WO2018132939A1

WO2018132939A1 - Method for synthesizing nucleic acid under constant temperature

Info

Publication number: WO2018132939A1
Application number: PCT/CN2017/071394
Authority: WO
Inventors: 杜昱光; 毛瑞; 刘洪涛; 王倬
Original assignee: 中国科学院过程工程研究所
Priority date: 2017-01-17
Filing date: 2017-01-17
Publication date: 2018-07-26

Abstract

A method for synthesizing nucleic acid under constant temperature, comprising the following steps: 1) providing a nucleic acid, the 3' end of the nucleic acid has an Flr region, the Flr region anneals with an Flc region on the same strand, and a helix ring may be formed by simultaneous annealing of the Flr and Flc regions; 2) using the nucleic acid in step 1) as a template to synthesize a complementary strand thereof; 3) performing complementary strand synthesis by means of a polymerase-catalyzed strand substitute complementary strand synthesis reaction to replace the synthesized complementary strand in step 2); wherein the nucleotide sequence of the oligonucleotide at the 5' end of the primer is substantially the same as a region synthesized by using the primer as a starting point.

Description

Method for synthesizing nucleic acid under constant temperature condition

Technical field

The present invention relates to the field of genetic engineering technology, and in particular, to a method for synthesizing nucleic acid under constant temperature conditions, in particular to a synthetic method for forming a special structural nucleic acid composed of a specific nucleotide sequence, and based on the specific nucleic acid A useful method of amplifying nucleic acids in a sequence.

Background technique

The most fundamental difference in the organisms carrying the genetic information of the organism, based on the complementarity analysis method of the nucleotide sequence, can directly analyze the genetic characteristics carried by the gene. This analysis is a very powerful method for identifying genetic diseases, cancer, microorganisms and the like. When the target gene content in the sample is very small, it is generally difficult to detect, so it is necessary to amplify the target gene or amplify the detection signal. As a method of amplifying target genes, the PCR method is considered to be the most classical method (Saiki, Gelfand et al. 1988), and is also the most common technique for nucleic acid sequence amplification in vitro. The exponential amplification result of this method makes it highly sensitive, and has established its position in the field of molecular biological method detection. After several decades of development, it has a series of mature products. In addition, amplification products are recyclable and are therefore widely used as an important tool to support genetic engineering techniques such as gene cloning and structural determination. However, the PCR method clearly has the following problems: in the actual operation, a special program temperature control system must be used; the exponential rise of the amplification reaction makes it difficult to quantify; the sample and the reaction solution are susceptible to external contamination, and the false positive problem is more prominent.

The current human genome project has been completed, and single nucleotide polymorphisms (SNPs) have shown a large number and wide distribution characteristics, so their analysis has gradually received attention. By designing primers to include SNPs in their nucleotide sequences, it is feasible to detect SNPs by PCR amplification, that is, by deciding whether or not a nucleotide sequence complementary to the primer is present, whether or not the reaction product is present can be inferred. However, once the complementary strand is accidentally synthesized in the PCR, the product is run as a template in the next reaction, which will result in erroneous results. In practical applications, if the primer ends are only one base different, it will be difficult to strictly control the PCR, so it is necessary to improve the specificity to make the PCR more suitable for the detection of SNPs.

On the other hand, scientists have also developed techniques for synthesizing nucleic acids under constant temperature conditions compared to the cumbersome process of temperature-controlled synthesis of nucleic acids (Zhao, Chen et al. 2015), mainly including the following: nucleic acid sequence-dependent amplification (NASBA), rolling circle amplification (RCA), strand displacement amplification (SDA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), and recombinant polymerase amplification (RPA).

NASBA, also known as TMA (Turning-Mediated Amplification Method), does not require complex temperature control. The method uses DNA polymerase to synthesize a target RNA as a template and a probe linked to a T7 promoter, and the second probe enters a double strand to generate a product, and then uses the generated double-stranded DNA as a template to pass T7 RNA polymerase. A large amount of RNA product is amplified by transcription. NASBA requires a heat denaturation step until double stranded DNA is formed, but the subsequent transcription reaction is carried out by isothermal conditions by T7 RNA polymerase. A variety of enzyme combinations such as reverse transcriptase, RNase H, DNA polymerase and T7 RNA polymerase must be used, however combinations of multiple enzymes are disadvantageous for cost. At the same time, due to the complex set of various enzyme reaction conditions, this method is difficult to generalize as a general analytical method.

RCA (Rolling Circle Amplification) is designed to mimic the rolling circle replication process of circular DNA in microorganisms. For circular single-stranded DNA templates, the primers combined with the template can only achieve circular nucleic acids in the original method. Amplification. In order to make the method universal for linear DNA amplification, a single-stranded DNA complementary to a padlock probe or a circular probe is shown to have a series of nucleotide sequences with a padlock probe or a circular probe. Complementary single-stranded DNA can be synthesized continuously in the presence of target nucleotides (Lizardi, Huang et al. 1998). This method also has the problem of requiring multiple enzymes. Moreover, the initiation of complementary strand synthesis depends on the reaction linking the two adjacent regions, and its specificity is substantially the same as in the LCR.

The Strand Displacement Amplification (SDA) method is also known as a method for amplifying a template DNA having a sequence complementary to a target sequence (Zhang, Cui et al. 1992). The SDA method uses a specific DNA polymerase to synthesize a complementary strand starting from the 3'-side complementary primer of the nucleotide sequence of interest to replace the double-stranded 5'-side sequence. Since the newly synthesized complementary strand replaces the 5'-side duplex, the technique is referred to as the SDA method. In the SDA method, the restriction enzyme recognition sequence is inserted as a primer into the annealing sequence to remove the temperature change step necessary in the PCR method. That is, the 3'-OH group is supplied as a synthetic starting point of the complementary strand by restriction enzyme-generated nicks, and the first synthesized complementary strand is released by strand displacement synthesis to release a single strand, and then used again as a template for the following complementary strand synthesis. However, SDA amplification products differ from natural nucleic acid structures and have limitations on the use of restriction enzymes to cleave or apply amplification products to gene cloning. This is also the main reason for the high cost. In addition, when the SDA method is applied to an unknown sequence, the nucleotide sequence of the same restriction enzyme recognition sequence for introducing a gap may exist in the region to be synthesized, thus possibly preventing the synthesis of the fully complementary strand.

Helicase-dependent Isothermal DNA Amplification (HAD) is a novel nucleic acid constant temperature amplification technique (Vincent, Xu et al. 2004) invented by researchers from NEB USA in 2004. This technique mimics the natural process of DNA replication in nature, using a helicase to unwind DNA double-strands under constant temperature conditions, while a single-stranded DNA-binding protein (SSB) is used to stabilize the unfolded single. The strands are provided with a binding template for the primers, which are then catalyzed by a DNA polymerase to synthesize a complementary strand. The newly synthesized double strand is decomposed into a single strand under the action of a helicase, and enters the above-mentioned cyclic amplification reaction as a template for the next round of synthesis, and finally achieves an exponential growth of the target sequence.

