RU2252964C2 - Method and kit for synthesis of nuclear acids having nucleotide sequence wherein complementary nucleotide sequences are alternately bonded in one chain - Google Patents

Abstract

FIELD: biotechnology, in particular pharmaceutical industry and medicine.

SUBSTANCE: method and kit for nuclear acid synthesis are disclosed. Said kit includes DNA-polymerase, catalyzing synthesis of complementary chain according to replacement mechanism, substrate therefore, two inner primer, and two oligonucleotide. Claimed method includes mixing of said kit with nuclear acid sample and mixture incubation at temperature sufficient for saving enzymatic activity of DNA-polymerase and stable coupling of sequence bases of inner primers with sequences being complementary thereto. Method of present invention makes it possible to obtain nuclear acid with nucleotide sequence wherein complementary nucleotide sequences are alternately bonded in one chain.

EFFECT: inexpensive method with increased synthesis specificity.

9 cl, 18 dwg, 8 ex

Description

The present invention relates to a method for synthesizing a nucleic acid consisting of a specific nucleotide sequence, which is applicable as a method for amplifying a nucleic acid.

BACKGROUND OF THE INVENTION

An analysis method based on the complementary nucleotide sequence of a nucleic acid can directly analyze genetic traits. Thus, this analysis is a very effective tool for identifying genetic diseases, malignancy, microorganisms, etc. Further, the gene itself is an object of detection, and therefore, time-consuming and burdensome procedures, for example cultivation procedures, may be omitted in some cases.

However, the detection of a target gene present in very small amounts in a sample is usually not easy, so amplification of the target gene itself or its detectable signal is necessary. As a method for amplifying a target gene, a PCR (polymerase chain reaction) method is known (Science, 230, 1350-1354, 1985). Currently, the PCR method is the most popular method as a method of amplification of nucleic acids in vitro. This method is well established as an excellent method of determination, due to its high efficiency based on the effect of exponential amplification. In addition, since the amplification product can be extracted as DNA, this method is widely used as an important tool for providing genetic engineering methods such as cloning and gene structure determination. However, the PCR method has the following known problems: for its use, a special temperature controller is needed; the exponential development of the amplification reaction leads to the problem of quantification, and the samples and reaction solutions are easily contaminated from the outside, which makes it possible to erroneously mix nucleic acids to function as a matrix.

As information about the genome accumulates, an analysis of single nucleotide polymorphisms (SNPs) is attracting attention. Detection of SNP by PCR is possible due to the design of the primer so that its nucleotide sequence contains SNP. That is, whether a nucleotide sequence complementary to this primer is present or not present can be determined by determining whether a reaction product is present or not. However, as soon as the complementary chain is randomly synthesized by mistake in PCR, this product functions as a matrix in the subsequent reaction, giving an erroneous result. In practice, it is believed that strict PCR monitoring is difficult when only one base is present at the end of the primer. Thus, an improvement in specificity is required for PCR applications to detect SNPs.

On the other hand, a nucleic acid synthesis method using ligase is also used in practice. The LCR method (ligase chain reaction, Laffler TG; Garrino JJ; Marshall RL; Ann. Biol. Clin. (Paris), 51: 9, 821-6, 1993) is based on a reaction in which two adjacent probes hybridize with a target sequence and are ligated to each other by a ligase. These two probes cannot be ligated in the absence of a target nucleotide sequence, and therefore, the presence of a ligated product is an indication of the presence of a target nucleotide sequence. Since the LCR method also requires temperature control to separate the complementary chain from the matrix, the same problem arises as in the PCR method. For LCR, there is also a report on a method for improving specificity by adding the step of providing a gap between adjacent probes and filling this gap with DNA polymerase. However, what can be expected in this method is only specificity, but the problem still remains that temperature control is necessary. In addition, the use of an additional enzyme leads to an increase in cost.

The method called the SDA method (amplification with the displacement (replacement) of the chain) [Proc. Natl. Acad. Sci. USA, 89, 392-396, 1992] [Nucleic Acid. Res., 20, 1691-1696, 1992], is also known as a method for amplifying a DNA having a sequence complementary to the target sequence as a template. In the SDA method, a special DNA polymerase is used to synthesize a complementary strand starting from a primer complementary to the 3'-side of a specific nucleotide sequence, with the displacement (substitution) of the double-stranded chain, if present, on the 5'-side of this sequence. In this description, the simple expression “5'-side” or “3'-side” refers to the side of the chain serving as a matrix. Since the double-stranded chain on the 5'-side is replaced by the newly synthesized complementary chain, this method is called the SDA method. The temperature change step necessary in the PCR method can be eliminated in this SDA method by preliminarily inserting a restriction enzyme recognition sequence (restrictase) into the hybridizable sequence as a primer. That is, the nickname (single chain rupture) generated by the restriction enzyme gives a 3'-OH group acting as a seed for the synthesis of the complementary chain, and the previously synthesized complementary chain is released as a single-strand chain through synthesis with chain replacement and then used again as a matrix for the subsequent synthesis of a complementary chain. Thus, the complex temperature control required in the PCR method is not required in the SDA method.

However, a restriction enzyme that generates nickname must be used in the SDA method, except for the type-displacing DNA polymerase. This requirement of an additional enzyme is the main reason for the higher cost. Further, since the restriction enzyme should not be used to cleave both strands of a double stranded nucleic acid, but to introduce a nick (i.e., cleave only one of these strands), a dNTP derivative, such as α-thio-dNTP, should be used as a substrate for synthesis to make another chain resistant to cleavage by this enzyme. Thus, the SDA amplification product has a structure different from that of a natural nucleic acid, and therefore limits restriction enzyme digestion or the use of an amplified product for gene cloning. There is also a good reason for higher costs in this regard. In addition, when using the SDA method for an unknown sequence, it is possible that the same nucleotide sequence as the restriction enzyme recognition sequence used to introduce nickname may be present in the region to be synthesized. In this case, it is possible that a complete complementary chain cannot be synthesized.

NASBA (nucleic acid sequence based amplification, also called TMA / transcription-mediated amplification method) is also known as a nucleic acid amplification method in which complex temperature control is not necessary. NASBA is a reaction system where DNA is synthesized by a DNA polymerase in the presence of a target RNA as a template with a probe having a T7 promoter added to it, and this product forms a double strand chain with a second probe, followed by transcription by T7 RNA polymerase with a double strand formed as a matrix for amplification of a large amount of RNA (Nature, 350, 91-92, 1991). NASBA requires some stages of heat denaturation until the synthesis of double-stranded DNA is complete, but the subsequent transcription reaction with T7 RNA polymerase proceeds under isothermal conditions. However, it is necessary to combine numerous enzymes such as reverse transcriptase, RNase H, DNA polymerase and T7 RNA polymerase, which adversely affects the cost, similar to SDA. Further, since it is difficult to establish conditions for the reaction of numerous enzymes, this method is hardly widespread as a general analytical method. In known nucleic acid amplification reactions, problems remain, such as complex temperature control and the need for multiple enzymes, as described above.

With respect to these known nucleic acid synthesis reactions, there are several reports of an attempt to further improve the efficiency of nucleic acid synthesis without compromising specificity or cost. For example, in a method called RCA (rolling ring amplification), it was shown that single-stranded DNA having a series of nucleotide sequences complementary to a similar “padlock” probe can be synthesized continuously in the presence of a target nucleotide sequence (Paul M. Lizardi et al. , Nature Genetics, 19, 225-232, July, 1998). RCA uses a padlock-like probe with a special structure in which each of the 5'- and 3'-ends of a single oligonucleotide make up an adjacent probe in the LCR. Then, the continuous synthesis reaction of a complementary chain with a padlock probe as a matrix, which was ligated and cyclized in the presence of a target nucleotide sequence, is initiated by combining with a polymerase that catalyzes the reaction by the type of displacement (replacement) of the synthesis chain of a complementary chain. Thus, a single-stranded nucleic acid is formed having a structure of a number of regions, each of which consists of the same nucleotide sequence. The primer is then further hybridized with this single-stranded nucleic acid to synthesize its complementary strand, and therefore a high degree of amplification is performed. However, there remains the problem of the need for multiple enzymes. Further, the start of the synthesis of a complementary chain depends on the ligation reaction of two adjacent regions, and its specificity is basically the same as in LCR.

For the purpose of providing 3'-OH, there is a known method in which a nucleotide sequence is provided at the 3'-end with a sequence complementary to it, and a loop in the form of a hairpin is formed at this end (Gene, 71, 29-40, 1988). The synthesis of a complementary strand with the target sequence itself as the template begins with a hairpin loop to form a single-stranded nucleic acid consisting of a complementary nucleotide sequence. For example, a structure in which hybridization occurs in the same strand at the end to which a complementary nucleotide sequence has been attached is obtained in PCT / FR95 / 00891. However, in this method, a stage is necessary in which this end cancels the base pairing with a complementary chain, and the base pairing occurs again in the same chain. It is estimated that this stage proceeds depending on the delicate state of equilibrium at this end of mutually complementary nucleotide sequences, including base pairing. That is, the equilibrium state maintained between the pairing of the bases with a complementary chain and the pairing of the bases in the same chain is used, and only one chain hybridizing with the nucleotide sequence in the same chain serves as a seed for the synthesis of the complementary chain. Thus, it is believed that in order to obtain a high reaction efficiency, strict reaction conditions must be established. In addition, in this previously existing method, the primer itself forms a loop structure. Thus, as soon as the primer dimer is formed, the amplification reaction is automatically initiated regardless of whether the target nucleotide sequence is present or not, and in this way a non-specific synthetic product is formed. This can be a serious problem. Further, the formation of a primer dimer and the subsequent use of this primer by a non-specific synthetic reaction leads to a decrease in the amplification efficiency of the desired reaction.

In addition, it is reported that a region that does not serve as a template for DNA polymerase was used to realize hybridization of the 3'-terminal structure with the same chain (EP713922). This message indicates the same problem as in PCT / FR95 / 00891 above regarding the use of dynamic equilibrium at this end or the possibility of a nonspecific synthetic reaction due to the formation of a dimeric primer. In addition, a special region that does not serve as a template for DNA polymerase must be prepared as a primer.

Further, in various amplification signaling reactions, for which the principle of the NASBA described here is used, an oligonucleotide having a hairpin structure at its end is often used to provide a double-stranded promoter region (JP-A5-211873 of Japan). However, these methods are not methods allowing sequential provision of 3'-OH for the synthesis of a complementary chain. In addition, a hairpin loop structure having a 3 ′ end hybridized by hybridization in the same strand is used to prepare a DNA template transcribed by RNA polymerase in JP-A 10-510161 (WO96 / 17079). In this method, the matrix is amplified using transcription in RNA and reverse transcription from RNA to DNA. However, in this method, the reaction system cannot be designed without combining multiple enzymes.

Description of the invention

An object of the present invention is to provide a method for synthesizing a nucleic acid based on a new principle. A more specific objective is to provide a method capable of performing nucleic acid synthesis depending on the sequence efficiently at low cost. That is, the purpose of this invention is to provide a method capable of synthesizing and amplifying a nucleic acid using a single enzyme even under isothermal reaction conditions. Another objective of this invention is the provision of a method for the synthesis of nucleic acids, which can give high specificity, difficult to achieve in the case of the known principles of the reactions of synthesis of nucleic acids, as well as a method of amplification of nucleic acids using the specified synthetic method.

The authors of this invention focused on the fact that the use of a polymerase that catalyzes the synthesis of a complementary strand by the type of displacement (substitution) of the strand is applicable for the synthesis of nucleic acids independent of complex temperature control. Such DNA polymerase is an enzyme used in SDA and RCA. However, even when using such an enzyme, the reaction of another enzyme is always required to provide 3'-OH as a seed for synthesis in a well-known primer-based method such as SDA.

Under these conditions, the authors of this invention investigated the provision of 3'-OH from a completely different point of view in comparison with the known approach. As a result, the authors of the present invention found that using an oligonucleotide having a special structure, 3'-OH can be provided without additional enzymatic reaction, whereby the purpose of the present invention was achieved. That is, the present invention relates to a method for synthesizing a nucleic acid, a method for amplifying a nucleic acid using the method for synthesizing a nucleic acid, and a new oligonucleotide that makes these methods possible, as follows:

1. A method of synthesizing a nucleic acid having complementary nucleotide sequences linked alternately in a single strand chain, comprising:

a) a step of providing a nucleic acid which is provided at its 3'-end with an F1 region capable of hybridizing with a portion of F1c in the same chain, and which, when hybridizing the F1 region with F1c, is capable of forming a loop containing the F2c region capable of base pairing,

b) the step of completing the synthesis of the complementary chain, where the 3'-end of F1, attached by hybridization to F1c, serves as the seed of synthesis,

c) a hybridization step with the F2c region of the oligonucleotide provided with its 3'-end, with F2 consisting of a sequence complementary to the F2c region, followed by synthesis, with the indicated oligonucleotide as a synthesis seed, a complementary strand with a polymerase that catalyzes the chain displacement (substitution) reaction synthesis of a complementary chain to displace the complementary chain synthesized in stage b), and

d) a hybridization step, with a complementary strand displaced in step c), to prepare for base pairing, a polynucleotide provided at its 3'-end with a sequence complementary to an arbitrary region in said strand synthesized in step c), followed by synthesis, s the indicated 3'-end as a seed of synthesis of a complementary strand with a polymerase catalyzing the reaction of displacing the synthesis strand of a complementary strand to displace the complementary strand synthesized in step c).

