WO2013080307A1

WO2013080307A1 - Primer set for amplifying mosquito-borne virus, assay kit for detecting mosquito-borne virus, and detection method using said primer set and said assay kit

Info

Publication number: WO2013080307A1
Application number: PCT/JP2011/077574
Authority: WO
Inventors: 高橋　匡慶; 源間　信弘; 二階堂　勝; 山本　直樹; 美彩子矢島
Original assignee: 株式会社東芝; シンガポール国立大学
Priority date: 2011-11-29
Filing date: 2011-11-29
Publication date: 2013-06-06

Abstract

The present embodiment relates to a primer set for amplifying a mosquito-borne virus comprehensively. The mosquito-borne virus to be amplified includes a chikungunya virus, a dengue virus, a Japanese encephalitis virus, a West Nile virus and a yellow fever virus. The primer set includes a first primer group including SEQ ID NOs: 1 to 7, a second primer group including SEQ ID NOs: 8 to 12, a third primer group including SEQ ID NOs: 13 to 18, a fourth primer group including SEQ ID NOs: 19 to 23, a fifth primer group including SEQ ID NOs: 24 to 29, a sixth primer group including SEQ ID NOs: 30 to 35, a seventh primer group including SEQ ID NOs: 36 to 41 and an eighth primer group including SEQ ID NOs: 42 to 47.

Description

Primer set for amplifying mosquito-borne virus, assay kit for detecting mosquito-borne virus, and detection method using them

The present invention relates to a primer set for amplifying mosquito medium virus, an assay kit for detecting mosquito medium virus, and a detection method using them.

There are chikungunya virus, dengue virus, Japanese encephalitis virus, West Nile virus and yellow fever virus as the causative viruses of mosquito-borne infections. Since these viruses are also mosquito-borne viruses, it is desirable to detect them in a short time at a time.

However, so far, there is no method that can comprehensively detect chikungunya virus, dengue virus, Japanese encephalitis virus, West Nile virus, and yellow fever virus. All currently existing detection kits are kits for detecting chikungunya virus, dengue virus, Japanese encephalitis virus and West Nile virus individually, or for detecting only some of these viruses simultaneously. It is a kit. In the case of such a detection kit, in order to comprehensively detect chikungunya virus, dengue virus, Japanese encephalitis virus, West Nile virus and yellow fever virus, there are a plurality of different types of amplification devices for performing different amplification reactions. In addition, different detection reactions need to be performed.

This embodiment relates to a primer set for comprehensively amplifying mosquito-borne viruses. The mosquito-borne viruses of interest are chikungunya virus, dengue virus, Japanese encephalitis virus, West Nile virus and yellow fever virus. The primer set includes a first primer group including SEQ ID NOS: 1 to 7, a second primer group including SEQ ID NOS: 8 to 12, a third primer group including SEQ ID NOS: 13 to 18, and SEQ ID NO: 19 A fourth primer group comprising -23, a fifth primer group comprising SEQ ID NOs: 24-29, a sixth primer group comprising SEQ ID NOs: 30-35, and a seventh primer comprising SEQ ID NOs: 36-41 A group and an eighth primer group comprising SEQ ID NOs: 42-47.

It is a figure which shows the example of a design of the primer group of embodiment. It is a figure which shows the example of the amplified material by the primer group of embodiment. It is a figure which shows the example of a design of the nucleic acid probe of embodiment. It is a scheme which shows the detection method of embodiment. It is a schematic diagram which shows the nucleic acid probe fixed chip | tip of embodiment. It is a schematic diagram which shows the nucleic acid probe fixed chip | tip of embodiment.

According to one embodiment, a primer set for comprehensive amplification of chikungunya, dengue fever, West Nile fever, Japanese encephalitis and yellow fever is provided.

According to another embodiment, an assay kit capable of comprehensively detecting Chikungunya, Dengue fever, West Nile fever, Japanese encephalitis and yellow fever is provided.

According to a further embodiment, a method is provided that can comprehensively detect Chikungunya, Dengue fever, West Nile fever, Japanese encephalitis and yellow fever.

1. Chikungunya virus, dengue virus, Japanese encephalitis virus, West Nile virus and yellow fever virus amplification Chikungunya virus, Dengue virus, Japanese encephalitis virus, West Nile virus and yellow fever virus are mosquito-borne viruses. In order to detect these viruses comprehensively, first, these viruses are comprehensively amplified.

(1) Chikungunya virus Chikungunya virus (CHIKV) is comprehensively amplified by LAMP amplification using the first primer group. The first primer group comprises a primer having SEQ ID NO: 1, a primer having SEQ ID NO: 2, a primer having SEQ ID NO: 3, a primer having SEQ ID NO: 4, a primer having SEQ ID NO: 5, a primer having SEQ ID NO: 6, a sequence A primer having the number 7 is included. Sequence number 1 is CAGATGCGGTATGAGCCCTGTATGGAGAAGTCCGAATCATGC. Sequence number 2 is CCGATGCGGTGTGGGCTCTGTATAGAGAAATCTGAATCTTGC. SEQ ID NO: 1 and SEQ ID NO: 2 are FIP primers. Sequence number 3 is TCCGCGTCCTTTACCAAGGAAATTTGGCGTCCTTAACTGTGAC and is a BIP primer. Sequence number 4 is ACGCAATTGAGCGAAGCAC and is F3 primer. Sequence number 5 is CTGAAGACATTGGCCCCAC and is a B3 primer. SEQ ID NO: 6 is GCTGATGCAAATTCTGT, which is an LPF primer. Sequence number 7 is CCTATGCAAACGGCGAC and is an LPB primer.

(2) Dengue virus Dengue virus (DENV) includes type 1, type 2, type 3 and type 4. In order to amplify the dengue virus exhaustively, each of these types uses an appropriate primer set.

Dengue virus type I (DENV-1) is comprehensively amplified by LAMP amplification using the second primer group. The second primer group includes a primer having SEQ ID NO: 8, a primer having SEQ ID NO: 9, a primer having SEQ ID NO: 10, a primer having SEQ ID NO: 11, and a primer having SEQ ID NO: 12. Sequence number 8 is GCTGCGTTGTGTCTTGGGAGGTTTTCTGTACGCATGGGGTAGC and is a FIP primer. Sequence number 9 is CCCAACACCAGGGGAAGCTGTTTTTTTGTTGTTGTGCGGGGG and is a BIP primer. Sequence number 10 is GAGGCTGCAAACCATGGAA and is F3 primer. Sequence number 11 is CAGCAGGATCTCTGGTCTCT and is a B3 primer. Sequence number 12 is GGTGGTAAGGACTAGAGG and is an LPB primer.

Dengue virus type II (DENV-2) is comprehensively amplified by LAMP amplification using the third primer group. The third primer group includes a primer having SEQ ID NO: 13, a primer having SEQ ID NO: 14, a primer having SEQ ID NO: 15, a primer having SEQ ID NO: 16, a primer having SEQ ID NO: 17, and a primer having SEQ ID NO: 18. . Sequence number 13 is TTGGGCCCCCATTGTTGCTGTTTTAGTGGACTAGCGGTTAGAGG and is a FIP primer. SEQ ID NO: 14 is GGTTAGAGGAGACCCCCCCAATTTTGGAGACAGCAGGATCTCTGG, which is a BIP primer. SEQ ID NO: 15 is TGGAAGCTGTACGCATGG and is an F3 primer. Sequence number 16 is GTGCCTGGAATGATGCTG and is a B3 primer. SEQ ID NO: 17 is GATCTGTAAGGGAGGGG and is an LPF primer. SEQ ID NO: 18 is GCATATTGACGCTGGGA, which is an LPB primer.

