WO2012036111A1 - Primer, probe, and method for multi-specimen analysis - Google Patents

Abstract

The present invention relates to a method for analyzing a partial nucleic acid sequence on each specimen nucleic acid contained in a plurality of specimens. This method comprises (a) through (e). (a) A plurality of primer sets comprising a first primer and a second primer are prepared. A plurality of first primers are prepared and contain mutually different tag sequences corresponding to the plurality of specimens. The second primer is the opposite of the first primer. A tag sequence is inserted into any site from the 6^th to the 12^th base from the 3' terminal side of the first primer and the tag sequence is three to seven bases in length. When the first primer is hybridized with a template, the tag sequence loops out. (b) Each of the plurality of specimens is amplified by the corresponding primer set at a unique reaction place. (c) The amplification products obtained by (b) are mixed. (d) The mixture of amplification products of (c) is reacted with a nucleic acid probe fixed on a substrate. (e) The partial nucleic acid sequences on a plurality of specimen nucleic acids are analyzed from hybridization results produced in (d).

Description

Primers, probes and methods for multi-analyte analysis

Embodiments of the present invention relate to primers, probes, and analysis methods for analyzing nucleic acids.

In the pet industry, it is important that the animal being traded has good health. For example, if an animal purchased by a consumer develops a disease in a short time after purchase or unfortunately dies, it causes unnecessary economic loss and mental damage to the consumer. At the same time, the vendors and breeders who provide the animals often cease to operate, causing loss of trust.

In dogs, especially underage dogs, infection with distemper virus or parvovirus is said to have a fatality rate of about 100%. At present, a method using an antigen-antibody reaction is used to detect such viruses. In order to make an accurate determination by an antigen-antibody reaction, it is necessary to pass a certain period of time from infection, and detection sensitivity is low. These methods are not sufficient for early and rapid diagnosis of infection. Furthermore, in the case of an antigen-antibody reaction, it is necessary to perform a detection operation for each type of virus.

The figure which shows a tag arrangement | sequence introduction primer and a nucleic acid probe. The scheme figure which shows an amplification process. The figure which shows a detection process. The scheme figure which shows an amplification process. The figure which shows a LAMP primer. The figure which shows the intermediate product of LAMP amplification. The scheme figure which shows an amplification process. The figure which shows a detection process. The figure which shows the tag arrangement | sequence introduction primer and nucleic acid probe in a LAMP method. The scheme figure which shows an amplification process. The top view of a DNA chip. The top view of a DNA chip. The graph which shows the screening result of a primer. The graph which shows the screening result of a primer. The schematic diagram shown about a tag insertion position and the number of tag bases. The graph which shows the influence on amplification of a tag. The graph which shows the influence on amplification of a tag. A graph showing the impact on tag detection. A graph showing the impact on tag detection. A graph showing the impact on tag detection. A graph showing the impact on tag detection. The graph which shows the influence of the unreacted residual primer. The schematic diagram shown about the influence of the unreacted residual primer. A graph showing the impact on tag detection. A graph showing the impact on tag detection. A graph showing the impact on tag detection. The graph which shows a result when detecting two or more objects simultaneously.

According to one embodiment, there is provided a method for analyzing a plurality of samples of a nucleic acid sequence in a sample nucleic acid. In the method, a template sequence is amplified by using different types of primer sets for each specimen. The primer set includes a first primer and a second primer. The first primer includes a tag sequence having a different sequence for each specimen. The second primer is used in pairs with the first primer. Thereby, amplification of the target sequence is achieved. The tag sequence is inserted from the 6th base to the 12th base from the 3 'end side of the first primer, and the tag sequence has 3 to 7 bases. The tag sequence is designed to loop out when the first primer hybridizes to the template sequence of the partial nucleic acid sequence. Next, the amplification products obtained for each specimen are mixed, and the obtained amplification product mixture is reacted with the nucleic acid probe. The nucleic acid probe is immobilized on a substrate. A sequence detected using hybridization with a nucleic acid probe as an index is a target sequence. The target sequence includes a tag sequence and a sequence derived from the template sequence for each partial nucleic acid sequence of the template sequence. Next, the presence and / or amount of the target nucleic acid is detected and / or measured by detecting the amount of hybridization.

Such an embodiment provides a method for analyzing a plurality of detection targets quickly and easily.

[Definition]
As used herein, the term “nucleic acid” is a generic term for substances that can be partially represented by their nucleotide sequences, such as DNA, RNA, PNA, LNA, S-oligo, and methylphosphonate oligo. It is shown.

The “specimen” is a target to be subjected to the analysis method according to the present embodiment, and may be any sample that may contain a nucleic acid. The specimen is preferably in a state that does not interfere with the amplification reaction and / or the hybridization reaction. For example, in order to use a material obtained from a living body as a specimen according to this embodiment, pretreatment may be performed by any means known per se. For example, the specimen may be a liquid, in which case it may be referred to as a “test liquid”. Therefore, the “test solution” may be understood as a solution in which a nucleic acid or a template nucleic acid may be present.

The terms “multiple samples” and “plural samples” indicate two or more samples and can be used interchangeably.

The nucleic acid contained in the sample is referred to as “sample nucleic acid”. Among the sample nucleic acids, the sequence to be amplified by the primer of this embodiment is referred to as “template sequence”. A nucleic acid containing a template sequence is referred to as a “template nucleic acid” or “template”. A partial sequence contained in the template nucleic acid is referred to as a “partial nucleic acid sequence”. A partial nucleic acid sequence is the sequence or base to be analyzed. The primer according to this embodiment is designed to amplify a region containing a partial nucleic acid sequence. The partial nucleic acid sequence may be equal to or included in the template sequence.

According to this embodiment, for example, when a specific virus is detected, a nucleic acid derived from the virus may be a template nucleic acid. In that case, the partial nucleic acid sequence may be, for example, a sequence specific to the virus.

“Target nucleic acid” refers to an amplification product obtained by amplifying a template nucleic acid or a template sequence using a forward primer and a reverse primer according to the present embodiment. The target nucleic acid includes a target sequence in a part thereof.

“Target sequence” consists of a tag sequence and a partial sequence of a template sequence. The target sequence is used to detect a target nucleic acid using a nucleic acid probe.

“Nucleic acid probe” is a nucleic acid containing a sequence complementary to a target sequence. The nucleic acid probe is used by being immobilized on a solid phase such as a substrate and forms a hybrid with an amplification product containing a region derived from the template sequence.

The “region derived from the template sequence” means a region other than the region to which the primer binds among the regions amplified by the primer, and the sequence is reflected in the sequence of the amplification product. For example, when detecting a gene polymorphism or gene mutation, the region is a partial nucleic acid sequence to be analyzed. The partial nucleic acid sequence is designed so as to be within the region derived from the template sequence.

A “DNA chip” is an apparatus for analyzing a nucleic acid using a hybridization reaction between a nucleic acid probe having a sequence complementary to the nucleic acid to be detected and the nucleic acid to be detected. The term DNA chip is synonymous with commonly used terms such as “nucleic acid chip”, “microarray” and “DNA array”, and is used interchangeably.

“Analyzing multiple samples” means analyzing a plurality of samples simultaneously. “Analyzing a plurality of nucleic acid sequences in a specimen” refers to simultaneously analyzing a plurality of partial nucleic acid sequences contained in one specimen. A plurality of partial nucleic acid sequences to be analyzed simultaneously may be included in one template nucleic acid, or may be included in different types of sample nucleic acids included in the sample.

The analyzed items include, for example, detection of specific nucleic acids such as genes derived from viruses and / or bacteria, measurement of gene expression levels, identification of genotypes for polymorphisms and / or detection of the presence or absence of mutations. And so on. However, the present invention is not limited to this.

“Amplification” refers to amplifying a target nucleic acid using a primer set, and includes, for example, a PCR method and a LAMP method. “LAMP method” includes LAMP method and RT-LAMP method. The “RT-LAMP method” is one type of LAMP method that is an isothermal gene amplification method. The RT-LAMP method is a method of performing LAMP amplification using RNA as a template by simultaneously performing a reverse transcription reaction and a LAMP reaction. Here, when it is simply described as “LAMP method”, it may be understood that both “LAMP method” and “RT-LAMP method” are referred to unless otherwise specified. The same primers can be used for the LAMP method and the RT-LAMP method.

“Reaction field” refers to the place where the reaction takes place. The reaction field may be formed in, for example, a well provided in a tube, a well, a chamber, a channel, a cup, a dish, and a plate including a plurality of them, for example, a multiwell plate.

[Embodiment]
Hereinafter, this embodiment will be described.

FIG. 1 shows a tag sequence introduction primer and a nucleic acid probe.