2. The method according to claim 1, where in step d) the synthesis seed is an R1 region present at the 3'-end in the same chain and capable of hybridizing with the R1c region, and a loop containing the R2c region capable of base pairing, formed by hybridization of R1 with R1c.

3. An oligonucleotide consisting of at least two regions X2 and X1c below, and X1c is connected to the 5'-side of X2,

X2: a region having a nucleotide sequence complementary to an arbitrary region X2c in a nucleic acid having a specific nucleotide sequence, and

X1c: a region having substantially the same nucleotide sequence as in the X1c region located on the 5 ′ side of the X2c region in a nucleic acid having a specific nucleotide sequence.

4. The method according to claim 1, where the nucleic acid in step a) is a second nucleic acid provided with the following steps:

i) a hybridization step with an F2c region in a nucleic acid serving as a template, an F2 region in the oligonucleotide described in claim 3, where region X2 is region F2 and region X1c is region F1c,

ii) a step for synthesizing a first nucleic acid having a nucleotide sequence complementary to the matrix, wherein F2 in this oligonucleotide serves as a seed for synthesis,

iii) a step for converting an arbitrary region in the first nucleic acid synthesized in step ii) into a region ready for base pairing, and

iv) a hybridization step of an oligonucleotide having a nucleotide sequence complementary to the region converted to a base ready for pairing in the first nucleic acid in step iii), followed by the synthesis of a second nucleic acid with the indicated oligonucleotide as a seed for synthesis and conversion of F1 to its 3 '-end to the area ready for mating.

5. The method according to claim 4, where the region capable of base pairing in step iii) is R2c, and the oligonucleotide in step iv) is the oligonucleotide described in claim 3, where region X2c is region R2c, and region X1c is the region of R1c.

6. The method according to claim 4 or 5, where the stage of giving the ability to mate the bases in stages iii) and iv) is carried out by synthesis with the displacement of the chain of the complementary chain by polymerase, which catalyzes the reaction of the displacement of the synthesis chain of the complementary chain, where the external primer hybridizes with the 3'-side F2c in the template, and an external primer hybridizing to the 3 ′ side of the region used as the synthesis seed in step iv) for the first nucleic acid, serve as the synthesis seed.

7. The method according to claim 6, where the melting temperature of each oligonucleotide and its complementary region in the matrix used in this reaction is in the following ratio with the same stiffness:

(external primer / region on the 3'-side of the matrix) ≤ (F2c / F2 and R2c / R2) ≤ (F1c / F1 and R1c / R1).

8. The method according to any one of paragraphs 4-7, wherein the nucleic acid serving as the template is RNA, and the synthesis of the complementary strand in step ii) is carried out by an enzyme having reverse transcriptase activity.

9. A method for amplification of a nucleic acid having complementary nucleotide sequences linked alternately in a single-stranded chain using the repeated steps of:

A) the stage of providing the matrix, which is provided at its 3'- and 5'-ends with a region consisting of a nucleotide sequence complementary to each end region in the same chain, and which upon hybridization of these mutually complementary nucleotide sequences forms a loop capable of pairing the grounds between them

B) stages of completing the synthesis of a complementary chain, where the 3'-end of the specified matrix, hybridizing with the same chain, serves as a seed synthesis,

C) stages of hybridization, with a loop part, of an oligonucleotide provided at its 3'-end with a complementary nucleotide sequence, with a loop which among these loops is located at the 3'-terminal site, followed by synthesis, with an oligonucleotide as a seed of synthesis, of a complementary chain a polymerase that catalyzes the displacement reaction of the synthesis chain of a complementary chain to displace the complementary chain synthesized in stage B), to obtain its 3'-end, ready for pairing, and

D) a stage in which a chain with a 3'-end made ready for pairing in C) serves as a new matrix.

10. The method according to claim 9, where the oligonucleotide in step C) is provided at its 5'-end with a nucleotide sequence complementary to the 3'-end serving as a seed for synthesis in step B).

11. The method of claim 10, further comprising a step in which a complementary strand synthesized with the oligonucleotide in step C) as a seed for synthesis is used as the matrix in step A).

12. The method according to claim 9, where the matrix in stage A) is synthesized according to the method described in paragraph 5.

13. The method according to claim 1 or 9, where the displacement reaction of the synthesis chain of the complementary chain is carried out in the presence of a melting temperature controller.

14. The method according to item 13, where the regulator of the melting temperature is betaine.

15. The method according to 14, where 0.2-3.0 M betaine may be present in the reaction solution.

16. A method for detecting a target nucleotide sequence in a sample, comprising performing the amplification method described in any of paragraphs 9-15, and observing whether the product of the amplification reaction is generated or not generated.

17. The method according to clause 16, where the probe containing the nucleotide sequence complementary to the loop is added to the product of the amplification reaction and hybridization between them is observed.

18. The method according to 17, where this probe is labeled on the particles, and observe the aggregation reaction that occurs during hybridization.

19. The method according to clause 16, where the amplification method described in any of paragraphs 9-15 is carried out in the presence of a detector for a nucleic acid, and determining whether or not the amplification reaction product is generated is observed based on a change in the detector signal.

20. The method for detecting a mutation in the target nucleotide sequence according to the determination method described in clause 16, where the mutation in the nucleotide sequence as an amplification object prevents the synthesis of any of the complementary chains involved in the amplification method.

21. A kit for the synthesis of a nucleic acid having complementary chains alternately linked to a single strand chain, containing the following elements:

i) the oligonucleotide described in claim 3, where the F2c region in the nucleic acid as the matrix is X2c, and F1c located on the 5'-side of F2c is X1c;

ii) an oligonucleotide containing a nucleotide sequence complementary to an arbitrary region in a complementary chain synthesized with the oligonucleotide in (i) as a primer;

iii) an oligonucleotide having a nucleotide sequence complementary to the F3c region located on the 3 ′ side of the F2c region in a nucleic acid serving as a template;

iv) DNA polymerase catalyzing a reaction such as displacement of a complementary strand synthesis chain; and

v) a nucleotide serving as a substrate for element iv).

22. The kit according to item 21, where the oligonucleotide in ii) is the oligonucleotide described in claim 3, where an arbitrary region of R2c in the complementary chain synthesized with the oligonucleotide in 1) as a synthesis seed is X2c, and R1c located at 5 'R2c, is X1c.

23. The kit of claim 22, further comprising: vi) an oligonucleotide having a nucleotide sequence complementary to the R3c region located on the 3'-side of an arbitrary R2c in the complementary chain synthesized with the oligonucleotide in i) as a synthesis seed.

24. A kit for detecting a target nucleotide sequence, comprising a detector for determining a product of a synthetic nucleic acid reaction further in the kit described in any one of paragraphs 21-23.

A nucleic acid having complementary nucleotide sequences linked alternately in a single strand chain as an object of synthesis in this invention means a nucleic acid having mutually complementary nucleotide sequences directly linked in a single strand. In addition, in the present invention, it must contain a nucleotide sequence for looping between these complementary chains. In the present invention, this sequence is called a loop forming sequence. The nucleic acid synthesized according to this invention consists essentially of mutually complementary chains linked through a loop-forming sequence. Typically, a chain that does not separate into 2 or more molecules upon dissociation of base pairing is called a single-stranded chain, regardless of whether it includes base pairing or not. A complementary nucleotide sequence can form base pairs in the same strand. An intramolecular product with paired bases, which can be obtained by allowing the nucleic acid to have complementary nucleotide sequences linked alternately in a single strand chain in accordance with this invention, to have paired bases in the same chain, gives an area consisting of, obviously, a double strand chain and a baseless loop.

That is, a nucleic acid having complementary nucleotide sequences linked alternately in a single strand chain according to this invention contains complementary nucleotide sequences capable of hybridizing in the same chain, and its hybridized product can be determined as a single stranded nucleic acid consisting of a loop, not containing mating bases in a curved, articulated part. An oligonucleotide having a nucleotide sequence complementary to this part can hybridize to this baseless loop. The loop forming sequence may be an arbitrary nucleotide sequence. The loop-forming sequence is capable of base pairing in such a way as to initiate the synthesis of a complementary molecule for displacement, and is preferably provided with a sequence different from the nucleotide sequence located in another region to obtain specific hybridization. For example, in a preferred embodiment, the loop forming sequence contains the same nucleotide sequence as the F2c region (or R2c) located on the 3'-side of the region (i.e., F1c or R1c) originating from the nucleic acid as a template, and annealed (hybridized) in the same chain.

In the present invention, essentially the same nucleotide sequence is defined as follows. Namely, when a complementary strand synthesized with a specific sequence as a template hybridizes to a target nucleotide sequence to seed a synthesis of a complementary strand, that particular sequence is essentially the same as the target nucleotide sequence. For example, the term “essentially the same sequence as F2” includes not only the exact same nucleotide sequence as F2, but also a nucleotide sequence capable of functioning as a matrix giving a nucleotide sequence capable of hybridizing with F2 and act as a primer for complementary chain synthesis. The term “hybridize” in this invention means the formation of a double-stranded nucleic acid structure through base pairing based on the Watson-Crick law. Thus, even if the nucleic acid chain having base pairing is a single-stranded chain, hybridization occurs if the intramolecular complementary nucleotide sequences are paired bases. In the present invention, annealing and hybridization have the same meaning that the nucleic acid forms a double-stranded structure by base pairing.

The number of pairs of complementary nucleotide sequences constituting a nucleic acid in accordance with this invention is at least 1. According to a preferred embodiment of the invention, it may be 2 or more. In this case, theoretically there is no upper limit on the number of pairs of complementary nucleotide sequences constituting this nucleic acid. When this nucleic acid as a synthetic product of the present invention is composed of multiple sets of complementary nucleotide sequences, this nucleic acid is composed of repeat nucleotide sequences.

A nucleic acid having complementary nucleotide sequences linked alternately in a single strand chain synthesized by this invention may not have the same structure as naturally occurring nucleic acid has. It is known that if a nucleotide derivative is used as a substrate when a nucleic acid is synthesized by DNA polymerase, a nucleic acid derivative can be synthesized. A nucleic acid derivative used includes nucleotides labeled with a radioactive isotope or nucleotide derivatives labeled with a binding ligand, for example, biotin or digoxin. These nucleotide derivatives can be used to label derivatives of nucleic acids as a product. Alternatively, if fluorescent nucleotides are used as a substrate, the nucleic acid as a product may be a fluorescent derivative. Further, this product may be either DNA or RNA. Which product is formed from them is determined by the combination of the structure of the primer, such as a substrate for polymerization and polymerization reagents for polymerization of a nucleic acid.

The synthesis of a nucleic acid having the structure described above may be initiated by the use of DNA polymerase having chain displacement activity and nucleic acid, which is provided at its 3'-end with an F1 region capable of hybridizing with a portion of F1c in the same chain, and which, when hybridizing the F1 region with F1c, is capable of forming a loop containing the F2c region capable of base pairing. There are numerous reports of the synthesis reaction of a complementary chain in which a loop in the form of a hairpin forms, and the sample sequence itself is used as a matrix, whereas in this invention a part of the hairpin loop is provided with a region capable of pairing bases, and therefore there is a new a feature consisting in the use of this region in the synthesis of a complementary chain. By using this region as a synthesis seed, the complementary chain synthesized previously with the sequence of the sample in the form of a matrix is displaced. Then, the region R1c (an arbitrary region) located at the 3'-end of the extruded chain is in a state ready for pairing. A region having a complementary sequence to this R1c hybridizes with it, resulting in the formation of a nucleic acid (2 molecules) having a nucleotide sequence extending from F1 to R1c and its complementary chain linked alternately through a looping sequence. In this invention, an arbitrary region, such as R1c described above, can be selected arbitrarily, provided that it can be hybridized with a polynucleotide having a nucleotide sequence complementary to this region, and that the complementary chain synthesized with this polynucleotide as a seed of synthesis has the necessary functions for this invention.

The term “nucleic acid” is used in this invention. The nucleic acid in this invention typically includes both DNA and RNA. However, a nucleic acid whose nucleotide is replaced by an artificial derivative or a modified nucleic acid derived from natural DNA or RNA is also included in the nucleic acid term of the present invention while it functions as a template for the synthesis of a complementary strand. The nucleic acid of the present invention is usually contained in a biological sample. A biological sample includes animals, plant or microbial tissues, cells, cultures and excretions, or extracts thereof. A biological sample of the invention includes genomic DNA or RNA of intracellular parasites, such as a virus or mycoplasma. The nucleic acid of the present invention may be derived from a nucleic acid contained in said biological sample. For example, cDNA synthesized from mRNA, or a nucleic acid amplified based on a nucleic acid derived from a biological sample, is a typical example of a nucleic acid of the present invention.

