WO2017185766A1

WO2017185766A1 - Method for designing primers and probe for amplifying low-concentration mutant target sequence

Info

Publication number: WO2017185766A1
Application number: PCT/CN2016/109623
Authority: WO
Inventors: 邹鸿志; 牛智通
Original assignee: 广州市康立明生物科技有限责任公司
Priority date: 2016-04-29
Filing date: 2016-12-13
Publication date: 2017-11-02
Also published as: CN110951828A; CN105861678B; CN105861678A

Abstract

Disclosed is a method for designing primers and a probe for amplifying a low-concentration mutant target sequence: first determining a mutant position of a target sequence to be amplified, selecting a 12-25 bp nucleic acid fragment comprising a base at the site 0 in a negative direction of the mutant site to serve as a forward primer, and selecting a 12-25 bp nucleic acid sequence starting from a base at the site -1 or the base at the site 0 in a positive direction of the mutant site to serve as a probe sequence of the amplification system; and finally designing a reverse primer at a suitable downstream position of a 3' direction of the probe sequence by means of a conventional method.

Description

Design method of primers and probes for amplifying low concentration mutant target sequences

This application claims priority to Chinese patent application filed on April 29, 2016, the Chinese Patent Office, Application No. 201610281016.3, entitled "Design Method for Primers and Probes for Amplifying Low Concentration Mutation Target Sequences" The entire contents are hereby incorporated by reference.

Technical field

The invention belongs to the technical field of molecular biology and relates to a novel method for designing nucleic acid primers and probes. More specifically, it relates to a method of designing primers and probes for amplifying low concentration mutant target sequences.

Background technique

Many diseases are closely related to genetic mutations, and in many cases the type and production of post-drug reactions are also related to genetic mutations. The detection of gene mutations is of great significance in many fields and in less cases, and the detection technology of gene mutations often uses PCR detection technology. PCR (PolymeraseChainReaction) refers to the polymerase chain reaction, which is based on the DNA polymerase catalyzed, using parental DNA as a template, using specific primers as an extension starting point, and replicating and parenting the template in vitro by denaturation, annealing and extension. The process of DNA complementary daughter strand DNA. PCR is a DNA in vitro synthesis amplification technology that can rapidly and specifically amplify any DNA of interest in vitro. It can be used for gene isolation and cloning, sequence analysis, gene expression regulation, gene polymorphism research and many other aspects.

When semi-retained DNA is replicated, the double-stranded DNA can be degenerated into a single strand under the action of various enzymes, and is replicated into the same two copies according to the principle of base complementary pairing with the participation of DNA polymerase and promoter. Under the experimental conditions, DNA can also undergo denaturing and melting at high temperatures, and when the temperature is lowered, it can be renatured into a double strand. Therefore, by controlling the denaturation and renaturation of DNA by temperature changes, and designing primers as promoters, DNA polymerase and dNTP can be added to complete the in vitro replication of specific genes. PCR is similar to the natural replication process of DNA, and its specificity depends on oligonucleotide primers complementary to both ends of the target sequence. PCR consists of three basic reaction steps of denaturation-annealing (refolding)-extension: 1 denaturation of template DNA: template DNA is heated to 94 ° C After a certain period of time, the double-stranded DNA of the template DNA double-stranded or amplified by PCR is dissociated to make it a single strand, so that it binds to the primer to prepare for the next round reaction; 2 annealing of the template DNA and the primer ( Refolding): After the template DNA is denatured into a single strand by heating, the temperature is lowered to about 40-60 ° C, and the primers are paired with the complementary sequence of the single strand of the template DNA; 3 primer extension: DNA template-primer conjugate in the DNA polymerase Under the action of 72 °C, dNTP as the reaction material, the target sequence as a template, according to the principle of base pairing and semi-reserved replication, synthesize a new semi-reserved replication strand complementary to the template DNA strand, repeated cycles can be obtained More, the semi-reserved copy chain, and this new chain can be the template for the next cycle. It takes 2 to 4 minutes to complete each cycle, and the amplification of the gene to be amplified can be amplified several million times in 2 to 3 hours.

PCR technology is often used in clinical medicine, such as detection of hepatitis B virus, tumors, pathogens, and the like. Many common tumor diseases in humans are closely related to the genetic causes of certain viral diseases and tumor-related genes. PCR technology has achieved gratifying results in the research of tumor virus etiology, tumor-related genes, tumor-associated tumor suppressor genes. It is also used for genetic diseases with multiple point mutations. PCR is applied to paternity testing, blood group identification, and fingerprint identification in law. For blood samples that cannot be traced by traditional serological methods, the ABO and MN blood types can be tested by PCR. The verification of biological materials at certain crime sites will provide forensic medicine with reliable and effective evidence and direct and efficient data.

For PCR detection techniques, the design of primers and probes is a critical prerequisite. In the use of PCR technology for detecting gene mutations, especially when the amount of wild-type DNA is relatively large (ie, there are fewer mutations), the shortcomings of existing PCR techniques are mainly reflected in the design of primers and probes. Poor sex, primers and probes designed according to common methods for gene mutations often produce non-specific amplification bands; 2 poor selectivity, in the context of higher wild-type templates, for lower levels of genes Mutant DNA has limited detection ability, and most of the mutations that cause tumors are somatic mutations. Mutant cells are doped in wild-type cells, so the proposed DNA also carries a large amount of wild-type DNA; In the case of a small sample size or complex background interference in the sample, it is difficult to produce effective DNA amplification using the extracted DNA, or even cause detection or false negatives.