The core of LAMP technology (Notomi, Okayama et al. 2000) is to use four high-activity strands to replace DNA polymerases by designing four specific primers for six regions on the target gene, so that strand-replacement DNA synthesis is constantly self-circulating. . The technique can achieve 10 ⁹ -10 ¹⁰ times amplification in 15-60 minutes, and the reaction can produce a large amount of amplification product, namely magnesium pyrophosphate white precipitate. The presence or absence of white precipitate can be visually observed to determine whether the target gene exists. Japan Rongyan Company has also developed a turbidity meter to achieve real-time monitoring of amplification reactions. In addition to high specificity and high sensitivity, the LAMP method is very simple to operate. The requirements for the instrument are low in the application stage. A simple thermostat can realize the reaction. The result is also very simple. The white precipitate is directly observed by the naked eye. Green fluorescence can be used, which is a suitable method for on-site and base layer rapid detection. One of the limitations, because of the high specificity and sensitivity of the method depends on the nature of the four primers. The optimal primers usually require sequence alignment, online primer design, primer selection and specificity test. This process is very cumbersome. .

Recombinase Polymerase Amplification (RPA), the main point of which is that the protein-DNA complex formed by the combination of the recombinase and the primer can find homologous sequences in the double-stranded DNA. Once the primers have localized homologous sequences, subsequent strand displacement DNA polymerases will mediate strand exchange reactions and initiate DNA synthesis, exponentially amplifying the target region on the template. The replaced DNA strand binds to a single-stranded binding protein (SSB) to prevent further substitution. In this system, a synthetic event is initiated by two relative primers. The entire process proceeds very quickly and generally yields detectable levels of amplification products in less than ten minutes. However, it is necessary to screen primers that bind to the recombinase and have good specificity throughout the process, and the use of three enzymes will greatly increase the cost.

Liu Wei (Dong et al. 2015) of the Academy of Military Medical Sciences of the People's Liberation Army proposed a novel nucleic acid isothermal amplification technique called polymerase helix reaction (PSR), which uses the same enzyme as the LAMP reaction. The 5' end of the designed PCR primers is introduced into a specific sequence for amplification to form 5' and 3' ends which can self-assemble to form a closed helical structure to provide 3'-OH as a starting point for synthesis, and as an amplification initiation structure Then, a large number of DNA single strands of the same sequence are synthesized, and finally a long-chain helical structure product is formed. However, the introduction of foreign genes into the primer sequences of this method will greatly increase the likelihood of mismatches leading to erroneous results. In addition, the closed loop structure in the closed structure in the initial structure is only about 20 base pairs, which makes the intermolecular hydrogen bond weak and makes the spiral loop unstable, and if the length of the foreign gene is too long, Affect the spiral ring formation process.

Summary of the invention

The object of the present invention is to provide a method for synthesizing nucleic acid, which is inspired by the common double helix structure of DNA and the LAMP and PSR methods. The primer working mode is redesigned and planned based on PCR primers, and the amplification of the helical loop is initiated. Structure, designing the formation process of the structural loop, and having a new feature of overlapping bases with more base pairs, no introduction of foreign gene fragments, and amplification products can be reused. More specifically, it provides a novel low cost method for efficiently synthesizing nucleic acids by means of sequences. That is, it is an object of the present invention to provide a method for accomplishing nucleic acid synthesis and amplification by a single enzyme and isothermal conditions. Another object of the present invention is to provide a method for synthesizing nucleic acid, which is capable of rapidly synthesizing a highly specific nucleic acid which is difficult to achieve by modifying an existing nucleic acid synthesis reaction principle, and a method for amplifying a nucleic acid by the synthetic method .

The present invention utilizes a polymerase-catalyzed strand displacement type of complementary strand synthesis without complicated temperature control, which is beneficial to the synthesis of nucleic acids. The DNA polymerase is an enzyme used in methods such as SDA, RCA, LAMP, and PSR.

The present inventors have improved the supply of the known method 3'-OH, and as a result, it has been found that by using an oligonucleotide having a specific structure, a 3'-OH structure can be provided without any additional enzyme reaction, thereby obtaining the present invention. . That is, the present invention relates to a method of synthesizing a nucleic acid, a method of amplifying a nucleic acid by the nucleic acid synthesis method, and a kit to which the method is applied.

The technical solution of the invention is as follows:

The method for synthesizing nucleic acid under the constant temperature condition of the invention comprises the following steps:

1) Providing a nucleic acid having a 3' end which is annealed to the F1c region on the same chain a F1r region, and a simultaneous spiraling of the F1r region and the Flc region to form a spiral ring;

2) synthesizing its own complementary strand with the nucleic acid of step 1) as a template, the R1rc region of the complementary strand is annealed to the R1 region, and the 3' end of the F1r region annealed in the Flc region constitutes a helical loop as a starting point for synthesis;

3) performing complementary strand synthesis by polymerase catalytic strand displacement-type complementary strand synthesis reaction to replace the complementary strand synthesized in step 2), wherein the polynucleotide comprises one at its 3' end and in step 2) A sequence complementary to any region of the complementary complementary strand.

The method for synthesizing a nucleic acid according to the present invention, wherein the method for preparing the nucleic acid of step 1) comprises the steps of:

i) an annealing step of annealing the first oligonucleotide I to the F1c region of the template, wherein the 3' end of the template comprises an F1c region and an F2c region located on the 3' side of the F1c region, the 5' end of the template comprising the R1 region And an R2 region located on the 5' side of the R1 region, wherein the first oligonucleotide I includes an R1r region and an F1 region, and the Rlr region is connected to the 5' side of the F1 region, wherein

F1 region: a region having a nucleotide sequence complementary to the template F1c region,

R1r area: an area opposite to the template R1 area;

Ii) a step of synthesizing a first nucleic acid having a nucleotide sequence complementary to the template, the step of synthesizing a first nucleic acid using the F2 region of the first oligonucleotide I as a starting point for synthesis, The 3' end of the first nucleic acid has an F1 region which can anneal to a portion of the F1c region on the same chain, and a helical ring which can be formed by simultaneous annealing of the F1 region and the Flc region;

Iii) replacing the first nucleic acid synthesized in step ii) with a polymerase catalytic strand displacement reaction, wherein the first outer primer I annealed to the F2c region on the 3' side of F1c in the template is used as a starting point for synthesis, and

Iv) an annealing step of annealing the second oligonucleotide II to the R1c region of the first nucleic acid obtained in step iii), wherein the second oligonucleotide II comprises the R1 region and the F1r region, and the Flr region and the R1 region The 5' side is ligated, and the second oligonucleotide II is the reverse sequence of the first oligonucleotide I;

R1 region: a region having a nucleotide sequence complementary to the R1c region of the first nucleic acid,

Flr region: a region opposite to the F1 region of the first nucleic acid;

v) using the second oligonucleotide II as a starting point for synthesis, synthesizing a second nucleic acid, and replacing the second nucleic acid with a polymerase catalytic chain displacement reaction to obtain the nucleic acid of step 1); wherein, the second nucleic acid is replaced At the time, a second external primer II which anneals to the R2c region on the 3' side of R1c in the first nucleic acid serves as a starting point for the synthesis.

Further, the template of step i) is RNA, and the first nucleic acid in step ii) is synthesized by an enzyme having reverse transcriptase activity. The present invention is applicable to various RNAs such as RNA of various viruses and the like. For example, RNA detection for the MERS-CoV virus, such as: orf1a, orf1b segment of the RNA.