<Primer>
As exemplified by the tag-introduced F primer of FIG. 1, the primer includes a first priming sequence and a second priming sequence that bind to a primer binding site of a template nucleic acid, and a first priming sequence and a second priming sequence. And a tag sequence introduced in between. Tag sequences are used to analyze multiple specimens.

The tag sequence has a different sequence so as to correspond to each of a plurality of samples. The base length of the tag sequence is 3 to 7 bases. When the primer containing the tag sequence is bound to the template nucleic acid, on the other hand, the first priming sequence and the second priming sequence are bound to the template nucleic acid, while the tag sequence portion does not bind to the template nucleic acid and loops out. To do.

Examples of tag sequence combinations introduced for each of a plurality of primers brought into the same reaction field in order to analyze a plurality of specimens are “CTG”, “GGA”, “CCT”, “TCC”, “ATC”, “GCG”, “CGC”, “CCTCT”, “GTGCA”, “GACGT” and “ACGTC”. When detecting two or more specimens, for each specimen, “CTG”, “GGA”, “CCT”, “TCC”, “ATC”, “GCG”, “CGC”, “CCTCT”, “GTGCA” A tag sequence selected from at least one selected from the group consisting of “,” “GACGT” and “ACGTC” may be used. Examples of preferred combinations of tag sequences brought into the same reaction field are “CTG”, “GGA”, “CCT”, “TCC”, “CGC” and “GTGCA”. When two or more specimens are detected, at least one tag sequence selected from the group consisting of “CTG”, “GGA”, “CCT”, “TCC”, “CGC”, and “GTGCA” is used for each specimen. May be used for

The length of the primer may be 13 to 40 bases, for example, 15 to 30 bases. In the case of a primer including a tag (herein also referred to as “tag-containing primer”), the length may be 16 to 47 bases, for example, 18 to 37 bases.

The following is important for the place where the tag sequence is inserted into the primer. That is, when the primer binds to the template, the tag sequence portion needs to loop out without binding to the template. Further, when detecting a polymorphism such as a mutation or a single nucleotide polymorphism as shown in FIG. 1, the nucleic acid probe needs to include both a tag sequence and a sequence derived from the template sequence. Therefore, in the case of PCR amplification, the tag sequence may be inserted at any position from the 6th base to the 12th base from the 3 ′ end side of the Forward primer (F primer) and / or the Reverse primer (R primer). . In the case of LAMP amplification, it may be inserted at any site from the 6th base to the 12th base from the 3 'end of the F2 region and / or B2 region. Specifically, it may be inserted at any position from the 6th base to the 12th base from the 3 'end of the F2 sequence of the FIP primer and / or from the 6th base to the 12th base of the B2 sequence of the BIP primer. . This provides good amplification and detection characteristics.

The type of nucleic acid constituting the tag sequence is not particularly limited as long as it is a substance capable of expressing a partial structure by a base sequence, such as DNA, RNA, PNA, LNA, S-oligo, and methylphosphonate oligo.

<Nucleic acid probe>
A group of nucleic acid probes contained in one reaction field can be used to simultaneously obtain sequence information about the sample nucleic acid contained in each of a plurality of samples. It can also be used to simultaneously obtain sequence information for a plurality of types of sample nucleic acids contained in one sample. Furthermore, it can also be used to simultaneously obtain sequence information for a plurality of samples and a plurality of types of sample nucleic acids.

The nucleic acid probe can detect the target nucleic acid and identify which sample nucleic acid the target nucleic acid is derived from. Thus, the nucleic acid probe is designed to include a sequence that is complementary to the tag sequence. The sequence complementary to the tag sequence is a sequence for tag sequence detection. Furthermore, the nucleic acid probe is designed to include a sequence complementary to a region derived from the template sequence as desired as shown in FIG.

For example, when detecting gene mutation and / or polymorphism of nucleic acid in a sample, the gene mutation and / or gene polymorphism site is included in the region derived from the template sequence near the primer binding site on the amplification product. Prepare the primer. Nucleic acid probes are also designed to include sequences corresponding to genetic mutation and / or gene polymorphic sites. Thereby, the base information of the mutation and / or polymorphic site on the sample nucleic acid is obtained using the presence / absence and / or amount of hybridization between the nucleic acid probe and the amplification product as an index. For example, in order to detect whether a sample nucleic acid is a wild type or a mutant type, a corresponding nucleic acid probe is used, and the amount of hybridization with the target nucleic acid is compared, whereby the genotype of the sample is compared. Can be determined. In that case, a nucleic acid probe for wild type detection and a nucleic acid probe for mutation type detection are used as the nucleic acid probe. These nucleic acid probes include a sequence for detecting a tag sequence and a sequence for detecting gene mutation and / or polymorphism. Whether the sample nucleic acid is wild-type or mutant is determined by comparing the amount of hybridization between the wild-type detection nucleic acid probe, the mutant-type detection nucleic acid probe, and the target nucleic acid. It may be determined.

Also, for nucleic acids in one or more specimens, it may be used to identify multiple species that are classified in the same genus of bacteria. In this case, for example, the tag introduction primers that are amplified in common by the same genus are prepared for each sample and amplified. At this time, the primers are designed so that a region that is characteristic for each species and has a specificity that can be distinguished from other species is included in the region derived from the template sequence near the primer binding site on the amplification product. The Nucleic acid probes are also designed to include sequences that correspond to sites for identifying such species. Thereby, base information on a plurality of species classified into the same genus is obtained using the presence / absence and / or amount of hybridization between the nucleic acid probe and the amplification product as an index. Such a nucleic acid probe includes a sequence for tag sequence detection and a nucleic acid probe for species identification having a sequence characteristic to each species. Further, a negative control nucleic acid probe containing a sequence indicating that it is unrelated to the species may be prepared and used together with the nucleic acid probe for species identification. For example, the species is identified by comparing the hybridization amount between the nucleic acid probe for species identification and the target nucleic acid, and the amount of hybridization between the negative control nucleic acid probe containing a sequence unrelated to the species and the target nucleic acid. You can also

As an index for analysis, when detecting the presence or absence of nucleic acid amplification in a specimen, it is not always necessary to include a sequence complementary to the region derived from the template sequence.

The chain length of the nucleic acid probe according to this embodiment is not particularly limited, but is preferably in the range of 5 to 50 bases, more preferably in the range of 10 to 40 bases, and still more preferably in the range of 15 to 35 bases.

The nucleic acid probe may be modified with a reactive functional group such as an amino group, a carboxyl group, a hydrosyl group, a thiol group, or a sulfone group, or a substance such as avidin or biotin in order to be immobilized on the substrate. In addition, a spacer may be introduced between such a functional group and a nucleotide. As the spacer, for example, an alkane skeleton, an ethylene glycol skeleton or the like may be used. The modification with the functional group of the nucleic acid probe is not limited to this, but is preferably at the end of the nucleic acid probe.

The solid phase for immobilizing the nucleic acid probe may be any substrate generally used as a solid phase for a DNA chip. Such a substrate may be composed of glass, silicon, nitrocellulose membrane, nylon membrane, microtiter plate, electrode, magnet, bead, plastic, latex, synthetic resin, natural resin, or optical fiber, but is not limited thereto. Not. A plurality of types of nucleic acid probes are immobilized on these substrates to form a DNA chip.

<Method>
Next, a method for analyzing multiple samples using a primer into which a tag sequence has been introduced and a DNA chip will be described.

As shown in FIG. 2, first, a plurality of tag sequences having different sequences from each other, that is, a tag sequence 1, a tag sequence 2, and a plurality of samples, that is, a sample 1, a sample 2, and a sample 3, respectively. A tag array 3 is designed. A plurality of tag introduction primers into which these tag sequence 1, tag sequence 2, and tag sequence 3 are introduced, that is, a sample 1 tag introduction primer, a sample 2 tag introduction primer, and a sample 3 tag introduction primer are prepared. A plurality of specimens are amplified using these tag introduction primers. This amplification is performed in a reaction field that is independent of each other for each type of the plurality of specimens. The reaction fields that are independent from each other for each type of sample may be any reaction field that does not mix different samples. For example, amplification may be performed in a separate tube, well, or flow path for each specimen.

After amplification, amplification products with partially different sequences for each specimen are obtained. When the template nucleic acid does not exist, that is, in the case of the sample 2, amplification does not occur and an amplification product is not obtained. In the case of the specimen 1 and the specimen 3, the amplification products obtained in the respective reaction fields include different tag sequences for each specimen and a region derived from the template nucleic acid. Therefore, by identifying the tag sequence contained in the amplification product, it is possible to determine which specimen is the amplification product.

This amplification product is mixed, reacted with a nucleic acid probe immobilized on a substrate as shown in FIG. 3, and hybridized. The nucleic acid probe includes a sequence that is complementary to the respective tag sequence. Thereafter, the presence / absence and / or amount of hybridization produced by the reaction is detected using any detection method known per se.