Dengue virus type III (DENV-3) is comprehensively amplified by LAMP amplification using the fourth primer group. The fourth primer group includes a primer having SEQ ID NO: 19, a primer having SEQ ID NO: 20, a primer having SEQ ID NO: 21, a primer having SEQ ID NO: 22, and a primer having SEQ ID NO: 23. SEQ ID NO: 19 is TGGCTTTTGGGCCTGACTTCTTTTTTGAAGAAGCTGTGCAGCCTG, which is a FIP primer. Sequence number 20 is CTGTAGCTCCGTCGTGGGGATTTTCTAGTCTGCTACACCGTGC and is a BIP primer. Sequence number 21 is GCCACCTTAAGCCACAGTA and is F3 primer. Sequence number 22 is GTTGTGTCATGGGAGGG and is a B3 primer. Sequence number 23 is GGAGGCTGCAAACCGTG and is an LPB primer.

Dengue virus type IV (DENV-4) is comprehensively amplified by LAMP amplification using the fifth primer group. The fifth primer group includes a primer having SEQ ID NO: 24, a primer having SEQ ID NO: 25, a primer having SEQ ID NO: 26, a primer having SEQ ID NO: 27, a primer having SEQ ID NO: 28, and a primer having SEQ ID NO: 29 . Sequence number 24 is TGGGAATTATAACGCCTCCCGTTTTTTCCACGGCTTGAGCAAACC and is a FIP primer. Sequence number 25 is GGTTAGAGGAGACCCCTCCCTTTTAGCTTCCTCCTGGCTTCG and is a BIP primer. SEQ ID NO: 26 is CTATTGAAGTCAGGCCAC and is an F3 primer. Sequence number 27 is ACCTCTAGTCCTTCCACC and is a B3 primer. Sequence number 28 is GGCGGAGCTACAGGCAG and is a LPF primer. SEQ ID NO: 29 is TCACCAACAAAACGCAG and is an LPB primer.

(3) Japanese encephalitis virus Japanese encephalitis virus (JEV) is comprehensively amplified by LAMP amplification using the sixth primer group. The sixth primer group includes a primer having SEQ ID NO: 30, a primer having SEQ ID NO: 31, a primer having SEQ ID NO: 32, a primer having SEQ ID NO: 23, a primer having SEQ ID NO: 34, and a primer having SEQ ID NO: 35 . Sequence number 30 is GCGGACGTCCAATGTTGGTTTGGCCACTTGGGTGGACTTG and is a FIP primer. Sequence number 31 is AAGCTAGCCAACTTGCTGAGGTCGTCGAGATGTCAGTGACTG and is a BIP primer. SEQ ID NO: 32 is GGAATGGGCAATCGTGACT and is an F3 primer. Sequence number 33 is CGTTGTGAGCTTCTCCAGT and is a B3 primer. SEQ ID NO: 34 is TCGTTTGCCATGATTGTC, which is an LPF primer. Sequence number 35 is GAAGTTACTGCTATCATGCT and is an LPB primer.

(4) West Nile virus West Nile virus (WNV) is comprehensively amplified by LAMP amplification using the seventh primer group. The seventh primer group includes a primer having SEQ ID NO: 36, a primer having SEQ ID NO: 37, a primer having SEQ ID NO: 38, a primer having SEQ ID NO: 39, a primer having SEQ ID NO: 40, and a primer having SEQ ID NO: 41 . SEQ ID NO: 36 is TTGGCCGCCTCCATATTCATCATTTTCAGCTGCGTGACTATCATGT, which is a FIP primer. Sequence number 37 is TGCTATTTGGCTACCGTCAGCGTTTTTGAGCTTCTCCCATGGTCG and is a BIP primer. SEQ ID NO: 38 is TGGATTTGGTTCTCGAAGG and is an F3 primer. SEQ ID NO: 39 is GGTCAGCACGTTTGTCATT and is a B3 primer. SEQ ID NO: 40 is CATCGATGGTAGGCTTGTC, which is an LPF primer. SEQ ID NO: 41 is TTCCCACCAAAGCTGCGT, which is an LPB primer.

(5) Yellow Fever Virus Yellow fever virus (YFV) is comprehensively amplified by LAMP amplification using the eighth primer group. The eighth primer group includes a primer having SEQ ID NO: 42, a primer having SEQ ID NO: 43, a primer having SEQ ID NO: 44, a primer having SEQ ID NO: 45, a primer having SEQ ID NO: 46, and a primer having SEQ ID NO: 47 . Sequence number 42 is CGGCTTCCCTTTGCTTTCCCAAAGGTGTCGGACTTGTGTGT and is a FIP primer. Sequence number 43 is GGTATATGTGGCTGGGAGCGCCCCAATGGTCCTCATTCAGG and is a BIP primer. SEQ ID NO: 44 is AAGGAAGCTGCACCAACAA and is an F3 primer. SEQ ID NO: 45 is CTTCCACTCCTCCTCCTGA, which is a B3 primer. And SEQ ID NO: 46 is CTCTGACAGCTTCTTCTC, which is an LPF primer. SEQ ID NO: 47 is GTATCTTGAGTTTGAGG and is an LPB primer.

(6) Primer set for comprehensive amplification of mosquito-borne viruses Primer sets for comprehensive amplification of mosquito-borne viruses consisting of chikungunya virus, dengue virus, Japanese encephalitis virus, West Nile virus and yellow fever virus are as follows: A first primer set, a second primer set, a third primer set, a fourth primer set, a fifth primer set, a sixth primer set, a seventh primer set, and an eighth primer set are included.

By using a comprehensive amplification primer set including these first to eighth primer sets, Chikungunya virus, Dengue virus, Japanese encephalitis virus, West Nile virus and yellow fever virus are comprehensively amplified.

Through exhaustive amplification, Chikungunya virus, Dengue virus, Japanese encephalitis virus, West Nile virus and yellow fever virus are amplified through the same amplification reaction using the same type of amplification device. Thereby, Chikungunya virus, dengue virus, Japanese encephalitis virus, West Nile virus and yellow fever virus can be amplified easily and rapidly. Chikungunya virus, dengue virus, Japanese encephalitis virus, West Nile virus and yellow fever virus can be simultaneously amplified, for example, in one reaction field.

Table 1 summarizes the primer sets for comprehensive amplification.

(7) LAPM amplification The comprehensive amplification primer set is a primer set for LAMP or RT-LAMP amplification. The “LAMP method” and the “RT-LAMP method” are nucleic acid amplification methods. These are also referred to as isothermal gene amplification methods. Nucleic acids are amplified using DNA as a template by the LAMP method. The RT-LAMP method amplifies a nucleic acid using RNA as a template by simultaneously performing a reverse transcription reaction and a LAMP reaction. Here, although the LAMP method will be described, the RT-LAMP method can be performed in the same manner as the LAMP method except that a reverse transcription reaction is performed.

The LAMP method uses 2 or 4 region primers or 4 or 6 region primers. The LAMP method is superior in amplification efficiency to the method using PCR and is not easily affected by impurities in the sample. Therefore, by using the primer according to this embodiment, it is possible to detect microorganisms classified as trace amounts of mosquito-borne viruses by simple sample pretreatment.

Here, primer design in the LAMP method and amplification products obtained by amplification will be described with reference to FIG. 1 and FIG. FIG. 1 shows double-stranded DNA to be detected in the center. A total of four types of primer sequences, that is, FIP primer, F3 primer, BIP primer, and B3 primer are set. The FIP primer and the BIP primer each contain two regions (FIP is F1c and F2, and BIP is B2 and B1c). The F3 primer contains the F3 region. The B3 primer contains the B3 region. Here, the F3, F2, F1, B1c, B2c, and B3c regions are regions set in this order from the 5 ′ to 3 ′ direction of the single-stranded DNA of the double-stranded DNA. The B3, B2, B1, F1c, F2c, and F3c regions are regions set in this order from the complementary strand to the 5 'to 3' direction of the single-stranded DNA. At this time, B3 and B3c, B2 and B2c, B1 and B1c, F1c and F1, F2c and F2, and F3c and F3 are complementary strands.

