CN102776291B

CN102776291B - Method for detecting gene mutation genotyping based on Taqman-ARMS (Amplification Refractory Mutation System) technology and kit

Info

Publication number: CN102776291B
Application number: CN201210291849.XA
Authority: CN
Inventors: 王弢; 秦勇
Original assignee: SUZHOU MICRO DIAG BIOMEDICINE CO Ltd
Current assignee: Jiangsu is the real biopharmaceutical technology Limited by Share Ltd
Priority date: 2012-08-16
Filing date: 2012-08-16
Publication date: 2014-12-17
Anticipated expiration: 2032-08-16
Also published as: CN102776291A

Abstract

The invention discloses a method for detecting gene mutation genotyping based on a Taqman-ARMS (Amplification Refractory Mutation System) technology, relating to the field of molecular biology. According to the method, an ARMS mutation enrichment technology and a Taqman-MGB (Minor Groove Binder) specificity fluorescence detection technology are combined, a mutation target sequence is subjected to specificity PCR (Polymerase Chain Reaction) amplification by using an ARMS primer, a Taqman-MGB probe is used for carrying out specificity locus detection on an amplification product, and specific mutation is identified on the basis of Real-time PCR. Compared with mutation detection technologies such as direct sequencing, chip detection and the like, the method has the advantages of strong specificity, high sensitivity, simplicity and rapidness in operation, high flux and the like when used for detecting gene mutation.

Description

Based on method and the test kit of Taqman-ARMS technology for detection gene mutation typing

Technical field

The present invention relates to biotechnology and medical field, be specifically related to a kind of method based on Taqman-ARMS technology inspection transgenation position somatotype.

Background technology

The detection method of gene mutation generally applied at present is restriction small segment length polymorphism analysis method (RFLP method) and DNA direct Sequencing etc.RFLP method is the method combined with restriction enzyme digestion by PCR, but the method exists following shortcoming: RFLP experimental implementation is loaded down with trivial details, and sense cycle is long, with high costs, there is first round enzyme and cut the false positive not exclusively caused, non-stopped pipe operation, be easy to pollute, be difficult to meet clinical detection requirement.DNA direct Sequencing is the gold standard of abrupt climatic change.It is longer to there is following shortcoming sense cycle in the method, both expensive, and non-stopped pipe operation, be difficult to avoid crossed contamination, flux is not high.The sensitivity of DNA direct Sequencing is lower, the problems such as the existence of the contracting of heterozygous mutant, glue laminated, GC enrichment region make to be difficult to obtain accurate data by once sequencing, need repeatedly to repeat order-checking and just may avoid false positive etc., therefore direct Sequencing method difficulty is applicable to clinical detection.

Therefore, be badly in need of exploitation a kind of quick, accurate, easy and simple to handle and avoid the detection in Gene Mutation technology of crossed contamination, meet the ageing requirement of gene mutation typing.

Summary of the invention

In view of this, an object of the present invention is to provide the method based on Taqman-ARMS technology for detection gene mutation typing, solve in prior art carry out that gene mutation typing program is loaded down with trivial details, somewhat expensive, time-consuming, easy pollution and the problem such as sensitivity is low.

For achieving the above object, technical scheme is:

Based on the method for Taqman-ARMS technology for detection gene mutation typing, comprise the following steps:

(1) according to the mutational site design ARMS primer of goal gene, the upstream primer of described ARMS primer or 3 ' end of downstream primer are mutational site, and will be arranged in arbitrary missense mutation of 1-3 position, upstream, mutational site Nucleotide;

(2) according to described mutational site design Taqman-MGB probe, the Taqman probe in the amplified production positive-sense strand mutational site of described Taqman-MGB probe specific recognition ARMS primer, 3 ' end of described probe is combined with minor groove binding molecule;

(3) extract masterplate DNA, utilize step (1) gained primer pair and step (2) gained probe to carry out fluorescence quantitative PCR detection to template DNA.