Summary of the invention

The technical problem to be solved by the present invention is to overcome the defects and shortcomings of the existing gene mutation detection primers and probe design methods, and to provide a design method for amplifying primers and probes for low-content mutant DNA in the background of high content of wild-type DNA. And its application in the field of nucleic acid detection. The primers and probes designed according to the method of the present invention can efficiently amplify a target fragment in the background of a higher wild-type template, and are a simple, inexpensive, highly efficient and highly specific PCR amplification primer for amplifying a target fragment. And probe design methods.

In order to achieve the above object, the present invention provides the following technical solutions:

The present invention provides a method of obtaining primers and/or probes comprising the steps of:

S1. The number of bases of the mutation point on the target sequence to be amplified is 0, the 5' direction of the base of the mutation is negative, the 3' direction is positive, and the base from the point of mutation to the 5' direction The number of bits is called -1, -2, -3... in turn; the number of bases from the point of mutation to the 3' direction is called +1, +2, +3... in turn;

S2. determining the 0 position of the mutant target sequence to be amplified;

S3. In the negative direction of the mutation point, a 15-25 bp nucleic acid fragment containing 0 bases is selected as the forward primer for amplification; the -1 to -4 position of the forward primer can be introduced according to the needs of the assay. Base or multi-base mismatch to adjust the specificity of amplification and the efficiency of amplification;

S4. In the positive direction of the mutation point, a 12-25 bp nucleic acid sequence is selected from the -1 base or the 0 base as a probe sequence of the amplification system;

S5. At the downstream position in the 3' direction of the probe sequence, the reverse primer is designed according to a conventional primer design method.

In some embodiments of the present invention, the effect of the introduction of the mismatched base pair on the amplification specificity of the forward primer in the step S3 of the method is: -1 position > -2 position > -3 position > -4 Position; that is, the amplification specificity of introducing a mismatch base at position -1 is the highest.

In some embodiments of the invention, the 5' end of the probe sequence of the method step S4 is labeled with a fluorophore and the 3' end is labeled with a corresponding quencher.

In some embodiments of the present invention, the base at position -1 on the probe sequence of the method step S4 may be the same as that on the primer, or may be different from the primer.

In some embodiments of the invention, the method step S3 is negative at the point of mutation In the direction, a nucleic acid fragment of 18 to 23 bp including the base 0 is selected as an amplified forward primer.

In some embodiments of the invention, the method step S4 is to select a 15-23 bp nucleic acid sequence from the -1 base or the 0 base as the probe sequence of the amplification system in the positive direction of the mutation point.

The invention also provides primers and/or probes obtained by the methods described.

The invention also provides the use of the primers and/or probes described in amplifying a low concentration mutant target sequence.

In some embodiments of the invention, the amplifying the low concentration mutant target sequence is specifically for amplifying a low concentration mutant DNA.

The invention also provides the use of the primers and/or probes to amplify low levels of mutated DNA in the context of high levels of wild-type DNA.

The invention also provides the use of the primers and/or probes described for detecting genetic mutations and/or single nucleotide polymorphisms.

The invention also provides a method for PCR amplification using the primers and/or probes, which comprises the following steps:

(1) Pre-denaturation;

(2) a first partial PCR amplification comprising a number of denaturation, primer annealing and primer extension cycles;

(3) A second partial PCR amplification comprising several denaturation, primer annealing and primer extension cycles.

The present invention discloses a method for designing primers and probes for amplifying low concentration mutant target sequences. First, determine the position of the mutation (mutation point, ie, position 0) of the target sequence to be amplified; then, select the 15-25 bp nucleic acid fragment containing the 0 base as the forward primer in the negative direction of the mutation point, at the mutation point. The 12-25 bp nucleic acid sequence is selected as the probe sequence of the amplification system from the base of the -1 base or the base of the base; and finally, the reverse primer is designed according to a conventional method at a suitable position downstream of the probe sequence in the 3' direction. Primers and probes designed according to the method of the present invention can efficiently (high specificity and high efficiency) amplify a fragment of interest in the context of a higher content of wild-type template, especially for point mutations, deletion mutations, and Insertion mutations, combined with fluorescence real-time PCR technology, can be very effective in solving the current difficulties in the sensitivity of tumor detection and drug sensitivity detection.

DRAWINGS

Figure 1 is a schematic diagram of PCR amplification reaction of primers and probes designed according to the present invention; including Figure a and Figure b;

Figure 2 is a diagram showing the amplification of the G G T>G C T mutant and the wild type of the primers and probes designed according to the method of the present invention in Example 1 on the codon 12 of the Kras gene;

Figure 3 is a diagram showing the amplification of the G G T>G C T mutant and the wild type of the primers and probes designed according to the conventional method in Example 1 on the codon 12 of the Kras gene;

Figure 4 is a diagram showing the amplification of the BRAF gene V600E mutant and wild type by primers and probes according to the method of the present invention in Example 2;

Figure 5 is a diagram showing the amplification of the BRAF gene V600E mutant and wild type by primers and probes according to the conventional method in Example 2;

Figure 6 is a diagram showing the amplification of PIK3CA gene c.3140A>G mutant and wild type by primers and probes designed in the method of the present invention in Example 3;

Figure 7 is a diagram showing the amplification of the PIK3CA gene c.3140A>G mutant and the wild type using the primers and probes designed in the ordinary method in Example 3;

Figure 8 is an amplification of the (c.2311T2C; p.L771L) mutant and wild type of the BRCA1 gene using primers and probes designed using the method of the present invention;

Figure 9 is a diagram showing amplification of BRCA1 gene c.2311T2C; p.L771L mutant and wild type using primers and probes designed by a common method;

Figure 10 is a diagram showing the amplification of c.2573T2G; p. L858R mutant and wild type of EGFR gene using primers and probes designed by the method of the present invention;