2 and 3 show examples of three samples, but it is clear that the number of samples is not limited to this. In addition, as shown in FIG. 1, if a primer is designed so that the region derived from the template sequence of the amplification product as described above includes a mutation or a polymorphic site, the sample is identified by the tag sequence and included in the sample. Mutation and / or polymorphism detection or identification can be analyzed simultaneously. In this case, the nucleic acid probe may include a tag sequence and a sequence derived from the template sequence, or a sequence complementary thereto. The sequence derived from the template sequence or its complementary strand has a sequence for detecting or identifying mutations and / or polymorphisms. As described above, when analyzing a plurality of samples at the same time, tag sequences having different sequences may be used for each sample, that is, corresponding to each sample.

Furthermore, as shown in FIG. 4, it is also possible to analyze the sequence information by multi-amplifying a plurality of template sequences having different sequences in one reaction field. In this case, the template sequence may be a plurality of template sequences present in different regions included in one template nucleic acid included in the specimen, and a plurality of sequences included in each of the plurality of template nucleic acids included in the specimen may be used. It may be a template sequence. The tag sequence corresponds to each of a plurality of template sequences to be amplified or partial nucleic acid sequences to be analyzed, that is, has a different sequence from each other for each template sequence or each partial nucleic acid sequence. Should be designed to.

After the above amplification, if a DNA chip is detected for the amplification product of the specimen, it is possible to analyze a plurality of specimens for a plurality of template sequences. Detection is performed using hybridization of the nucleic acid probe immobilized on the substrate and the amplification product as an indicator. The nucleic acid probe includes a sequence complementary to each tag sequence. After an amplification reaction is performed to obtain an amplification product, hybridization between the amplification product and the nucleic acid probe may be detected using any known detection method. Although FIG. 4 shows an example of three template sequences, it is clear that the number of template nucleic acids is not limited to this.

In addition, the primer may be designed so that the region derived from the template sequence of the amplification product includes a mutation detection sequence and / or a species identification sequence. The sequence for mutation detection may be a sequence corresponding to the site of the mutation and / or polymorphism to be detected or identified. The species identification sequence may be a sequence corresponding to a site that is characteristic of the species to be identified and that can exhibit specificity for other species. In this case, the sequence for mutation detection and / or the sequence for species identification is a sequence to be analyzed and is interpreted as a partial nucleic acid sequence. When analyzing a plurality of partial nucleic acid sequences at the same time, different tag sequences are used corresponding to each of the plurality of partial nucleic acid sequences, that is, for each partial nucleic acid sequence. At this time, the nucleic acid probe may be further designed to include a tag sequence and a mutation detection sequence and / or a species identification sequence. It is possible to analyze mutations, polymorphisms, biological species, etc. by using such a nucleic acid probe after a plurality of different template nucleic acids are multi-amplified.

It is also possible to analyze a plurality of partial nucleic acid sequences for a plurality of specimens. In that case, the amplification for the specimens 1 to 3 described in FIG. 2 as described above and the multi-amplification as described in FIG. 4 may be performed in parallel. A product and a plurality of amplified products amplified for each specimen may be mixed, and the mixture may be detected with a nucleic acid probe. When the amplification shown in FIG. 2 and the multi-amplification shown in FIG. 4 are performed in parallel on three types of specimens and three types of partial nucleic acid sequences, a total of nine different tags may be used.

The detection target in this embodiment includes, for example, an individual's genomic DNA, genomic RNA, mRNA, and the like. Individuals include, but are not limited to, humans, non-human animals, plants, and microorganisms such as viruses, bacteria, bacteria, yeasts and mycoplasmas.

These nucleic acids are extracted from samples collected from individuals, such as blood, serum, leukocytes, urine, stool, semen, saliva, tissue, biopsy, oral mucosa, cultured cells, sputum and the like. Alternatively, it is extracted directly from the microorganism. Nucleic acid extraction can be performed using, but not limited to, commercially available nucleic acid extraction kits such as QIAamp (manufactured by QIAGEN), Sumitest (manufactured by Sumitomo Metals), and the like. A solution containing nucleic acid extracted from an individual sample or a microorganism is used as a test solution.

The specimen is amplified by the amplification method according to the method of the present embodiment. When the detection target is RNA, it can be converted into complementary strand DNA by, for example, reverse transcriptase before amplification. Both reverse transcriptase and DNA polymerase may be added in the same tube, and reverse transcription and DNA amplification may be performed simultaneously.

As for the amplification method, for example, Polymerase chain reaction method (PCR method), Loop mediated isometric amplification method (LAMP method), Isothermal and chimeric acidified IC (Non-Chemical Optimized Amplification method). Method), Strand displacement amplification (SDA method), Ligase chain reaction (LCR method), Rolling Circle Amplification method (RCA method), etc. It can be used. The obtained amplification product is fragmented or single-stranded as necessary. Examples of means for forming a single strand include heat denaturation, a method using beads, an enzyme, and the like, and a method of performing a transcription reaction using T7 RNA polymerase. When amplified by the LAMP method or ICAN method and a single-stranded region is present in the product and this single-stranded region is used as a target sequence, it can be directly subjected to the hybridization step.

Since the single-stranded process is not necessary, the target nucleic acid obtained by amplification preferably has a stem-loop structure. The amplification product having a stem-loop structure can conveniently use the sequence of the single-stranded loop portion for the reaction with the probe.

For amplification of the target nucleic acid, the LAMP method (for example, see Japanese Patent No. 3313358) is preferably used. The LAMP method is a rapid and simple gene amplification method, and the amplification product has a stem-loop structure.

FIG. 5 is a diagram showing an example of basic primer design used in the LAMP method. The principle of the LAMP method will be briefly described with reference to the schematic diagram of FIG. In the LAMP method, six types of primers that recognize a maximum of eight regions of a template nucleic acid and a strand displacement type DNA synthase are used. The template nucleic acid is amplified under isothermal (60-65 ° C.) conditions. The eight regions are defined as F3 region, F2 region, LF region, F1 region, B3c region, B2c region, LBc region, and B1c region in this order from the 5 'end side of the template nucleic acid. The F1c, F2c, F3c, B1, B2, and B3 regions represent regions in the complementary strand of the F1, F2, F3, B1c, B2c, and B3c regions, respectively. The eight kinds of primers shown in FIG. 5 have a FIP inner primer having a sequence complementary to F1 on the 5 ′ end side and the same sequence as F2 on the 3 ′ end side, and the same sequence as B1c on the 5 ′ end side. 'BIP inner primer having a sequence complementary to B2c on the terminal side, F3 primer having the same sequence as F3 region, B3 primer having a sequence complementary to B3c region, LFc primer having a sequence complementary to LF region, LBc primer having the same sequence as the LBc region. Indispensable for the amplification reaction are the FIP inner primer and the BIP inner primer, and the F3 primer, B3 primer, LF primer and LB primer are added to increase the amplification efficiency.

A loop structure as shown in FIG. 6 is formed in the amplified product by the LAMP method, between the F2 region and the F1 region, between the F2c region and the F1c region, between the B2 region and the B1 region, and between the B2c region and the B1c region. Is a single-stranded region. Therefore, if a target sequence is designed in this region, the target nucleic acid can be detected easily and with high sensitivity (see, for example, JP-A-2005-143492). When the LF primer and / or LB primer and the target sequence overlap, it is preferable not to add the LF primer and / or LB primer.

FIG. 7 is used to explain a method for analyzing multiple samples using a primer for introducing a tag sequence and a DNA chip when the LAMP method is used.

First, a primer having the tag sequence introduced into the F2 region and / or B2 region is prepared for each sample.

Next, amplification is performed for each sample in a reaction field independent for each sample using the primer. For example, amplification may be performed in a separate tube for each specimen. After amplification, amplification products having partial sequences that differ depending on the specimen are obtained in the single-stranded loop portion. If no template nucleic acid is present, amplification does not occur and no amplification product is obtained. This amplified product is mixed and hybridized with a nucleic acid probe containing a sequence complementary to each tag sequence immobilized on a substrate as shown in FIG. Thereafter, hybridization between the amplification product and the nucleic acid probe is detected by an appropriate detection method.

7 and 8 show an example with three samples, but it is clear that the number of samples is not limited to this.

Further, as shown in FIG. 9, regions derived from the template sequence detected by the nucleic acid probe, that is, between the F2 region and the F1 region, between the F2c region and the F1c region, between the B2 region and the B1 region, and between the B2c region and the B1c region. If primers are designed so that mutations and polymorphic sites are located between them, detection can be performed by using a nucleic acid probe that detects these mutations and polymorphisms.