In the process of forming the initial helix, the sequence of the oligonucleotide used in the F1 region and the R1r region, or the sequence connecting the R1 region and the F1r region may be none, but if a linker (L) is introduced, The sequence must be a reverse sequence, ie, the two oligonucleotides are 5'-R1r-L-F1-3', and 5'-F1r-Lr-R1-3' must be a reverse complement sequence (L and Lr) R1r is the reverse sequence of R1, F1r is the reverse sequence of F1), and linker is generally a restriction endonuclease sequence.

A method of synthesizing a nucleic acid according to the present invention, wherein the synthetic nucleic acid is in one of its chains A nucleic acid having a first-tail complementary nucleotide sequence.

The method of synthesizing a nucleic acid according to the present invention, wherein the constant temperature means that the entire reaction process is carried out at a constant temperature of 60 to 65 °C.

A method of synthesizing a nucleic acid according to the present invention, wherein the melting temperature between each oligonucleotide and its complementary region in the template has the following relationship under the same stringent conditions: (external primer or template 3' side Region) ≤ (F2c or F2, and, R2c or R2) ≤ (F1c or F1, and, Rlc or Rl).

According to the method of synthesizing a nucleic acid of the present invention, preferably, the obtained second nucleic acid can be accelerated by introducing a method of accelerating the probe Xin, wherein Xin is an intermediate portion located in the F1 region to the R1 region.

The present invention can repeat steps 1) to 3) to synthesize long-chain nucleic acids using the complementary strand after the replacement of step 3).

The polymerase used in the polymerase catalytic chain displacement reaction of the present invention is Bst DNA polymerase, Bca (exo-) DNA polymerase, DNA polymerase I Klenow fragment, Vent DNA polymerase, Vent (Exo -) DNA polymerase (Vent DNA polymerase lacking exonuclease activity), Deep Vent DNA polymerase, Deep Vent (Exo-) DNA polymerase (Deep Vent DNA polymerase lacking exonuclease activity), Φ29phage One or more of DNA polymerase and MS-2phage DNA polymerase. Among them, Bst DNA polymerase or Bca (exo-) DNA polymerase is preferably used.

A method of synthesizing a nucleic acid according to the present invention, wherein a melting temperature adjusting agent can be added to the polymerase catalytic chain displacement reaction. Among them, the melting temperature adjusting agent is preferably a betaine, and further preferably, the concentration of the betaine in the reaction solution is allowed to be 0.2 to 3.0M.

The kit for synthesizing nucleic acid under constant temperature conditions of the invention, characterized in that the kit comprises:

An oligonucleotide I comprising an F1 region and an R1r region, wherein the R1r region is linked to the 5' side of the F1 region, wherein

F1 region: a region having a nucleotide sequence complementary to the F1c region of the template, and

R1r zone: a zone opposite to the R1 zone of the template;

An oligonucleotide II comprising an R1 region and an F1r region, wherein the F1r region is linked to the 5' side of the R1 region, wherein

R1 region: a region having a nucleotide sequence complementary to the R1c region of the template, and

F1r: the area opposite to the F1 area of the template;

a first primer I having a nucleotide sequence complementary to the F2c region on the 3' side of the F1c region of the nucleic acid as a template;

a second primer II having a nucleotide sequence complementary to the R2c region on the 3' side of the R1c region of the nucleic acid as a template;

a DNA polymerase that catalyzes a strand-replacement complementary strand synthesis reaction, and,

Nucleotide, which serves as a substrate for the DNA polymerase.

The kit according to the present invention, wherein the kit further comprises a detection reagent for detecting a nucleic acid synthesis reaction product.

The kit according to the present invention, wherein the kit further comprises an acceleration probe Xin, wherein Xin is a nucleotide segment located in the middle segment of the F1 region to the R1 region of the template, specifically, the Fin and Rin regions located between F1 and R1.

The kit according to the present invention, wherein the DNA polymerase is Bst DNA polymerase, Bca (exo-) DNA polymerase, DNA polymerase I Klenow fragment, Vent DNA polymerase, Vent (Exo-) One or more of DNA polymerase, Deep Vent DNA polymerase, Deep Vent (Exo-) DNA polymerase, Φ29phage DNA polymerase, and MS-2phage DNA polymerase. Among them, Bst DNA polymerase or Bca (exo-) DNA polymerase is preferably used.

The invention provides the use of the above kit for synthesizing nucleic acids or detecting target nucleotide sequences in a sample.

The method for synthesizing a nucleic acid according to the present invention provides a method for detecting a target nucleotide sequence in a sample, comprising performing amplification by the method for synthesizing a nucleic acid of the present invention using a target nucleotide as a template, and observing whether or not amplification is generated product.

A probe comprising a nucleotide sequence complementary to the formed helical loop is added to the above amplification product, and hybridization between the two is observed. It is also possible to label the probe on the particles and observe the aggregation reaction occurring by hybridization. The amplification method can be carried out in the presence of a nucleic acid detection reagent, and it is observed whether or not an amplification product is generated based on a signal change of the detection reagent.

The method for synthesizing a nucleic acid according to the present invention may further provide a method for detecting a mutation of a target nucleotide sequence in a sample, comprising performing amplification by a method for synthesizing a nucleic acid according to the present invention using a target nucleotide as a template. Among them, the mutation in the nucleotide sequence as a target of amplification hinders the synthesis of any complementary strand constituting the amplification method, thereby detecting the mutation.

A single-stranded nucleic acid having a complementary nucleotide sequence of the first and the tail is the object of the present invention, and the nucleic acid refers to a nucleic acid having a target nucleic acid sequence which is ligated side by side in a single strand with mutually complementary nucleotide sequences. Furthermore, a nucleotide sequence for helixing between complementary strands should be included in the present invention. This sequence is referred to as a helical loop sequence in the present invention. The nucleic acids synthesized by the present invention consist essentially of mutually complementary strands joined by a helical loop sequence. In general, a strand that cannot be separated into two or more molecules when paired bases are separated is referred to as a single strand, whether or not partially involved in base pairing. The complementary nucleotide sequence in the same strand can form base pairing, and the present invention can obtain the product of intramolecular base pairing by allowing base pairing of nucleic acids having a nucleotide sequence end-to-end linked in a single strand in the same strand. The product contains a region that constitutes a distinct double strand and a loop that does not involve base pairing.

That is, the nucleic acid of the present invention having a complementary nucleotide sequence end-to-end linked in a single strand can be defined as a single-stranded nucleic acid comprising a complementary nucleotide sequence capable of annealing in the same strand, and an annealing product thereof in a curved portion A loop that does not involve base pairing is constructed. A nucleotide having a complementary nucleotide sequence can be annealed to a loop that does not involve base pairing. The loop-forming sequence can be any nucleotide sequence. The loop-forming sequences are capable of base pairing to initiate synthesis of the complementary strand for substitution. Sequences different from the nucleotide sequences located in other regions are preferentially provided to obtain specific annealing.

The substantially identical nucleotide sequence in the present invention is defined as follows: when a complementary strand synthesized by using a sequence as a template anneals to a target nucleotide sequence to supply a starting point for synthesizing a complementary strand, the sequence is substantially identical to the target nucleotide sequence the same. For example, a sequence substantially identical to F1 includes not only the same sequence as F1 but also a nucleotide sequence that can serve as a template, which can give a nucleotide sequence annealed to F1 and can be used as a template. To synthesize the starting point of the complementary strand. The term "annealing" in the present invention refers to the formation of a nucleic acid of complementary structure by base pairing according to Watson-Crick's law. Therefore, even if the nucleic acid strands constituting the base pairing are single-stranded, annealing may occur if the complementary nucleotide sequences in the molecule are base-paired. The base-paired nucleic acid constitutes a double-stranded structure, so that the meanings expressed by annealing and hybridization of the present invention have overlapping portions.