Figure 11 shows the amplification of c.2573T2G; p.L858R mutant and wild type of EGFR gene using primers and probes designed by common methods;

Figure 12 is a diagram showing the amplification of c.182A>G; p.Q61R mutant and wild type of NRAS gene using primers and probes designed by the method described in the present patent;

Figure 13 is a diagram showing the amplification of c.182A>G; p.Q61R mutant and wild type of NRAS gene using primers and probes designed by a common method;

Figure 14 is a diagram showing the amplification of c.524G>A; p.R175H mutant and wild type of TP53 gene using primers and probes designed by the method described in the present patent;

Figure 15 is a diagram showing the amplification of c.524G>A; p.R175H mutant and wild type of TP53 gene by primers and probes designed by a common method;

Figure 16 is a representation of the amplification of the RET gene c.2753T>C; p.M918T mutant and wild type using primers and probes designed using the methods described in the present patent;

Figure 17 shows the amplification of the RET gene c.2753T>C; p.M918T mutant and wild type using primers and probes designed by the conventional method.

detailed description

The invention discloses a design method for a primer and a probe for amplifying a low concentration mutant target sequence, and those skilled in the art can learn from the contents of the present article and appropriately improve the process parameters. It is to be understood that all such alternatives and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The method and the application of the present invention have been described by the preferred embodiments, and it is obvious that the method and application described herein may be modified or appropriately modified and combined without departing from the scope of the present invention. The technique of the present invention is applied.

Another object of the present invention is to provide a method for designing primers and probes for amplifying a low concentration of a mutant target sequence.

Still another object of the present invention is to provide an application of the above-described primer and probe design method.

The object of the invention is achieved by the following technical solutions:

A method for designing primers and probes for amplifying a low concentration mutant target sequence, preferably, the primers and probes for amplifying a low concentration mutant target sequence are specifically for amplifying a low concentration mutant DNA. Primers and probes (lower mutated DNA amplified in the context of high wild-type DNA).

The design method includes the following steps:

S1. For a better explanation of the technical content of the present invention, the definition is as follows: the number of bits of the base of the mutation point on the target sequence to be amplified is 0, and the 5' direction of the base of the mutation is negative, 3' The direction is positive, and the number of bases from the point of mutation to the 5' direction is called -1, -2, -3, respectively; the number of bases from the point of mutation to the 3' direction is called +1. , +2, +3... bits;

S2. determining the position of the mutated base of the target sequence to be amplified and determining the type of mutation, ie determining the 0 position;

S4. In the positive direction of the mutation point, a 12-25 bp nucleic acid sequence is selected from the -1 base or the 0 base as a probe sequence of the amplification system; since the sequence of the probe is from -1 or 0 Initially, therefore, the method of the present invention has an obvious feature in structure: the 3' end of the forward primer and the 5' end of the probe have an overlap of 1 bp or 2 bp;

S5. The reverse primer is designed in a conventional manner downstream of the probe sequence in the 3' direction.

Further, the effect of the introduction of the mismatched base pair on the amplification specificity of the forward primer in the step S3 is: -1 bit > -2 position > -3 position > -4 position; The base has the highest amplification specificity.

Preferably, the probe sequence of step S4 is labeled with a fluorophore at the 5' end and a corresponding quencher group at the 3' end. The labeling group can be a conventional labeling group such as FAM, VIC, HEX, and the corresponding quenching group.

More preferably, the labeled fluorophore and quenching group are FAM and BHQ1. When using the MGB tag, the sequence of the probe should be designed to be as short as possible.

Preferably, the base at position -1 on the probe sequence in step S4 may be the same as on the primer or different from the primer.

In addition, preferably, in order to have a suitable Tm value for the designed primer, the GC content of the designed primer and probe is preferably between 40% and 60%. Specifically, the forward primer can be obtained by appropriately adjusting the length of the primer and the type of the introduced mismatch base and the introduction of a suitable length of the unrelated sequence at the 5' end; the probe sequence can be adjusted by adjusting the length of the probe, and marking different The fluorophore either introduces an unrelated sequence at the 3' end, but the overall design requirements of the probe are preferably short and not too long.

Preferably, in step S3, in the negative direction of the mutation point, a nucleic acid fragment of 18 to 23 bp including the base 0 is selected as the amplified forward primer.

Preferably, step S4 is a probe sequence of an amplification system in which a 15- to 23 bp nucleic acid sequence is selected from the -1 base or the 0 base in the positive direction of the mutation point.

The use of the above design methods in the design of primers and probes for the amplification of low levels of mutant DNA in the context of high levels of wild-type DNA is also within the scope of the invention.

In addition, PCR amplification using the primers and probes designed by the present invention includes the following steps:

(1) Pre-denaturation;

In order to increase the amplification efficiency of the product, the number of cycles in the second step is set to 3 to 10 cycles, and the annealing temperature is set to 56 ° C to 65 ° C. The results show that the annealing temperature is set to 56 ° C to 65 ° C at this temperature. The primers that are most favorable for design and the target sequence template specifically bind, and the primers are designed to bind to the wild-type template with the lowest possibility, so that the mutant template in the high-content wild-type background can be amplified in a large amount, which is beneficial to the subsequent The third part of the cycle and the amplification efficiency of the entire system. The number of PCR amplification cycles in the third step is set to 30 to 45, preferably 35, which may be determined as needed, and the annealing temperature of the portion is 5 to 8 ° C lower than the annealing temperature of the first portion. After the specific amplification of the target sequence in the first part, the ratio of the mutant template to the wild type template in this part has been significantly higher than that in the initial sample, so lowering the annealing temperature is more effective for the mutant target. Amplification of the sequence. After amplification of the second part, a small number of mutations are enriched millions of times, while the wild-type template is completely at a disadvantage of binding and fluorescence during the entire amplification process, with almost no amplification. In this way, a very small amount of mutant DNA in the DNA template to be detected can be detected well. Studies have shown that this method can be used to design primers and probes to effectively detect 0.1% or more mutations.