The nucleic acid characteristic of the present invention, which is provided at its 3'-end of the F1 region, capable of hybridizing with a portion of F1c in the same chain, and which, when hybridizing the F1 region with F1c, is capable of forming a loop containing the F2c region capable of base pairing can be obtained in various ways. In a most preferred embodiment, a complementary strand synthesis reaction using an oligonucleotide having the following structure can be used to produce this structure.

That is, the oligonucleotide useful in this invention consists of at least two regions X2 and X1c described below, where X1c is ligated to the 5 ′ side of X2.

X2: a region having a nucleotide sequence complementary to region X2c in a nucleic acid having a specific nucleotide sequence.

X1c: a region having substantially the same nucleotide sequence as the X1c region located on the 5 ′ side of the X2c region in a nucleic acid having a specific nucleotide sequence.

Herein, a nucleic acid having a specific nucleotide sequence, which determines the structure of the oligonucleotide of the present invention, is called a nucleic acid serving as a template when using the oligonucleotide of the present invention as a primer. In the case of detecting a nucleic acid based on the synthetic method of the present invention, a nucleic acid having a specific nucleotide sequence is a determination target or a nucleic acid originating from this determination target. A nucleic acid having a specific nucleotide sequence is called a nucleic acid in which at least a portion of the nucleotide sequence is detectable or predictable. Part of the detected nucleotide sequence is the X2c region and the X1c region located on its 5'-side. It can be assumed that these 2 regions are adjacent or localized separately from each other. The relative positional ratio of these two regions determines the state of the loop formed upon self-hybridization of the nucleic acid as a product. The distance between these two regions is preferably not very far from each other, so that the nucleic acid as a product undergoes self-hybridization, prevailing over intermolecular hybridization. Thus, the positional relationship between these two regions is preferably such that they are adjacent when the interval between them is usually 0-100 bases. However, in looping through self-hybridization described below, there may be a case where it would be unprofitable for looping that these two regions are too close to each other. In this loop, there is a need for a structure for hybridization of a new oligonucleotide and for easy initiation of the displacement reaction of the synthesis chain of a complementary chain with the indicated oligonucleotide as a seed of synthesis. More preferably, the distance between region X2c and region X1c located on the 5'-side of X2c is 0-100 bases, more preferably 10-70 bases. This numerical value shows the length except for the lengths X1c and X2. The number of bases making up the loop is equal to this length plus the length of the region corresponding to X2.

Both the term “identical” and the term “complementary”, used to characterize the nucleotide sequence constituting the oligonucleotide based on the present invention, do not mean “absolutely identical” or “absolutely complementary”. That is, the expression “identical sequence as a specific sequence” includes sequences complementary to nucleotide sequences capable of hybridizing with a specific sequence. On the other hand, a complementary sequence denotes a sequence capable of hybridizing under stringent conditions to form a 3'-end serving as a seed for complementary chain synthesis.

Typically, the regions X2 and X1c constituting the oligonucleotide of the present invention for a nucleic acid having a specific nucleotide sequence are adjacent without overlapping with each other. If there is a common part in both nucleotide sequences, then these two nucleotide sequences may be partially overlapping. Since X2 must function as a primer, it must always be the 3'-end. On the other hand, X1c must impart a primer function, as described below, to the 3 ′ end of the complementary strand synthesized with this nucleic acid as a template, and therefore it must be placed at the 5 ′ end. The complementary strand obtained with this oligonucleotide as a synthesis seed serves as a template for synthesizing the complementary strand in the opposite direction in the next step, and finally, a portion of the oligonucleotide of the present invention is copied as a matrix into the complementary strand. The 3 ′ end generated by copying has the nucleotide sequence X1 that hybridizes with X1c in the same chain to form a loop.

In the present invention, the term “oligonucleotide” means an oligonucleotide that satisfies two requirements, that is, it must be able to form complementary base pairing and give an —OH group serving as a seed for complementary chain synthesis at the 3 ′ end. Thus, its skeleton should not be limited only to a structure containing phosphodiester bonds. For example, it may consist of a phosphotioate derivative having S instead of O as a skeleton, or a peptide-nucleic acid based on peptide bonds. Bases may be bases capable of complementary binding of bases. In nature, there are 5 bases, that is, A, C, T, G and U (A, C, T, G and Y), but the base can also be an analogue, for example bromodeoxyuridine. The oligonucleotide used in this invention preferably functions not only as a seed for synthesis, but also as a template for the synthesis of a complementary chain. The term polynucleotide in this invention includes oligonucleotides. The term “polynucleotide” is used when the chain length is not limited, while the term “oligonucleotide” is used to refer to a nucleotide polymer having a relatively short chain length.

The oligonucleotide in accordance with this invention has such a chain length so as to be capable of pairing bases with a complementary chain and maintain the necessary specificity in a particular environment in the various nucleic acid synthesis reactions described below. Specifically, it consists of 5-200 bp, more preferably 10-50 bp The primer chain recognized by a known polymerase catalyzing a sequence-dependent nucleic acid synthesis reaction is at least about 5 bases long, so that the chain length of the hybridizing moiety must be greater than this length. In addition, a length of 10 bases or more is statistically desirable to anticipate the specificity of this nucleotide sequence. On the other hand, obtaining too long a nucleotide sequence by chemical synthesis is difficult, and therefore, the chain length described above is exemplified as a desirable range. As an example, chain length refers to the chain length of a portion hybridizing to a complementary chain. As described below, the oligonucleotide in accordance with this invention can hybridize ultimately with at least 2 regions individually. Thus, it should be understood that the chain length given here as an example is the chain length of each region constituting the given oligonucleotide.

Further, the oligonucleotide in accordance with this invention can be labeled with a known labeling substance. The labeled substrate includes binding ligands such as digoxin and biotin, an enzyme, fluorescent substances and luminescent substances and radioactive isotopes. Methods for replacing a base located in an oligonucleotide with a fluorescent analogue are also known (WO95 / 05391, Proc. Natl. Acad. Sci. USA, 91, 6644-6648, 1994).

Other oligonucleotides in accordance with this invention may also be associated with the solid phase. Alternatively, an arbitrary portion of the oligonucleotide can be labeled with a binding ligand, such as biotin, and can be immobilized directly through a binding partner, such as immobilized avidin. When using an immobilized oligonucleotide as a seed for synthesis, the nucleic acid as a synthetic reaction product is captured by this solid phase, thereby facilitating its separation. The separated product can be determined by a specific nucleic acid indicator or hybridization with a labeling probe. Target nucleic acid fragments can also be recovered by cleaving the product by arbitrary restriction enzymes (restrictase enzymes).

The term “matrix” as used in this invention means a nucleic acid that serves as a template for the synthesis of a complementary strand. A complementary chain having a nucleotide sequence complementary to a matrix denotes a chain corresponding to the matrix, but this relationship between the two chains is only relative. That is, a chain synthesized as a complementary chain can again function as a matrix. That is, a complementary chain can become a matrix.

The oligonucleotide useful in this invention is not limited to the 2 regions described above, and may contain an additional region. While X2 and X1c are located at the 3'- and 5'-ends, respectively, an arbitrary sequence can be located between them. For example, it may be a restriction enzyme recognition site, a promoter recognized by RNA polymerase, or a DNA encoding a ribozyme. Using it as a restriction enzyme recognition sequence, a nucleic acid having a complementary sequence alternately linked in a single strand as a synthetic product of the present invention can be split into double stranded nucleic acids of the same length. By placing the promoter sequence recognized by RNA polymerase, the synthetic product of the present invention serves as a template, making possible further transcription into RNA. An additional room for DNA encoding a ribozyme is a system in which the transcription product is self-cleavable. These additional nucleotide sequences are sequences that function after they form a double strand chain. Thus, when a single-stranded nucleic acid in accordance with this invention forms a loop, these sequences do not function. They do not function until this nucleic acid is elongated and hybridized in the absence of a loop into a chain having a complementary nucleotide sequence.

When combining a promoter with an oligonucleotide based on the present invention in such a direction as to allow transcription of the synthesized region, the reaction product of this invention, where the same nucleotide sequence is repeated, implements a highly efficient transcription system. By combining this system with a suitable expression system, translation into protein is also possible. That is, this system can also be used for transcription and translation into protein in bacteria or animal cells or in vitro.

The oligonucleotide of the present invention having the structure described above can be chemically synthesized. Alternatively, the naturally occurring nucleic acid may be cleaved, for example, with restriction enzymes and modified to be composed of the nucleotide sequence described above or ligated into the nucleotide sequence described above.

The basic principle of the reaction for performing synthesis using the valuable oligonucleotide described above, in combination with a DNA polymerase having chain displacement activity, in a nucleic acid synthesis reaction in accordance with this invention, is described with reference to FIGS. 5-6. The oligonucleotide described above (FA in FIG. 5) is hybridized at X2 (corresponding to F2) with a nucleic acid as a matrix to seed a complementary strand synthesis. In FIG. 5, a complementary chain synthesized from FA as a synthesis seed is displaced by synthesis of a complementary chain (described below) from an external primer (F3) to form a single strand chain (FIG. 5-A). When the synthesis of the complementary strand into the resulting complementary strand is carried out further, the 3'-end of the nucleic acid synthesized as a complementary strand in FIG. 5-A has a nucleotide sequence complementary to the oligonucleotide of the present invention. That is, since the 5'-end of the oligonucleotide of the present invention has the same sequence as the X1c region (corresponding to F1c), the 3'-end of the nucleic acid thus synthesized has the complementary sequence X1 (F1). Figure 5 shows that the complementary chain synthesized from R1 as a synthesis seed is superseded by the synthesis of a complementary chain with primer R3 as a synthesis seed. Once the 3'-end is made ready for base pairing through this extrusion, the X1 (F1) at the 3'-end hybridizes with X1c (F1c) in the same chain, and an elongation reaction occurs with itself as a matrix (FIG. 5-B). Then X2c (F2c), located at its 3'-end, remains in the form of a loop that does not participate in base pairing. X2 (F2) in the oligonucleotide in accordance with this invention hybridizes with this loop, and the complementary chain is synthesized with the indicated oligonucleotide as a seed for synthesis (Fig. 5-B). The product of the synthetic reaction of a complementary chain with a previously synthesized product as a matrix is displaced by a chain displacement reaction in such a way that it is ready to mate.

By preparing the bases using one type of oligonucleotide of the present invention and an arbitrary reverse primer capable of synthesizing a nucleic acid in which a complementary strand synthesized with the indicated oligonucleotide as a primer is used as a template, many synthetic nucleic acid products can be obtained, as shown in Fig.6. As can be seen from FIG. 6, (D) is the desired nucleic acid product of the present invention having a complementary nucleotide sequence alternately linked in a single strand chain. After being converted to a single chain chain by treatment such as heat denaturation, another product (E) again serves as a matrix for the formation of (D). If the product (D) in the form of a double-stranded nucleic acid is converted into a single-stranded strand by heat denaturation, hybridization occurs in the same chain with a high probability without the formation of the initial double-stranded strand. This is because a complementary chain having the same melting point (Tm) undergoes an intramolecular reaction predominant over the intermolecular reaction. Each single chain strand produced from a product (D) annealed in the same chain hybridizes in the same chain and returns to state (B), and each chain additionally gives one molecule (D) and (E), respectively. By repeating these steps, it is possible to successfully synthesize a nucleic acid having complementary nucleotide sequences linked alternately in a single strand chain. The matrix and product formed in cycle 1 increase exponentially, making, therefore, this reaction very effective.

To realize the state of FIG. 5 (A), the initially synthesized complementary chain, at least in the part with which the reverse primer hybridizes, must be ready for base pairing. This stage is achieved through an arbitrary method. That is, an external primer (F3) that hybridizes to the first matrix in the F3c region on the 3 ′ side of the F2c region with which the oligonucleotide of this invention hybridizes is prepared separately. If this external primer is used as a seed for synthesis for the synthesis of a complementary chain by a polymerase that catalyzes the synthesis of a complementary chain as a chain displacement, then the complementary chain synthesized from F2c as a seed for synthesis in this invention is crowded out, and as a result, the R1c region which is to hybridize with R1, is made ready for base pairing (FIG. 5). Using the chain displacement reaction, the reaction now proceeds under isothermal conditions.

When using an external primer, synthesis from an external primer (F3) should be initiated after synthesis from F2c. In the simplest method, the concentration of the internal primer is made higher than the concentration of the external primer. Specifically, these primers are usually used at concentrations varying 2-5 times, preferably 4-10 times, as a result of which this reaction can proceed as expected. In addition, the melting temperature (Tm) of the outer primer is set so that it is lower than Tm X1 (corresponding to F1 and R1) in the inner primer, whereby synthesis timing can be controlled. That is, (external primer F3: F3c) ≤ (F2c / F2) ≤ (F1c / F1) or (external primer / region on the 3′-side in the matrix) ≤ (X2s: X2) ≤ (X1s: X1). Here the reason for (F2c / F2) ≤ (F1c / F1) is the need for hybridization between F1c / F1 before hybridization of F2 with the loop. Hybridization between F1c / F1 is an intramolecular reaction and can therefore occur predominantly with high probability. However, it makes sense to consider Tm in order to create more desirable reaction conditions. It goes without saying that similar conditions should be considered even in the design of the reverse primer. Using this relationship, statistically ideal reaction conditions can be achieved. If the remaining conditions are fixed, the melting temperature (Tm) can be theoretically calculated by combining the length of the hybridizing complementary chain and the bases involved in the pairing of the bases. Thus, those skilled in the art can develop preferred conditions based on the material set forth herein.