Preferably, by the missense mutation in the Nucleotide of the 1st, upstream, described mutational site.

Preferably, in described step (1), described mutational site is EGFR gene 2573 missense mutation, and described ARMS primer is the nucleotide sequence shown in SEQ ID No:3 and SEQ ID No:5.

Preferably, in described step (2), described Taqman-MGB probe is the nucleotide sequence shown in SEQ ID No:9.

Two of the object of the invention is the test kit providing above-mentioned detection method to use, and it is easy to use, highly sensitive, and technical scheme is:

Described test kit comprises ARMS primer and the Taqman-MGB probe in the mutational site of testing goal gene, the upstream primer of described ARMS primer or 3 ' end of downstream primer are mutational site, and will be arranged in arbitrary missense mutation of 1-3 position, upstream, mutational site Nucleotide;

Described Taqman-MGB probe is the Taqman probe in the amplified production positive-sense strand mutational site of specific recognition ARMS primer, and 3 ' end of described probe is combined with minor groove binding molecule.

Preferably, described ARMS primer is the nucleotide sequence shown in SEQ ID No:3 and SEQ ID No:5.

Preferably, described Taqman-MGB probe is the nucleotide sequence shown in SEQ ID No:9.

Preferably, described test kit is by PCR damping fluid, dNTPs, primer pair, Taqman-MGB probe, MgCl ₂, Taq DNA polymerase and template DNA composition, during each component reaction, final concentration is:

PCR damping fluid	Final concentration 0.5 ~ 2.5 ×;
		dNTPs	0.1～0.75mM；
Primer	Upstream and downstream primer final concentration is respectively 150 ~ 350 μMs;
		Template DNA	0.01～10ng/μL；
Taq DNA polymerase	0.01～1.0U/μL；
		MgCl ₂	Final concentration is 1.5 ~ 3.5mM;
Taqman-MGB probe	Final concentration is 50 ~ 200nM

Preferably, described PCR damping fluid, dNTPs, primer pair, Taqman-MGB probe, MgCl ₂, Taq DNA polymerase and template DNA final concentration consist of:

PCR damping fluid	Final concentration 1 ×;
		dNTPs	0.25mM；
Primer pair	Upstream and downstream primer final concentration is respectively 250 μMs;
		Template DNA	0.05～1.5ng/μL；
Taq DNA polymerase	0.01～0.10U/μL；
		MgCl ₂	Final concentration is 2.0 ~ 2.5mM;
Fluorescent probe	Final concentration is 50nM;

In the present invention, term " primer " refers to a kind of oligonucleotide, can be natural also can be synthesis, it can as the starting point of induce dna synthesis under certain condition, the primer extension product that synthesis is complementary mutually with nucleic acid chains can be brought out under these conditions, namely under four kinds of different triphosphoric acid thymus nucleic acids and a kind of polymerization agent (i.e. archaeal dna polymerase or reversed transcriptive enzyme) exist, above-mentioned synthesis is carried out at a suitable temperature at a kind of suitable damping fluid.Preferred primer is sub-thread oligodeoxyribonucleotide.The appropriate length of primer depends on the designed use of this primer, but general between 15 ~ 25 Nucleotide, shorter primer molecule needs lower temperature usually, thus forms fully stable hybridization complex with template.Primer need not the exact sequence of reaction template, but must be fully complementary, has hybridized with template and has caused DNA and synthesized.

Design of primers adhere to principled: 1. design and there is specificity in primer application nucleic acid series conserved regions.2. product can not form secondary structure.3. primer length is generally between 15 ~ 30 bases.4. G+C content is between 40% ~ 60%.5. base wants stochastic distribution.6. primer self can not have the complementation of continuous 4 bases.7. the complementation of continuous 4 bases can not be had between primer.8. primer 5 ' end can be modified.9. primer 3 ' end can not be modified.10. primer 3 ' end will avoid the 3rd of codon.The software carrying out design of primers has Primer 5, Beacon Designer 7.