Furthermore, as shown in FIG. 10, it is possible to multi-amplify a plurality of types of template sequences consisting of different sequences within one reaction field. After amplification, if a DNA chip is detected for the amplification product of the specimen, it is possible to analyze a plurality of specimens for a plurality of target sequences. Detection is performed by hybridization with a nucleic acid probe containing a sequence complementary to each tag sequence immobilized on the substrate. Thereafter, hybridization between the amplification product and the nucleic acid probe is detected by an appropriate detection method. Although FIG. 10 shows an example of three template nucleic acids, it is clear that the number of template nucleic acids is not limited to this. In addition, the primer should be designed so that the region derived from the template sequence of the amplification product is located at the site of mutation or polymorphism, and / or a site that is characteristic for the species to be identified and that is specific for other species. For example, a nucleic acid probe containing sequences complementary to the bases of these sites, that is, a mutation detection sequence and / or species identification sequence and a tag sequence is used, and mutations, polymorphisms, and / or biological species are used. The sample nucleic acid, that is, the sample can be analyzed.

<DNA chip>
The DNA chip used in this embodiment may be provided with a substrate and a nucleic acid probe immobilized on the substrate. The substrate of the DNA chip may be any conventionally known microarray substrate such as an electrochemical detection type represented by a current detection type, a fluorescence detection type, a chemical color development type, and a radioactivity detection type.

Any type of microarray can be produced by a method known per se. For example, in the case of a current detection type microarray, the negative control probe immobilization region and the detection probe immobilization region may be arranged on different electrodes.

An example of a DNA chip is shown in FIG. 11 as a schematic diagram, but is not limited thereto. The DNA chip has an immobilization region 2 on a substrate 1. The nucleic acid probe is immobilized on the immobilization region 2. Such a DNA chip can be manufactured by a method well known in the art. A person skilled in the art can appropriately change the design of the number and the arrangement of the immobilization regions 2 arranged on the substrate 1 as necessary. Such a DNA chip may be suitably used for a detection method using fluorescence.

Another example of the DNA chip is shown in FIG. The DNA chip in FIG. 12 includes an electrode 12 on a base 11. The nucleic acid probe is immobilized on the electrode 12. The electrode 12 is connected to the pad 13. Electrical information from the electrode 12 is acquired via the pad 13. Such a DNA chip can be manufactured by a method well known in the art. The number of electrodes 12 arranged on the substrate 11 and the arrangement thereof can be appropriately changed by those skilled in the art as needed. Furthermore, the DNA chip of this example may include a reference electrode and a counter electrode as necessary.

The electrode is composed of a simple metal such as gold, gold alloy, silver, platinum, mercury, nickel, palladium, silicon, germanium, gallium or tungsten, or an alloy thereof, or carbon such as graphite or glassy carbon, or a material thereof. Although an oxide or a compound can be used, it is not limited to these.

The DNA chip as in this example may be suitably used for an electrochemical detection method.

<Hybridization conditions>
Hybridization may be performed under appropriate conditions that allow sufficient hybridization. Appropriate conditions vary depending on the type and structure of the target nucleic acid, the type of base contained in the target sequence, and the type of nucleic acid probe. For example, hybridization may be performed in a buffer solution having an ionic strength in the range of 0.01 to 5 and a pH in the range of 5 to 9. The reaction temperature may range from 10 ° C to 90 ° C. The reaction efficiency may be increased by stirring or shaking. In the reaction solution, hybridization accelerators such as dextran sulfate, salmon sperm DNA, and bovine thymus DNA, EDTA, or a surfactant may be added.

<Cleaning conditions>
A washing solution for washing the DNA chip after hybridization has an ionic strength in the range of 0.01 to 5, and a buffer in the range of pH 5 to 9 is preferably used. The cleaning liquid preferably contains a salt and a surfactant. For example, an SSC solution prepared using sodium chloride or sodium citrate, a Tris-HCl solution, a Tween 20 solution, or an SDS solution is preferably used. The washing temperature is, for example, in the range of 10 ° C to 70 ° C. The washing solution passes or stays on the surface of the probe-immobilized substrate or the region where the nucleic acid probe is immobilized. Alternatively, the DNA chip may be immersed in a cleaning solution. In this case, the cleaning liquid is preferably stored in a temperature-controllable container.

<Detection method>
The detection of the hybrid produced by the hybridization process can utilize a fluorescence detection method and an electrochemical detection method.

(A) Fluorescence detection method Detection is performed using a fluorescent labeling substance. Primers used in the nucleic acid amplification step may be labeled with a fluorescently active substance such as a fluorescent dye such as FITC, Cy3, Cy5, or rhodamine. Alternatively, a second probe labeled with these substances may be used. A plurality of labeling substances may be used simultaneously. The label in the labeled sequence or the secondary probe is detected by the detection device. Use an appropriate detection device depending on the label used. For example, when a fluorescent substance is used as a label, it is detected using a fluorescence detector.

(B) Electrochemical detection method A double-stranded recognition substance well known in the art is used. The double-stranded recognizing substance may be selected from Hoechst 33258, acridine orange, quinacrine, dounomycin, metallointercalator, bisintercalator such as bisacridine, trisintercalator and polyintercalator. Further, these double strand recognition substances may be modified with an electrochemically active metal complex such as ferrocene or viologen.

The double strand recognition substance varies depending on the type, but is generally used at a concentration in the range of 1 ng / mL to 1 mg / mL. In this case, a buffer solution having an ionic strength in the range of 0.001 to 5 and a pH in the range of 5 to 10 can be used.

For the measurement, for example, a potential equal to or higher than the potential at which the double strand recognition substance reacts electrochemically is applied, and the reaction current value derived from the double strand recognition substance is measured. At this time, the potential may be applied at a constant speed, may be applied in pulses, or a constant potential may be applied. The current and voltage may be controlled using devices such as a potentiostat, a digital multimeter, and a function generator. Electrochemical detection can be performed by methods well known in the art. For example, the method described in JP-A-10-146183 can be used.

<Assay kit>
The present embodiment also provides an assay kit for use in the nucleic acid analysis method described above. Such an assay kit is
A tag sequence having a different sequence for each specimen, wherein the tag sequence is designed to loop out when hybridized to a template sequence in a template nucleic acid for each specimen; A primer set comprising a second primer and a second primer used in pairs; and a substrate comprising a substrate, enzyme, buffer, etc. for carrying out an amplification reaction, and a target comprising the tag sequence immobilized on the substrate A DNA chip comprising a nucleic acid probe complementary to the sequence;
What is necessary is just to comprise.

At this time, the nucleic acid probe may be a nucleic acid probe complementary to a target sequence including a tag sequence and at least a part of a sequence derived from a template sequence in a specimen.

The assay kit is
A primer set, a substrate for performing an amplification reaction, a reagent such as an enzyme or a buffer, and a DNA chip may be included.

The primer set may include a first primer and a second primer used as a pair with the first primer. The first primer includes a tag sequence having different types of sequences corresponding to the plurality of partial nucleic acid sequences. The tag sequence is designed to loop out when the first primer hybridizes to the template nucleic acid.

The DNA chip includes a substrate and a nucleic acid probe immobilized on the substrate. The nucleic acid probe includes a sequence that is complementary to the target sequence. The target sequence includes a tag sequence and at least a part of the sequence derived from the template sequence.

A plurality of primers and nucleic acid probes may be provided to correspond to a plurality of partial nucleic acid sequences corresponding to different samples in order to simultaneously amplify and detect a plurality of samples.

Also, the first primer included in the assay kit contains at least one kind and amount of primer necessary for use in one analysis. When n samples are analyzed simultaneously, n types of first primers are used. When different types of first primers are compared in terms of sequence, the sequences may be identical except for the tag sequence.

The second primer included in the assay kit contains an amount of primer necessary for use in at least one analysis. In addition to the first primer, the second primer may include a tag sequence. In that case, the second primer may comprise the type and amount of primer necessary for use in at least one analysis. When n samples are analyzed simultaneously, n types of second primers are used. When different types of second primers are compared in terms of sequence, the sequences may be the same except for the tag sequence.

When the assay kit uses the PCR method, the first primer includes, for example, a tag sequence associated with at least n analytes that can contain at least a template nucleic acid, and a partial sequence of the template nucleic acid. There may be n kinds of forward primers or reverse primers including a complementary sequence (where n is an integer of 2 or more). The second primer contains the amount of primer necessary for use in at least one analysis. Such a second primer may be at least one reverse primer or forward primer used in pairs with the first primer. If the first primer is a forward primer, the second primer is a reverse primer, and if the first primer is a reverse primer, the second primer may be a forward primer.