Further, a phenomenon called continuous stacking can also be used to control the timing of hybridization of the external primer. Continuous stacking is a phenomenon in which an oligonucleotide that is unable to hybridize independently becomes capable of hybridization when it is part of a double-stranded strand. (Chiara Borghesi-Nicoletti et al., Bio Techniques, 12, 474-477 (1992)). That is, the external primer is designed so that it is adjacent to F2c (X2c) and is not able to hybridize independently. As a result of this hybridization, the external primer does not occur until F2c (X2c) is hybridized, and therefore F2c (X2c) hybridization occurs predominantly. Based on this principle, the examples show the installation of the nucleotide sequence of the oligonucleotide required as a primer for a number of reactions. This stage can also be achieved by denaturation by heating or using DNA helicase.

If the template nucleic acid having F2c (X2c) is RNA, state 5- (A) can also be implemented in a different way. For example, if this RNA chain is destroyed, R1 becomes ready for base pairing. That is, F2 hybridizes with F2c in RNA and a complementary strand is synthesized in the form of DNA by reverse transcriptase. The RNA serving as the template is destroyed by alkaline denaturation or enzyme treatment using a ribonuclease acting on RNA in the double-stranded DNA / RNA strand, whereby the DNA synthesized from F2 forms into a single-strand strand. For an enzyme that selectively destroys RNA in a double-stranded DNA / RNA strand, RNase H or some reverse transcriptase can be used. In this way, the reverse primer can hybridize to R1 made capable of base pairing. Thus, an external primer, to give R1c the ability to mate with the bases, becomes unnecessary.

Alternatively, reverse transcriptase chain displacement activity can be used to displace the chain with an external primer, as described above. In this case, the reaction system may consist only of reverse transcriptase. That is, using RNA as a matrix, it is possible to synthesize a reverse transcriptase synthesis of a complementary chain from F2 hybridized to F2c in the matrix, and to synthesize a complementary chain from an external primer F3 as a seed for synthesis hybridized to F3c located on the 3'-side of F2c, and simultaneously displace the previously synthesized complementary chain. When the reverse transcriptase performs the synthesis reaction of a complementary strand with DNA as a template, all the synthesis reactions of complementary strands, including the synthesis of a complementary strand R1 as a seed of synthesis hybridizing with R1c in a displaced complementary strand, as a matrix, the synthesis of a complementary strand with R3 in as a seed of synthesis hybridizing with R3c located on the 3'-side of R1c, and the simultaneous displacement reaction occurs under the influence of reverse transcriptase. If this reverse transcriptase cannot be expected to exhibit DNA / RNA chain displacement activity under specific reaction conditions, it can also be used in a DNA polymerase combination having the chain displacement activity described above. An embodiment of the first single-stranded nucleic acid with RNA as the template described above is a preferred embodiment of the present invention. On the other hand, if a DNA polymerase, such as Bca DNA polymerase, having both chain displacement activity and reverse transcriptase activity, is used, not only the synthesis of the first single-stranded nucleic acid from RNA, but also the subsequent reaction with DNA as a template can proceed similarly using the same enzyme.

The reaction system described above allows various variations inherent in this invention by using a reverse primer having a specific structure. The most effective variation is described below. That is, an oligonucleotide constructed as described in [5] is used as a reverse primer in the most advantageous embodiment of the present invention. The oligonucleotide described in [5] is an oligonucleotide in which arbitrary regions of R2c and R1c in the complementary chain synthesized with F2 as a primer are X2c and X1c, respectively. Using this reverse primer, a series of reactions for the formation of a loop and for the synthesis and displacement of a complementary chain from this loop occur in both the sense and antisense chains (the forward side and the reverse side). As a result, the reaction efficiency for the synthesis of a nucleic acid having complementary nucleotide sequences linked alternately in a single strand chain in accordance with this invention is greatly improved, while a number of these reactions are possible under isothermal conditions. In the future, this method is described in more detail with reference to figures 1-3, where this method is summarized.

In a further embodiment, 2 types of oligonucleotides are prepared based on the present invention. For explanation, they are referred to as FA and RA. The areas constituting FA and RA are as follows:

X2 X1c FA F2 F1c RA R2 R1c

Here, F2 is a complementary nucleotide sequence with respect to the F2c region in a nucleic acid as a template. R2 is the nucleotide sequence complementary to the region of R2c contained in the complementary chain synthesized with F2 as a primer. F1c and R1c are arbitrary nucleotide sequences located along the transcription from F2c and R2c, respectively. The distance between F2 and R2 can be arbitrary. Even if its length is approximately 1 kb, sufficient synthesis is possible under suitable conditions, although it depends on the synthetic ability of the DNA polymerase to carry out the synthesis of a complementary strand. Specifically, when Bct DNA polymerase is used, the desired product is definitely synthesized if the distance between F2 and R2c is 800 bp, preferably 500 bp. or less. It is believed that in PCR with a temperature cycle, a decrease in the activity of the enzyme under the influence of stress changes in temperature reduces the efficiency of synthesis of a long nucleotide sequence. In a preferred embodiment of the invention, a temperature cycle in the nucleic acid amplification step is not required, and therefore the synthesis and amplification of even a long nucleotide sequence can definitely be achieved.

First, F2 in FA hybridizes with the nucleic acid as a template and is used as a seed for complementary strand synthesis. The subsequent reaction steps to FIG. 1 (4) are the same as those described in the previously described basic process (FIG. 5) of the present invention. The sequence hybridized as F3 in FIG. 1 (2) is the external primer described above. DNA polymerase for carrying out the synthesis of a complementary strand according to the type of chain displacement with this primer is used as a seed for synthesis so that the complementary strand synthesized from FA is forced out and made ready for base pairing.

When R2c is prepared for base pairing in (4), RA as a reverse primer is hybridized with it in a combination of R2c / R2. The synthesis of a complementary chain with this site as a synthesis seed occurs until this chain reaches F1c at the 5'-end of the FA. After this synthesis reaction of a complementary chain, an external displacement primer R3 hybridizes with it to synthesize a complementary chain, during which a chain is also displaced so that the complementary chain synthesized from RA as a synthesis seed is displaced. In the complementary chain thus extruded, the RA is located on its 5'-side, and the sequence complementary to the FA is located on its 3'-end.

On the 3'-side of the single-stranded nucleic acid thus displaced is an F1 sequence complementary to F1c in the same chain. F1 quickly hybridizes with F1c in the same molecule to initiate the synthesis of a complementary chain. When a 3’-end (F1) is hybridized with F1c, a loop containing F2c is formed in the same chain. As also apparent from FIGS. 2- (7), part of this loop remains ready for base pairing. The oligonucleotide FA of the present invention, having a nucleotide sequence complementary to F2c, hybridizes with part of this loop and acts as a primer for the synthesis of a complementary chain (7). The synthesis of the complementary chain from the loop proceeds, while the reaction product in the pre-initiated synthesis from the F1 complementary chain is displaced. As a result, the complementary chain synthesized with itself as a matrix is made ready for base pairing again at the 3'-end. This 3'-end is provided with an R1 region capable of hybridizing with R1c in the same chain, and these two regions hybridize mainly due to the rapid intramolecular reaction. The same reaction as the above reaction, starting from the 3'-end synthesized with FA as a matrix, also proceeds in this area. As a result, a nucleic acid having a complementary nucleotide sequence linked alternately in the same single-stranded chain in accordance with this invention continues to elongate from R1 as a starting point at the 3'-end by sequential synthesis of the complementary chain and its subsequent displacement. Since R2c is always contained in the loop formed by intramolecular hybridization of the 3'-terminal R1, the oligonucleotide (RA) provided by R2 hybridizes with the loop at the 3'-end in the subsequent reaction.

When attention is paid to a nucleic acid synthesized as a complementary strand from an oligonucleotide hybridizing with a loop in a single stranded nucleic acid elongated to itself as a template, nucleic acid synthesis having complementary nucleotide sequences linked alternately in the same single-stranded chain according to with this invention also occurs in doing so. That is, the synthesis of a complementary chain from the loop ends when it reaches RA, for example, in FIG. 2- (7). Then, when the nucleic acid displaced by this nucleic acid synthesis initiates the synthesis of a complementary strand (Figs. 3- (8)), this reaction reaches the loop that was once the seed of the synthesis, and displacement is initiated again. In this way, the nucleic acid, the synthesis of which is initiated from this loop, is also displaced, and the result is a 3'-terminal R1 capable of hybridizing with the same chain (Fig.3- (10)). This 3'-terminal R1 hybridizes to R1c in the same chain to initiate the synthesis of a complementary chain. This reaction is the same as in FIGS. 2- (7), except that F. is used instead of R. Thus, the structure shown in FIGS. 3- (10) can function as a new nucleic acid, which continues to self-elongate and form a new nucleic acid.

The nucleic acid synthesis reaction initiated from the nucleic acid shown in FIGS. 3- (10) causes elongation from the 3'-terminal F1 as a seed for synthesis, as opposed to the reaction described above. That is, in the present invention, when one nucleic acid is elongated, the reaction of continuing to supply a new nucleic acid initiating elongation proceeds separately. Further, when the chain is elongated, a plurality of looping sequences arise, not only at the end, but also in the chain itself. When these looping sequences are made ready for base pairing through a synthetic displacement reaction, the oligonucleotide hybridizes with them to serve as the basis for the new nucleic acid formation reaction. Effective amplification is then achieved by a synthetic reaction, starting not only at the end, but also in the chain. The oligonucleotide RA based on this invention is combined as a reverse primer as described above, whereby elongation and subsequent formation of a new nucleic acid occurs. Further, in this invention, this newly formed nucleic acid itself is elongated and causes subsequent formation of a new nucleic acid. A number of these reactions continue theoretically constantly with very efficient amplification of the nucleic acid. In addition, this reaction in the present invention can be carried out under isothermal conditions.

The reaction products thus accumulated have a structure having a nucleotide sequence between F1 and R1 and its complementary sequence linked alternately in it. However, both ends of this repeating unit have a region consisting of the nucleotide sequences F2-F1 (F2c-F1c) and R2-R1 (R2c-R1c). For example, in FIGS. 3- (9), the sequences (R2-F2c) - (F1-R2c) - (R1-F1c) - (F2-R2c) are connected in this order from the 5'-side. This is because the amplification reaction based on this invention proceeds according to the principle that this reaction is initiated from F2 (or R2) with the oligonucleotide as a synthesis seed, and then the complementary chain is elongated by the synthetic reaction from F1 (or R1) with 3 '-end as a seed synthesis.

Here, in the most preferred embodiment of the invention, the oligonucleotides FA and RA in accordance with this invention were used as oligonucleotides that hybridize with part of the loop. However, even if these oligonucleotides having a limited structure are not used, the amplification reaction according to this invention can be carried out using an oligonucleotide capable of initiating the synthesis of a complementary chain from the loop. That is, the elongation of the 3'-end, once replaced by a complementary chain synthesized from the loop, again gives part of the loop. Since this nucleic acid, having complementary nucleotide sequences linked alternately in a single strand chain, is always used as a matrix in the synthesis of a complementary chain, starting from the loop, it is obvious that the nucleic acid desired in this invention can be synthesized. However, the nucleic acid synthesized in this way performs the synthesis of a complementary strand by looping after displacement, but there is no 3 ′ end available for subsequent looping, and therefore it cannot function as a new matrix. Thus, it cannot be expected that the product in this case, in contrast to the nucleic acid initiated to synthesis by FA or RA, can be exponentially amplified. For this reason, an oligonucleotide having a structure of FA or RA is applicable for highly efficient nucleic acid synthesis based on the present invention.

A series of these reactions proceeds by adding the following components to a single-stranded nucleic acid as a template and then incubating this mixture at such a temperature that the nucleotide sequence of FA and RA can form a stable base pairing with its complementary nucleotide sequence, while the enzymatic activity can be saved.

- 4 types of oligonucleotides:

FA,

RA

external primer F3 and

external primer R3,

- DNA polymerase to perform the synthesis of a complementary chain according to the type of displacement of the chain,

- a nucleotide serving as a substrate for DNA polymerase.

Thus, a temperature cycle, such as in PCR, is not necessary. Stable base pairing, referred to herein, denotes a condition in which at least a portion of the oligonucleotide present in this reaction system can seed the synthesis of a complementary strand. For example, a desirable condition for causing stable base pairing is to set a lower temperature than the melting point (Tm). Typically, the melting temperature (Tm) is considered as the temperature at which 50% of nucleic acids having mutually complementary nucleotide sequences are sequences with paired bases. Installation at a melting point (Tm) or lower temperature is not a prerequisite in this invention, but is one of the reaction conditions that must be taken into account to obtain high synthesis efficiency. If the nucleic acid to be used as a template is a double-stranded chain, that nucleic acid must be made ready for base pairing, at least in the region with which the oligonucleotide is hybridized. For this, denaturation is usually carried out by heating, and it can be carried out only once in the form of a pre-treatment before initiating the reaction.