In addition to these four types of primers, a loop primer may be used in combination. The loop primer is an LPF primer and / or an LPB primer. By using these loop primers, it is possible to efficiently perform an amplification reaction.

Four types of primers composed of these regions, ie, FIP primer, F3 primer, BIP primer, B3 primer, or 5 or 6 types of primers, ie, FIP primer, F3 primer, BIP primer, B3 primer, LPF primer When LAMP amplification is performed using LPB primers, an amplification product having a dumbbell-shaped stem and loop structure as shown in FIG. 2 is obtained from each strand of the double-stranded DNA of FIG. The structure shown in FIG. 2 is an example of the structure of some nucleic acids contained in the amplification product. The description of the amplification mechanism is omitted, but if necessary, refer to, for example, Japanese Patent Laid-Open No. 2002-186871.

The RT-LAMP method is a method in which an enzyme having reverse transcription activity is added to the LAMP method reaction solution and the LAMP amplification method is performed while performing the reverse transcription reaction. The same primer as the LAMP method can be used. Here, when “LAMP method” is described, it may be understood that it is a reference to both the LAMP method and the RT-LAMP method.

Preferably, the primer is designed so that the target sequence is located in the single-stranded loop part. A “target sequence” is a sequence to be hybridized to a nucleic acid probe. As shown in FIG. 1, the target array (for example, any one of FPc, FP, BP, and BPc in FIG. 1) is between the regions F1 and F2 (this region may include the F2 region), and the region F2c Between F1c (this region may include F2c region), between regions B1 and B2 (this region may include B2 region), and / or between regions B2c and B1c (this region is B2c Six primer regions are set so as to correspond to any of the regions (which may include a region). The target sequence may be designed to be located at any part of the single-stranded loop portion formed between the respective regions. Here, the F2 region itself may be included in the loop portion between the primer regions F1 and F2. Four types of primers are prepared based on the six primer regions thus set, and RT-LAMP amplification is performed using these primers. Thereby, a part of the LAMP amplification product as shown in FIG. 3 is obtained. In this LAMP amplification product, the target sequences FPc, FP, BP, and BPc are located in a single-stranded loop in the dumbbell structure of the amplification product.

On the other hand, since the primer regions F1c and F1 and B1c and B1 originally have complementary sequences to each other, self-hybridization occurs with each other to form a double strand. Thus, the target sequence contained in the amplification product exists in a single-stranded state as shown in FIG. Therefore, specific hybridization with a nucleic acid probe complementary to each target sequence (for example, a nucleic acid having a sequence of FP, FPc, BP, BPc) is possible without performing a denaturation operation, as shown in the figure. . Detection of the amplification product can also be performed by using such a nucleic acid probe.

For example, the amplification reaction may be performed using one primer set of the first to eighth primer sets per reaction field, for example, per tube, or the first reaction field (for example, one tube). It may be performed using at least two primer sets selected from the first to eighth primer sets, or may be performed using all of the first to eighth primer sets simultaneously. The reaction field is where the reaction takes place. For example, the reaction field may be maintained inside a container in which the reaction can take place. Such containers may be, for example, tubes, microtubes, beakers, multiwell plates, etc., but are not limited thereto.

The amplification reaction is not limited to this. For example, the amplification reaction is performed in a buffer having the following composition.

Here, “sample” means body fluids, tissues, cells such as humans, mice, rats, guinea pigs, hamsters, ferrets, rhesus monkeys, rabbits, dogs, cats, cows, pigs, sheep, seals, and porpoises, and porpoises. It may be any substance present in the environment such as stool, insects such as mosquitoes, and water, lake water, river water, sea water and soil. Alternatively, the sample may be a substance suspected of containing a microorganism classified as a mosquito-borne virus or a gene thereof. For example, a culture medium may be used. Such a substance may be pretreated by means known per se into a state suitable for nucleic acid amplification, and any pretreatment may not be performed. Examples of such pretreatment include denaturation, filtration, nucleic acid extraction, impurity removal and the like.

By performing nucleic acid amplification using the primer set as described above, it is possible to comprehensively amplify nucleic acids of mosquito-borne viruses specifically, simply, inexpensively and at high speed.

2. Detection of mosquito-borne virus (1) Nucleic acid probe set The nucleic acid derived from mosquito-borne virus in the amplification product obtained by amplification as described above is specifically detected using the nucleic acid probe set.

The nucleic acid probe set has a nucleic acid probe having SEQ ID NO: 48, a nucleic acid probe having SEQ ID NO: 49, a nucleic acid probe having SEQ ID NO: 50, a nucleic acid probe having SEQ ID NO: 51, a nucleic acid probe having SEQ ID NO: 52, and a sequence number 53 A nucleic acid probe, a nucleic acid probe having SEQ ID NO: 54, a nucleic acid probe having SEQ ID NO: 55 and a nucleic acid probe having SEQ ID NO: 56.

SEQ ID NO: 48 is GCGACCATGCCGTCACAGTTAAGGA, SEQ ID NO: 49 is GCGATCATGCCGTCACAGTAAAGGA, SEQ ID NO: 50 is TAACCACTAGTCTGCTACCCCATGCGTACA, SEQ ID NO: 51 is ATTGACGCTGGGAAAGACCAGAGATCCTGC, SEQ ID NO: 52 is CCTTTGACGGGCATCGC 54 is CTATCTCCTTCTAGCACCAAGTCCACCCAA, SEQ ID NO: 55 is TAGGCTTGTCCTTAGACATGATAGTCACGC, and SEQ ID NO: 56 is TCTTTTCCCCATCATGTTGTACACACAAGT.

The nucleic acid probes having SEQ ID NOs: 48 and 49 are nucleic acid probes for specifically detecting chikungunya virus. The nucleic acid probe having SEQ ID NO: 50 is a nucleic acid probe for specifically detecting dengue virus type I. The nucleic acid probe having SEQ ID NO: 51 is a nucleic acid probe for specifically detecting dengue virus type II. The nucleic acid probe having SEQ ID NO: 52 is a nucleic acid probe for specifically detecting dengue virus type III. The nucleic acid probe having SEQ ID NO: 53 is a nucleic acid probe for specifically detecting dengue virus type IV. The nucleic acid probe having SEQ ID NO: 54 is a nucleic acid probe for specifically detecting Japanese encephalitis virus. The nucleic acid probe having SEQ ID NO: 55 is a nucleic acid probe for specifically detecting West Nile virus. The nucleic acid probe having SEQ ID NO: 56 is a nucleic acid probe for specifically detecting yellow fever virus.

The above nucleic acid probes are summarized in Table 3.

(3) Detection Method A method for comprehensively amplifying mosquito-borne viruses composed of chikungunya virus, dengue virus, Japanese encephalitis virus, West Nile virus, and yellow fever virus will be described with reference to FIG.

First, a sample and first to eighth primer groups are added to a container for maintaining the reaction field (a). These are subjected to LAMP amplification under appropriate reaction conditions (b). Next, the obtained amplification product is added to a nucleic acid probe set containing nucleic acid probes having SEQ ID NOs: 45 to 56 (c), and a reaction is carried out (d). FIG. 4 shows an example in which these nucleic acid probe sets are immobilized on a nucleic acid probe-immobilized substrate. Next, hybridization between the amplification product and each nucleic acid probe contained in the nucleic acid probe set is detected. For example, hybridization is detected by detecting a hybridization signal (e). Determine whether and / or how much mosquito-borne virus is present in the sample based on the presence or absence and / or intensity of the resulting hybridisation signal (F). By such a protocol, the method for detecting a mosquito-borne virus in a sample is implemented.

Means for detecting hybridization between the nucleic acid probe and the amplification product are not particularly limited to these, but turbidity, visible light, fluorescence, chemiluminescence, electrochemiluminescence, chemiluminescence, fluorescence energy transfer method An optical method such as ESR, or electrical properties such as current, voltage, frequency, conductivity, and resistance may be used.