When the primers and probes designed according to the present invention are subjected to PCR amplification reaction, the components of DNA polymerase, dNTP, Mg ²⁺ and system buffer in the reaction solution are the same as ordinary PCR, and can be optimized according to different reactions. .

In addition, the use of the above design methods in designing primers and probes for detecting genetic mutations and/or single nucleotide polymorphisms is also within the scope of the present invention. Primers and/or probes designed according to this method are well suited for detecting genetic mutations, single nucleotide polymorphisms, and/or SNPs.

The reasons for the high specificity of the primers and probes designed by this method are mainly related to the following two aspects:

(1) Primer design: Primer design was performed according to the conventional design method with the mutated strand as the target sequence strand, and the mutation point was placed at the 3' end of the primer; due to the matching at the 3' end It is critical for amplification, so the amplification efficiency of this primer is extremely low for unmatched wild-type templates, which is the first heavy amplification specific enhancement. Then, a number of mismatched bases are artificially introduced on the primers, and the new strand amplified after the mismatched base is introduced will completely match the primers, and the original wild-type strand or the mutant strand does not match the primer. Perfect match, but the mutant strand is easier to match with the primer than the wild type strand. Setting the higher annealing temperature in the first stage is to ensure that the primer and the wild type template are combined as much as possible during the amplification process. Specific amplification provides a second guarantee for enrichment of low abundance mutant templates in the first few cycles.

(2) Probe design: The probe design in this method is basically a sequence of 15-22 bp downstream from -1 or -2, and the probe length can be adjusted according to actual test conditions. Since the 0th position is the mutation point and the probe also contains the mutated base at position 0, adjusting the appropriate annealing temperature according to the Tm value of the probe allows the probe to preferentially bind to the target sequence instead of the wild type sequence. To increase the specificity of the role.

A schematic diagram of a PCR amplification reaction of primers and probes designed in accordance with the present invention is shown in FIG. The process of amplification is explained as follows: at the denaturation temperature, the double strands of the DNA are unfolded to form a single strand, respectively; during the initial annealing phase, the DNA strand is renatured, and the primer binds to the DNA template strand. Since the annealing temperature of the first stage is higher, for the mutant template, the end of the primer and the mutation point on the template are matched, so it is easier to bind to the mutant template strand; while the wild type template is not because of the end. Matching is not easy to bind to the template strand (although it is not easy to bind, there will still be a portion of the primers bound to the wild-type template strand). In the subsequent amplification process, the newly generated mutant DNA strand and the primer are completely matched, which makes the primer easier to bind to the mutant strand. After several cycles, the mutant template is continuously amplified, while the wild type template is never produced. Effective amplification, thus resulting in a greater difference between the two, ultimately achieves an effective distinction between the mutant fluorescent signal and the wild-type fluorescent signal.

The invention has the following beneficial effects:

(1) The most important feature of the primers and probes designed by the present invention is that the 3' end of the primer and the 5' end of the probe have an overlap of 1 to 2 bp. This amplification is not only primer specific but also probe specific. This double restriction further ensures the specificity and efficiency of amplification.

(2) The forward primer designed by the present invention can introduce an appropriate mismatch base according to the result of amplification and the need to increase the specificity of amplification or increase the efficiency of amplification, and ensure amplification specificity. Under the premise, the corresponding Ct value can be optimized according to the introduced mismatch, which is beneficial to the optimization of the process in the multiplex PCR system.

(3) The mismatch bases introduced in the forward primers are superior in the position of -3 or -4, and most of the gene amplification systems introduce mismatches here to obtain better specificity and amplification efficiency. .

(4) The labeling group of the probe sequence designed by the method may select a conventional labeling group such as FAM, VIC, HEX or the like and a corresponding quenching group, and more preferably the labeled fluorophore and quenching group are FAM and BHQ1. . When using the MGB tag, the sequence of the probe should be designed to be as short as possible.

Based on the above, the primer and probe design methods of the present invention are directed to point mutations, deletion mutations, and insertion mutations in gene mutations, and combined with real-time PCR technology can effectively solve the current lack of sensitivity in clinical detection and drug sensitivity detection. Difficulties.

The materials and reagents used in the design method of the primers and probes for amplifying a low concentration mutant target sequence provided by the present invention are commercially available.

The above method of the present invention has been extensively studied and experimentally verified. The following is a description of mutation detection of eight genes as an example.

Example 1

1. Primers and probes were designed using the methods of the present invention, and the G G T>G C T mutations on the codon 12 of the Kras gene and the different gradients of the wild type samples of the control were subjected to fluorescent PCR amplification assays.

According to the wild type gene sequence of the 12th codon of the Kras gene published by Cosmic data and the G G T>G C T mutant gene sequence, one probe was designed as Kras-Pb; the primers were Kras-Fp and Kras-Rp, respectively.

Specifically, the primers and probe sequences designed in accordance with the methods of the invention are as follows:

SEQ ID No. 1: Kras-0Fp: CACTCTTGCCTACGCCTG;

SEQ ID No. 2: Kras-0Pb: TGCAGCTCCAACTACCAC;

SEQ ID No. 3: Kras-0Rp: GGCCTGCTGAAAATGACTG.