The method that primer synthesis adopts is phosphoramidite triester method, DNA is fixed on synthesis solid phase carrier completing DNA chain, and the direction of synthesis is held to 5 ' end synthesis by 3 ' of primer to be synthesized, and adjacent Nucleotide is connected by 3 ' → 5 ' phosphodiester bond.

In the present invention, term " fluorescent probe " refers to a kind of oligonucleotide of mark fluorescent signal, is synthetic, it can as combining with specific DNA under certain condition, under the effect that archaeal dna polymerase 5'-3' is exo-acting, send fluorescent signal, accept by quantitative real time PCR Instrument.Preferred probe is the sub-thread oligodeoxyribonucleotide of mark fluorescent signal.The appropriate length of probe depends on the designed use of this probe, general between 10 ~ 25 Nucleotide, although its specificity of shorter probe molecule reduces, but can avoid uncertainty that is complicated because of DNA sequence dna and that cause.The exact sequence of the necessary reaction template of probe.

Probe design adhere to principled: 1. design and there is specificity in probe application nucleic acid series conserved regions.2. product can not form secondary structure.3. probe length is generally between 10 ~ 30 bases.4. G+C content is between 40% ~ 60%.5. base wants stochastic distribution.6. probe self can not have the complementation of continuous 4 bases.7. probe 5' first base can not for G 8. probe 5 ' end add fluorescence radiation group.9. probe 3 ' end adds quenching of fluorescence group.10. in probe sequence, the content of G can not be higher than the content of C.The software carrying out design of primers has Express 3.0.

Synthetic method and the primer of probe are similar, just after sequent synthesis, add fluorescence radiation group at the 5' end of oligonucleotide, add quenching of fluorescence group at the 3' end of oligonucleotide.

In the present invention, term " test kit " refers to the mixture for PCR reaction, and it comprises damping fluid (buffer), dNTP mixed solution, primer, fluorescent probe, MgCl needed for reaction ₂, Taq enzyme.

In the present invention, Taqman probe is the detection technique of fluorescence gone out at Real-time round pcr platform development, and 5 ' end of probe is containing fluorescent reporter group, and 3 ' end is containing fluorescent quenching group.When probe is complete, the fluorescent signal that reporter group is launched is quenched group absorptions, when carrying out pcr amplification, probe enzyme is cut degraded to the 3 ' 5 prime excision enzyme activity held by 5 ' end of Taq archaeal dna polymerase, reporter group is separated with quenching group, send fluorescent signal, thus reach the accumulation of fluorescent signal and PCR primer forms Complete Synchronization.Taqman-MGB probe is the Taqman probe at 3 ' end with minor groove binding molecule (minor groove binder, MGB), improves the Tm value of probe, shortens probe length, detect while being convenient to multi-mutant site.

Amplification refractory mutation system (amplification refractory mutation system, ARMS) be PCR-based technical foundation grows up for check point sudden change or the technology of polymorphism.ARMS has been successfully applied to analyzing gene polymorphism, comprises germinal mutation and somatic mutation, and this technology can tell the sudden change of low levels under a large amount of wild DNA background.Lack 3 ' end to 5 ' end 5 prime excision enzyme activity according to the Taq DNA polysaccharase used during pcr amplification, primer 3 ' can not be revised and hold base mispairing, as long as primer 3 ' is held with template 1 base unpaired, just cannot amplify specific product.In order to increase the specificity of primer, the mispairing of primer and the wrong timing of target DNA is avoided to extend, another one or two base mismatch can be introduced by 2-3 the base of holding at 3 ' of primer, make it to form multiple mispairing between template and extend to stop mispairing.

This technology of Taqman-ARMS, based on Real-time PCR platform, detects two kinds of technology in conjunction with ARMS sudden change enrichment and Taqman-MGB specificity fluorescent.Utilize ARMS primer pair mutated target sequence to carry out specific PCR amplification, Taqman-MGB probe carries out specific position detection to amplified production, and specific sudden change is identified on Real-time PCR basis.