The nucleotide sequence of the constituent nucleic acids of the invention is at least one. In the model contemplated by the present invention, the nucleotide sequence logarithm can be an integral multiple of one. In this case, the complementary nucleotide sequence of the constituent nucleotides of the present invention has no theoretical upper limit. When the synthetic product nucleic acid of the present invention consists of a plurality of sets of complementary nucleotide sequences, the nucleic acid is repeated by the same nucleotide. Sequence composition.

The single-stranded nucleotide having the head-to-tail complementary loop-forming sequence synthesized by the present invention may not have the same structure as the naturally occurring nucleic acid, and it is generally known that when a nucleic acid is synthesized by a nucleic acid polymerase, a nucleotide derivative is used as a nucleotide derivative. A substrate can synthesize a nucleic acid derivative. Nucleotide derivatives used include radioisotope labeled nucleotides or nucleotide derivatives that bind to a ligand tag such as biotin or digoxin. These nucleotide derivatives can be used to label product nucleic acids. Alternatively, if the substrate is a fluorescent nucleotide, the product nucleic acid may be a fluorescent derivative. Moreover, the product may be DNA or RNA. The resulting product is determined by a combination of a primer structure for realizing the polymerization of the nucleic acid, a type of the polymerization substrate, and a reagent for the polymerization.

The synthesis of a nucleic acid having the above structure is carried out by using a DNA polymerase having a strand displacement activity and the F1r region having a portion of the Flc region on the same strand at the 3'-end to form a synthetic complementary strand. There are many reports on the synthesis reaction of complementary strands, in which a hairpin loop is formed, the hairpin loop sequence itself is used as a template, and a spiral loop is formed, and the loop loop sequence itself is used as a template, and in the present invention, the head and tail portions of the loop are provided. A region capable of base pairing and having new features for utilizing this region in the synthesis of complementary strands. By using this region as a starting point for synthesis, the complementary strand previously synthesized with the helical loop sequence itself as a template was replaced.

The term "nucleic acid" is used in the present invention, and the nucleic acid of the present invention generally includes both DNA and RNA. However, nucleic acids or modified nucleotides derived from natural DNA or RNA whose nucleotides are replaced by artificial derivatives, which function as templates for the synthesis of complementary strands, are also included in the nucleic acid range of the present invention. Typically, the nucleic acids of the invention are included in biological samples, including tissues, cells, cultures and secretions of animals, plants or microorganisms, and extracts thereof. Biological samples of the invention include intracellular parasite genomic DNA or RNA, such as viruses or mycoplasmas. The nucleic acids of the invention are typically derived from a nucleic acid contained in the biological sample. For example, a nucleic acid which is synthesized from mRNA and which is amplified based on a nucleic acid derived from a biological sample is a typical example of the nucleic acid of the present invention.

The nucleic acid of the present invention is characterized in that the F1r region is provided at the 3'-end, and can be annealed with a portion of Flc on the same chain, and the F1r region is annealed with Flc on the same chain to form an R1 region including base pairing. The loop can be obtained in a variety of ways.

The terms "identical" and "complementary" as used in constituting the nucleotide sequence features of the oligonucleotides of the present invention are not meant to be absolutely identical and absolutely complementary. That is, a sequence identical to a sequence includes a sequence complementary to a nucleotide sequence annealed to a sequence. On the other hand, the complementary sequence is a sequence that can be annealed under stringent conditions, providing a 3'-end as a starting point for the synthesis of the complementary strand.

In the present invention, an oligonucleotide is a nucleotide that satisfies two requirements, i.e., must be capable of forming a complementary base pairing, and supplying an -OH group at the 3'-end is a starting point for complementary strand synthesis. Therefore, its main chain is not necessarily limited to phosphorus The acid diester bond is a linkage. For example, it may be composed of a phosphorothioate derivative or a peptide-based peptide nucleic acid, and the phosphorothioate derivative is S-substituted O. Bases are those bases that are complementary to each other. There are five bases naturally occurring, namely A, C, T, G and U, and the base may also be an analogue such as bromodeoxyuridine. Preferably, the oligonucleotide of the present invention can be used not only as a starting point for synthesis but also as a template for complementary strand synthesis. The term polynucleotide of the invention includes oligonucleotides. The term "polynucleotide" as used herein has a chain length that is not limited, and the term "oligonucleotide" as used herein refers to a polymer of nucleotides having a relatively short chain length.

In the various nucleic acid synthesis reactions described below, under the given conditions, the oligonucleotide strand of the present invention has such a length that it can base pair with the complementary strand and maintain a certain specificity. Specifically, it consists of 5 to 200 bases, more preferably 10 to 50 base pairs. The known polymerase is identified to have a chain length of at least 5 bases. The polymerase catalyzes a nucleic acid synthesis reaction that relies on the sequence. Therefore, the chain length of the annealed portion should be longer than this length. In addition, it is statistically desirable to lengthen 10 bases or longer to obtain target nucleotide specificity. On the other hand, it is difficult to prepare a nucleotide sequence too long by chemical synthesis. Therefore the above chain length is an example of a desired range. The chain length of the illustration refers to the chain length of the portion that anneals to the complementary strand. As described below, the oligonucleotides of the invention may eventually anneal at least to the two regions, respectively. Thus, the chain length exemplified herein is understood to be the chain length of each region that makes up the oligonucleotide.

Furthermore, the oligonucleotides of the invention may be labeled with known labels. Labels include binding ligands such as digoxin and biotin, enzymes, fluorescents, illuminants, and radioisotopes. A technique for replacing a base constituting an oligonucleotide by a fluorescent analog is well known (W095/05391, Proc. Natl. Acad. Sci. USA, 91, 6644-6648, 1994).

Other oligonucleotides of the invention may also be incorporated into a solid phase. Alternatively, any portion of the oligonucleotide may be labeled with a binding ligand, such as biotin, indirectly by a binding ligand such as immobilized avidin. When the immobilized oligonucleotide is the starting point of synthesis, the nucleic acid of the synthetic reaction product is captured by the solid phase, which will facilitate its separation. The separated fraction can be detected by nucleic acid specific indicators or by hybridization with a labeled probe. The nucleic acid product obtained by the present method is recovered for a target nucleic acid fragment in which the target nucleic acid fragment can be digested by a restriction enzyme.

The term "template" as used in the present invention refers to a nucleic acid used as a template for the synthesis of a complementary strand. A complementary strand having a nucleotide sequence complementary to a template means a strand corresponding to the template. But the relationship between the two is only relative. That is, the synthesized complementary strand can once again function as a template. That is, the complementary strand can also serve as a template.