The primers and probes designed according to the general conventional primer and probe design methods are as follows:

SEQ ID No. 4: Kras-1 Fp: CACTCTTGCCTACGCCTG;

SEQ ID No. 5: Kras-1Pb: GCTCCAACTACCACAAGTT;

SEQ ID No. 6: Kras-1Rp: GGCCTGCTGAAAATGACTG.

2. Sample preparation:

A sequence carrying the G G T>G C T mutation and the corresponding Kras wild sequence were artificially synthesized, and the two sequences were separately loaded into a plasmid for amplification. The synthesized plasmid was digested and a fragment of 10 ⁴ copies of the fragment was obtained, and then the two were mixed in different ratios to obtain samples containing different concentrations of mutant and wild type: 100% mutant, 50% mutant, 10% mutant, 5% mutant, 1% mutant, 0.1% mutant and 100% wild type sample template.

3. Real-time fluorescent PCR amplification

(1) The system of real-time fluorescent PCR is shown in Table 1.

Table 1

组分Component	加入量(μl)Adding amount (μl)
前向引物(100μM)Forward primer (100μM)	0.1250.125
后向引物(100μM)Backward primer (100μM)	0.1250.125
探针(100μM)Probe (100μM)	0.050.05
Mg²⁺(25mM)Mg ²⁺ (25mM)	33
dNTP(10mM)dNTP (10mM)	11
热启动酶(5U/μl)Hot start enzyme (5U/μl)	0.30.3
5buffer5buffer	55
水water	14.414.4
DNADNA	11
总体积total capacity	2525

(2) The real-time fluorescent PCR reaction procedure is:

Pre-denaturation: 95 ° C 5 min;

The first part of the 10 cycles: 95 ° C 20s, 62 ° C 30s, 72 ° C 20s;

The second part of the 40 cycles: 95 ° C for 20 s, 58 ° C for 30 s, 72 ° C for 20 s and collect fluorescent signals.

4. The test results are shown in Figure 2, Figure 3 and Table 2.

Figure 2 shows the amplification effect of primers and probes designed according to the method of the present invention. The results show that the wild type template is very low in amplification and can effectively distinguish 0.1% of the mutation types.

Figure 3 shows the amplification effect of primers and probes designed according to the conventional method. The wild type template amplification is more obvious, and only 1% of the mutation types can be distinguished. The comparison between the two is shown in Table 2.

Table 2

Comparing the amplification effects of Figures 2, 3 and 2, it can be clearly seen that the primers and probes designed using the method of the present invention have better detection specificity for low concentration mutant templates. In Figure 2, the difference between the Ct value of the 0.1% mutant (about 10 copies) ratio template and the wild type template is 12.27, and the difference between the Ct value of the same template in the common design system and the wild type template is only 0.92, and the difference is 1 Ct is almost impossible to use in actual testing. Therefore, most of the primers designed according to the conventional method have a detection limit of generally 1%, and the detection limit of the method of the present invention is much lower than 1 ‰, which is a thousand times different. Thus the primers and probes described in the methods of the invention are more sensitive and specific and require less sample.

Example 2

1. Detection of BRAFV600E mutation using primers and probes designed according to the present invention.

The following primer and probe designs were performed based on the wild-type and mutant sequences of the BRAF gene queried by cosmic data:

BRAFV600E primers and probes designed according to the method of the invention:

SEQ ID No. 7: BRAF-0Fp: CCCACTCCATCGAGATGTCT;

SEQ ID No. 8: BRAF-0Rp: TGAAGACCTCACAGTAAAA;

SEQ ID No. 9: BRAF-0Pb: CTCTGTAGCTAGACCA.

BRAFV600E primer and probe sequences designed according to the usual method:

SEQ ID No. 10: BRAF-1Fp: CCCACTCCATCGAGATTTCT;

SEQ ID No. 11: BRAF-1Rp: TGAAGACCCTCACAGTAAAA;

SEQ ID No. 12: BRAF-1 Pb: CTGTAGCTAGACCAA.

2. Sample preparation:

A sequence with the BRAFV600E mutation and the corresponding BRAF wild sequence were artificially synthesized, and the two sequences were separately loaded into a plasmid for amplification. The synthesized plasmid was digested with a restriction enzyme system to obtain a 10 4 copy number fragment, and then mixed in different ratios to obtain samples containing different concentrations of mutant and wild type: 100% mutant. 50% mutant, 10% mutant, 5% mutant, 1% mutant, 0.1% mutant and 100% wild type sample template.

3. Real-time fluorescent PCR amplification

(1) The real-time fluorescent PCR system is shown in Table 3.

table 3

组分Component	加入量(μl)Adding amount (μl)
前向引物(100μM)Forward primer (100μM)	0.1250.125
后向引物(100μM)Backward primer (100μM)	0.1250.125
探针(100μM)Probe (100μM)	0.050.05
Mg2+(25mM)Mg2+ (25mM)	33
dNTP(10mM)dNTP (10mM)	11
热启动酶(5U/μl)Hot start enzyme (5U/μl)	0.30.3
5buffer5buffer	55
水water	14.414.4
DNADNA	11
总体积total capacity	2525

(2) The real-time PCR reaction procedure is:

95 ° C 5 min;

The first part of the 10 cycles: 95 ° C 20s, 62 ° C 30s, 72 ° C 20s;

The second part of 40 cycles: 95 ° C for 20 s, 55 ° C for 30 s, 72 ° C for 20 s and collect fluorescent signals.

4. The test results are shown in Figure 4, Figure 5 and Table 4.

Figure 4 is a graph showing the effect of primer and probe design on the detection of BRAFV600E mutations in accordance with the methods of the present invention.