Beneficial effect of the present invention is: the method based on Taqman-ARMS technology for detection gene mutation typing disclosed by the invention, has high specificity: the ARMS primer of design, can specific amplification mutagenesis template DNA only for transgenation sequence; Design one or two base mismatch in 3 ' to 5 ' end 1-4 position of ARMS primer, the specificity of ARMS primer can be increased; The mutational site that the Taqman-MGB probe of the present invention's design connects for goal gene justice is designed, specifically in conjunction with mutagenesis template DNA.The method also has highly sensitive feature, and the ARMS primer of design, can specific amplification mutagenesis template DNA only for gene specific mutant nucleotide sequence, thus reaches the inrichment to micro-mutagenesis template, improves detection sensitivity.The mutator gene DNA profiling number that method detection transgenation sensitivity disclosed by the invention can reach 1%(and goal gene accounts for 1% of wild-type DNA profiling number); And the mutator gene DNA profiling number that the sensitivity of direct sequencing detection transgenation is 20%(and goal gene accounts for 20% of wild-type DNA profiling number); Testing process is stopped pipe reaction, the possibility of decreasing pollution, and fast simple to operate, whole PCR reaction process only has 90 minutes, and direct Sequencing rule needs the time of 2 days, and is open pipe operation, greatly increases the possibility of pollution; Result interpretation is clearly objective, only need get final product the interpretation of paired samples gene type according to the data on PCR instrument device.Utilize method disclosed by the invention to realize high throughput testing, can detect multiple gene on 96 orifice plates simultaneously, reach accurate result; Also have security high, whole system does not comprise hazardous and noxious substances simultaneously, without the need to the open pipe of PCR primer, to testing crew and environment all without harm.

Accompanying drawing explanation

Fig. 1 is that different positions introduces missense mutation result figure (M:Marker; 1: special primer; 2: the missense mutation of the 1st, upstream, mutational site; 3: the missense mutation of the 2nd, upstream, mutational site; 4: the missense mutation of the 3rd, upstream, mutational site).

Fig. 2 is different PCR damping fluid result figure (M:Marker; 0.5 ×, 1 ×, 1.5 ×, 2 ×, 2.5 × be respectively 0.5 times, 1 times, 1.5 times, 2 times and 2.5 times of PCR damping fluids).

Fig. 3 is different Mg Cl ₂concentration results figure (M:Marker; 1.5,2.0,2.5,3.0 and 3.5 represent MgCl respectively ₂concentration 1.5mM, 2.0mM, 2.5 mM, 3.0 mM and 3.5 mM).

Fig. 4 is different dNTPs concentration results figure (M:Marker; 0.1,0.25,0.5 and 0.75 represents that dNTPs concentration is respectively 0.1mM, 0.25 mM, 0.5mM and 0.75 mM respectively).

Fig. 5 is different primers concentration results figure (M:Marker; Primer concentration is respectively 150nM, 250nM, 300nM, 350nM and 400nM).

Fig. 6 is with L858R mutant DNA for template, the positive-sense strand in mutational site or antisense strand design Taqman-MGB probe result figure.

Fig. 7 is the sensitivity results figure of Taqman-ARMS technology.

Embodiment

Below in conjunction with specific embodiment, such scheme is described further.Should be understood that these embodiments are not limited to for illustration of the present invention limit the scope of the invention.The implementation condition adopted in embodiment can do further adjustment according to the condition of concrete producer, and not marked implementation condition is generally the condition in normal experiment.

embodiment 1

Human EGFR gene is positioned on genome No. 7 karyomit(e), (Genebank:NG_007726.3) of EGFR gene group DNA, and the full-length cDNA of coding EGFR gene is as shown in SEQ ID No:1.Mainly concentrate on exon 21 according to EGFR gene missense mutation, EGFR gene exon 21 sequence is as shown in SEQ ID No:2, and mutational site mainly contains 2573 missense mutation, and namely 2573 become G (referred to as L858R) from T.