In the present invention, if the target is RNA, it can be composed only by adding a reverse transcriptase, that is, using RNA as a template, annealing of F1 and F1c in the template by reverse transcriptase is possible to synthesize a complementary strand and from annealing to F2c. Primer F2 synthesizes the complementary strand for the synthetic starting point and simultaneously replaces the previously synthesized complementary strand, and the outer primer F2 is located on the 3'-side of F1c. When reverse transcriptase uses DNA as a template to synthesize a complementary strand, all reactions that synthesize a complementary strand by reverse transcriptase include the synthesis of a complementary strand that uses R1 annealed to Rlc as a starting point for synthesis. In the displacement reaction as a template; the synthesis of the complementary strand with R2 annealed to R2c as a starting point for synthesis and simultaneous strand displacement, R2 is located on the 3'-side of R2c. When it is not expected that the reverse transcriptase exhibits DNA/RNA strand displacement activity under the given reaction conditions, a DNA polymerase having the strand displacement activity as described above can be bound. The mode of obtaining the first single-stranded nucleic acid using RNA as a template as described above is a preferred mode of the invention. On the other hand, if a DNA polymerase having both strand displacement activity and reverse transcriptase activity, such as Bca DNA polymerase, is used, the first single-stranded nucleic acid from the RNA is passed through the same enzyme. The synthesis, and then the DNA-templated reaction can be similarly carried out.

The reaction is carried out in the presence of the following components, enabling the enzyme to react in a buffer of suitable pH, annealing or maintaining the essential salts of enzyme catalytic activity, protecting the medium of the enzyme, and regulating the melting temperature (Tm). For buffers, for example, Tris-HCl, which has a buffering effect in the neutral or weakly alkaline range, is used. According to the DNA polymerase used, the pH value is adjusted, and an appropriate amount of salt, KCl, NaCl, (NH4) ₂ SO _{4 is} added to maintain the activity of the enzyme and regulate the melting temperature (Tm) of the nucleic acid, and the medium for protecting the enzyme uses bovine serum white. Protein or sugar. In addition, dimethyl sulfoxide (DMSO) or formamide is generally used as a regulator of the melting temperature (Tm). Modulation of the oligonucleotide is achieved by annealing of the oligonucleotide under defined temperature conditions using a melting temperature (Tm) regulator. Moreover, betaine (N,N,N-trimethylglycine) or tetraalkylammonium (tetraalkyl) is also effective for improving the efficiency of strand displacement by its isostabilization. The desired promotion of nucleic acid amplification by the present invention can be obtained by adding 0.2-3.0 M betaine, preferably 0.5-1.5 M, to the reaction solution. Since these melting temperature regulators have the effect of lowering the melting temperature, those suitable rigor and reactivity conditions are combined with the salt concentration, reaction temperature, etc., empirically.

An important feature of the present invention is that a series of reactions cannot be performed unless the positional relationship of many zones is maintained. Due to this feature, non-specific synthetic reactions accompanying non-specific synthesis of complementary strands are effectively prevented. That is, even if a non-specific reaction occurs, the possibility of the product as a starting material in the subsequent amplification step is reduced, and the progress of the reaction is regulated by many regions, possibly resulting in similar nucleotides. A detection system in the sequence that accurately identifies the desired product can be constructed arbitrarily.

The nucleic acid synthesized by the present invention is a single strand, and in the case of a single strand, consists of a complementary nucleotide sequence, most of which are base-paired. By utilizing this feature, the synthesized product can be detected. By carrying out the method of synthesizing nucleic acid of the present invention, in the presence of a fluorescent dye as a double-specific intercalater such as ethidium bromide, SYBR Green I, Pico Green or Eva Green, as the product increases, it can be observed. The intensity of the fluorescence increases. By monitoring the fluorescence intensity, it is possible to track the progress of a real-time synthesis reaction in a closed system. It is also conceivable to apply this type of detection system in the PCR method, but there are many problems because the product signal and the signal of the primer dimer cannot be distinguished. However, when the system of the present invention is applied, the ability to increase non-specific base pairing is very low, and therefore, it is expected that high sensitivity and low interference may be simultaneously obtained, similar to the application of a double-specific intercalater. The transfer of fluorescent energy can be utilized in the same system to implement a method of detecting the system.

The method of synthesizing a nucleic acid of the present invention is supported by a DNA polymerase catalyzed synthesis of a strand displacement type complementary strand reaction. The reaction step of the unnecessary strand displacement type polymerase is also included during the above reaction. However, in order to simplify the constitutive agent and economical viewpoint, it is advantageous to use a DNA polymerase, the following enzymes are known. Furthermore, various mutants of these enzymes can be utilized in the scope of the present invention, all of which have sequence-dependent activity and strand displacement activity for complementary strand synthesis. The mutant refers to a mutant including those having only the catalytic activity required to cause the enzyme or those modified by catalytic activity, stability or thermostability by, for example, mutation in an amino acid.

Bst DNA polymerase

Bca(exo-)DNA polymerase

DNA polymerase I Klenow fragment

Vent DNA polymerase

Vent (Exo-) DNA polymerase (Vent DNA polymerase lacking exonuclease activity)

Deep Vent DNA Polymerase

Deep Vent (Exo-) DNA polymerase (Deep Vent DNA polymerase lacking exonuclease activity)

Φ29phage DNA polymerase

MS-2phage DNA polymerase

Among these enzymes, Bst DNA polymerase or Bca (exo-) DNA polymerase are particularly desirable enzymes because they have some degree of thermal stability and high catalytic activity. In a preferred embodiment, the reaction of the present invention can be achieved isothermally, but due to the adjustment of the melting temperature (Tm) or the like, it is not always possible to utilize the desired temperature conditions to maintain the stability of the enzyme. Therefore, it is one of the conditions required for the thermal stability of the enzyme. Although isothermal reactions are feasible, thermal denaturation can provide nucleic acids as an initial template, and in this regard, the use of thermostable enzymes broadens the choice of protocol.

The various reagents necessary for the synthesis or amplification of nucleic acids of the present invention may be pre-packaged and provided in the form of a kit. Specifically, the kit provided by the present invention comprises a primer synthesized as a synthetic complementary strand and used for a displacement reaction. Various oligonucleotides necessary for external primers, substrate dNTPs for complementary strand synthesis, DNA polymerases for strand-replacement complementary strand synthesis, buffers for providing suitable conditions for enzymatic reactions, and for detection The medium necessary to synthesize the reaction product. In particular, in a preferred mode of the invention, the reagents which are added during the reaction are not required, and thus the reagents which are necessary for the reaction after the reaction to the reaction vessel, wherein the reaction can be initiated only by the addition of the sample. A system for detecting a reaction product in a container by utilizing a visible light signal or a fluorescent signal. It is not necessary to open and close the container after the reaction. This is very beneficial for preventing pollution.

The present invention synthesizes a single-stranded nucleic acid having a nucleotide sequence in which the head-to-tail sequence can be annealed to a loop. The nucleic acid has, for example, the following utility: The first feature is the advantage of utilizing a specific structure having a complementary sequence in one molecule, which may facilitate detection, ie, a system known to detect nucleic acids, wherein the signal of the change depends on Base pairing with a complementary nucleotide sequence. For example, a detection system that fully utilizes the characteristics of the synthetic product of the present invention can be realized by a method in which a double-strand specific intercalating agent is used in combination as a detecting reagent as described above. If the product of the synthesis reaction of the present invention undergoes a thermal denaturation in the detection system and returns to the original temperature, intramolecular annealing preferentially occurs, and thus allows rapid base pairing between the complementary sequences. If non-specific products are present, they do not have complementary sequences in the molecule such that after separation by thermal denaturation into two or more molecules, they do not immediately return to the original duplex. The interference accompanying the non-specific reaction is reduced by the thermal denaturation step provided prior to the detection. If the DNA polymerase used is not resistant to heat, the thermal denaturation step has the meaning of termination of the reaction and thus facilitates control of the reaction temperature.