Figure 5 shows the design of primers and probes for BRAFV600E mutation according to the conventional method. Detect the effect.

Table 4

By comprehensively comparing the amplification effects of Figures 4 and 5 and Table 4, it can be clearly seen that the primers and probes designed using the method of the present invention have better detection specificity for low concentration mutant templates. In Figure 4, the difference between the Ct value of the 0.1% mutant (about 10 copies) ratio template and the wild type template is 4, and the difference between the Ct value of the same template in the common design system and the wild type template is only 1.2, and the difference is 1 Ct is almost impossible to use in actual testing. Therefore, most of the primers designed according to the conventional method have a detection limit of generally 1%, and the primers and probes designed using the method of the present invention have detection limits much lower than 1 ‰, and the difference between them is more than 10 times. Therefore, the primers and probes designed by the method of the invention are more sensitive and specific, and the requirements for the sample are lower.

Example 3

1. Primers and probes designed using the method of the present invention and primers and probes designed according to common methods were used to detect mutations of PIK3CA gene c.3140A>G, respectively, and the effects were compared.

The following primer and probe designs were performed based on the wild-type and mutant sequences of the PIK3CA gene queried from cosmic data:

PIK3CAc.3140A>G primers and probes designed according to the method of the invention:

SEQ ID No. 13: PIK-0Fp: AACAAATGAATGATGCGCG

SEQ ID No. 14: PIK-0Rp: TGCATGCTGTTTAATTGTGTGG

SEQ ID No. 15: PIK-0Pb: CGTCATGGTGGCTGGACAACA

PIK3CAc.3140A>G primer and probe sequences designed according to the usual method:

SEQ ID No. 16: PIK-1Fp: CAAATGAATGATGCACG

SEQ ID No. 17: PIK-1Rp: TGCATGCTGTTTAATTGTGTGG

SEQ ID No. 18: PIK-1Pb: ATGGTGGCTGGACAACA

2. Sample preparation:

A sequence carrying the PIK3CAc.3140A>G mutation and the corresponding PIK3CA wild sequence were artificially synthesized, and the two sequences were separately loaded into a plasmid for amplification. The synthesized plasmid was digested with a restriction enzyme system to obtain a digested fragment of 10 ⁴ copies, and then mixed in different ratios to obtain samples containing different concentrations of mutant and wild type: 100% mutant, 50 % mutant, 10% mutant, 5% mutant, 1% mutant, 0.1% mutant and 100% wild type sample template.

3. Real-time fluorescent PCR amplification

(1) The system of real-time fluorescent PCR is shown in Table 5.

table 5

(2) The real-time PCR reaction procedure is:

95 ° C 5 min;

The first part of the 10 cycles: 95 ° C 20s, 62 ° C 30s, 72 ° C 20s;

4. The test results are shown in Figure 6, Figure 7, and Table 6.

Figure 6 is a primer and probe pair designed using the method of the present invention to PIK3CAc.3140A>G Amplification of genes. Figure 7 shows the amplification of the PIK3CAc.3140A>G gene using primers and probes designed using conventional methods.

Table 6

By comprehensively comparing the amplification effects of Figure 6 and Figures 7 and 6, it is apparent that the primers and probes designed using the methods of the present invention have better detection specificity for low concentration mutant templates. In Figure 6, the difference between the Ct value of the 0.1% mutant (about 10 copies) ratio template and the wild type template is 5.1, and the difference between the Ct value of the same template in the common design system and the wild type template is only 1.2, and the difference is 1 Ct is almost impossible to use in actual testing. Therefore, most of the primers designed according to the conventional method have a detection limit of generally 1%, and the detection limit of the method of the present invention is much lower than 1 ‰, which is more than 30 times. Thus the primers and probes described in the methods of the invention are more sensitive and specific and require less sample.

Example 4

1. Primers and probes designed using the method of the present invention and primers and probes designed according to an ordinary method were used to detect mutations of the (c. 2311T2C; p. L771L) SNP site of the BRCA1 gene, respectively, and the effects were compared.

The following primer and probe designs were performed based on the wild-type and mutant sequences of the BRCA1 gene queried from the cosmic data:

(1) (c.2311T2C; p.L771L) SNP point primers and probes of the BRCA1 gene designed according to the method of the present invention:

SEQ ID No. 19: BRC-0Fp: AATCAGTACCAGGTAGCAG

SEQ ID No. 20: BRC-0Rp: GTGGAGAAAGGGTTTTGCAA

SEQ ID No. 21: BRC-0Pb: GTGAAATACTGCTACTCTC

(2) SNP point primers and probe sequences of the (c.2311T2C; p.L771L) BRCA1 gene designed according to the conventional method:

SEQ ID No. 22: BRC-1Fp: AATCAGTACCAGGTAGCAG

SEQ ID No. 23: BRC-1Rp: GTGGAGAAAGGGTTTTGCAA

SEQ ID No. 24: BRC-1Pb: GAAATACTGCTACTCTCTAC

2. Sample preparation:

A sequence carrying the BRCA1 gene (c.2311T2C; p.L771L) SNP site and the corresponding BRCA1 wild sequence were artificially synthesized and loaded into a plasmid for amplification. The synthesized plasmid was digested with a restriction enzyme system and a fragment of 10 ⁴ copies of the fragment was obtained as a template for fluorescent PCR amplification.