According to L858R mutation type, Primer 5 is utilized to design ARMS primer pair, last position making missense mutation site be positioned at upstream primer 3 ' to hold, and position, upstream, mutational site the 1st, 2 and 3 introducing mispairing mutating alkali yl will be positioned at, concrete primer is as shown in table 1, and downstream primer is: 5 '-aaacaatacagctagtgggaaggc-3 ' (SEQ ID No:3)

Table 1. ARMS upstream primer sequence

3 ' end mismatch site	Upstream primer sequence (5 ' → 3 ')
			Special primer	5’- tcaagatcacagattttgggc g -3’	SEQ ID No：4
2nd bit mismatch	5’- tcaagatcacagattttggg gg-3’	SEQ ID No：5
			3rd bit mismatch	5’- tcaagatcacagattttgg cc g -3’	SEQ ID No：6
4th bit mismatch	5’- tcaagatcacagattttg cgc g -3’	SEQ ID No：7

Build the positive quality control product of L858R, be specially the positive reference substance of 2573 missense mutation.By screening L858R mutant DNA or synthetic L858R mutant nucleotide sequence, be cloned in pGM-T carrier, be built into recombinant plasmid.Then by recombinant plasmid transformed bacillus coli DH 5 alpha, after order-checking is defined as recombinant plasmid, recombinant plasmid is extracted, purified rear dilution, obtained positive control, for subsequent use.

Get the positive control after dilution to mix in varing proportions with wild type gene group DNA, obtain wild-type sample (not containing positive reference substance), 1% sudden change sample (ratio of positive reference substance and wild sample is 1:100), 2% sudden change sample (ratio of positive reference substance and wild sample is 2:100), 5% sudden change sample (ratio of positive reference substance and wild sample is 5:100), 10% sudden change sample (ratio of positive reference substance and wild sample is 10:100), 50% sudden change sample (ratio of positive reference substance and wild sample is 50:100), 100% sudden change sample (not containing wild type gene group DNA), make the OD260/OD280 of sample after mixing between 1.8 ~ 2.0, make Positive mutants sample, for subsequent use.

(in 20 μ L systems, the final concentration of each component is respectively 1 × PCR Buffer, 0.25mM dNTP, 2.5mM MgCl for masterplate carries out PCR reaction to utilize the ARMS primer pair of L858R mutation type and the positive control of preparation ₂, 1U/ reaction dna polysaccharase, 250nM primer, 30ng template DNA and surplus be water), PCR reaction conditions is: 95 DEG C of denaturations 5 minutes, a circulation; 40 amplification cycles, 95 DEG C are out of shape 20 seconds, anneal and extend 40 seconds for 60 DEG C; Last 40 DEG C of coolings 15 seconds, PCR primer carries out electroresis appraisal, as shown in Figure 1.As shown in Figure 1, base mismatch is introduced in 1-3 position, upstream, mutational site, all can amplify object band, but the optimum position of introducing base mismatch is at the 1st.Therefore, the nucleotides sequence shown in SEQ ID No:6 is classified as ARMS upstream primer best results, and the primer pair amplifies formed by SEQ ID No:6 and SEQ ID No:3 is most effective, and band is special.

embodiment 2

Arrange as primer with the nucleotides sequence of SEQ ID No:5 and SEQ ID No:3, positive control prepared by embodiment 1 is that template carries out PCR, in PCR reaction PCR buffer concentration be respectively 0.5 ×, 1 ×, 1.5 ×, 2 × and 2.5 ×, all the other constituent concentrations are identical, and (in 20 μ L systems, the final concentration of each component is respectively 0.25mM dNTP, 2.5mM MgCl ₂, 1U/ reaction dna polysaccharase, 250nM primer, 30ng template DNA and surplus be water).PCR reaction conditions is: 95 DEG C of denaturations 5 minutes, a circulation; Increase 40 circulations, 95 DEG C of distortion 20 seconds, anneal and extend 40 seconds for 60 DEG C; Last 40 DEG C of coolings 15 seconds.Pcr amplification product is by electroresis appraisal, and result as shown in Figure 2.As shown in Figure 2, be by amplified band in 0.5 × ~ 2.5 × scope in PCR buffer concentration gradient, when PCR Buffer concentration is its result the best of 1 × time.