This reaction is carried out in the presence of a buffer giving a suitable pH for the enzymatic reaction, salts necessary for hybridization or for maintaining the catalytic activity of the enzyme, a protective agent for the enzyme and, if necessary, a regulator for the melting temperature (Tm). As the buffer used, for example, Tris-HCl having a buffering effect in the neutral-slightly alkaline range. The pH is adjusted (adjusted) depending on the DNA polymerase used. As salts, it is convenient to add KCl, NaCl, (NH ₄ ) ₂ SO ₄ , etc. to maintain the activity of the enzyme and to regulate the melting temperature (Tm) of the nucleic acid. Bovine serum albumin or sugars are used as a protective agent for the enzyme. Further, dimethyl sulfoxide (DMSO) or formamide is usually used as a regulator of melting temperature (Tm). By using a regulator for the melting point (Tm), the hybridization of the oligonucleotide can be controlled under conditions of limited temperature. Further, betaine (N, N, N-trimethylglycine) or tetraalkylammonium salt are also effective in improving the efficiency of chain displacement due to isostabilization. When betaine is added in an amount of 0.2-3.0 M, preferably 0.5-1.5 M, to the reaction solution, its stimulating effect on the amplification of the present invention can be expected. Since these melting temperature controllers act to lower the melting temperature, conditions giving suitable stiffness and reactivity are determined empirically taking into account salt concentration, reaction temperature, etc.

An important feature in this invention is that a number of reactions do not occur if the positional relationship of many areas is not maintained. By this feature, a nonspecific synthetic reaction accompanied by a nonspecific synthesis of a complementary chain is effectively prevented. That is, even if some nonspecific reaction takes place, the possibility that the product of this reaction serves as a starting material in the subsequent amplification step is minimized. Further, the regulation of the development of reactions in many areas makes it possible that a determination system capable of strictly identifying the desired product in similar nucleotide sequences can be arbitrarily constructed.

This trait can be used to detect mutations in the gene. In the method of the invention where an external primer is used, 4 primers are used, i.e. 2 external primers and 2 primers consisting of the oligonucleotides of the present invention. That is, while 6 regions contained in these 4 oligonucleotides do not work as planned, the synthetic reaction of the present invention does not take place. In particular, the sequences of the 3 ′ end of each oligonucleotide as a seed for the synthesis of a complementary strand and the 5 ′ end of the X1c region where the complementary strand serves as a seed for synthesis are important. Therefore, these important sequences are designed so that they correspond to the mutation to be determined, and the synthetic reaction product of the present invention is observed, whereby the presence or absence of the mutation, such as deletion or insertion of the base, or genetic polymorphism, such as SNP, can be comprehensively analyzed. . Specifically, bases evaluated as having a mutation or polymorphism are designed so that they correspond to the proximity of the 3'-end of the oligonucleotide as a seed synthesis of a complementary chain, or its 5'-end when the complementary chain is a synthesis seed. If mismatch is present at the 3'-end as a seed for synthesis of a complementary strand or in the vicinity of it, the synthesis reaction of a complementary strand to a nucleic acid is significantly inhibited. In the present invention, a high degree of amplification reaction was not achieved until the structure of these product ends in the initial reaction caused repeated reactions. Thus, even if erroneous synthesis takes place, the synthesis of the complementary chain constituting the amplification reaction has always been interrupted in some stages, and therefore, a high degree of amplification reaction does not occur in the presence of erroneous pairing. As a result, mismatching effectively inhibits the amplification reaction, and in the end an accurate result is achieved. That is, it can be said that the nucleic acid amplification reaction based on the present invention has a highly sophisticated mechanism for checking the nucleotide sequence. These features are an advantage hardly expected, for example, in the PCR method, where the amplification reaction is performed in only 2 regions.

The region X1c that distinguishes the oligonucleotide used in this invention can serve as a seed for synthesis after the complementary sequence has been synthesized, and this complementary sequence hybridizes to the sequence X1 in the same newly synthesized chain, whereby a synthetic reaction takes place with itself in as a matrix. Thus, even if a so-called primer dimer is formed, which is often a problem in the state of the art, this oligonucleotide does not form a loop. Thus, nonspecific amplification associated with the primer dimer cannot theoretically occur, and therefore, this oligonucleotide helps to improve the specificity of this reaction.

Further, according to this invention, the external primers shown as F3 (FIGS. 1- (2)) or R3 (FIGS. 2- (5)) are combined, whereby a number of the reactions described above can be carried out under isothermal conditions. That is, the present invention provides a method for amplifying a nucleic acid having complementary sequences linked alternately in a single strand chain, which constitutes the steps shown in paragraph 9 above. In this method, temperature conditions are selected under which stable hybridization takes place between F2c / F2, between R2c / R2, between F1c / F1 and between R1c / R1, and preferably F3c / F3 and R3c / R3 are set so that hybridization occurs by the phenomenon of continuous stacking facilitated by the hybridization of F2c / F2 and R2c / R2, respectively.

The terms “synthesis” and “amplification” of a nucleic acid are used in this invention. Nucleic acid synthesis in the present invention means elongation of a nucleic acid from an oligonucleotide serving as a seed of synthesis. If not only this synthesis, but also the formation of another nucleic acid and the elongation reaction of this formed nucleic acid occur continuously, a number of these reactions are called comprehensive amplification.

A single-stranded nucleic acid that is provided at its 3'-end with an F1 region capable of hybridizing with a portion of F1c in the same chain and which, when hybridizing the F1 region with F1c in the same chain, is capable of forming a loop containing the F2c region capable of mating, is an important element of this invention. Such a single-stranded nucleic acid can also be supplied as follows. Namely, the synthesis of a complementary chain is allowed to proceed on the basis of a primer having the following structure. 5 '[region X1 hybridizing with the region X1c located in the primer] - [looping sequence ready for base pairing] - [region X1c] - [region having a sequence complementary to the matrix] -3'.

As a region having a sequence complementary to the template, two nucleotide sequences are prepared, that is, a nucleotide sequence (FA primer) complementary to F1 and a nucleotide sequence (RA primer) complementary to R1c. The nucleotide sequence comprising the nucleic acid to be synthesized comprises a nucleotide sequence extending from region F1 to region R1c, and a nucleotide sequence extending from region R1 having a nucleotide sequence complementary to this nucleotide sequence to region F1c. X1c and X1 capable of hybridizing within this primer may be arbitrary sequences. However, in the region between the primers FA and RF, the sequence of the region X1c / X1 is preferably made different.

First, a complementary strand is synthesized by the FA primer from the F1 region in the template nucleic acid. Then, the R1c region in the synthesized complementary chain is made ready for base pairing with which another primer is hybridized to seed a synthesis of the complementary chain. The 3'-end of the complementary chain synthesized in this step has a nucleotide sequence complementary to the primer FA constituting the 5'-end of the originally synthesized chain, so that it is provided at its 3'-end with region X1 that hybridizes with region X1c in that the same chain with the formation of a loop. A representative 3'-terminal structure in accordance with this invention is provided in this manner, and the subsequent reaction constitutes the reaction system described previously as the most preferred embodiment. An oligonucleotide hybridizing with part of this loop provides at its 3'-end with an X2 region, complementary to an X2c region located in the loop, and at its 5'-end with an X1 region. In the previous reaction system, primers FA and RA were used to synthesize a strand complementary to the nucleic acid template, thereby obtaining a loop structure at the 3 ′ end of the nucleic acid. In this method, the end structure characteristic of the present invention is provided with short primers. In this embodiment, on the other hand, the entire nucleotide sequence constituting the loop is provided as a primer, and the synthesis of this longer primer is necessary.

If a nucleotide sequence containing a restriction enzyme recognition region is used as a reverse primer, a different embodiment of the present invention can be obtained. A reverse primer reaction containing a restriction enzyme recognition sequence is specifically described with reference to FIG. 6. After completion of FIG. 6- (D), a nickname (single chain break) is generated using the restriction enzyme corresponding to the restriction enzyme recognition site in the reverse primer. The synthesis reaction of a complementary chain by the type of chain displacement is initiated from this nickname as a seed of synthesis. Since reverse primers are located at both ends of the double-stranded nucleic acid component (D), a complementary strand synthesis reaction is also initiated at both ends. Although mainly based on the SDA method described in the prior art, the nucleotide sequence serving as a matrix has a structure having a complementary nucleotide sequence alternately linked according to this invention, so that a nucleic acid synthesis system unique to the invention is formed. The portion serving as a complementary reverse primer chain that must be nick-cleaved must be designed to incorporate the dNTP derivative so that it confers resistance to nucleases to prevent cleavage of the double strand chain by this restriction enzyme.

You can also insert the promoter for RNA polymerase in this reverse primer. The transcription from both ends in FIG. 6- (D) is performed by RNA polymerase recognizing this promoter, in this case very similar to the previous embodiment in which the SDA method was used.

The nucleic acid synthesized in this invention is a single-stranded chain, but consists of partial complementary sequences, and therefore, most of these sequences are paired based on base pairing. Using this feature, a synthesized product can be determined. By carrying out this nucleic acid synthesis method of the invention in the presence of a fluorescent pigment as a double-strand specific intercalator such as ethidium bromide, SYBR Green I or Pico Green, an increasing fluorescence density is observed as the amount of product increases. By monitoring this increase, you can trace the synthetic real-time reaction in a closed system. The use of this type of determination system for the PCR method is also considered, but it is believed that there are many problems, since the signal from the product cannot be distinguished from signals from primer dimers, etc. However, when applying this system to the present invention, the possibility of increasing non-specific base pairing is very low, and therefore, high sensitivity and low noise can be expected at the same time. Similarly to the use of a specific two-strand intercalator chain, fluorescence energy transfer can be used for a method for implementing a determination system in a uniform system.

The method for synthesizing a nucleic acid in accordance with this invention is supported by DNA polymerase, which catalyzes a reaction such as chain displacement for the synthesis of a complementary chain. During this reaction described above, there is also a reaction step, which does not necessarily require a polymerase acting as a chain displacement. However, to simplify the reagent used and from an economic point of view, it is advantageous to use one type of DNA polymerase. The following enzymes are known as DNA polymerases of this type. In addition, various mutants of these enzymes can be used in the present invention as long as they have both sequence-dependent complementary chain synthesis activity and chain displacement activity. Mutants referenced herein include those mutants that have only a structure causing the catalytic activity required for this enzyme, or those mutants that have modifications with respect to catalytic activity, stability or thermal stability, for example, amino acid mutations.

Bst DNA polymerase

(exo) BCA DNA polymerase

Klenov fragment of DNA polymerase I

DNA polymerase Vent

(ex-) Vent DNA polymerase (Vent DNA polymerase defective in exonuclease activity)

Deep Vent DNA Polymerase

(Ex-) DNA DNA polymerase Deep Vent (DNA polymerase Deep Vent, defective in exonuclease activity)

Phage F29 DNA polymerase

Phage MS-2 DNA polymerase

Z-Taq DNA Polymerase (Takara Shuzo Co., Ltd.)

KOD DNA Polymerase (Toyobo Co., Ltd.)

Among these enzymes, Bst DNA polymerase and Bca (exo) DNA polymerase Bca are particularly preferred enzymes because they have some degree of thermal stability and high catalytic activity. The reaction of the present invention can be carried out isothermally in the preferred embodiment, but due to the correction of the melting temperature (Tm), etc. it is not always possible to use the temperature conditions desired for enzyme stability. Thus, one of the desired conditions is that the enzyme must be thermostable. Although an isothermal reaction is possible, heat denaturation can be performed to provide the nucleic acid as the first matrix, and in this regard, the use of a thermostable enzyme also broadens the choice of assay protocol.

(Ex-) Vent DNA DNA polymerase is an enzyme with both chain displacement activity and a high degree of thermal stability. It is known that the synthesis reaction of a complementary strand, including the displacement of a strand by DNA polymerase, is stimulated by the addition of a single-strand protein (Paul M. Lizardi et al., Nature Genetics, 19, 225-232, July, 1998). This action is used in the present invention, and upon the addition of a single chain binding protein, an effect of stimulating the synthesis of a complementary chain can be expected. For example, the 32 T4 gene is effective as a single chain binding protein for Vent DNA polymerase.

For DNA polymerase that does not have 3'-5'-exonuclease activity, there is a well-known phenomenon, namely, that the synthesis of a complementary strand does not stop at the 5'-end of the template, which leads to the generation of a protrusion consisting of one base. In the present invention, this phenomenon is not preferable, since when the synthesis of a complementary chain reaches this end, the sequence of the 3'-end leads to the initiation of the next synthesis of a complementary chain. However, due to the addition of base “A” with a high probability to the 3'-end of this DNA polymerase, this sequence can be chosen so that synthesis from the 3'-end begins at “A”, so there is no problem if the additional base mistakenly added dATP. Further, even if the 3 ′ end has a protrusion during the synthesis of a complementary chain, 3 ′ → 5 ′ exonuclease activity can be used to cleave this protrusion to make this end blunt. For example, since Vent natural DNA polymerase has this activity, this enzyme can be used as a mixture with Vent (exo) DNA polymerase to solve this problem.