3. Fluorescence PCR amplification, the system is shown in Table 7:

Table 7

组分Component	加入量(μl)Adding amount (μl)
前向引物(100μM)Forward primer (100μM)	0.1250.125
后向引物(100μM)Backward primer (100μM)	0.1250.125
探针(100μM)Probe (100μM)	0.050.05
Mg2+(25mM)Mg2+ (25mM)	33
dNTP(10mM)dNTP (10mM)	11
热启动酶(5U/μl)Hot start enzyme (5U/μl)	0.30.3
5buffer5buffer	55
WaterWater	14.414.4
DNADNA	11
TotalTotal	2525

The real-time PCR reaction procedure was: 95 ° C for 5 min; 50 cycles: 95 ° C for 20 s, 51 ° C for 30 s, 72 ° C for 30 s and collect fluorescent signals.

4. The results are shown in Figures 8 and 9, and Table 8.

Table 8

By comprehensively comparing the amplification effects of Figures 8, 9, and 4, it is apparent that the primers and probes designed using the methods described in this patent have better detection specificity for the mutant template.

Example 5

1. Using the primers and probes designed by the method of the present invention and designing the primers and probes according to the conventional method, respectively, the c.2573T2G and p.L858R mutants of the EGFR gene were detected and compared.

The following primer and probe designs were performed based on the wild-type and mutant sequences of the EGFR gene queried according to cosmic data:

(1) c.2573T2G of the EGFR gene designed according to the method of the present invention; p. L858R mutant primer and probe:

SEQ ID No. 25: EGFR-0Fp: CAAGATCACAGATTTTGCGCG

SEQ ID No. 26: EGFR-0Rp: CTTACTTTGCCTCCTTCTGC

SEQ ID No. 27: EGFR-0Pb: GGCCCAAACTGCTGGGT

(2) c.2573T2G of the EGFR gene designed according to the conventional method; p.L858R mutant primer and probe sequence:

SEQ ID No. 28: EGFR-1 Fp: CAAGATCACAGATTTTGCGCG

SEQ ID No. 29: EGFR-1Rp: CTTACTTTGCCTCCTTCTGC

SEQ ID No. 30: EGFR-1 Pb: GCCAAACTGCTGGGTGCGGA

2. Sample preparation:

A sequence carrying the EGFR gene c.2573T2G; p. L858R mutation site and the corresponding EGFR wild sequence were artificially synthesized and loaded into a plasmid for amplification. The synthesized plasmid was digested with a restriction enzyme system and a fragment of 10 ⁴ copies of the fragment was obtained as a template for fluorescent PCR amplification.

3. Fluorescence PCR amplification, the system of which is shown in Table 9.

Table 9

The real-time PCR reaction procedure was: 95 ° C for 5 min; 50 cycles: 95 ° C for 20 s, 48 ° C for 30 s, 72 ° C for 30 s and collect fluorescent signals.

4. The results are shown in Figures 10, 11 and 10.

Table 10

By comprehensively comparing the amplification effects of Figure 10 and Figures 11 and 10, it is apparent that the primers and probes designed using the methods described in this patent have better detection specificity for the mutant template.

Example 6

1. The primers and probes designed by the method of the present invention and the primers and probes designed according to the conventional method were respectively used to detect the c.182A>G; p.Q61R mutant of the NRAS gene and compare the effects.

The following primer and probe designs were performed based on the wild-type and mutant sequences of the NRAS gene queried from cosmic data:

(1) c.182A>G; p.Q61R mutant primers and probes of the NRAS gene designed according to the method of the present invention:

SEQ ID No. 31: NRAS-0Fp: CATGGCACTGTACTCTGCTC

SEQ ID No. 32: NRAS-0Rp: ACCCCCAGGATTCTTACAGA

SEQ ID No. 33: NRAS-0Pb: CGTCCAGCTGTATCCAGTATG

(2) c.182A>G of the NRAS gene designed according to the conventional method; p.Q61R mutant primer and probe sequence:

SEQ ID No. 34: NRAS-1Fp: CATGGCACTGTACTCTGCTC

SEQ ID No. 35: NRAS-1Rp: ACCCCCAGGATTCTTACAGA

SEQ ID No. 36: NRAS-1 Pb: CCAGCTGTATCCAGTATGTCC

2. Sample preparation:

A sequence carrying the NRAS gene c.182A>G; p.Q61R mutation site and the corresponding NRAS wild sequence were artificially synthesized and loaded into a plasmid for amplification. The synthesized plasmid was digested with a restriction enzyme system and a fragment of 10 ⁴ copies of the fragment was obtained as a template for fluorescent PCR amplification.

3. Fluorescence PCR amplification, the system of which is shown in Table 11.

Table 11

4. The results are shown in Figures 12, 13, and 12.

Table 12

By comprehensively comparing the amplification effects of Figures 12 and 13 and Table 12, it is apparent that the primers and probes designed using the methods described in this patent have better detection specificity for the mutant template.

Example 7

1. The primers and probes designed by the method described in the present invention and the primers and probes designed according to the conventional method were respectively used to detect the c.524G>A; p.R175H mutant of the TP53 gene, and the effects were compared.

The following primer and probe designs were performed based on the wild-type and mutant sequences of the TP53 gene queried according to cosmic data:

(1) c.524G>A; p.R175H mutant primers and probes of the TP53 gene designed according to the method of the present invention:

SEQ ID No. 37: TP53-0Fp: GCTCATGGTGGGGGTAGT

SEQ ID No. 38: TP53-0Rp: TTGATTCCACACCCCCGCC

SEQ ID No. 39: TP53-0Pb: TGCCTCACAACCTCCGTC

(2) c.524G>A of the TP53 gene designed according to the common method; p.R175H mutant primer and probe sequence:

SEQ ID No. 40: TP53-1Fp: GCTCATGGTGGGGGTAGT

SEQ ID No. 41: TP53-1Rp: TTGATTCCACACCCCCGCC

SEQ ID No. 42: TP53-1Pb: ACAACCTCCGTCATGTGCTG

2. Sample preparation:

A sequence carrying the TP53 gene c.524G>A; p.R175H mutation site and the corresponding TP53 wild sequence were artificially synthesized and loaded into a plasmid for amplification. The synthesized plasmid was digested with a restriction enzyme system and a fragment of 10 ⁴ copies of the fragment was obtained as a template for fluorescent PCR amplification.