embodiment 3

Arranging the positive control prepared for primer and embodiment 1 with the nucleotides sequence of SEQ ID No:5 and SEQ ID No:3 for template carries out MgCl ₂the PCR that concentration is different, all the other component conditions identical (in 20 μ L systems, the final concentration of each composition is 1 × PCR damping fluid, 0.25mM dNTP, 1U/ reaction dna polysaccharase, 250nM primer, 30ng template DNA, and surplus is water), MgCl ₂concentration is respectively 1.5mM, 2.0mM, 2.5 mM, 3.0 mM and 3.5 mM.PCR reaction conditions is identical with embodiment 2, and amplified production carries out electroresis appraisal, and result as shown in Figure 3.As shown in Figure 3, at MgCl ₂concentration all has object band to increase within the scope of 1.5mM ~ 3.5mM, works as MgCl ₂concentration is best results when 2.0-2.5mM.

embodiment 4

Arranging the positive control prepared for primer and embodiment 1 with the nucleotides sequence of SEQ ID No:5 and SEQ ID No:3 for template carries out the pcr amplification of different dNTPs concentration, other conditions are fixed, and (in 20 μ L systems, each composition final concentration is 1 × PCR damping fluid, 2.5mM MgCl ₂, 1U/ reaction dna polysaccharase, 250nM primer, 30ng template DNA, surplus be water), dNTPs concentration is respectively 0.1mM, 0.25 mM, 0.5mM and 0.75 mM.PCR reaction conditions is identical with embodiment 2, and amplified production carries out electroresis appraisal, and result as shown in Figure 4.As shown in Figure 4, be all have object product amplification between 0.25 mM ~ 0.75 mM in dNTPs concentration, when dNTP concentration is 0.25mM, its result is best.

embodiment 5

Arranging the positive control prepared for primer and embodiment 1 with the nucleotides sequence of SEQ ID No:5 and SEQ ID No:3 for template carries out the pcr amplification of different primers concentration, other conditions are fixed, and (in 20 μ L systems, each composition final concentration is 1 × PCR Buffer, 2.5mM MgCl ₂, 0.25mM dNTP, 1U/ reaction dna polysaccharase, 30ng template DNA, surplus be water), primer concentration is respectively 150nM, 250nM, 300nM, 350nM and 400nM.PCR reaction conditions is identical with embodiment 2, and amplified production carries out electroresis appraisal, and result as shown in Figure 5.As shown in Figure 5, primer concentration all can amplify object band within the scope of 150-350nM, but when primer concentration is 250nM its best results.

embodiment 6

Express 3.0 is adopted to design Taqman-MGB probe, at positive-sense strand (identifying ARMS primer extension product positive-sense strand) and antisense strand (identifying ARMS primer extension product antisense strand) the mutational site design Taqman-MGB probe of ARMS upstream primer, the nucleotides sequence of Sense probes is classified as ttgggggggccaaa(SEQ ID No:8), the nucleotides sequence of antisense probe is classified as tttggcccccccaa(SEQ ID No:9).

Arrange as ARMS primer with the nucleotides sequence of SEQ ID No:5 and SEQ ID No:3, shown in SEQ ID No:8 and SEQ ID No:9, Nucleotide is Taqman-MGB probe, its specificity is verified for masterplate carries out quantitative fluorescent PCR with the positive control of preparation, quantitative fluorescent PCR condition is: 95 DEG C of denaturations 5 minutes, a circulation; 40 amplification cycles, 95 DEG C are out of shape 20 seconds, anneal and extend 40 seconds for 60 DEG C; Last 40 DEG C of coolings 15 seconds, result as shown in Figure 6.As shown in Figure 6, when probe design is on antisense strand mutated site, its specificity, amplification efficiency are best.Therefore, the nucleotide sequence detecting the preferred probe of L858R sudden change is tttggcccccccaa(SEQ ID No:9)