Various reagents necessary for the method of synthesis or amplification of a nucleic acid in accordance with this invention can be pre-packaged and provided in a kit. Specifically, a kit for the present invention is provided containing various types of oligonucleotides necessary as primers for the synthesis of a complementary chain and as external primers for displacement, dNTP as a substrate for the synthesis of a complementary chain, DNA polymerase for carrying out synthesis according to the type of chain displacement, buffer creating suitable conditions for the enzymatic reaction, and, if necessary, the reagents necessary to detect the products of the synthetic reaction. In particular, the addition of reagents is necessary during the reaction in a preferred embodiment of the present invention, and therefore, the reagents necessary for one reaction are fed after pipetting into the reaction vessel, whereby the reaction can be initiated by adding only a sample. Using a system in which a reaction product can be detected in situ in a reaction vessel using a luminescent signal or a fluorescent signal, it is not necessary to open and close the vessel after the reaction. It is very desirable to prevent pollution.

A nucleic acid having complementary nucleotide sequences alternately linked in a single strand, synthesized in accordance with this invention, has, for example, the following application. The first sign is the use of advantages arising from a special structure that has complementary sequences in one molecule. This feature is expected to facilitate identification. That is, there is a known system for detecting a nucleic acid in which its signal varies depending on the base pairing with a complementary nucleotide sequence. For example, by combining with a method of using a double-strand specific intercalator as a detector, as described above, a detection system can be fully utilized that utilizes the properties of the synthetic product of the present invention. If the synthetic reaction product of the present invention is denatured once by heating in the indicated determination system and returned to its original temperature, predominantly intramolecular annealing (hybridization) takes place, which makes it possible, therefore, to quickly pair complementary sequences. If there are products of a nonspecific reaction, they do not have complementary sequences in the molecule, so that after separation by denaturation by heating into 2 or more molecules, they cannot immediately return to the original double-stranded chain. By providing a heat denaturation step before determination, the noise associated with the non-specific reaction can be reduced. If heat-resistant DNA polymerase is used, this step of heat denaturation has the meaning of terminating the reaction and is therefore beneficial for controlling the reaction temperature.

The second sign is that a loop is always formed capable of pairing the bases. The structure of the loop capable of binding the bases shown in Fig.4. As can be seen from figure 4, this loop consists of the nucleotide sequence F2c (X2c), which can be annealed (hybridized) with a primer, and the nucleotide sequence inserted between F2c-F1c (X1c). The sequence between F2c-F1c (or between X2c-X1c in a more universal form) is a nucleotide-derived sequence derived from a matrix. Thus, if a probe having a complementary nucleotide sequence hybridizes to this region, a matrix-specific determination is possible. In addition, this area is always ready for base pairing, and therefore, heat denaturation before hybridization is not necessary. The nucleotide sequence making up the loop in the amplification reaction product may be of arbitrary length. Thus, if hybridization with the probe is desired, the region to be hybridized with the primer and the region to be hybridized with the probe are placed separately to prevent them from competing, whereby ideal reaction conditions can be provided.

According to a preferred embodiment of the invention, a large number of loops capable of base pairing are provided in a single nucleic acid chain. This means that a large number of probes can be hybridized with a single nucleic acid molecule, which makes sensitive determination possible. Thus, not only can sensitivity improvement be realized, but also a method for determining nucleic acid based on the principle of a particular reaction, for example, aggregation, can be implemented. For example, a probe immobilized on small particles, such as polystyrene latex, is added to the reaction product of the present invention, aggregation of latex particles is observed as the product hybridizes with this probe. Highly sensitive and quantitative observation is possible using optical measurements of aggregation strength. Since aggregation can also be observed with the naked eye, a reaction system that does not use an optical measuring device can also be provided.

Further, the reaction product of the present invention, allowing the binding of a large number of labels to one nucleic acid molecule, enables chromatographic determination. In the field of immunoassay, in practice, an analytical method (immunochromatography) is used using a chromatographic medium using a visually detectable label. This method is based on the principle that the analyte consists, as in a sandwich, between an antibody immobilized on a chromatographic medium and a labeled antibody, and the unreacted labeled component is washed out. The reaction product of this invention allows the application of this principle for nucleic acid analysis. Namely, a labeled probe is prepared for part of the loop and immobilized on a chromatographic medium to obtain an exciting capture probe, which makes analysis possible in this chromatographic medium. As an exciting probe, a sequence complementary to the loop part can be used. Since the reaction product of this invention has a large number of loops, this product binds to a large number of labeled probes, giving a visually recognizable signal.

The reaction product of this invention, always yielding a loop region capable of base pairing, makes possible a wide variety of other determination systems. For example, a detection system using resonance of surface plasmons using an immobilized probe for this part of the loop is possible. Further, if the probe for a portion of the loop is labeled with a double-strand chain specific intercalator, a more sensitive fluorescence analysis may be performed. Alternatively, the ability of a nucleic acid synthesized according to this invention to form a loop capable of base pairing on both 3 ′ and 5 ′ sides can also be positively utilized. For example, one loop is designed in such a way that it has the usual nucleotide sequence between the normal and abnormal type, while the other loop is designed to generate a difference between them. You can create a characteristic analytical system in which the presence of a gene is confirmed by a probe for the common part, while the presence of a deviation from the norm is confirmed in this other area. Since the nucleic acid synthesis reaction of this invention can also proceed isothermally, a very important advantage is that real-time analysis can be performed using a conventional fluorescence photometer. Prior to this, the structure of the nucleic acid to be hybridized in the same strand is known. However, a nucleic acid having complementary nucleotide sequences linked alternately in a single strand chain obtained by this invention is new because it contains a large number of loops capable of pairing bases with other oligonucleotides.

On the other hand, the largest number of loops formed by the reaction product in accordance with this invention can be used as probes. For example, in a set of matrices (chips) DNA probes must accumulate at high density in a limited area. However, in this technology, the number of oligonucleotides that can be immobilized in a specific area is limited. Thus, by using the reaction product of this invention, a large number of probes capable of hybridization can be immobilized at high density. Namely, the reaction product in accordance with this invention can be immobilized as probes on a DNA chip (matrix set). After amplification, the reaction product can be immobilized by any methods known in the art, or the immobilized oligonucleotide is used as the oligonucleotide in the amplification reaction of the present invention, which leads to the generation of the immobilized reaction product. By using a probe immobilized in this way, a large number of sample DNA can be hybridized in a restricted area, and therefore high signals can be expected.

Brief Description of the Drawings

Figure 1 is an illustration of part (1) to (4) of the reaction principle in a preferred embodiment of the present invention.

Figure 2 is an illustration of part (5) to (7) of the reaction principle in a preferred embodiment of the present invention.

Figure 3 is an illustration of part (8) to (10) of the reaction principle in a preferred embodiment of the present invention.

Figure 4 is an illustration of the structure of a loop formed by a single stranded nucleic acid, in accordance with this invention.

Figure 5 is an illustration of part (A) to (B) in the main embodiment of the present invention.

6 is an illustration of part (C) to (D) in the main embodiment of the present invention.

7 is a drawing showing the positional relationship of each nucleotide sequence constituting the oligonucleotide in the nucleotide sequence of the target M13mp18.

Fig is a photograph showing the result of agarose electrophoresis of a product obtained by the method of synthesis of single-stranded nucleic acid with M13mp18 as a matrix in accordance with this invention.

Lane 1: XIV size marker

Lane 2: 1 fmol dsDNA M13mp18

Lane 3: no target nucleic acid

FIG. 9 is a photograph showing the result of agarose gel electrophoresis of a restriction enzyme digested product obtained in Example 1 by a nucleic acid synthesis reaction in accordance with this invention.

Lane 1: XIV size marker

Lane 2: BamHI cleavage product of the purified product

Lane 3: PvuII cleavage product of the purified product

Lane 4: HindIII Cleavage Product of the Purified Product

10 is a photograph showing the result of agarose gel electrophoresis of a product obtained by the method of synthesizing a single-stranded nucleic acid in accordance with this invention using M13mp18 as a matrix in the presence of betaine. 0, 0.5, 1 and 2 indicate the concentration (M) of betaine added to the reaction solution. N indicates a negative control, and –21 indicates a concentration of 10 ⁻²¹ mol of the DNA template.

11 is a drawing showing the positional relationship of each nucleotide sequence constituting the oligonucleotide in the target nucleotide sequence derived from HVB.

12 is a photograph showing the result of agarose gel electrophoresis of a product obtained by the method of synthesizing a single stranded nucleic acid in accordance with this invention, where HBV-M13mp18 integrated into M13mp18 was used as a matrix.

Lane 1: XIV size marker

Lane 2: 1 fmol dsDNA HBV-M13mp18

Lane 3: no target nucleic acid

FIG. 13 is a photograph showing the result of agarose gel electrophoresis of an alkali-denatured product obtained by the method of synthesizing a single-stranded nucleic acid in accordance with this invention.

Lane 1: lambda phage HindIII cleavage fragment

Lane 2: reaction product in example 1

Lane 3: reaction product in example 3

Fig is a photograph showing the result of agarose gel electrophoresis of a product obtained by the method of synthesis of single-stranded nucleic acid in accordance with this invention, where the concentration of M13mp18 as a target was varied. The upper and lower photographs show the result of the reaction for 1 and 3 hours, respectively.

Lane 1: 1 × 10 ^-15 mol per dsDNA M13mp18 tube

Lane 2: 1 × 10 ^-16 mol per tube of dsDNA M13mp18

Lane 3: 1 × 10 ^-17 mol per tube dsДHK М13mp18

Lane 4: 1 × 10 ^-18 mol per dsDNA M13mp18 tube

Lane 5: 1 × 10 ^-19 mol per dsDNA tube M13mp18

Lane 6: 1 × 10 ^-20 mol per dsDNA tube M13mp18

Lane 7: 1 × 10 ^-21 mol per tube dsDNA M13mp18

Lane 8: 1 × 10 ^-22 mol per test tube dsДHK М13mp18

Lane 9: no target nucleic acid

Lane 10: XIV size marker

Fig is a drawing showing the position of the mutation and the positional relationship of each region of the nucleotide sequence of the target (target). The underlined guanine is replaced by adenine in the mutant.

Fig is a photograph showing the result of agarose gel electrophoresis of a product in accordance with the amplification reaction of the present invention.

M: 100 - bp - stairs (New England Biolabs)

N: no matrix (purified water)

WT: 1 fmol wild-type M13mp18 matrix

MT: 1 fmol of the matrix of the mutant M13mp18

17 is a drawing showing the positional relationship of each nucleotide sequence constituting the oligonucleotide in the nucleotide sequence encoding the target mRNA.

Fig is a photograph showing the result of agarose gel electrophoresis of a product obtained by the method of synthesis of single-stranded nucleic acid in accordance with this invention using mRNA as a target.

The best option for carrying out the present invention.

Example 1. Amplification of the area in M13mp18

A method for synthesizing a nucleic acid having complementary chains alternately linked in a single strand chain in accordance with this invention was tested using M13mp18 as a template. Four types of primers were used in this experiment, namely, M13FA, M13RA, M13F3 and M13R3. M13F3 and M13R3 were external primers for displacing the first nucleic acid obtained with M13FA and M13RA, respectively, as a seed primer. Because external primers are primers that serve as a primer for complementary chain synthesis after synthesis with M13FA (or M13RA), they were designed to hybridize to the region adjacent to M13FA (or M13RA) using the continuous stacking phenomenon. Further, the concentrations of these primers were set high, so that hybridization of M13FA (or M13RA) occurred predominantly.

The nucleotide sequence constituting each primer is shown in the List of sequences (see the end of the description). The structural characteristics of these primers are summarized below. Further, the positional relationship of each region relative to the nucleotide sequence (target) is shown in Fig.7.

Primer Area on the 5'-side / area on the 3'-side

M13FA The same as the F1c region in the complementary chain synthesized by M13FA / complementary F2c region in M13mp18

M13RA Same as region R1c in the complementary chain synthesized by M13RA / complementary region R2c in the complementary chain synthesized by M13FA

M13F3 Complementary F3c adjacent to the 3'-side of the F2c region in M13mp18

M13R3 Complementary R3c adjacent to the 3 ′ side of the F2c region in the complementary chain synthesized by M13FA

Using such primers, a nucleic acid was synthesized in which a region extending from F1c to R1c in M13mp18 and its complementary nucleotide sequence are alternately linked through a looping sequence containing F2c in a single strand chain. The composition of the reaction solution for the method of synthesis of nucleic acids using these primers in accordance with this invention is shown below.