It is possible to use a nucleic acid probe-immobilized chip as a means for detecting hybridization between a nucleic acid probe and an amplification product. The nucleic acid probe immobilization chip is an apparatus in which the above-described nucleic acid probe is immobilized on a substrate that is a solid phase. This is generally called a microarray or a DNA chip. However, the nucleic acid probe is not immobilized on the chip and may be used in the liquid phase.

(4) Nucleic acid probe immobilization chip A nucleic acid probe immobilization chip can be used as a means for detecting hybridization between a nucleic acid probe and an amplification product. The nucleic acid probe immobilization chip is an apparatus in which the above-described nucleic acid probe is immobilized on a substrate that is a solid phase. This is generally called a microarray or a DNA chip.

A non-limiting example of a nucleic acid probe-immobilized chip is schematically shown in FIG. The nucleic acid probe immobilization chip 51 includes an immobilization region 53 on a base 52. The nucleic acid probe 54 is immobilized on the immobilization region 53. Such a nucleic acid probe immobilization chip 51 can be manufactured by a method well known in the art. A person skilled in the art can appropriately change the design of the number of the fixing regions 53 arranged on the base 52 and the arrangement thereof as necessary.

Nucleic acid probes each having SEQ ID NO: 48 to SEQ ID NO: 56 as the nucleic acid probe 54 are immobilized in different immobilization regions 53 for each type. In the nucleic acid probe immobilization chip 51, the immobilization region 53 obtains a positive control region 55 for obtaining a positive control signal and / or a background signal in addition to the region for immobilizing the detection nucleic acid probe. A background area 56 may be further provided.

The positive control region 55 and the background region 56 may be configured to obtain a positive signal and a background signal by using any technique known per se.

Such a nucleic acid probe-immobilized chip may be suitably used for a detection method using fluorescence. In one immobilization region 53, one type or one or more types of nucleic acid probes or nucleic acid probe sets necessary for obtaining information that needs to be obtained as one independent signal are immobilized.

A further non-limiting example of the nucleic acid probe-immobilized chip is shown in FIG. The nucleic acid probe immobilization chip 61 in FIG. 6 includes an electrode 63 as an immobilization region on a base 62. The nucleic acid probe 64 is immobilized on the electrode 63. The electrode 63 is connected to the pad 67. Electrical information from the electrode 63 is acquired via the pad 67. Such a nucleic acid probe immobilization chip 61 can be manufactured by a method well known in the art. The number of electrodes 63 arranged on the base 62 and the arrangement thereof can be appropriately changed by those skilled in the art as needed. Furthermore, the nucleic acid probe immobilization chip 61 of this example may include a reference electrode and a counter electrode as necessary. In one immobilization region, one type or one or more types of nucleic acid probes or nucleic acid probe sets necessary for obtaining information that needs to be obtained as one independent signal are immobilized.

That is, the nucleic acid probes each having SEQ ID NO: 48 to SEQ ID NO: 56 as the nucleic acid probe 64 are immobilized on different electrodes 63 for each type. The nucleic acid probe immobilization chip 61 has an electrode 63 for obtaining a positive control electrode 65 for obtaining a positive control signal and / or a background signal in addition to the region for immobilizing the detection nucleic acid probe. A background electrode 66 may be further provided.

When the nucleic acid probe is immobilized on the substrate, a functional group such as an amino group, a thiol group, or biotin may be introduced at the end of the nucleic acid probe described above. Furthermore, a spacer may be introduced between the functional group and the nucleotide. Although the kind of spacer used here is not specifically limited, For example, you may use alkane frame | skeleton, ethylene glycol frame | skeleton, etc.

The substrate for immobilizing the nucleic acid probe used in this embodiment is not particularly limited, but includes resin beads, magnetic beads, metal fine particles, microtiter plates, glass substrates, silicon substrates, resin substrates, electrode substrates, and the like. May be used.

The substrate material used in this embodiment is not particularly limited. For example, inorganic insulating materials such as glass, quartz glass, alumina, sapphire, forsterite, silicon carbide, silicon oxide, and silicon nitride can be used. In addition, polyethylene, ethylene, polypropylene, polyisobutylene, polymethyl methacrylate, polyethylene terephthalate, unsaturated polyester, fluorine-containing resin, polyvinyl chloride, polyvinylidene chloride, polyvinyl acetate, polyvinyl alcohol, polyvinyl acetal, acrylic resin, polyacrylonitrile, Organic materials such as polystyrene, acetal resin, polycarbonate, polyamide, phenol resin, urea resin, epoxy resin, melamine resin, styrene / acrylonitrile copolymer, acrylonitrile butadiene styrene copolymer, silicone resin, polyphenylene oxide and polysulfone may be used. .

For example, when using electrical properties, it is preferable to place the electrode on the substrate. The electrode is not particularly limited, but, for example, simple metals such as gold, gold alloy, silver, platinum, mercury, nickel, palladium, silicon, germanium, gallium and tungsten, and alloys thereof, or graphite and glassy It may be carbon such as carbon, or an oxide or compound thereof. Further, a semiconductor compound such as silicon oxide, or various semiconductor devices such as CCD, FET, and CMOS may be used.

The extraction method is not particularly limited, and a liquid-liquid extraction method such as a phenol-chloroform method or a solid-liquid extraction method using a carrier can be used. Further, a commercially available nucleic acid extraction method QIAamp (manufactured by QIAGEN), (manufactured by Co., Ltd.) or the like can also be used. Next, RT-LAMP amplification is performed using the extracted nucleic acid component as a template, and then a hybridization reaction is performed with the gene detection electrode. The reaction solution is carried out in a buffer solution having an ionic strength of 0.01 to 5 and a pH of 5 to 10. In this solution, dextran sulfate, salmon sperm DNA, bovine thymus DNA, EDTA and / or a surfactant, which are hybridization accelerators, can be added. The extracted and amplified nucleic acid component is added to this and then donated to the hybridization reaction with the nucleic acid probe. During the reaction, the reaction rate can be increased by an operation such as stirring or shaking. The reaction temperature is in the range of 10 ° C to 90 ° C, and the reaction time is about 1 minute to overnight. For washing after the hybridization reaction, a buffer solution having an ionic strength of 0.01 to 5 and a pH of 5 to 10 is used.

Is the extracted and amplified sample nucleic acid previously labeled with fluorescent dyes such as FITC, Cy3, Cy5 and rhodamine, enzymes such as biotin, hapten, oxidase and phosphatase, or electrochemically active substances such as ferrocene or quinones? Alternatively, the detection may be performed by using a second nucleic acid probe labeled with the aforementioned substance.

When performing detection using an electrochemically active nucleic acid binding substance, the detection is performed according to the following procedure. After the substrate is washed, a nucleic acid binding substance that selectively binds to the double-stranded portion formed on the electrode surface may be allowed to act to perform electrochemical measurement. The nucleic acid binding substance used here is not particularly limited, and examples thereof include Hoechst 33258, acridine orange, quinacrine, dounomycin, metallointercalators and bisintercalators such as bisacridine, trisintercalators and polyintercalators. May be used. Furthermore, these intercalators can be modified with an electrochemically active metal complex such as ferrocene and viologen. The concentration of the nucleic acid binding substance varies depending on the type, but is generally used in the range of 1 ng / ml to 1 mg / ml. At this time, a buffer solution having an ionic strength of 0.001 to 5 and a pH of 5 to 10 is used. After the electrode is reacted with the nucleic acid binding substance, electrochemical measurement is performed. The electrochemical measurement is performed with a three-electrode type, that is, a reference electrode, a counter electrode, and a working electrode, or a two-electrode type, that is, a counter electrode and a working electrode. In the measurement, a potential higher than the potential at which the nucleic acid binding substance reacts electrochemically is applied, and the reaction current value derived from the nucleic acid binding substance is measured. At this time, the potential may be swept at a constant speed, applied with a pulse, or a constant potential may be applied. For measurement, current and voltage are controlled using devices such as a potentiostat, a digital multimeter, and a function generator. Based on the obtained current value, the concentration of the target gene is calculated from the calibration curve. A gene detection apparatus using a gene detection electrode includes a gene extraction unit, a gene reaction unit, a nucleic acid binding substance reaction unit, an electrochemical measurement unit, a washing unit, and the like.