A second feature is the often closed loop that forms a base-paired end-to-end linkage. The structure of the base-pairable loop is shown in Figure 3. As seen in Figure 3, the loop consists of nucleotide sequences F1, R1, F1c, R1c which can be subjected to intramolecular annealing to form a closed loop.

According to a preferred mode of the invention, a large number of base-pairable loops are supplied in a single-stranded nucleic acid. This means that a large number of probes can hybridize to one molecule of nucleic acid to allow for highly sensitive detection. So it is not only possible to achieve improvements Sensitivity may also enable methods for detecting nucleic acids based on specific reaction principles such as aggregation. For example, a probe immobilized on a fine particle such as polystyrene latex is added to the reaction product of the present invention, and aggregation of the latex particles is observed to hybridize the product to the probe. The intensity of the aggregation is highly sensitive and quantitatively observed by optical measurement. Alternatively, the aggregation can be observed by the naked eye, so that a reaction system without an optical measuring device can also be established.

Furthermore, the reaction products of the invention allow for some bindable labels in which each nucleic acid molecule can be chromatographed. In the field of immunoassay, the actual application is an analytical method (immunochromatography) using a chromatographic medium using visible detection marks. The method is based on the principle that the analyte is sandwiched between an antibody immobilized on a chromatographic medium and a labeled antibody, and the unreacted labeled component is eluted. The reaction product of the invention applies this principle to nucleic acid analysis. That is, a labeled probe for the loop portion is prepared and immobilized on a chromatographic medium to prepare a capture probe for capture to allow analysis in the chromatographic medium. A capture probe whose sequence is complementary to a loop moiety is utilized. Since the reaction product of the present invention has a large number of loops, the product combines with a large number of labeled probes to give a visually identifiable signal.

The reaction products of the present invention are often capable of providing base-paired loop regions, which can broaden various other detection systems. For example, it is feasible to use a surface cytoplasmic genome to detect a portion of the loop portion using a fixed probe. Furthermore, if the probe of the loop portion is labeled with a double-stranded specific insert, a more sensitive fluorescence assay can be performed. Or the ability to actively utilize the present invention to synthesize nucleic acids is on the 3'- and 5'- sides to form base-pairing helical loops. For example, designing a loop to have a common nucleotide sequence between normal and abnormal types, and designing other loops to make a difference therein. It is possible to form a characteristic analysis system by confirming the presence of a gene in the common portion by the probe and confirming the abnormal presence in other regions. Since the reaction for synthesizing nucleic acids of the present invention can also be carried out isothermally, it is worth mentioning that real-time analysis can be performed by a general fluorophotometer. Until then, the structure of the nucleic acid to be annealed in the same chain is known. However, the nucleic acid obtained by the present invention having a single-tail annealed loop-like sequence single strand is novel and contains a large number of loops which can be paired with other bases.

On the other hand, a large number of loops given by the reaction product of the present invention can be used as probes, for example, in a DNA chip, probes are densely packed in a limited area, and the technique can be fixed in a certain area. The number of oligonucleotides is limited, so that a large number of annealable probes can be immobilized by high density by using the product of the present invention, that is, the reaction product of the present invention can be used as a fixed probe on a DNA chip, and the reaction product can be passed after amplification. Any technique known in the art can be immobilized, or a fixed oligonucleotide can be used as the oligonucleotide of the amplification reaction of the present invention, resulting in the formation of a fixed reaction product. Therefore, by using a fixed probe, a large amount of sample DNA is hybridized in a limited area, and as a result, a high signal value is expected.

DRAWINGS

Figure 1 is a graphical representation of the steps of the synthesis of a first nucleic acid of the invention.

Figure 2 is a graphical representation of the steps of the synthesis of a second nucleic acid of the invention.

Figure 3 is a diagram showing the structure of a ring formed by the single-stranded nucleic acid of the present invention.

Figure 4 is a diagram showing the acceleration of the loop structure formed by the single-stranded nucleic acid of the present invention by the addition of additional primers.

Figure 5 is a graph showing the positional relationship of each nucleotide sequence constituting an oligonucleotide in the target nucleotide sequence of MERS-orf1b.

Fig. 6 is a photograph showing the results of agarose electrophoresis of a product obtained by a method of synthesizing a single-stranded nucleic acid of the present invention using MERS-orf1b as a template.

Lane 1: Biyuntian O0107DNA Ladder

Lane 2: 1fmol MERS-orf1b dsDNA

Figure 7 is a graph showing the positional relationship of each nucleotide sequence constituting an oligonucleotide in the target nucleotide sequence of MERS-orf1b.

Fig. 8 is a photograph showing the results of agarose gel electrophoresis of a restriction enzyme digestion product obtained in Example 1 by the nucleic acid synthesis reaction of the present invention. among them,

Lane 1: Biyuntian O0107DNA Ladder;

Lane 2: 1fmol MERS-orf1b dsDNA;

Lane 3: HindIII digestion of the purified product.

Figure 9 is a graph showing the real-time fluorescence of an increase in DNA containing the MERS-orf1b target nucleotide sequence under the action of a primer.

Figure 10 is a graph showing the real-time fluorescence curve of the increase in DNA containing the MERS-orf1b target nucleotide sequence under the action of the primer.

Figure 11 is a graph showing the fluorescence intensity of the amplification system of different DNA target concentrations as a function of reaction time under the action of primers by the addition of accelerated primers.

Figure 12 is a schematic flow diagram of a method of synthesizing a nucleic acid of the present invention.

Figure 13 is a schematic representation of the helical structure of the nucleic acid synthesized in the present invention.

detailed description

The experimental methods used in the following examples are all conventional methods unless otherwise specified, and can be specifically referred to the specific methods listed in the book "Molecular Cloning Experiment Guide" (Third Edition) J. Sambrook, or The kits and product specifications are carried out; the materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 for amplification of fragments in MERS-orf1b

The nucleic acid of the present invention having a complementary strand joined to the single strand in the form of a helical loop was attempted using MERS-orf1b (from GenBank: NM_001012270.1) as a template. Four primers, Mo1bHF, Mo1bHR, Mo1bF2 and Mo1bR2, were used in the experiment. Mo1bF2 and Mo1bR2 are external primers that replace the first nucleic acid obtained by using Mo1bHF and Mo1bHR as synthesis starting points, respectively. Because the external primers after synthesis by Mo1bHF (or Mo1bHR) are primers for the starting point of complementary strand synthesis. These are designed to anneal to a zone of the ring by utilizing adjacent stacking phenomena. Furthermore, setting these primers to a high concentration preferentially causes annealing of Mo1bHF (or Mo1bHR).

The nucleotide sequences constituting each primer are shown in the sequence listing, and the structural features of the primers are summarized below. Furthermore, the positional relationship for each region of the target nucleotide sequence is shown in FIG.

The combination of the reaction solutions of the method of synthesizing the nucleic acid of the present invention by these primers is shown in Table 1 below.

Table 1 Primer and Oligonucleotide Information

Through the primers, a nucleic acid in which R1 and R1rc, F1c and F1r are complementary to a helical loop is synthesized. The combination of the reaction solutions of the method of synthesizing the nucleic acid of the present invention by these primers is shown below.