An assay kit for analytical methods utilizing the LAMP method is also provided. When the F3 region, F2 region, LF region, and F1 region are designed from the 5 ′ end side of the template sequence, and the B3c region, B2c region, LBc region, and B1c region are designed from the 3 ′ end side, the following 1 to 9 A primer set selected from at least one selected from the group consisting of:
1. FIP primer having a sequence complementary to F1 on the 5 ′ end side, the same sequence as F2 on the 3 ′ end side, and a tag sequence different from each other corresponding to a plurality of specimens inserted into the F2 sequence (ie, A first primer), and a BIP primer having the same sequence as B1c on the 5 ′ end side and a sequence complementary to B2c on the 3 ′ end side (ie, the second primer);
2. FIP primer having a sequence complementary to F1 on the 5 ′ end side and having the same sequence as F2 on the 3 ′ end side (ie, second primer), and 3 ′ end having the same sequence as B1c on the 5 ′ end side A BIP primer having a sequence complementary to B2c on the side and having a different tag sequence inserted into the B2c sequence corresponding to a plurality of specimens (ie, a first primer);
3. FIP primer having a sequence complementary to F1 on the 5 ′ end side, the same sequence as F2 on the 3 ′ end side, and a tag sequence different from each other corresponding to a plurality of specimens inserted into the F2 sequence (ie, The first primer), and a tag sequence that has the same sequence as B1c on the 5 ′ end side and a complementary sequence to B2c on the 3 ′ end side, and that is different from each other corresponding to a plurality of specimens, is inserted into the B2c sequence. A modified BIP primer (ie, a second primer);
4). FIP primer having a sequence complementary to F1 on the 5 ′ end side, the same sequence as F2 on the 3 ′ end side, and a tag sequence different from each other corresponding to a plurality of specimens inserted into the F2 sequence (ie, First primer) BIP primer having the same sequence as B1c on the 5 ′ end side and a sequence complementary to B2c on the 3 ′ end side (ie, the second primer), F3 primer having the same sequence as the F3 region (Third primer), and B3 primer (fourth primer) having a sequence complementary to the B3c region;
5. FIP primer having a sequence complementary to F1 on the 5 ′ end side and the same sequence as F2 on the 3 ′ end side (that is, the second primer), 3 ′ end side having the same sequence as B1c on the 5 ′ end side A BIP primer having a sequence complementary to B2c and a tag sequence different from each other corresponding to a plurality of specimens inserted in the B2c sequence (ie, the first primer), and an F3 primer having the same sequence as the F3 region (Ie, a third primer), and a B3 primer having a sequence complementary to the B3c region (ie, a fourth primer);
6). FIP primer having a sequence complementary to F1 on the 5 ′ end side, the same sequence as F2 on the 3 ′ end side, and a tag sequence different from each other corresponding to a plurality of specimens inserted into the F2 sequence (ie, First primer) A tag sequence having the same sequence as B1c on the 5 ′ end side and a sequence complementary to B2c on the 3 ′ end side and different from each other corresponding to a plurality of samples is inserted into the B2c sequence. BIP primer (ie, second primer), F3 primer having the same sequence as F3 region (ie, third primer), and B3 primer having sequence complementary to B3c region (ie, fourth primer) ;
7. FIP primer having a sequence complementary to F1 on the 5 ′ end side, the same sequence as F2 on the 3 ′ end side, and a tag sequence different from each other corresponding to a plurality of specimens inserted into the F2 sequence (ie, First primer) BIP primer having the same sequence as B1c on the 5 ′ end side and a sequence complementary to B2c on the 3 ′ end side (ie, the second primer), F3 primer having the same sequence as the F3 region (Ie, the third primer), a B3 primer having a sequence complementary to the B3c region (ie, the fourth primer), an LFc primer having a sequence complementary to the LF region (ie, the fifth primer), and An LBc primer having the same sequence as the LBc region (ie, a sixth primer);
8). FIP primer having a sequence complementary to F1 on the 5 ′ end side and the same sequence as F2 on the 3 ′ end side (that is, the second primer), 3 ′ end side having the same sequence as B1c on the 5 ′ end side A BIP primer having a sequence complementary to B2c and a tag sequence different from each other corresponding to a plurality of specimens inserted in the B2c sequence (ie, the first primer), and an F3 primer having the same sequence as the F3 region (Ie, the third primer), a B3 primer having a sequence complementary to the B3c region (ie, the fourth primer), an LFc primer having a sequence complementary to the LF region (ie, the fifth primer), and An LBc primer having the same sequence as the LBc region (ie, a sixth primer);
9. FIP primer having a sequence complementary to F1 on the 5 ′ end side, the same sequence as F2 on the 3 ′ end side, and a tag sequence different from each other corresponding to a plurality of specimens inserted into the F2 sequence (ie, First primer) A tag sequence having the same sequence as B1c on the 5 ′ end side and a sequence complementary to B2c on the 3 ′ end side and different from each other corresponding to a plurality of samples is inserted into the B2c sequence. BIP primer (ie second primer), F3 primer having the same sequence as F3 region (ie third primer), B3 primer having sequence complementary to B3c region (ie fourth primer), LFc primer having a sequence complementary to the LF region (ie, the fifth primer) and / or LBc primer having the same sequence as the LBc region (ie, the sixth primer).

Furthermore, the assay kit may include an enzyme and / or container for performing an amplification reaction, a washing solution, a buffer solution, salts for preparing a buffer solution, and the like. Further, the DNA chip may be included in a state where the nucleic acid probe and the substrate are not integrated.

Such an assay kit makes it possible to analyze nucleic acids more easily.

<Distemper virus and parvovirus>
Using this detection method for multiple specimens, it is possible to detect distemper virus and parvovirus simultaneously. Template nucleic acids selected for detection are shown in Table 1 for distemper virus and Table 2 for parvovirus.

<Primer design>
Primers for LAMP amplification were designed based on the respective template nucleic acids from distemper virus and parvovirus. The F1 region, F2 region, F3 region, B1 region, B2 region and B3 region were determined for distemper virus and parvovirus, respectively. These regions are shown in Table 3-1, Table 3-2 and Table 3-3. Sequence numbers 1 to 15 in the table are sequences for distemper virus, and sequence numbers 16 to 46 are sequences for parvovirus. The sequences of “F1 region”, “F2 region”, “F3 region”, “B1 region”, “B2 region” and “B3 region” are “F1 sequence”, “F2 sequence”, “F3 sequence”, “ These are referred to as “B1 sequence”, “B2 sequence” and “B3 sequence”.

<Primer sequence for distemper virus>
Primers for specifically LAMP amplification of the distemper virus were designed based on the F1, F2, F3, B1, B2, and B3 regions for the distemper virus. Examples of primers are shown in Table 4-1 and Table 4-2.

An example of a primer containing a tag sequence is shown at the bottom of Table 4-2. This sequence is an example in which the tag sequence CTG is inserted at the 9th base from the 3 'end of the primer name Di FIP-2-3 of SEQ ID NO: 58 in Table 4-1. The tag sequence is underlined. In the case of producing a tagging primer, a desired tag sequence may be included at a desired position in the same manner.

Table 5 shows examples of preferable combinations when these primers are used as a primer set.

<Primer sequence for parvovirus>
Primers for parvovirus specific LAMP amplification were designed based on the F1, F2, F3, B1, B2, and B3 regions for parvovirus. Were determined. These regions are shown in Table 6-1, Table 6-2, and Table 6-3.

When these primers are used as a primer set, for example, the combinations shown in Table 7 may be used.

<Primer>
In the example of the primer for distemper virus, it may be a sequence containing each polynucleotide represented by SEQ ID NO: 47 to SEQ ID NO: 75, or a sequence consisting of each polynucleotide. Further, it may be a sequence containing each polynucleotide represented by a complementary sequence of SEQ ID NO: 47 to SEQ ID NO: 75, or a sequence consisting of each polynucleotide. Each polynucleotide represented by SEQ ID NO: 47 to SEQ ID NO: 75 or a complementary sequence thereof has 1 to 5, preferably 1 to several nucleotides at any position thereof substituted, deleted and / or inserted. You may have. In addition, 1 to 5, preferably 1 to several nucleotides at any position of each polynucleotide represented by SEQ ID NO: 47 to SEQ ID NO: 75 or its complementary sequence are mixed nucleotides or universal nucleotides. Also good.

In the example of the primer for parvovirus, it may be a sequence containing each polynucleotide represented by SEQ ID NO: 77 to 115 or a sequence consisting of each polynucleotide. Further, it may be a sequence including each polynucleotide represented by a complementary sequence of SEQ ID NO: 77 to SEQ ID NO: 115 or a sequence comprising each polynucleotide. Each of the polynucleotides represented by SEQ ID NO: 77 to SEQ ID NO: 115 or its complementary sequence has 1 to 5, preferably 1 to several nucleotides at any position substituted, deleted and / or inserted. You may have. In addition, 1 to 5, preferably 1 to several nucleotides at any position of each polynucleotide represented by SEQ ID NO: 47 to SEQ ID NO: 75 or its complementary sequence are mixed nucleotides or universal nucleotides. Also good.