3. Assay Kit An assay kit for comprehensively detecting mosquito-borne viruses includes the primer set and the nucleic acid probe set.

The assay kit may contain a buffer necessary for LAMP amplification and / or RT-LAMP amplification in addition to the primer set and nucleic acid probe set described above, and a buffer necessary for hybridization, and the amplification and / or high concentration therein. A container for performing hybridization may be provided. In addition, the nucleic acid probe contained in the assay kit may be provided immobilized on a substrate as described above, or the assay kit may be provided including a substrate for immobilizing a nucleic acid probe.

4). Regarding mutations contained in the primer set One or more primers contained in the first to eighth primer groups contained in the primer set contain mutations to the extent that the nucleic acid derived from the corresponding mosquito-borne virus can be specifically amplified. It may be an array. The mutation is caused by substitution, deletion and / or substitution of 1 to 5, preferably 1 to several nucleotides at any position in the polynucleotide represented by the sequence described in any of the above SEQ ID NOs or a complementary sequence thereof. It may be an insertion. The specifically amplifiable range may be a range that does not affect the identification when a mosquito-borne virus to be amplified by a primer is taxonomically identified.

A plurality of sequences containing such mutations may be simultaneously present in one amplification reaction field. In that case, 1 to 5, preferably 1 to several nucleotides at any position of the polynucleotide represented by the sequence described in any of the above SEQ ID Nos. Or a complementary sequence thereof may be prepared as a mixed nucleotide. In general, 1 to 5, preferably 1 to several nucleotides at any position may be universal nucleotides.

Examples of universal nucleotides include, but are not limited to, deoxyinosine (dI), Gren Research 3-nitropyrrole, 5-nitroindole, deoxyribofuranosyl DP) and deoxy-5′-dimethoxytrityl-D-ribofuranosyl; dK) and the like.

Here, a sequence of about 1 to 100 nucleotides, preferably about 2 to 30 nucleotides (for example, a sequence used as a spacer) may be included between each sequence of the primer or on the terminal side thereof. The length of the primer may be about 30 to 200 nucleotides, preferably 35 to 100 nucleotides, more preferably 43 to 60 nucleotides.

In the primer group for each virus, each of the FIP primer, the BIP primer, the F3 plumer, and the B3 primer may be of one type, or each may contain a plurality of types of sequences. When an LPF primer and / or an LPB primer is further used in these primer groups, the LPF primer and the LPB primer may each consist of one kind of sequence, and each may contain a plurality of kinds of sequences.

When amplification by a LAMP method or RT-LAMP method is performed on a sample containing a nucleic acid derived from a mosquito-borne virus using a primer using the region as described above, as described in FIG. A loop structure is formed, resulting in a target sequence derived from a mosquito-borne virus contained within a single-stranded loop structure. This target sequence is a sequence for hybridizing the nucleic acid probe. Therefore, when at least one primer included in the primer set includes a mutation, the corresponding at least one nucleic acid probe included in the nucleic acid probe set may include a mutation accordingly.

In order to amplify mosquito-borne viruses more universally, a plurality of types of FIP primers, BIP primers, F3 plumer, B3 primer, LPF primer and LPB primer may be used. In order to amplify the virus more reliably and comprehensively, primers may be designed and used so that they are universal nucleotides or mixed bases at least with respect to mutation sites specific to species.

A plurality of sequences with different base types may be represented by a single sequence for the mutation part. In that case, the base of the mutation part in question is described by including a single base symbol indicating a plurality of bases. The meanings of the bases indicated by these symbols are those commonly used in the art. That is, “r” is guanine or adenine, “y” is thymine or cytosine, “m” is adenine or cytosine, “k” is guanine or thymine, “s” is guanine or cytosine, “w” is adenine or thymine, “B” is guanine or cytosine or thymine, “d” is adenine or guanine or thymine, “h” is adenine or cytosine or thymine, “v” is adenine or guanine or cytosine, “n” is adenine or guanine or cytosine or It is thymine.

When the mutation is included in the primer set, each primer can be designed as follows.

The sequence of the region in each virus is downloaded from a known database such as the NCBI nucleotide database, and an alignment is created to clarify the mutation. Next, after performing an amplification test on a high-frequency mutant, if a specific mutation affects the amplification efficiency, the primer corresponding to the mutation position is included in the primer as a mix base.

For example, when designing the first primer set for yellow fever virus in this way, the polyprotein region of yellow fever virus can be downloaded from the NCBI database and an alignment can be created to obtain the conserved region. . The primer is then designed using, for example, the software “Primer Explorer V4” (see “Primer Explorer V4”, “http://primerexplorer.jp/”). The designed primer may be synthesized by a method known per se.

Examples of accession numbers for each mosquito media virus sequence that can be used to design each primer are listed below. Primers containing mutations and mixed bases may be made by making alignments for these sequences.

(1) Chikungunya virus AF192894 HM045797_7550..11296 AF192895 HM045790_7550..11296 HM045800_7547..11293 HM045791_7550.785 HM045789_7544..11290 AF1928 97 11294 HM045804_7552..11298 HM045816_7552..11298 HM045815_7550..11296 HM045786_7552..11298 HM045807_7551..11297 AF192892_Y69732_7569..11315 HM045819_7552..11298 HM045818_7552.4582 FJ445427_7543..11289 GQ428210_7548..11294 GQ428211_7548..11294 HM045799_7548..11294 EF027138_7554..11300 FJ807896_7567..11313 DQ462746_1..1023 DQ462749_1..673 EU .11314 FJ000068_7568..11314 EF027136_7553..11299 HM045801_7548..11294 FJ000065_7568..11314 GU189061_7567..11313 GQ119362 GQ119364 FJ705369 FJ705371 FJ445428_7543..11289 FJ445510_755 3..11299 FJ445511_7543..11289 GU199350_7525..11271 FJ807894 HM045794_7550..11296 GQ428212_7548..11294 GQ428214_7548..11294 FJ000069_7568..11314 FJ807899_7567..11313 FN295485 GQ42811_80.492 .11289 FJ445463_7543..11289 FJ445430_7543..11289 FJ445432_7543..11289 FJ445443_7540..11286 GU301780_7567..11313 FJ445484_7543..11289 FJ445502_7543..11289 GU199352_7525..11271 GU199311_225 ..11313 FJ513628_7542..11288 FJ513657_7523..11269 FJ513629_7543..11289 GU013528_7542..11288 FJ513679_7542..11288 FJ513635_7553..11299 FJ513637_7542..11288.GU013529_7542..11288 GU0137567. 11294 FJ445426_7543..11289 FJ513632_7519..11265 FJ513645_7543..11289 FJ513654_7544..11290 FJ513673_7543..11289 FJ513675_7540..11286 GU199351_7568..11314 AY549583_1..1050 HM0458232967550.784 _7548..11294 EF027139_7568..11314 HM045812_7550..11296 HM045822_7550..11296 AF192903 AF192904 HM045805_7550..11296 HM045795_7549..11295 AF192905 HM045821_7550.11296 AF490259_7567.11296 AF490292_7567.11296 AF490259_7567.11296 11296 HM045811_7550..11296 HM045809_7550..11296 AF192906 HM045793_7543..11289 AY253740 AY549575_1..1050 AY549582_1..1050 AY549584_1..1050 EF051584_1..1092 AF192898 HM045814_19250 HM045811_19250 .11296 AF192901 HM045803_7550..11296 HM045813_7550..11296 AY253729 AY253732 HM045810_7550..11296 AY253733 AY253734 AY253735 AY253737 AY253738 AY253742 AY253743 AY253731 AM397008 AM397009 FJ807887 FN295483 FN295484 FJ807888 FJ807889 FJ807886 FJ807890 FJ807897_7555..11301 EU703762_7567..11313 EU703759_7567..11313 AM397002 AM397004 EU703761_7567. .11313 EU703760_7567..11313 FJ445487 FJ445486 FJ445485 FJ445483 FJ445481 FJ445480 FJ445479 FJ445477 FJ445475 FJ4 45472 FJ445469 FJ445435 FJ445434 FJ445429 FJ445425 FJ445424 EU441883 EU441882.