3. Fluorescence PCR amplification, the system of which is shown in Table 13.

Table 13

4. The results are shown in Figures 14, 15 and 14.

Table 14

By comprehensively comparing the amplification effects of Figure 13 and Figures 14 and 7, it is apparent that the primers and probes designed using the methods described in this patent have better detection specificity for the mutant template.

Example 8

1. The primers and probes designed by the method of the present invention are designed and the primers and probes are designed according to an ordinary method, and the c.2753T>C; p. M918T mutant of the RET gene is separately detected and compared.

The following primer and probe designs were performed based on the wild-type and mutant sequences of the RET gene queried from the cosmic data:

(1) c.2753T>C; p.M918T mutant primers and probes of the RET gene designed according to the method of the present invention:

SEQ ID No. 43: RET-0Fp: CGGATTCCAGTTAAATCGAC

SEQ ID No. 44: RET-0Rp: TCACTTTGCGTGGTGTAGAT

SEQ ID No. 45: RET-0Pb: ACGGCAATTGAATCCCT

(2) c.2753T>C; p.M918T mutant primer and probe sequence of RET gene designed according to the common method:

SEQ ID No. 46: RET-1Fp: CGGATTCCAGTTAAATCGAC

SEQ ID No. 47: RET-1Rp: TCACTTTGCGTGGTGTAGAT

SEQ ID No. 48: RET-1 Pb: GCAATTGAATCCCTTCTTG

2. Sample preparation:

A sequence carrying the RET gene c.2753T>C; p.M918T mutation site and the corresponding RET wild sequence were artificially synthesized, and the two sequences were separately loaded into a plasmid for amplification. The synthesized plasmid was digested with a restriction enzyme system and a fragment of 10 ⁴ copies of the fragment was obtained as a template for fluorescent PCR amplification.

3. Fluorescence PCR amplification, the system of which is shown in Table 15.

Table 15

4. The results are shown in Figures 16, 17, and 16.

Table 16

By comprehensively comparing the amplification effects of Figure 15 and Figures 16 and 16, it is apparent that the primers and probes designed using the methods described in this patent have better detection specificity for the mutant template.

The design methods of the primers and probes for amplifying low-concentration mutant target sequences provided by the present invention are described in detail above. The principles and embodiments of the present invention have been described with reference to specific examples, and the description of the above embodiments is only to assist in understanding the method of the present invention and its core idea. It should be noted that those skilled in the art can make various modifications and changes to the present invention without departing from the spirit and scope of the invention.

Claims

A method for obtaining a primer and/or a probe, comprising the steps of:

S1. The number of bases of the mutation point on the target sequence to be amplified is 0, the 5' direction of the base of the mutation is negative, the 3' direction is positive, and the base from the point of mutation to the 5' direction The number of bits is called -1, -2, -3... in turn; the number of bases from the point of mutation to the 3' direction is called +1, +2, +3... in turn;

S2. determining the 0 position of the mutant target sequence to be amplified;

S3. In the negative direction of the mutation point, a 15-25 bp nucleic acid fragment containing 0 bases is selected as the forward primer for amplification; the -1 to -4 position of the forward primer can be introduced according to the needs of the assay. Base or multi-base mismatch to adjust the specificity of amplification and the efficiency of amplification;

S4. In the positive direction of the mutation point, a 12-25 bp nucleic acid sequence is selected from the -1 base or the 0 base as a probe sequence of the amplification system;

S5. At the downstream position in the 3' direction of the probe sequence, the reverse primer is designed according to a conventional primer design method.
The method according to claim 1, wherein the effect of the introduction of the mismatched base pair on the amplification specificity of the forward primer in the step S3 is: -1 position > -2 position > -3 position > -4 Position; that is, the amplification specificity of introducing a mismatch base at position -1 is the highest.
The method according to claim 1 or 2, wherein the probe sequence of step S4 is labeled with a fluorophore at the 5' end and a corresponding quencher group at the 3' end.
The method according to any one of claims 1 to 3, wherein the base at position -1 on the probe sequence in step S4 may be the same as on the primer or different from the primer.
The method according to any one of claims 1 to 4, wherein the step S3 is to select a nucleic acid fragment of 18 to 23 bp including the base 0 as an amplified forward primer in the negative direction of the mutation point. .
The method according to any one of claims 1 to 5, wherein the step S4 is to select a 15-23 bp nucleic acid sequence from the -1 base or the 0 base as the amplification system in the positive direction of the mutation point. Probe sequence.
Primers and/or probes obtained by the method according to any one of claims 1 to 6.
The primer and/or probe according to claim 7 is for amplifying a low concentration mutant target sequence Applications.
Use of the primers and/or probes according to claim 7 for amplifying low concentration mutant DNA.
Use of a primer and/or probe according to claim 7 for amplifying low-content mutant DNA in the context of high levels of wild-type DNA.
Use of the primers and/or probes according to claim 7 for detecting genetic mutations and/or single nucleotide polymorphisms.
A method for PCR amplification using the primers and/or probes of claim 7, comprising the steps of:

(1) Pre-denaturation;

(2) a first partial PCR amplification comprising a number of denaturation, primer annealing and primer extension cycles;

(3) A second partial PCR amplification comprising several denaturation, primer annealing and primer extension cycles.