The composition of the reaction solution (25 μl)

20 mM Tris-Hcl pH 8.8

10 mM KCl

10 mM (NH ₄ ) ₂ SO ₄

6 mM MgSO ₄

0.1% Triton X-100

5% dimethyl sulfoxide (DMSO)

0.4 mM dNTP

Primers

800 nM M13FA / SEQ ID NO: 1

800 nM M13RA / SEQ ID NO: 2

200 nM M13F3 / SEQ ID NO: 3

200 nM M13R3 / SEQ ID NO: 4

Target: dsAHK M13mp18 / SEQ ID NO: 5

Reaction: The solution described above was heated at 95 ° C for 5 minutes and the target was denatured into a single strand chain. The reaction solution was transferred to a mixture of ice water and 4 E Bst DNA polymerase (New England Biolabs) was added thereto, and this mixture was reacted at 65 ° C. for 1 hour. After the reaction, the reaction was stopped at 80 ° C for 10 min and again transferred to a mixture of water and ice.

Confirmation of the reaction: 1 μl of application buffer was added to 5 μl of the reaction solution described above, and this sample was subjected to electrophoresis for 1 hour at 80 mV on 2% agarose gel (0.5% TBE). XIV (100 bp ladder, Boehringer Mannheim) was used as a molecular weight marker. The gel after electrophoresis was stained with SYBR Green I (Molecular Probes, Inc.) to confirm nucleic acid. The results are shown in FIG. The corresponding tracks correspond to the following samples.

1. Marker size XIV.

2. Track 2: 1 fmol dsДHK M13mp18.

Lane 3: without a target.

There was no lane in lane 3, except that unreacted primers were stained. In lane 2, in the presence of the target, the products were confirmed as a ladder of stripes of low size, in the form of smeared staining at a high size and in the form of a strip barely entering the gel during electrophoresis. Among the bands of low band size near 290 bp and 450 bp consistent with the products approximately estimated in the synthetic reaction of the present invention, namely, double-strand chains of SEQ ID NO: 11 and 12 (corresponding double-strand chains formed as shown in FIGS. 2- (7) and 3- (10), and a single-strand chain figure 3- (9)), and therefore it was confirmed that the reaction occurs as expected. It was roughly estimated that the results of electrophoresis with a smeared picture at a high size and the band that did not enter the gel during electrophoresis arose because this reaction was mainly a continuous reaction, allowing the formation of varying molecular masses of the reaction product, and because this the product has a complex structure, as it consists of a partially single-strand chain and a double-stranded complex.

Example 2. Confirmation of reaction products by restriction enzyme digestion

For the purpose of determining the structure of a nucleic acid having complementary nucleotide sequences linked alternately in the single-stranded chain obtained in Example 1 in accordance with this invention, these products were digested with restriction enzymes. If the fragments are theoretically generated by their cleavage with restriction enzymes and at the same time the blurred picture disappears at a high size and the electrophoresis band not observed in Example 1, then it can be roughly estimated that any of these products are nucleic acid having complementary sequences linked alternately in a single-strand chain synthesized in accordance with this invention.

A reaction solution (200 μl) of 8 tubes in Example 1 was combined and purified by phenol treatment and ethanol precipitation. The resulting precipitates were recovered and dissolved again in 200 μl of TE buffer and an aliquot of 10 μl was digested at 37 ° C for 2 hours with restriction enzymes BamHI, PvuII and HindIII, respectively. The cleavage product was subjected to electrophoresis for 1 hour at 80 mV on 2% agarose gel (0.5% TBE). Super Ladder-Low (100 bp ladder) (Gensura Laboratories, Inc.) was used as a molecular marker. The gel after electrophoresis was stained with SYBR Green I (Molecular Probes, Inc.) to confirm nucleic acid. The results are shown in Fig.9. The corresponding tracks correspond to the following samples.

1. Marker size XIV.

2. BamHI cleavage product of the purified product.

3: PvuII cleavage product of the purified product.

4: HindIII cleavage product of the purified product.

It was estimated that the nucleotide sequences constituting the relatively short amplification products are SEQ ID NOS: 13, 14, 15, and 16. Based on these nucleotide sequences, the estimated size of each fragment obtained by restriction enzyme digestion is as shown in Table 1. The “L” in this table indicates that its position in the electrophoresis is not established, since L is a fragment containing a loop (single-strand chain).

Table 1. Fragments obtained by restriction enzyme digestion of amplification products in accordance with this invention

SEQ ID NO: Bamhi PvuII HindIII thirteen 177 + L 56 + L 147 + L 14 15 + 101 + L - 142 + L fifteen 171 + 101 + L 56 + L 147 + 161 + L 16 11 + 101 + 230 + L 237 + L 142 + 170 + L Total 101, 177, 230 56, 237 142, 147, 161, 170

(11, 15; not confirmed)

Since almost all bands before cleavage changed into estimated bands, it was confirmed that the products of the reaction in question were amplified. Further, it was also shown that there were no non-specific products or there were fewer non-specific products.

Example 3. Stimulation of the amplification reaction by the addition of betaine

An experiment was conducted to test the effect of betaine (N, N, N-trimethylglycine, Sigma) added to the reaction solution of the amplification reaction on the nucleic acid amplification reaction. The synthesis of a nucleic acid having complementary chains linked alternately in a single strand chain in accordance with this invention was carried out using M13mp18 as a template, similar to that described in example 1, in the presence of betaine at various concentrations. The primers used in this experiment were identical to the primers used in Example 1. The amount of template DNA was 10 ^-21 mol (M13 mp18), and water was used as a negative control. Betaine was added at concentrations of 0, 0.5, 1 and 2 M to the reaction solution. The composition of the reaction solution is shown below.

The composition of the reaction solution (25 μl)

20 mM Tris-Hcl pH 8.8

4 mm MgSO ₄

0.4 mM dNTPs

10 mM KCl

10 MM (NH ₄ ) ₂ SO ₄

0.1% Triton X-100

Primers

800 nM M13FA / SEQ ID NO: 1

800 nM M13RA / SEQ ID NO: 2

200 nM M13F3 / SEQ ID NO: 3

200 nM M13R3 / SEQ ID NO: 4

Target: dsDNA M13mp18 / SEQ ID NO: 5

The polymerase, reaction conditions and conditions for electrophoresis after the reaction were identical to those described in example 1.

The results are shown in FIG. 10. In the reaction in the presence of betaine at a concentration of 0.5 or 1.0 M, the amount of amplification product increased. Further, if its concentration was increased to 2.0 M, amplification was not observed. Thus, it was shown that the amplification reaction was stimulated in the presence of betaine at a suitable concentration. A roughly estimated reason that the amount of amplification product decreased when the concentration of betaine was 2 M was that Tm decreased too much.

Example 4. Amplification of the HBV gene sequence

A nucleic acid synthesis method was tested in accordance with the present invention, using M13mp18 dsDNA having a partial sequence of the HBV gene integrated therein as a template. Four types of primers were used in this experiment, namely HB65FA (SEQ ID NO: 6), HB65RA (SEQ ID NO: 7), HBF3 (SEQ ID NO: 8) and HBR3 (SEQ ID NO: 9). HBF3 and HBR3 were external primers for displacing the first nucleic acid obtained with HB65FA and HB65RA, respectively, as a seed primer. Since external primers are primers that serve as a primer for complementary chain synthesis after synthesis with HB65FA (or HB65RA), they were designed to hybridize to the region adjacent to HB65FA (or HB65RA) using the continuous stacking phenomenon. Further, the concentrations of these primers were set high, so that the hybridization of HB65FA (or HB65RA) occurred predominantly. The target sequence (430 bp) in this example, originating from HBV integrated into M13tr18, is shown in SEQ ID NO: 10.

The nucleotide sequence constituting each primer is shown in the List of sequences (see the end of the description). The structural feature of each primer is shown below. Further, the positional relationship of each region relative to the nucleotide sequence (target) is shown in Fig. 11.

Primer Area on the 5'-side / area on the 3'-side

HB65FA The same as the F1c region in the complementary chain synthesized by HB65FA / complementary F2c region in HBV-M13mp18

HB65RA Same as region R1c in the complementary chain synthesized by HB65RA / complementary region R2c in the complementary chain synthesized by HB65FA

HBF3 Complementary F3c adjacent to the 3 ′ side of the F2c region in HBV-M13mp18

HBR3 Complementary R3c adjacent to the 3 ′ side of the F2c region in the complementary chain synthesized by HB65FA

Using such primers, a nucleic acid was synthesized in which a region extending from F1c to R1c in M13mp18 (HBV-M13mp18) and its complementary nucleotide sequence are alternately linked through a loop forming sequence containing F2c in a single strand chain. The reaction was carried out under the same conditions as described in Example 1, except that the primers described above were used and the reaction solution was analyzed by agarose gel electrophoresis. The results are shown in FIG. The corresponding tracks correspond to the following samples.

1. Marker size XIV.

2. 1 fmol dsDNA HBV-M13mp18.

3: Without a target.

Like example 1, the products were confirmed only in the presence of a target in the form of a ladder of strips of low size, in the form of smeared staining at a high size and in the form of a strip barely entering the gel during electrophoresis (lane 2). Among the bands of low band size near 310 bp and 480 bp consistent with the products approximately estimated in the synthetic reaction of the present invention, namely the double-strand chains of SEQ ID NOs: 17 and 18, and therefore it was confirmed that the reaction was proceeding as expected. As described in the results in Example 1, it was approximately estimated that the smeared pattern at a high size and the band that did not enter the gel during electrophoresis were due to the structure of the synthetic product characteristic of this invention. Based on this experiment, it was confirmed that the invention can be practiced even if a different sequence (target) is used for amplification.

Example 5. Confirmation of product sizes of these synthetic reactions

To confirm the structure of the nucleic acid synthesized in accordance with this invention, its length was analyzed by electrophoresis under alkaline denaturation conditions. 1 μl of alkaline application buffer was added to 5 μl of each reaction solution in the presence of a target in Example 1 or 4 and subjected to electrophoresis at 50 mA in 0.7% agarose gel (50 mM NaOH, 1 mM EDTA) for 14 hours. HindIII lambda phage fragments were used as a molecular weight marker. The gel after electrophoresis was neutralized with 1 M Tris, pH 8 and stained with SYBR Green I (Molecular Probes, Inc.) to confirm nucleic acid. The results are shown in FIG. The corresponding tracks correspond to the following samples.

1. Fragments of the cleavage of HindIII from phage lambda.

2. The reaction product in example 1.

3. The reaction product in example 4.

During electrophoresis of the reaction product under conditions of alkali denaturation, its size could be confirmed in a single-chain state. It was confirmed that the sizes of the main products both in Example 1 (lane 2) and in Example 4 (lane 3) were within 2 kb. Further, it turned out that the product in accordance with this invention was extended to a size of at least 6 TPN or more within the range verifiable using this analysis. In addition, it was again confirmed that bands that did not move under electrophoresis under non-denaturing conditions in Examples 1 and 4 were separated in the denatured state into individual single-strand chains of a smaller size.

Example 6. Confirmation of the dependence of amplification on the concentration of the target in the amplification region in M13mp18

The effect of varying target concentrations on the method for synthesizing a nucleic acid in accordance with this invention was observed. The method of synthesizing a nucleic acid in accordance with this invention was carried out under the same conditions as in example 1, except that the amount of dsDNA M13mp18 as a target was 0-1 fmol and the reaction time was 1 hour or 3 hours. Like Example 1, the sample was subjected to electrophoresis on a 2% agarose gel (0.5 TBE) and stained with SYBR Green I (Molecular Probes, Inc.) to confirm nucleic acid. XIV (100 bp ladder, Boehringer Mannheim) was used as a molecular weight marker. The results are shown in FIG. 14 (upper: 1 hour reaction, lower: 3 hour reaction). The corresponding tracks correspond to the following samples.

1.1 × 10 ⁻¹⁵ mol per tube dsDNA M13mp18

2.1 × 10 ⁻¹⁶ mol per tube dsDNA M13mp18

3.1 × 10 ⁻¹⁷ mol per tube dsDNA M13mp18

4.1 × 10 ⁻¹⁸ mol per tube dsDNA M13mp18

5.1 × 10 ⁻¹⁹ mol per tube dsDNA M13mp18

6. 1 × 10 ^-20 mol per tube dsDNA M13mp18

7.1 × 10 ⁻²¹ mol per tube dsDNA M13mp18

8.1 × 10 ⁻²² mol per tube dsDNA M13mp18

9. Without a target

10. Marker size XIV.

A common band among the respective tracks appears at the bottom in the electrophoretic profile and shows unreacted stained primers. Regardless of the reaction time, no amplification product was observed in the absence of a target. The staining pattern of the amplified product, depending on the concentration of the target, was obtained only in the presence of the target. Further, the amplification product could be confirmed at a lower concentration as the reaction time increased.

Example 7. Detection of point mutations

(1) Obtaining M13mp18FM (mutant)

The target DNA used was M13mp18 (wild type) and M13mp18FM (mutant). To construct the mutant M13mp18FM, the in vitro La PCR ™ in vitro Mutagenesis Kit (Takara Shuzo Co., Ltd.) mutagenesis kit was used to replace one nucleotide per mutation. After this, the sequence was confirmed by sequencing. The sequence of area F1 is shown below:

Wild type: CCGGGGATCCTCTAGAGTCG (SEQ ID NO: 19)

Mutant: CCGGGGATCCTCTAGAGTCA (SEQ ID NO: 20)

(2) Design of primers

FA primers used for the wild type and mutant were provided at the 5'-end of their F1c region with different nucleotide sequences, respectively. The position of the mutation and the positional relationship of each region relative to the nucleotide sequence of the target are shown in Fig. 15.