Reaction solution combination (25 μL)

20mM Tris-HCl pH8.8

10mM KCl

10mM(NH ₄ ) ₂ SO ₄

14mM MgSO ₄

0.1% Triton X-100

1M betaine

1.25mM dNTP

8U Bst DNA Polymerase (NEW ENGLAND Biolabs)

Primer:

1600nM Mo1bHF/SEQ ID NO.l

1600nM Mo1bHR/SEQ ID NO.2

200nM Mo1bF2/SEQ ID NO.3

200nM Mo1bR2/SEQ ID NO.4

Target: MERS-orf1b dsDNA/SEQ ID NO. 5

The specific nucleotide sequences are as follows:

SEQ ID NO. 1: GTACGAAGGGCATTACGCTCTCGTGTTATTTCCAGG;

SEQ ID NO. 2: GGACCTTTATTGTGCTCTCGCATTACGGGAAGCATG;

SEQ ID NO. 3: TACCCGCAAATGTCCCATA;

SEQ ID NO. 4: TGTAGAGGCACATTGGTG;

SEQ ID NO. 5:

The mixture was reacted at 63 ° C for 1 hour, and after the reaction, the reaction was terminated at 80 ° C for 10 minutes, and then transferred to water pre-cooled with ice.

Confirmation of the reaction: 1 μL of the loading buffer was applied to 5 μL of the above reaction solution, and the sample was electrophoresed on a GelRed pre-stained (Biotum) 1% agarose gel (TAE dissolution) at 90 mV for 1 hour. With Biyun Day O0107 DNA Ladder is used as a molecular weight marker. The gel after electrophoresis is used to verify the nucleic acid. The results are shown in Figure 6, with each lane being relative to the sample below.

1. molecular weight marker DNA ladder

2. 1fmol M13mpl8dsDNA.

Example 2 confirmed the reaction product by restriction enzyme digestion

In order to clarify the nucleic acid structure obtained in Example 1 of the present invention having a complementary nucleotide sequence linked in a single chain in a cyclic structure, the product was digested with a restriction enzyme. If a theoretical fragment is produced by digestion, and at the same time, there is no such phenomenon that the high molecular weight observed in Example 1 produces an unclear strip pattern and a band that is not electrophoresed, and any of these products can be expected to be present. A nucleic acid having a complementary sequence alternately linked within a single strand is invented.

The reaction solution in Example 1 was deposited and purified by treatment with phenol and ethanol, and the resulting precipitate was recovered and redissolved in ultrapure water, digested with restriction enzyme HindIII at 37 ° C for 2 hours, and the sample was pretreated at 90 mV in GelRed. The stained (Biotum) 1% agarose gel (TAE dissolution) was electrophoresed for 1 hour. The Biyuntian O0107 DNA Ladder was used as the molecular weight marker. The gel after electrophoresis is used to verify the nucleic acid. The results are shown in Figure 7, with each lane being relative to the sample below.

1. molecular weight marker DNA ladder

2. 1fmolM13mpl8dsDNA

3 purified product HindIII digestion

Example 3 Verification of Reaction Products Using EvaGreen

Similar to SYBR Green I, EvaGreen is a dye with a green excitation wavelength that binds to all dsDNA double helix minor groove regions, and its inhibition of nucleic acid amplification reactions such as PCR is much smaller than the latter. In the free state, EvaGreen emits a weak fluorescence, but once bound to double-stranded DNA, the fluorescence is greatly enhanced. Therefore, the fluorescence signal intensity of EvaGreen is related to the amount of double-stranded DNA, and the amount of double-stranded DNA present in the nucleic acid amplification system can be detected based on the fluorescence signal.

The combination of the reaction solutions of the method of synthesizing the nucleic acid of the present invention by these primers is shown below.

Reaction solution combination (25 μL)

20mM Tris-HCl pH8.8

10mM KCl

10mM(NH ₄ ) ₂ SO ₄

14mM MgSO ₄

0.1% Triton X-100

1M betaine

1.25mM dNTP

8U Bst DNA Polymerase (NEW ENGLAND Biolabs)

1X EvaGreen (Biotum)

120μM

Primer:

1600nM Mo1bHF/SEQ ID NO.l

1600nM Mo1bHR/SEQ ID NO.2

200nM Mo1bF2/SEQ ID NO.3

200nM Mo1bR2/SEQ ID NO.4

Target: MERS-orf1b dsDNA/SEQ ID NO. 5

Set ABI StepOne real time PCR reaction temperature is constant at 63 ° C, reaction time is 75 min. The curve of the fluorescence intensity as a function of reaction time is shown in Fig. 8. Fluorescence detection is applied to the purpose of real-time monitoring, and the results can be judged in advance by real-time amplification curves.

Example 4 Application of EvaGreen-based real-time fluorescence comparison of target gene amplification at different concentrations

Reaction solution combination (25μL) eight tubes

20mM Tris-HCl pH8.8

10mM KCl

10mM(NH ₄ ) ₂ SO ₄

14mM MgSO ₄

0.1% Triton X-100

1M betaine

1.25mM dNTP

8U Bst DNA Polymerase (NEW ENGLAND Biolabs)

1X EvaGreen (Biotum)

Primer:

1600nM Mo1bHF/SEQ ID NO.l

1600nM Mo1bHR/SEQ ID NO.2

200nM Mo1bF2/SEQ ID NO.3

200nM Mo1bR2/SEQ ID NO.4

Target: MERS-orf1b dsDNA/SEQ ID NO. 5

The same reaction solution was set to 8 tubes, and only the addition of the target was 10 ⁸ Copies, 10 ⁷ Copies, 10 ⁶ Copies, 10 ⁵ Copies, 10 ⁴ Copies, 10 ³ Copies, 10 ² Copies, pure water (0 Copies).

Set ABI StepOne real time PCR reaction temperature is constant at 63 ° C, reaction time is 90 min. The curves of the fluorescence intensity of the amplification system with different target concentrations as a function of reaction time are shown in Fig. 9. This result indicates that the results obtained by the method of the present invention have a good linear relationship and can be applied to quantitative detection of target nucleic acids.

Example 5 Application of EvaGreen-based real-time fluorescence comparison of different concentrations of RNA target gene amplification

AMV reverse transcriptase can synthesize cDNA using RNA as a template, and Bst DNA polymerase can detect RNA.

Reaction solution combination (25 μL)

20mM Tris-HCl pH8.8

10mM KCl

10mM(NH ₄ ) ₂ SO ⁴

14mM MgSO ₄

0.1% Triton X-100

1M betaine

1.25mM dNTP

8U Bst DNA Polymerase (NEW ENGLAND Biolabs)

10U AMV reverse transcriptase

1X EvaGreen (Biotum)

Primer:

1600nM Mo1bHF/SEQ ID NO.l

1600nM Mo1bHR/SEQ ID NO.2

200nM Mo1bF2/SEQ ID NO.3

200nM Mo1bR2/SEQ ID NO.4

Target: MERS-orf1b ssRNA/SEQ ID NO.5

The same reaction solution was set to 8 tubes, and only the addition of the target was different, respectively, 10 ⁸ Copies, 10 ⁷ Copies, 10 ⁶ Copies, 10 ⁵ Copies, 10 ⁴ Copies, 10 ³ Copies, 10 ² Copies, pure water (0 Copies) .

Set ABI StepOne real time PCR reaction temperature is constant at 63 ° C, reaction time is 90 min. The curves of the fluorescence intensity of the amplification system with different target concentrations as a function of reaction time are shown in FIG. This result indicates that the method is equally feasible for RNA detection.