(2) dengue virus AB519681 AF311958 AF311957 AF226685 AF311956 AF514876 AF514885 AF514883 AY277665 AF226686 AF226687 AF514878 AY206457 AF514889 AY277666 AY277664 AF513110 DQ285559 EU081258 AF298807 EF457905 AF180817 AF180818 AY145121 AY145122 U88535 U88536 U88537 DQ672564 DQ672556 DQ672557 DQ672558 DQ672559 DQ672560 DQ672561 DQ672562 DQ672563 FN429881 FN429882 FN429886 FN429887 FN429883 FN429884 FN429888 FN429885 FN429889 EF025110 AY732474 AY732476 AY762084 DQ285562 FJ850114 AF298808 AY732477 AY732478 AY732481 AY732483 AF350498 AY726555 AF309641 DQ193572 EU081276 EU081277 FN429890 EU081226 EU081229 EU081250 EU081252 EU081268 EU081235 EU081255 EU081260 EU081262 EU081264 EU081270 EU081227 EU081228 EU081231 EU081232 EU081233 EU081236 EU081238 EU081240 EU081242 EU081243 EU081244 EU081245 EU081246 EU081247 EU081248 EU081249 EU081251 EU081253 EU081254 EU081259 EU081261 EU081263 EU081265 EU081266 EU081267 EU081269 EU081271 EU081273 EU081274 EU081275 EU081279 EU081280 EU081281 EU081234 EU081272 EU081230 EU081239 EU081278 EU081257 EU081256 AY732475 M87512 AY732480 AY732479 AY732482 AY726554 FJ432732 AY835999 EU081237 EU081241 GQ199788 GQ199797 FJ432730 GQ868618 GU131759 GQ199814 FJ432739 GQ199816 FJ432744 GQ199808 GQ868608 GQ868630 GQ868639 GQ199840 GQ199842 GQ199801 FJ432735 GQ199773 GQ199806 GQ199847 GQ868613 GQ199851 GQ199853 GQ199780 GQ868606 GQ199854 GQ199856 GQ199841 GQ199800 GQ199821 GQ199798 GQ199807 GQ199824 GQ199789 FJ432746 GQ199811 GQ199845 GQ199817 GQ199820 GQ199799 GQ199813 GQ199826 GU131750 FJ432729 FJ432733 GQ199790 GQ199784 GQ199805 FJ432742 GU131731 GQ199822 GQ868610 GQ868636 GU131782 GQ199793 GQ199834 GQ199849 GQ199839 GQ199832 GQ199833 GQ199836 GQ199837 GQ199838 GQ868609 GQ199809 GQ868614 GQ199787 GQ199850 GQ199852 GQ199781 GQ199846 GQ199844 GQ199848 GQ199835 GQ199783.

(3) Japanese encephalitis virus GU187972_97..10395 GU205163_97..10395 FJ495189_97..10395 HM228921_97..10395 AB241118_97..10395 AB241119_97..39595 EU693899_97..10395 GU556217_97..10395 EU429297_97.97157_97214 AF045551_96..10394 AB196923_96..10394 AB196926_96..10394 AF014160_96..10394 AF014161_96..10394 AB196925_96..10394 AF254452_96..10394 AF254453_96..10394 AB196924_96..10394 AF069076.96394.326. .10394 AY508813_96..10394 GQ918133_96..10394 AF080251_96..10394 AF098735_96..10394 AF098736_96..10394 AF098737_96..10394 EF623987_96..10394 EF623988_96..10394 EF623989_96..9639410 JEU14163_96..10394 JEVSAV_96..10394 AY849939_96..10394 EF107523_96..10394 JEU47032_96..10394 AB551990_96..10394 EF543861_96..10394 AB551991_96..10394 AB551992_96..394 AY585243_96.09394 .10394 EF571853_96..10394 FJ185037_96..10394 FJ185036_96..10394 AF217620_96..10394 AY184212_96..10394 AF221499_96..10394 AF221500_96..10394.

(4) West Nile Virus AF260968_97..10398 AM404308_72..10373 EU081844_97..10398 EU249803_97..10398 AY660002_97..10398 HM488132_97..10398 AB185915_97..10398 AB185914_97..398 DQ164194_97..10398 HM1039796. AF206518_79..10380 GQ379161_97..10398 HM488134_97..10398 HM488135_97..10398 AF533540_97..10398 HM488133_97..10398 HM488136_97..10398 HM488127_101..10402 HM488128_92..3933 .10397 DQ080060_68..10369 HM488230_97..10398 DQ431708_1..10302 GQ379157_97..10398 HM488210_97..10398 DQ164193_97..10398 GQ507477_1..10302 DQ164198_97..10398 DQ164205_398.302.HM3981010 DQ176637_40..10341 GU828003_50..10351 GU828004_50..10351 AY712948_97..10398 GU828001_49..10350 GU828002_48..10349 GQ507474_1..10302 GU827999_62..10363 GU828000_49..484 .10398 HM488176_141..10442 HM488212_140..10441 GQ507483_1..10302 HM488254_97..10398 HM488155_97..10398 HM756654_97..10398 HM488138_97..10398 HM488144_97..10398 HM488145_97..10398 HM488146_97..10398 HM488137_97.391_398398 HM488235_10 .10302 GQ507478_1..10302 HM488211_97..10398 DQ080055_97..10398 DQ080059_97..10398 HM756665_88..10389 DQ080057_97..10398 HM488215_97..10398 HM756648_97..10398 DQ431699_1..251302 DQ43110 DQ080056_97..10398 DQ431700_1..10302 HM488193_97..10398 HM488204_97..10398 DQ080052_97..10398 DQ666451_97..10398 DQ164201_97..10398 DQ431712_1..10302 GQ507470_1..10302GQ507471_1.704_1 .10302 DQ080053_97..10398 GQ507468_1..10302 DQ666449_97..10398 GQ507469_1..10302 DQ080051_97..10398 DQ666448_97..10398 HM756677_97..10398 GQ507482_1..10302 GQ507480_1..4841 GQ379398.10484 DQ080064_69..10370 DQ080065_63..10364 DQ080066_69..10370 DQ080067_69 ..10370 DQ080068_69..10370 DQ080069_69..10370 DQ080070_69..10370 DQ431711_1..10302 DQ431706_1..10302 DQ431707_1..10302 DQ164204_97..10398 HM488191_97..10398 HM488198_93.379.398 HM75697 10398 HM756669_88..10389 HM488201_141..10442 HM488237_97..10398 HM488184_97..10398 DQ164196_97..10398 DQ164197_97..10398 HM488225_96..10397 HM488226_97..398 HM488229_97.1010 HM48822997 ..10398 DQ080054_97..10398 DQ005530_97..10398 HM488180_98..10399 HM488172_139..10440 HM488223_95..10396 HM488224_97..10398 HM488189_97..10398 DQ431694_1..10302 GQ507472_1..10302 DQ302705_391. 10413 DQ080058_97..10398 HM488195_97..10398 DQ164186_97..10398 DQ164200_97..10398 DQ431693_1..10302 HM488242_93..10394 HM488163_97..10398 HM488164_97..97398 HM488161_97.7910 HM10397_96. ..10398 HM488121_97..10398 HM488122_93..10394 HM48812 3_96..10397 HM488124_97..10398 HM488181_97..10398 HM488207_97..10398 HM488245_97..10398 HM488202_97..10398 DQ431710_1..10302 DQ666450_97..10398 HM488159_97..10398 GQ507481_1.756_HM .10391 HM756678_97..10398 HM488160_95..10396 HM756649_97..10398 HM488173_142..10443 HM488217_97..10398 HM756650_97..10398 HM756656_97..10398 HM488157_97..398 HM488221_431..10438 HM48810_1 GU827998_43..10344 HM488208_123..10424 HM488197_96..10397 HM488241_97..10398 HM488227_131..10432 HM488228_97..10398 DQ164189_97..10398 DQ431697_1..10302 HM488252_88..139389 DQ43110 .10398 HM488209_97..10398 HM488139_94..10395 HM488141_96..10397 HM488114_97..10398 HM488142_94..10395.