(3) Amplification reaction

An experiment was conducted to test whether a matrix-specific amplification reaction occurs using a combination of specific primers shown below, using M13mp18 (wild type) and M13mp18FM (mutant) as primers.

Wild type amplification primer set: FAd4, RAd4, F3, R3

Mutant amplification primer set: FAMd4, RAd4, F3, R3

The nucleotide sequence of each primer is as follows:

FAd4: CGACTCTAGAGGATCCCCGGTTTTTGTTGTGTGGAATTGTGAGCGGAT (SEQ ID NO: 21)

FAMd4: TGACTCTAGAGGATCCCCGGTTTTTGTTGTGTGGAATTGTGAGCGGAT (SEQ ID NO: 22)

RAd4: CGTCGTGACTGGGAAAACCCTTTTTGTGCGGGCCTCTTCGCTATTAC (SEQ ID NO: 23)

F3: ACTTTATGCTTCCGGCTCGTA (SEQ ID NO: 24)

R3: GTTGGGAAGGGCGATCG (SEQ ID NO: 25)

(4) Determination of point mutation in M13mp18

The composition of the reaction solution is as follows:

1 fmol (2 μl) of the M13mp18 or M13mp18FM target was added to the reaction solution and heated at 95 ° C for 5 min, as a result of which the target was denatured into a single strand chain. The reaction solution was transferred to ice-water and 1 μl (8 U) of Bst DNA polymerase (NEW ENGLAND Biolab) was added thereto and allowed to react for 1 hour at 68 ° C or 68.5 ° C. After the reaction, the reaction was stopped at 80 ° C for 10 minutes, and the reaction solution was again transferred to a mixture of ice water.

As shown in FIG. 16, when wild type FAd4 was used as the FA primer, effective amplification was observed only in the presence of a wild type matrix. On the other hand, when using FAMd4 for the mutant as an FA primer, effective amplification was observed only in the presence of a wild-type matrix [sic.] (Exactly so).

From the results described above, it is seen that the point mutation could be detected efficiently using the amplification reaction of the present invention.

Example 8. The amplification reaction of mRNA as a target

A method for synthesizing a nucleic acid in accordance with this invention was tested using mRNA as the target nucleic acid. To obtain a target mRNA, cells of the prostate cancer LNCaP cell line (ATCC No. CRL-1740) expressing specific antigen (PSA) of the prostate were mixed with chronic myeloid leukemia K562 cells (ATCC No. CCL-243) as non-expressing cells at 1:10 ⁶ -100: 10 ⁶ , followed by extraction of total RNA using the RNeasy Mini kit from Qiagen (Germany). Four types of primers were used in this experiment, namely PSAFA, PSARA, PSAF3 and PSAR3. PSAF3 and PSAR3 are external primers for displacing the first nucleic acid obtained with PSAFA and PSARA, respectively, as a seed primer. Further, the concentrations of these primers were set so high that hybridization of PSAFA (or PSARA) predominantly occurred. The nucleotide sequences constituting the corresponding primers are as follows.

Primer:

PSAFA: TGTTCCTGATGCAGTGGGCAGCTTTAGTCTGCGGCGGTGTTCTG (SEQ ID NO: 26)

PSARA: TGCTGGGTCGGCACAGCCTGAAGCTGACCTGAAATACCTGGCCTG (SEQ ID NO: 27)

PSAF3: TGCTTGTGGCCTCTCGTG (SEQ ID NO: 28)

PSAR3: GGGTGTGGGAAGCTGTG (SEQ ID NO: 29)

The structural features of these primers are summarized below. Further, the positional relationship of each primer with respect to the nucleotide sequence of the DNA encoding the target mRNA and the Sau3AI restriction enzyme recognition sites are shown in FIG.

Primer Area on the 5'-side / area on the 3'-side

PSAFA The same as the F1c region in the complementary strand synthesized by the PSAFA / complementary F2c region in the target nucleotide sequence

PSARA Same as region R1c in the complementary chain synthesized by PSARA / complementary region R2c in the complementary chain synthesized by PSAFA

PSAF3 Complementary F3c adjacent to the 3 ′ side of the F2c region in the target nucleotide sequence

PSAR3 Complementary R3c adjacent to the 3 ′ side of the R2c region in the complementary chain synthesized by PSAFA

The composition of the reaction solution for the method of synthesis of nucleic acids in accordance with this invention is as follows:

20 mM Tris-HCl pH 8.8

4 mm MgSO ₄

0.4 mM dNTPs

10 mM KCl

10 mM (NH ₄ ) ₂ SO ₄

0.1% Triton X-100

0.8 M betaine

5 mm DTT

1600 nM PSAFA and PSARA primers

200 nM primers PSAF3 and PSAR3

8 E Bst DNA Polymerase

100 E Rever Tra Ace (reverse transcriptase) (Toyobo Co., Ltd., Japan)

5 mcg of total RNA

All ingredients were mixed on ice. In this experiment, mRNA (single-strand chain) was used as a target, and, therefore, the step of obtaining a single-strand chain by heat denaturation is not necessary. The reaction was carried out at 65 ° C for 45 minutes and the reaction was stopped at 85 ° C for 5 minutes. After the reaction, the reaction solution was subjected to electrophoresis in 2% agarose and determined by staining with SYBR Green I.

The results are shown in FIG. The corresponding tracks correspond to the following samples.

In the absence of either Bst DNA polymerase or Rever Tra reverse transcriptase, Asa was unable to obtain the amplification product (lanes 1-4). In the presence of both enzymes, the amplification product was detected (lanes 5-7) if RNA derived from LNCaP was present. RNA extracted from a mixture of one LNCaP cell / one million K562 cells could be detected (lane 6). When the amplification product was cleaved at the Sau3AI restriction enzyme site located inside the target, the product was cleaved to form a fragment of an estimated size (lanes 8 and 9).

As can be seen from the above results, it was confirmed that the desired reaction product can be obtained in the method of synthesis of nucleic acids in accordance with this invention even when using RNA as a target.

Industrial applicability

In accordance with the novel oligonucleotide of the present invention and a method for synthesizing a nucleic acid using said oligonucleotide, a method for synthesizing a nucleic acid having complementary nucleotide sequences alternately linked in a single strand chain without the need for any complex temperature control is provided. The complementary chain synthesized with this oligonucleotide as a primer based on the present invention serves as a seed for the synthesis of a new complementary chain with the 3'-end of the synthesized chain as a template. This is accompanied by the formation of a loop that causes hybridization of the new primer, and the reaction product of the synthesis of a complementary chain with a previously synthesized chain as a matrix is again replaced by the synthesis of a complementary chain from the loop and is ready to mate. The nucleic acid thus obtained, synthesized with itself as a matrix, is combined, for example, with a known method for the synthesis of nucleic acids, such as SDA, to improve the efficiency of nucleic acid synthesis.

According to a further preferred embodiment of the present invention, there is provided a new nucleic acid synthesis method that improves the efficiency of the known nucleic acid synthesis method, does not require complex temperature control, can be expected to achieve high amplification efficiency, and can provide high specificity. Namely, an oligonucleotide based on the present invention is used with a matrix chain and its complementary chain, whereby a nucleic acid having complementary sequences linked alternately in a single strand chain can be successfully synthesized. This reaction continues theoretically until the starting materials necessary for synthesis are depleted, and during this process a new nucleic acid continues to form, the synthesis of which is initiated from the loop. Elongation from an oligonucleotide annealed with a loop performs chain displacement to provide 3'-OH for elongation of a long single stranded nucleic acid (namely, a nucleic acid having multiple pairs of complementary chains linked together). On the other hand, the 3'-OH of this long single-stranded chain carries out the synthesis reaction of the complementary chain with itself as a matrix, whereby its elongation is achieved, during which a new complementary chain, the synthesis of which is initiated from the loop, is forced out. This stage of the amplification reaction proceeds under isothermal conditions while maintaining high specificity.

The oligonucleotides of this invention can, when intended to be adjacent to one another, function as primers for the nucleic acid synthesis reaction of the invention. This contributes significantly to the preservation of specificity. By comparison, for example, with PCR, where a nonspecific amplification reaction is initiated by nonspecific erroneous hybridization, regardless of the expected positional relationship of the 2 primers, it can be easily explained that high specificity can be expected in this invention. This feature can be used for highly sensitive and accurate SNP detection.

A characteristic feature of the present invention is that such a reaction can be easily achieved using a very simple set of reagents. For example, the oligonucleotide in accordance with this invention has a special structure, but this is the result of the choice of the nucleotide sequence, and he, as a substance, is a simple oligonucleotide. Further, in a preferred embodiment, this reaction can be carried out only by DNA polymerase, catalyzing a reaction such as displacement of the synthesis chain of a complementary chain. Further, if the present invention is carried out with RNA as a template, a DNA polymerase, for example Bca DNA polymerase, having both reverse transcriptase activity and DNA polymerase activity such as chain displacement, is used so that all enzymatic reactions can be carried out with a single enzyme. The principle of a reaction that carries out a high degree of nucleic acid amplification reaction by such a simple enzymatic reaction is unknown. Even to apply the present invention to a known nucleic acid synthesis reaction, such as SDA, no additional enzyme is required for their combination, and such a simple combination with an oligonucleotide based on the present invention can be applied to various reaction systems. Thus, it can be said that the method for synthesizing a nucleic acid in accordance with this invention is advantageous in terms of cost.

As described above, the method for synthesizing a nucleic acid in accordance with this invention and the oligonucleotide used therein provide a new principle for simultaneously solving many difficult problems, such as efficiency (eliminating the need for temperature control), improving the efficiency of synthesis, economy and high specificity.

Claims (7)

1. A kit for the synthesis of a nucleic acid having a nucleotide sequence, where in the same chain complementary nucleotide sequences are alternately linked, containing the following elements: i) an internal FA primer containing a 3'-terminal nucleotide sequence that serves as a starting point for the synthesis of a chain having a single chain sequence that forms said complementary nucleotide sequences and a 5'-terminal nucleotide sequence complementary to an arbitrary region of said chain; ii) an internal primer RA containing a 3'-terminal nucleotide sequence that serves as a starting point for the synthesis of a chain having a sequence of another chain that forms the indicated complementary nucleotide sequences, and a 5'-terminal nucleotide sequence complementary to an arbitrary region of the specified chain; iii) an oligonucleotide having a nucleotide sequence complementary to an arbitrary region located on the 3 ′ side of the region that hybridizes with the internal primer of the FA region, in a nucleic acid serving as a template; iv) an oligonucleotide having a nucleotide sequence complementary to an arbitrary region located on the 3 ′ side of the region hybridizing with the internal primer of the RA region, in a complementary chain synthesized using the internal primer FA as the starting point for the synthesis; v) DNA polymerase, catalyzing the reaction of the synthesis of a complementary chain by the mechanism of chain displacement; vi) nucleotides serving as a substrate for element v). 2. A method of synthesizing a nucleic acid molecule having a nucleotide sequence, where complementary nucleotide sequences are alternately linked in the same chain, comprising: a) mixing a sample of nucleic acid as a matrix with the following components: i) an internal FA primer containing a 3'-terminal nucleotide sequence that serves as a starting point for the synthesis of a chain having a single chain sequence that forms said complementary nucleotide sequences and a 5'-terminal nucleotide sequence complementary to an arbitrary region of said chain; ii) an internal primer RA containing a 3'-terminal nucleotide sequence, which serves as a starting point for the synthesis of a chain having a sequence of another chain that forms the indicated complementary nucleotide sequences, and a 5'-terminal nucleotide sequence complementary to an arbitrary region of the specified chain; iii) an oligonucleotide having a nucleotide sequence complementary to an arbitrary region located on the 3 ′ side of the region that hybridizes with the internal primer of the FA region, in a nucleic acid serving as a template; iv) an oligonucleotide having a nucleotide sequence complementary to an arbitrary region located on the 3 ′ side of the region that hybridizes with the internal primer of the RA region, in a complementary chain synthesized using the internal FA primer in step i) as the starting point for the synthesis; v) DNA polymerase having chain displacement activity; vi) one or more types of nucleotides used by DNA polymerase to extend primers, b) incubating the mixture at a temperature at which the nucleotide sequence comprising FA and RA is capable of stable base pairing with its complementary nucleotide sequence while maintaining enzymatic activity. 3. The method according to claim 2, where the mixture further comprises a melting point controller. 4. The method according to claim 3, where the regulator of the melting temperature is betaine. 5. The method according to claim 4, where 0.2-3.0 M betaine is used. 6. The method according to claim 2, where the nucleic acid sample is RNA, and DNA polymerase has reverse transcriptase activity. 7. The method according to claim 2, where the distance between the region of nucleic acid of the sample hybridizing with FA and an arbitrary region and between the region of another chain hybridizing with RA and an arbitrary region is 0-100 bp.

Images