Here, examples of universal nucleotides include, but are not limited to, deoxyinosine (dI), 3-nitropyrrole (Nitropyrole), 5-nitroindole (Nitroindole), and deoxyribol from Gren Research. Lanosyl (deoxyribofuranosyl; dP), deoxy-5′-dimethoxytrityl-D-ribofuranosyl (deoxy-5′-dimethyloxytrityl-D-ribofuranosyl; dK).

“Mixed base” refers to a nucleic acid probe set that uses a mixture of two or more of the primers designed as “adenine”, “thymine”, “cytosine”, and “guanine” for the base at the desired location to be the mixed base. Say. Moreover, you may design so that it may substitute with the modified base which can be paired with respect to multiple types of bases.

Further, here, a sequence of 1 to 100 nucleotides, preferably about 2 to 30 nucleotides (for example, a sequence used as a spacer) is included as a further sequence between the respective sequences of the primer or at the end thereof. Also good. However, these additional sequences are preferably not included at the 3 ′ end of the primer containing the tag sequence.

<Primer set>
Examples of primer sets for distemper virus are shown in Table 5. Preferred examples are primer sets 8, 9, 11, 12 and 14, more preferred examples are primer sets 9, 12 and 14, and a more preferred example is primer set 9.

Table 7 shows examples of primer sets for parvovirus. Preferred examples are primer sets 1, 3, 4, 6, 7, 9, 10, 12, 13, 14, 15, 16, 19, 20, 25, 26, 27, 28, and more preferred examples are primer sets. Set 1, 4, 6, 7, 9, 10, 13, 15, 16, 19, 25, 26, 27, 28, more preferable examples are primer sets 19, 25, and 26, and more preferable examples are primers. Set 19. Here, it is shown that the FIP primers of primer sets 2 and 5 in Table 5 and the LPb primer of primer set 14 are mixed bases.

<Probe>
The probe sequence may be a sequence derived from an amplification product including a tag sequence for hybridization and detection. An example of a probe set for simultaneously detecting canine distemper virus and canine parvovirus is shown in Table 8, but is not limited thereto.

[Example 1]
1. Primer screening of canine distemper virus and canine parvovirus LAMP primers that specifically amplify canine distemper virus and canine parvovirus were designed and amplified. Regarding the primers used, Table 4-1 and Table 4-2 are LAMP primer sequences of canine distemper virus, Table 5 is a primer set, Table 6-1, Table 6-2 and Table 6-3 are Tables 7 are dogs Parvovirus LAMP primer sequences and primer sets are shown.

For the template nucleic acid, plasmids obtained by artificial synthesis of the NP (Nucleocapsid) gene sequence of canine distemper virus shown in Table 1 and the VP2 gene sequence of canine parvovirus shown in Table 2 were used, and the concentration was 1000 copies / reaction solution. went.

LAMP amplification was performed with the composition shown in Table 9, and the nucleic acid was amplified at 63 ° C. for 90 minutes. In the template negative control, sterilized water was used instead of the template nucleic acid.

The rise time of amplification was determined by detecting the white turbidity of pyrophosphoric acid produced in the amplification reaction and magnesium in the solution using a Loopamp real-time turbidity measuring device. Each experiment was performed twice.

FIG. 13 shows the results of amplification of canine distemper virus. In primer set 9, the turbidity rise time was the fastest. The next fastest turbidity rise time was primer sets 12 and 14, followed by primer sets 8 and 11. Primer set 9 was used in the following experiment. It was considered that the primer set 9 is preferable from the viewpoint that there are few mutations in the primer region. In the negative control, no rise in turbidity was observed in any primer set.

FIG. 14 shows the results of amplification of canine parvovirus. In primer set 19, the turbidity rise time was the fastest. Primer sets 25 and 26 were also very close to primer set 19 in turbidity rise time. Next, the turbidity rise time is the fastest for primer sets 1, 4, 6, 7, 9, 10, 13, 15, 16, 27, 28, followed by primer sets 3, 12, 14, 20 . Primer set 19 was used in the following experiment. It was considered that the primer set 19 is preferable from the viewpoint that there are few mutations in the primer region. In the negative control, no rise in turbidity was observed in any primer set.

[Example 2]
Examination of tag insertion position and tag base number Using the canine distemper virus primer set 9 and canine parvovirus primer set 19 determined in Example 1, the tag insertion position and tag base number were examined. As shown in FIG. 15, the tag insertion position is examined at the 3rd, 6th, 9th, 12th and 15th bases from the 3 ′ end of the FIP primer. Was performed with 3 bases, 5 bases, 7 bases and 9 bases, and 2 types of tag bases were designed.

The template concentrations were 1000 copy / reaction solution, 100 copy / reaction solution, and 10 copy / reaction solution. The amplification rise time was measured with a Loopamp real-time turbidity measuring apparatus in the same manner as in Example 1.

The results of canine distemper virus are shown in FIG. In the case of the third base from the 3 'end, amplification was not observed in all cases of the tag base number. In the case of the sixth base from the 3 'end, amplification was observed in the case of the tag base number of 3 bases and 5 bases. In the case of the 9th base, the 12th base, and the 15th base from the 3 'end, amplification was observed when the number of tag bases was 3, 5 and 7 bases. On the other hand, in the case of 9 bases, the amplification rise time was slow or no amplification was observed.

Similarly, the results of canine parvovirus are shown in FIG. In the case of the third base from the 3 'end, amplification was not observed in all cases of the tag base number. In the case of the sixth base from the 3 'end, amplification was observed in the case of the tag base number of 3 bases and 5 bases. In the case of the 9th base, the 12th base, and the 15th base from the 3 'end, amplification was observed when the number of tag bases was 3, 5 and 7 bases. On the other hand, in the case of 9 bases, the amplification rise time was slow or no amplification was observed.

From the above, it was suggested that the tag insertion position is superior to the 6 'base from the 3' end to the 5 'end, and the number of tag bases is 3 to 7 bases.

[Example 3]
Chip detection of 12 kinds of tag-introduced amplification products Twelve kinds of primers having a 3-base tag inserted at the 9th base from the 3 ′ end side of the FIP primer were designed and amplified. The 12 types of tags are: GAC, 2. CTG, 3. GGA, 4. CCT, 5. AGG, 6. TCC, 7. ATC, 8. TAG, 9. ACA, 10. TGT, 11. CAA, 12. GTT was used so that the sequences differed by 2 or more bases. Here, the number attached to the front of the tag sequence is a tag recognition number for convenience.

For 12 types of amplification products, probes for detecting each tag were immobilized on a substrate and chip detection was performed. The probe sequences used are shown in Table 8. The underlined part in the sequence of Table 8 is the tag sequence. The probe sequence is a sequence opposite to the tag sequence introduced into the primer. Chip detection was performed by an electrochemical method.

FIG. 18A, FIG. 18B and FIG. 18C show the results of chip detection of distemper virus. 1. Products that introduced GAC are 6. A non-specific signal was seen from the TCC detection probe. 2. The product which introduced CTG is 5. A non-specific signal was seen from the AGG detection probe. Conversely, 5. The product which introduced AGG is 2. A non-specific signal was seen from the CTG detection probe. 8). TAG, 9. ACA, 10. TGT, 11. CAA, 12. For GTT, the signal of the probe specifically detecting each was low. From this, 2. CTG, 3. GGA, 4. CCT, 6. TCC, 7. A combination of ATCs was suggested to be more preferred. FIG. 19 shows the result of detection on one chip using these five tags. As a result, it was confirmed that good characteristics were exhibited.

The same trend is seen for parvovirus. CTG, 3. GGA, 4. CCT, 6. TCC, 7. In the combination of ATC, no non-specific signal was observed, and the specific signal was also high and good results.

[Example 4]
1. Inhibition of hybridization by residual primer present in negative amplification product Good tag combination obtained in Example 3 at the 12th and 15th bases from the 3 ′ end side CTG, 3. GGA, 4. CCT, 6. TCC, 7. Primers with ATC inserted were designed and chip detection was performed in the same manner. As a result, as shown in FIG. 20, in the case of the 15th base from the 3 ′ end side, a sufficient signal was obtained when each positive amplification product was detected alone. In contrast, when four negative amplification products were mixed with one positive amplification product, a decrease in specific signal and an increase in non-specific signal were observed. As shown in FIG. 21, this decrease in the specific signal is due to the fact that the unreacted residual primer not used for amplification present in the negative amplification product is 2. 1. CTG amplification product and It was thought that this was caused by inhibition of hybridization of the CTG detection probe. The increase in the non-specific signal was also considered to be caused by the fact that each of the unreacted remaining primers had reacted with the probe.

For the 12th and 9th bases from the 3 'end, the signal did not change even when negative amplification products were mixed. From this, it was shown that it is preferable to design the tag insertion position on the 3 'end side from the 12th base from the 3' end in order to avoid the adverse effect of the remaining primer.