(5) Yellow fever virus AY572535_119..10354 AY603338_119..10354 AY839632 YFU21055_119..10354 AF094612_119..10354 AF052438_119..10354 YFU17067_119..10354 AF052437_119..10354 AF052439_119.10354 AF0510 10354 NC_002031_119..10354 X03700_119..10354 DQ118157_119..10354 FJ654700_119..10354 DQ100292_119..10354 GQ379162_119..10354 GQ379163_119..10354 YFU17066_119..10354 AY640589_119.10354 YFU21083_120.3543 10358 AY839631 AY968065_120..10358 AY968064_121..10359.

5. Nucleic acid probe The nucleic acid probe set described above may include mutation in at least one nucleic acid probe contained therein. The mutation contained in the nucleic acid probe may include a mutation within a range where the nucleic acid derived from the mosquito-borne virus can be specifically detected. The specifically detectable range may be a range that does not affect the identification when the target mosquito-borne virus is taxonomically identified using a nucleic acid probe containing a mutation. For example, each of the above-described nucleic acid probes may be composed of a sequence in which one or several bases at any position in the sequence represented by the above SEQ ID No. are substituted, deleted, or inserted. The nucleic acid probe is changed according to the genetic polymorphism or mutation held by each strain of mosquito-borne virus to be detected, and one or several bases at any position in the sequence indicated by the above SEQ ID No. It may consist of a sequence with substitutions, deletions or bases inserted. A plurality of sequences containing such mutations may be simultaneously present in one reaction field. In that case, 1 to 5, preferably 1 to several nucleotides at any position of the polynucleotide represented by the sequence described in any of the above SEQ ID Nos. Or a complementary sequence thereof may be prepared as a mixed nucleotide. In general, 1 to 5, preferably 1 to several nucleotides at any position may be universal nucleotides.

Here, the nucleic acid probe may further contain a sequence of about 1 to 100 nucleotides, preferably about 2 to 30 nucleotides (for example, a sequence used as a spacer) on the terminal side. The length of the nucleic acid probe may be about 30 to 200 nucleotides, preferably 35 to 100 nucleotides, and more preferably 43 to 60 nucleotides.

Any of the nucleic acid probes described above may be used alone or in multiple types in one reaction field. Moreover, when using it fixed to a base | substrate, you may fix and use one type in 1 area | region for obtaining 1 signal in the said base | substrate. However, a plurality of types may be fixed and used. When a plurality of types of nucleic acid probes are used, two types, two or more types, or all nucleic acid probes including the respective sequences may be used together. Further, any one or more bases constituting these sequences may be designed as a mixed base. Here, the “mixed base” is a mixture of two or more nucleic acid probes designed as “adenine”, “thymine”, “cytosine”, and “guanine” as bases at desired positions to be mixed bases. A nucleic acid probe set. Moreover, you may design so that it may substitute with the modified base which can be paired with respect to multiple types of bases. The mixed base may be used as a mixed base for a base at one position in one reaction field, or may be used as a mixed base corresponding to all of the bases at a plurality of positions.

The structure of the nucleic acid probe is not particularly limited, and DNA, RNA, PNA, LNA, methylphosphonate skeleton nucleic acid and / or other artificial nucleic acid chains can be used. In addition, a chimeric nucleic acid of any of these nucleic acids may be used.

[Example]
I. Preparation of primer set Design of primer set for yellow fever virus Specifically, the polyprotein region of yellow fever virus was downloaded from the NCBI nucleotide database. An alignment was created to obtain the saved area. The primers were then designed using, for example, the software “Primer Explorer V4” (see “Primer Explorer V4”, “http://primerexplorer.jp/”). The designed primers are from Life Technologies Inc. , And requested the synthesis as a cartridge grade. These gave a primer group for yellow fever virus.

Specifically, the prepared primer group includes a primer having SEQ ID NO: 42, a primer having SEQ ID NO: 43, a primer having SEQ ID NO: 44, a primer having SEQ ID NO: 45, a primer having SEQ ID NO: 46, and SEQ ID NO: 47. It was a primer. Sequence number 42 is CGGCTTCCCTTTGCTTTCCCAAAGGTGTCGGACTTGTGTGT and is a FIP primer. Sequence number 43 is GGTATATGTGGCTGGGAGCGCCCCAATGGTCCTCATTCAGG and is a BIP primer. SEQ ID NO: 44 is AAGGAAGCTGCACCAACAA and is an F3 primer. SEQ ID NO: 45 is CTTCCACTCCTCCTCCTGA, which is a B3 primer. And SEQ ID NO: 46 is CTCTGACAGCTTCTTCTC, which is an LPF primer. SEQ ID NO: 47 is GTATCTTGAGTTTGAGG and is an LPB primer.

2. Preparation of primer groups for chikungunya virus, dengue fever virus, Japanese encephalitis virus and west nile virus (1) chikungunya virus A primer group for chikungunya virus was prepared. FIP primer having CAGATGCGGTATGAGCCCTGTATGGAGAAGTCCGAATCATGC SEQ ID NO: 1 and CCGATGCGGTGTGGGCTCTGTATAGAGAAATCTGAATCTTGC SEQ ID NO: 2, BIP primer having TCCGCGTCCTTTACCAAGGAAATTTGGCGTCCTTAACTGTGAC having 3 TCCGCGTCCTTTACCAAGGAA A primer, an LPF primer having GCTGATGCAAATTCTGT of SEQ ID NO: 6, and an LPB primer having CCTATGCAAACGGCGAC of SEQ ID NO: 7 were prepared.

(2) Dengue virus (a) Dengue virus type I
Primers for dengue virus type I were prepared. FIP primer with GCTGCGTTGTGTCTTGGGAGGTTTTCTGTACGCATGGGGTAGC being SEQ ID NO: 8, BIP primer having CCCAACACCAGGGGAAGCTGTTTTTTTGTTGTTGTGCGGGGG being SEQ ID NO: 9, F3 primer having GAGGCTGCAAACCATGGAA being SEQ ID NO. An LPB primer having was prepared.

(B) Dengue virus type II
Primers for dengue virus type II were prepared. FIP primer having SEQ ID NO: 13 TTGGGCCCCCATTGTTGCTGTTTTAGTGGACTAGCGGTTAGAGG, BIP primer having GGTTAGAGGAGACCCCCCCAATTTTGGAGACAGCAGGATCTCTGG SEQ ID NO: 14, F3 primer having TGGAAGCTGTACGCATGG SEQ ID NO: 16, TGGCCTGAB And an LPB primer having GCATATTGACGCTGGGA which is SEQ ID NO: 18.

(C) Dengue virus type III
Primers for dengue virus type III were prepared. FIP primer having TGGCTTTTGGGCCTGACTTCTTTTTTGAAGAAGCTGTGCAGCCTG which is SEQ ID NO: 19, BIP primer having CTGTAGCTCCGTCGTGGGGATTTTCTAGTCTGCTACACCGTGC having SEQ ID NO: 21, F3 primer having GCCACCTTAAGCCACAGTA having SEQ ID NO: 21, GTGGGTG having GTGGGTGCAT having GTG An LPB primer having was prepared.

