the sequence of a portion other than the detection sequence in the loop structure portion is hybridized to the target nucleic acid. , assay kit, characterized in that it comprises for a method to detect the target nucleic acid is a probe nucleic acid which hybridizes with a sequence complementary to the detection sequence, the protected nucleic acid and buffer.

Images