Combined with the results of the amplification characteristics of Example 2, it was considered that the tag insertion position was better at the 6th to 12th bases from the 3 'end.

[Example 5]
Further examination of good tag combinations In Example 3, a good tag combination was found, but in order to further increase the number of simultaneously detectable samples, 13. GCG, 14. CGC (sequences different from each other by 5 bases or more from the 5 tags extracted in Example 3), 8 kinds of tag sequences as 5 base tags, and 15. CCTCT, 16. CTCTG, 17. AGTGG, 18. TGACC, 19. GTGCA, 20. GACGT, 21. GCAAG, 22. ACGTC (different from each other by 4 bases or more) was designed and chip detection was performed. These tags were introduced at the 9th base from the 3 ′ end of the FIP primer in the same manner as in Example 3.

As a result, as shown in FIG. 22A and FIG. 22B, 2. 16. When a CTG amplification product is detected CTCTG, 17. AGTGG, 21. The GCAAG detection probe showed a high nonspecific signal. In addition, 6. 18. When a TCC amplification product is detected The TGACC detection probe showed a high non-specific signal. Other newly studied GCG, 14. CGC, 15. CCTCT, 19. GTGCA, 20. GACGT, 22. As for ACGTC, as shown in FIG. 22 and FIG. As a result, 2. CTG, 3. GGA, 4. CCT, 6. TCC, 7. ATC, 13. GCG, 14. CGC, 15. CCTCT, 19. GTGCA, 20. GACGT, 22. It was demonstrated that 11 specimens can be detected simultaneously by using 11 kinds of tags of ACGTC.

[Example 6]
1. Detection of canine distemper virus and canine parvovirus multi-amplified products Among the 11 tags selected in Examples 3 and 5, they showed particularly good properties. CTG, 3. GGA, 4. CCT, 14. CGC, 19. GTGCA was used for detecting the distemper bar. Parvo was similarly examined. As a result, CTG, 3. GGA, 4. CCT, 6. TCC, 14. CGC, 19. GTGCA was better.

Therefore, distemper 2. CTG-inserted FIP primer, Parvo 2. 2. Dispense the CTG-inserted FIP primer and tube 2 amplification reagent. 2. GGA-inserted FIP primer, parvo 3. Dispense the GGA-inserted FIP primer and tube 3 amplification reagent. CCT-inserted FIP primer, parvo 4. CCT inserted FIP primer, tube 4 amplification reagent and distempered 14. CGC-inserted FIP primer, parvo 6. TCC inserted FIP primer, tube 5 amplification reagent, distempered 22. ACGTC-inserted FIP primer, parvo 19. Each of the GTGCA-inserted FIP primers was mixed. A nucleic acid extracted from a pup fecal sample was used as a sample, and RT-LAMP was applied in a reaction solution having the composition shown in Table 10.

Sample 1 was placed in tube 1, sample 2 was placed in tube 2, sample 3 was placed in tube 3, sample 4 was placed in tube 4, sample 5 was placed in tube 5, and amplification was performed. As shown in FIG. 24, the results of chip detection are as follows: real sample 1 is distemper negative, parvo positive, real sample 2, 3 is distemper negative, parvo negative, real sample 4 is distemper positive, parvo negative, real sample 5 is distemper positive Was positive for parvo. These results were consistent with the results of the antigen-antibody reaction.

[Composition of amplification reaction solution]
The composition shown in Table 9 can be used for LAMP amplification. This composition is an example of a composition for use in amplification of, for example, a synthesized plasmid. When amplification is performed on a virus, for example, the composition shown in Table 10 may be used.

1 ... Substrate, 2 ... Fixed area, 11 ... Substrate, 12 ... Electrode, 13 ... Pat

Claims (15)