(D) Dengue virus type IV
Primers for dengue virus type IV were prepared. FIP primer with SEQ ID NO: 24 TGGGAATTATAACGCCTCCCGTTTTTTCCACGGCTTGAGCAAACC, BIP primer with GGTTAGAGGAGACCCCTCCCTTTTAGCTTCCTCCTGGCTTCG with SEQ ID NO: 25, F3 primer with CTATTGAAGTCAGGCCAC with SEQ ID NO: 27, ACCTCTAGTCCTC with ACC And an LPB primer having TCACCAACAAAACGCAG which is SEQ ID NO: 29 were prepared.

(3) Japanese encephalitis virus A primer group for Japanese encephalitis virus was prepared. FIP primer having GCGGACGTCCAATGTTGGTTTGGCCACTTGGGTGGACTTG which is SEQ ID NO: 30, BIP primer having AAGGCTAGCCAACTTGCTGAGGTCGTCGAGATGTCAGTGACTG being SEQ ID NO31, F3 primer having GTATGGGTCTG3 which is GGTTTGTTGC having GGTTTG And an LPB primer having GAAGTTACTGCTATCATGCT which is SEQ ID NO: 35 were prepared.

(4) West Nile virus A primer group for West Nile virus was prepared. FIP primer having TTGGCCGCCTCCATATTCATCATTTTCAGCTGCGTGACTATCATGT being SEQ ID NO: 36, BIP primer having TGCTATTTGGCTACCGTCAGCGTTTTTGAGCTTCTCCCATGGTCG being SEQ ID NO: 37, F3 primer having TGGATTTGGTTCTCGAAGG being SEQ ID NO: 38, TG And an LPB primer having TCTCCACCAAAGCTGCGT which is SEQ ID NO: 41 were prepared.

II. Preparation of standard synthetic template DNA A template for producing RNA to be amplified by the above primer set was prepared. Each template was artificially synthesized based on the sequence information obtained from the database.

First, plasmid DNA into which a nucleotide sequence region necessary for LAMP amplification reaction of each virus and a T7 promoter were introduced was synthesized. The base sequence of the introduction part is as follows.

(1) Chikungunya virus standard synthetic template DNA
Standard synthetic template DNA for chikungunya virus is shown in Table 4-1.

(2) Dengue type I standard synthetic template DNA
Standard synthetic template DNA for Dengue type I is shown in Table 4-2.

(3) Dengue type II standard synthetic template DNA
Standard synthetic template DNA for dengue type II is shown in Table 4-3.

(4) Dengue type III standard synthetic template DNA
Standard synthetic template DNA for Dengue fever type III is shown in Table 4-4.

(5) Dengue type IV standard synthetic template DNA
Standard synthetic template DNA for dengue type IV is shown in Table 4-5.

(6) Japanese encephalitis virus standard synthetic template DNA
Standard synthetic template DNAs for Japanese encephalitis virus are shown in Table 4-6.

(7) West Nile virus standard synthetic template DNA
Standard synthetic template DNAs for West Nile virus are shown in Table 4-7.

(8) Yellow fever virus standard synthetic template DNA
Standard synthetic template DNAs for yellow fever virus are shown in Table 4-8.

III. Preparation of standard synthetic template RNA Template RNA was prepared from standard synthetic template DNA for each of the viruses described above. The synthesis of RNA from the standard synthetic template DNA was performed using T7 RiboMAX Express Large Scale RNA Production system (Promega). Transcribed RNA was purified by RNA easy (QIAGEN Inc.), and RNA concentration was measured using Qubit (Life Technologies Inc.). A standard synthetic template RNA was prepared by adjusting the RNA concentration to 1E + 04 copies / μL TE.

IV. Reverse transcription-LAMP reaction Table 1 shows the sequences of primer sets used in the reverse transcription-LAMP reaction (RT-LAMP). These are primers synthesized in the preparation of the above primer set.

In addition, Table 2 shows the composition of reagents necessary for the reverse transcription-LAMP reaction. In the case of a primer set not including LPF primer and LPB primer, sterilized distilled water (DW) was added correspondingly. This solution was reacted at 63 C ° for 50 minutes to carry out reverse transcription-LAMP reaction.

V. Production of nucleic acid probe-immobilized chip A DNA chip was prepared as a nucleic acid probe-immobilized chip. Table 3 shows the nucleotide sequence of the nucleic acid probe DNA immobilized on the DNA chip. Nucleic acid probes having the base sequences described in Table 3 were artificially synthesized.

100 nL of a solution containing 3 μM of each nucleic acid probe was spotted on an electrode arranged on one surface of the substrate and dried and fixed. This produced a DNA chip. As the DNA chip and the DNA chip measuring apparatus, those described in SICE Journal of Control, Measurement, and System Integration, Vol. 1, No. 3, No. 3, pp. 266-270, 2008 were used.

VI. Detection of Reverse Transcription-LAMP Product 5 μL was collected from 8 types of reverse transcription-LAMP reaction tubes, and 10 μL of 10 × SSCs was added thereto. This was used as a target solution. This target solution was injected into a DNA chip cassette to perform hybridization. Then it was washed and Hoechst 33258 solution was added. Thereafter, electrochemical measurement was performed.

VII. DNA chip detection results Table 5 shows the detection results of the DNA chip.

Specific signals were obtained for each serotype and 4 serotypes of dengue virus.

From the above results, it was shown that the mosquito-borne virus detection kit of the present application can simultaneously detect five viruses and four serotypes of dengue fever.

51, 61 Nucleic

acid immobilization chip

52, 62 Substrate 53 Immobilization region 63

Electrode

54, 64 Nucleic acid probe 55 Positive control region 56 Background region 65 Positive control electrode
66 Background electrode

Claims

A primer set for comprehensively amplifying mosquito-borne viruses consisting of chikungunya virus, dengue fever virus, Japanese encephalitis virus, West Nile virus and yellow fever virus, comprising primers each containing SEQ ID NOs: 1 to 7 A first primer group, a second primer group comprising primers respectively comprising SEQ ID NOs: 8-12, a third primer group comprising primers comprising SEQ ID NOs: 13-18, and SEQ ID NOs: 19-19 A fourth primer group comprising primers respectively comprising SEQ ID NO: 23, a fifth primer group comprising primers comprising SEQ ID NOS: 24-29, and a primer comprising primers respectively comprising SEQ ID NOS: 30-35, respectively. 6 primer groups and primers each containing SEQ ID NOS: 36-41 A primer set comprising a seventh primer group and an eighth primer group comprising primers each comprising SEQ ID NOs: 42 to 47, respectively.
An assay kit for simultaneously detecting a mosquito-borne virus comprising chikungunya virus, dengue virus, Japanese encephalitis virus, West Nile virus and yellow fever virus, comprising the primer set according to claim 1 and SEQ ID NOs: 48 to 56 An assay kit comprising a nucleic acid probe set comprising a nucleic acid probe contained therein.
The assay kit according to claim 2, wherein the primer set is immobilized on one nucleic acid immobilization chip.
A method for comprehensive detection of mosquito-borne viruses consisting of chikungunya virus, dengue virus, Japanese encephalitis virus, West Nile virus and yellow fever virus,
(A) amplifying the nucleic acid contained in the sample using the primer set according to claim 1,
(B) reacting the amplification product obtained in (a) with all the nucleic acid probes contained in the nucleic acid probe set according to claim 2;
(C) detecting a signal derived from hybridization generated between the amplification product and each nucleic acid probe included in the nucleic acid probe set, respectively.
(D) determining whether the sample contains a mosquito-borne virus based on the signal obtained in (c).
The method according to claim 4, wherein the nucleic acid probe set is immobilized on one nucleic acid immobilization chip.
The method according to claim 5, wherein the signal derived from the hybridization is a fluorescence intensity or an electrochemical signal.
Primers for specifically amplifying yellow fever virus comprising primers each containing SEQ ID NOs: 42 to 47.