Example 6 Application of Fin for amplification of target genes of different concentrations

Reaction solution combination (25μL) eight tubes

20mM Tris-HCl pH8.8

10mM KCl

10mM(NH ₄ ) ₂ SO ⁴

14mM MgSO ₄

0.1% Triton X-100

1M betaine

1.25mM dNTP

8U Bst DNA Polymerase (NEW ENGLAND Biolabs)

1X EvaGreen (Biotum)

Primer:

1600nM Mo1bHF/SEQ ID NO.l

1600nM Mo1bHR/SEQ ID NO.2

200nM Mo1bF2/SEQ ID NO.3

200nM Mo1bR2/SEQ ID NO.4

800nM Mo1bFin/SEQ ID NO.6

800nM Mo1bFin/SEQ ID NO.7

Target: MERS-orf1b dsDNA/SEQ ID NO. 5

The specific nucleotide sequences of the Fin and Rin primers are as follows:

SEQ ID NO. 6: ACAGTTCCTGGATATCCTAAGCT;

SEQ ID NO. 7: ACAGCCTCTTCACGAGTAATG.

The same reaction solution was set to 8 tubes, and only the addition of the target was different, respectively, 10 ⁶ Copies, 10 ⁵ Copies, 10 ⁴ Copies, 10 ³ Copies, 10 ² Copies, 10 ¹ Copies, 10 ⁰ Copies, pure water ( ⁰ Copies) .

Set ABI StepOne real time PCR reaction temperature is constant at 63 ° C, reaction time is 75 min. The curves of the fluorescence intensity of the amplification system with different target concentrations as a function of reaction time are shown in FIG. This result is in contrast to the results in Example 6 indicating that the addition of Fin oligonucleotides significantly reduces the amplification time.

The invention may, of course, be embodied in various other embodiments and various modifications and changes can be made by those skilled in the art without departing from the spirit and scope of the invention. Changes and modifications are intended to be included within the scope of the appended claims.

Claims

A method for synthesizing nucleic acids under constant temperature conditions, comprising the steps of:

1) Providing a nucleic acid having a 3' end having an F1r region annealed to an F1c region on the same chain, and forming a helical ring by simultaneous annealing of the F1r region and the Flc region;

2) synthesizing its own complementary strand with the nucleic acid of step 1) as a template, the R1rc region of the complementary strand is annealed to the R1 region, and the 3' end of the F1r region annealed in the Flc region constitutes a helical loop as a starting point for synthesis;

3) performing complementary strand synthesis by polymerase catalytic strand displacement-type complementary strand synthesis reaction to replace the complementary strand synthesized in step 2), wherein the polynucleotide comprises one at its 3' end and in step 2) A sequence complementary to any region of the complementary complementary strand.
The method for synthesizing a nucleic acid according to claim 1, wherein the step 1) the method for preparing the nucleic acid comprises the steps of:

i) an annealing step of annealing the first oligonucleotide I to the F1c region of the template, wherein the 3' end of the template comprises an F1c region and an F2c region located on the 3' side of the F1c region, the 5' end of the template comprising the R1 region And an R2 region located on the 5' side of the R1 region, wherein the first oligonucleotide I includes an R1r region and an F1 region, and the Rlr region is connected to the 5' side of the F1 region, wherein

F1 region: a region having a nucleotide sequence complementary to the template F1c region,

R1r area: an area opposite to the template R1 area;

Ii) a step of synthesizing a first nucleic acid having a nucleotide sequence complementary to the template, the step of synthesizing a first nucleic acid using the F2 region of the first oligonucleotide I as a starting point for synthesis, The 3' end of the first nucleic acid has an F1 region annealed to a portion of the F1c region on the same chain, and a helical ring formed by simultaneous annealing of the F1 region and the Flc region;

Iii) replacing the first nucleic acid synthesized in step ii) with a polymerase catalytic strand displacement reaction, wherein the first outer primer I annealed to the F2c region on the 3' side of F1c in the template is used as a starting point for synthesis, and

Iv) an annealing step of annealing the second oligonucleotide II to the R1c region of the first nucleic acid obtained in step iii), wherein the second oligonucleotide II comprises the R1 region and the F1r region, and the Flr region and the R1 region The 5' side is ligated, and the second oligonucleotide II is the reverse sequence of the first oligonucleotide I;

R1 region: a region having a nucleotide sequence complementary to the R1c region of the first nucleic acid,

Flr region: a region opposite to the F1 region of the first nucleic acid;

v) using the second oligonucleotide II as a starting point for synthesis, synthesizing a second nucleic acid, and replacing the second nucleic acid with a polymerase catalytic chain displacement reaction to obtain the nucleic acid of step 1); wherein, the second nucleic acid is replaced At the time, a second external primer II which anneals to the R2c region on the 3' side of R1c in the first nucleic acid serves as a starting point for the synthesis.
The method of synthesizing a nucleic acid according to claim 2, wherein the template of step i) is RNA, and the first nucleic acid in step ii) is synthesized by an enzyme having reverse transcriptase activity.
The method of synthesizing a nucleic acid according to any one of claims 1 to 3, wherein the nucleic acid synthesized in the step 3) is a nucleic acid having a head-to-tail complementary nucleotide sequence in one of its strands.
A method of synthesizing a nucleic acid according to any one of claims 1 to 3, characterized in that the melting temperature of each oligonucleotide with its complementary region in the template has the following relationship: (external primer or template) 3' side region) ≤ (F2c or F2, and, R2c or R2) ≤ (F1c or F1, and, Rlc or Rl).
The method of synthesizing a nucleic acid according to claim 2, wherein the obtained second nucleic acid accelerates nucleic acid amplification by introducing a method of accelerating the probe Xin, wherein Xin is an intermediate portion located in the F1 region to the R1 region. .
The method for synthesizing a nucleic acid according to any one of claims 1 to 3, wherein the nucleic acid is synthesized by repeating steps 1) to 3) by using the complementary strand after the step 3) as a template.
A kit for synthesizing nucleic acids under constant temperature conditions, characterized in that the kit comprises:

An oligonucleotide I comprising an F1 region and an R1r region, wherein the R1r region is linked to the 5' side of the F1 region, wherein

F1 region: a region having a nucleotide sequence complementary to the F1c region of the template, and

R1r zone: a zone opposite to the R1 zone of the template;

An oligonucleotide II comprising an R1 region and an F1r region, wherein the F1r region is linked to the 5' side of the R1 region, wherein

R1 region: a region having a nucleotide sequence complementary to the R1c region of the template, and

F1r: the area opposite to the F1 area of the template;

a first primer I having a nucleotide sequence complementary to the F2c region on the 3' side of the F1c region of the nucleic acid as a template;

a second primer II having a nucleotide sequence complementary to the R2c region on the 3' side of the R1c region of the nucleic acid as a template;

a DNA polymerase that catalyzes a strand-replacement complementary strand synthesis reaction, and,

Nucleotide, which serves as a substrate for the DNA polymerase.
The kit according to claim 10, further comprising an acceleration probe Xin, wherein said Xin is a nucleotide fragment located in an intermediate section of the F1 region to the R1 region of the template.
Use of the kit of claim 8 or 9 in the synthesis of a nucleic acid or detection of a target nucleotide sequence in a sample.