1. A method for analyzing a partial nucleic acid sequence on a sample nucleic acid contained in each of a plurality of samples,
   (A) A plurality of first primers each including a tag sequence having a different sequence corresponding to each of the plurality of specimens, and a second primer used in a pair with the first primer, Preparing a plurality of primer sets including:
   here,
   The first primer included in each of the plurality of primer sets has a tag sequence different from each other;
   The tag sequence is inserted at any position from the 6th base to the 12th base from the 3 ′ end side of the first primer, the tag base length is 3 to 7 bases, and the first primer is Designed to loop out the tag sequence when hybridized to a template;
   (B) amplifying each of the plurality of specimens using the corresponding primer set in a reaction field independent from each other to obtain an amplification product each containing the tag sequence;
   (C) mixing each amplification product from a plurality of specimens obtained in (b);
   (D) reacting a mixture of the amplification products obtained in (c) with a plurality of types of nucleic acid probes immobilized on a substrate, wherein each of the plurality of types of nucleic acid probes includes A target sequence consisting of a tag sequence and a sequence derived from a template sequence containing the partial nucleic acid sequence or a complementary sequence thereof;
   (E) determining the presence / absence and / or amount of hybridization produced in (d), and analyzing the partial nucleic acid sequences on the plurality of sample nucleic acids from the obtained results;
   A method comprising:
2. A method for analyzing a plurality of partial nucleic acid sequences contained on one or more sample nucleic acids in a sample,
   (A) a first primer including tag sequences each having a different sequence corresponding to each of the plurality of partial nucleic acid sequences, and a second primer used in pairs with the first primer, Preparing a plurality of primer sets including:
   here,
   The first primer included in each of the plurality of primer sets has a tag sequence different from each other;
   The tag sequence is inserted at any position from the 6th base to the 12th base from the 3 ′ end side of the first primer, the tag base length is 3 to 7 bases, and the first primer is Designed to loop out the tag sequence when hybridized to a template;
   (B) multi-amplifying the one or more sample nucleic acids in the sample using the plurality of primer sets in one reaction field to obtain amplification products each containing the tag sequence;
   (C) reacting the amplification product obtained in (b) with a plurality of types of nucleic acid probes immobilized on a substrate;
   Here, each of the plurality of types of nucleic acid probes is a target sequence consisting of the tag sequence and a sequence derived from a template sequence including one type of sequence selected from the plurality of partial nucleic acid sequences, or a complementary sequence thereof including;
   (D) determining the presence and / or amount of hybridization occurring in (c), and analyzing the plurality of partial nucleic acid sequences from the obtained results;
   A method comprising:
3. The method according to claim 1 or 2, comprising:
   Here, when the F3 region, F2 region, LF region, F1 region is set from the 5 ′ end side of the template sequence, and the B3c region, B2c region, LBc region, B1c region is set from the 3 ′ end side, the (a) At least one primer set selected from the group consisting of the following (1) to (9);
   (1) A sequence complementary to F1 on the 5 ′ end side, the same sequence as F2 on the 3 ′ end side, and the plurality of analytes or the plurality of partial nucleic acid sequences in the same sequence as F2 A FIP primer in which a tag sequence different from each other is inserted corresponding to each specimen, and a BIP primer having the same sequence as B1c on the 5 ′ end side and a sequence complementary to B2c on the 3 ′ end side;
   (2) FIP primer having a sequence complementary to F1 on the 5 ′ end side and having the same sequence as F2 on the 3 ′ end side, and having the same sequence as B1c on the 5 ′ end side, and 3 ′ BIP having a sequence complementary to B2c on the terminal side, and a tag sequence different from each other corresponding to each sample of the plurality of samples or the plurality of partial nucleic acid sequences is inserted into the sequence complementary to B2c Primer;
   (3) A sequence complementary to F1 on the 5 ′ end side, the same sequence as F2 on the 3 ′ end side, and the plurality of specimens or the plurality of sequences in the sequence having the same sequence as F2 FIP primer in which a different tag sequence is inserted corresponding to each sample of the partial nucleic acid sequence, and the same sequence as B1c on the 5 ′ end side, and a sequence complementary to B2c on the 3 ′ end side And a BIP primer in which different tag sequences are inserted corresponding to the respective samples of the plurality of samples or the plurality of partial nucleic acid sequences in a sequence complementary to the B2c;
   (4) A sequence complementary to F1 on the 5 ′ end side, the same sequence as F2 on the 3 ′ end side, and the plurality of specimens or the plurality of partial nucleic acid sequences in the same sequence as F2 FIP primers in which different tag sequences are inserted corresponding to the respective specimens, and BIP primers having the same sequence as B1c on the 5 ′ end side and a sequence complementary to B2c on the 3 ′ end side,
   An F3 primer having the same sequence as the F3 region, and a B3 primer having a sequence complementary to the B3c region;
   (5) FIP primer having a sequence complementary to F1 on the 5 ′ end side and having the same sequence as F2 on the 3 ′ end side,
   It has the same sequence as B1c on the 5 ′ end side, a sequence complementary to B2c on the 3 ′ end side, and the plurality of specimens or the plurality of partial nucleic acid sequences in the sequence complementary to B2c. BIP primers in which different tag sequences are inserted corresponding to each specimen,
   An F3 primer having the same sequence as the F3 region, and a B3 primer having a sequence complementary to the B3c region;
   (6) A sequence complementary to F1 on the 5 ′ end side, the same sequence as F2 on the 3 ′ end side, and the plurality of specimens or the plurality of partial nucleic acid sequences in the same sequence as F2 FIP primers in which different tag sequences are inserted corresponding to the respective samples,
   It has the same sequence as B1c on the 5 ′ end side, a sequence complementary to B2c on the 3 ′ end side, and the plurality of specimens or the plurality of partial nucleic acid sequences in the sequence complementary to B2c. BIP primers in which different tag sequences are inserted corresponding to each specimen,
   An F3 primer having the same sequence as the F3 region, and a B3 primer having a sequence complementary to the B3c region;
   (7) A sequence complementary to F1 on the 5 ′ end side, the same sequence as F2 on the 3 ′ end side, and the plurality of specimens or the plurality of partial nucleic acid sequences in the same sequence as F2 FIP primers in which different tag sequences are inserted corresponding to the respective samples,
   A BIP primer having the same sequence as B1c on the 5 ′ end side and a sequence complementary to B2c on the 3 ′ end side,
   An F3 primer having the same sequence as the F3 region, and a B3 primer having a sequence complementary to the B3c region, and an LFc primer having a sequence complementary to the LF region, and / or an LBc primer having the same sequence as the LBc region;
   (8) FIP primer having a sequence complementary to F1 on the 5 ′ end side and the same sequence as F2 on the 3 ′ end side,
   It has the same sequence as B1c on the 5 ′ end side, a sequence complementary to B2c on the 3 ′ end side, and the plurality of specimens or the plurality of partial nucleic acid sequences in the sequence complementary to B2c. BIP primers in which different tag sequences are inserted corresponding to each specimen,
   An F3 primer having the same sequence as the F3 region, and a B3 primer having a sequence complementary to the B3c region, and an LFc primer having a sequence complementary to the LF region, and / or an LBc primer having the same sequence as the LBc region;
   (9) A sequence complementary to F1 on the 5 ′ end side, the same sequence as F2 on the 3 ′ end side, and the plurality of specimens or the plurality of partial nucleic acid sequences in the same sequence as F2 FIP primers inserted with different tag sequences corresponding to the respective specimens of
   It has the same sequence as B1c on the 5 ′ end side, a sequence complementary to B2c on the 3 ′ end side, and the plurality of specimens or the plurality of partial nucleic acid sequences in the sequence complementary to B2c. BIP primers with different tag sequences inserted corresponding to each specimen,
   An F3 primer having the same sequence as the F3 region, and a B3 primer having a sequence complementary to the B3c region, and an LFc primer having a sequence complementary to the LF region, and / or an LBc primer having the same sequence as the LBc region;
   Also, here, the method in which the amplification in (b) is the LAMP method or the RT-LAMP method.
4. 4. The tag sequence according to claim 1, wherein the tag sequence is selected from two or more groups selected from the group consisting of CTG, GGA, CCT, TCC, ATC, GCG, CGC, CCTCT, GTGCA, GACGT, ACGTC and their complementary sequences. The method described in 1.
5. The partial nucleic acid sequence or one of the plurality of partial nucleic acid sequences is a sequence derived from canine distemper virus. 5. The method according to claim 3, wherein the method is GTGGAATCCCCCTGGACAG, the B3 primer is CAATATCCTTATTTCCCAACCA, and the LBc primer is TGGATTCTGAGGCAGATGAGGT.
6. The tag sequence is CTG, GGA, CCT, CGC and GTGCA, and the sequence of the nucleic acid probe is
   CATCAGGGTCGTCTCATCAGGAT,
   CATCAGGGTCGTCCTATTCCGAT,
   CATCAGGGTCGTCTATAGGGATC,
   TCAGGGTCTCTCTGGCGG and CATCAGGGTCGTCTTTGCACG
   The method of claim 5, wherein
7. The partial nucleic acid sequence or one of the plurality of partial nucleic acid sequences is a sequence derived from a canine parvovirus. 5. The method according to claim 3, wherein is GAGAATTATTTTTCAATGGGATAGAAC, the B3 primer is CAATGCTCTATTTTGTTCCATGG, and the LBc primer is ACAGGTGATGAATTTGCTACAGG.
8. The tag sequence is CTG, GGA, CCT, TCC and GTGCA, and the nucleic acid probe is
   GGTGTGCCACTAGTCAGTC,
   GGTGTGCCACTAGTTCCTC,
   GGTGTGCCACTAGTAGGTCC,
   GGTGTGCCACTAGTGGATCC and GGTGTGCCACTAGTGGCACTCC
   The method of claim 7, wherein
9. One of the plurality of partial nucleic acid sequences is a sequence derived from canine distemper virus. The primer is CAATATCCTTTATTCCCAACCA, and the LBc primer is TGGATTCTGAGGCAGATGAGGT;
   A further one of the plurality of partial nucleic acid sequences is a sequence derived from a canine parvovirus. , The B3 primer is CAATGCTCTATTTTGTGCCATG, the LBc primer is ACAGGTGATGAATTTGCTACAGGG,
   The primer set for the canine distemper virus and the primer set for the canine parvovirus are mixed in the same tube, and nucleic acids derived from both viruses are amplified simultaneously. The method according to item.
10. A primer set for specifically amplifying canine distemper virus, wherein the primer set includes an FIP primer, a BIP primer, an F3 primer, and a B3 primer, the FIP primer includes CAGAGTGTGATGCTTGGGATTAC-TGATCCAGAGGATCATAGACGAC, and the BIP primer includes ACATTTGCCATCAGGAG A primer set comprising GAGCTTTCGACCCTTCGTCTAC, wherein the F3 primer comprises GTGGAATCCCCCTGGACAG, and the B3 primer comprises CAATATCCTTATTCTCCAACCA.
11. The primer set according to claim 10, further comprising an LBc primer containing TGGATTCTGAGGCAGATGAGGT as a loop primer.
12. A primer set for specifically amplifying canine parvovirus, wherein the primer set includes an FIP primer, a BIP primer, an F3 primer, and a B3 primer, the FIP primer includes GAACATCATCTGGATCTGTACTCA-ACCCATCTCATACTGAGAACTAGTGGC, and the BIP primer includes CTGTGCCAGTACACTACTATAG -Primer set containing GTGTTAGTCTACCATGGTTTACAATC, the F3 primer containing GAGATATTATTTTCAATGGGATAGAAC, and the B3 primer containing CAATGCTCTCTTTGTTGCCATG.
13. The primer set according to claim 12, further comprising an LBc primer containing ACAGGTGATGAATTTGCTACAGG as a loop primer.
14. A primer set for specifically amplifying canine distemper, wherein the primer set includes an FIP primer, a BIP primer, an F3 primer, and a B3 primer, the FIP primer includes CAGAGTGTGATGCTTGGGATTAC-GATCCCAGGAGTCATAGACGAC, and the BIP primer includes ACATTTGCATGCAGAGAGCA GAGCTTTCCGACCCTTCGTCTAC, the F3 primer includes GTGGAATCCCCCTGGACAG, the B3 primer includes CAATATCCTTTATTCTCCAACCA, and CTG, GGA, CCT, TCC, ATC, GCG, CTC from the 6th base to the 12th base from the 3 ′ end side of the FIP primer. , CCTCT A first primer set comprising a tag sequence selected from the group consisting of GTGCA, GACGT, ACGTC and their complementary sequences;
    A primer set for specifically amplifying canine parvovirus, wherein the primer set includes an FIP primer, a BIP primer, an F3 primer, and a B3 primer, the FIP primer includes GAACATCATCTGGATCTGTACTCA-ACCCATCTCATACTGAGAACTAGTGGC, and the BIP primer includes CTGTGCCAGTACACTACTATAG -GTGTTAGTCACATGGTTTACAATC, the F3 primer contains GAGATATTATTTTCAATGGGATAGAAC, the B3 primer contains CAATGCTCCTATTTTGTTCCATCAT, CTG, GGA, CCT, 6th to 12th bases from the 3 'end of the FIP primer, A second primer set comprising a tag sequence selected from the group consisting of ATC, GCG, CGC, CCTCT, GTGCA, GACGT, ACGTC and their complementary sequences;
    An assay kit for simultaneously detecting canine distemper and canine parvovirus.
15. The first primer set further comprises an LBc primer containing TGGATTCTGAGGCAGATGAGGT as a loop primer for canine distemper, and the second primer set further comprises an LBc primer containing ACAGGTGATGATGATCTGCATAGGG as a loop primer for canine parvovirus The assay kit according to claim 14.

Images