embodiment 7

L858R site is adopted to test, 1% sudden change sample embodiment 1 prepared, 2% sudden change sample, 5% sudden change sample, 10% sudden change sample, 50% sudden change sample, 100% sudden change sample are masterplate, verify its sensitivity with the ARMS primer pair that embodiment 2 uses for primer and antisense strand Taqman-MGB probe carry out quantitative fluorescent PCR, result as shown in Figure 7.As shown in Figure 7, the detection sensitivity of detection method disclosed by the invention can reach 1%.

embodiment 8

Get the fresh blood of 400 routine volunteers, extract DNA as template, with Taqman-ARMS technology for detection L858R sudden change somatotype, primer is the nucleotide sequence of SEQ ID No:5 and SEQ ID No:3, the nucleotide sequence of probe is as shown in SEQ ID No:9, and all the other conditions are identical with embodiment 2.This detection method is compared with direct Sequencing simultaneously.Detected result shows: Taqman-ARMS detects in 400 routine fresh bloods, detects that 16 routine pattern detection have sudden change somatotype, and actual order-checking has 15 example sudden changes, and checking order as Taqman-ARMS in 15 routine samples of sudden change detects also is sudden change somatotype.Therefore Taqman-ARMS is detected as power is 100%, and it is that to detect concordance rates be 95% for 100%, two kinds of methods that positive detection goes out rate.From Analysis of test results, the accurate sensitivity of Taqman-ARMS technology for detection sudden change exceedes order-checking.

What finally illustrate is, above embodiment is only in order to illustrate technical scheme of the present invention and unrestricted, although by referring to the preferred embodiments of the present invention, invention has been described, but those of ordinary skill in the art is to be understood that, various change can be made to it in the form and details, and not depart from the present invention that appended claims limits.

<110> Suzhou Micro Diag Biomedicine Co., Ltd.

<120> is based on the method for Taqman-ARMS technology for detection gene mutation typing and test kit

<130>

<160> 9

<210> 1

<211> 3633

<212> DNA

<213> homo sapiens (homo sapiens) EGFR gene CDS

<400> 1

atgcgaccct ccgggacggc cggggcagcg ctcctggcgc tgctggctgc gctctgcccg 60

gcgagtcggg ctctggagga aaagaaagtt tgccaaggca cgagtaacaa gctcacgcag 120

ttgggcactt ttgaagatca ttttctcagc ctccagagga tgttcaataa ctgtgaggtg 180

gtccttggga atttggaaat tacctatgtg cagaggaatt atgatctttc cttcttaaag 240

accatccagg aggtggctgg ttatgtcctc attgccctca acacagtgga gcgaattcct 300

ttggaaaacc tgcagatcat cagaggaaat atgtactacg aaaattccta tgccttagca 360

gtcttatcta actatgatgc aaataaaacc ggactgaagg agctgcccat gagaaattta 420

caggaaatcc tgcatggcgc cgtgcggttc agcaacaacc ctgccctgtg caacgtggag 480

agcatccagt ggcgggacat agtcagcagt gactttctca gcaacatgtc gatggacttc 540

cagaaccacc tgggcagctg ccaaaagtgt gatccaagct gtcccaatgg gagctgctgg 600

ggtgcaggag aggagaactg ccagaaactg accaaaatca tctgtgccca gcagtgctcc 660

gggcgctgcc gtggcaagtc ccccagtgac tgctgccaca accagtgtgc tgcaggctgc 720

acaggccccc gggagagcga ctgcctggtc tgccgcaaat tccgagacga agccacgtgc 780

aaggacacct gccccccact catgctctac aaccccacca cgtaccagat ggatgtgaac 840

cccgagggca aatacagctt tggtgccacc tgcgtgaaga agtgtccccg taattatgtg 900

gtgacagatc acggctcgtg cgtccgagcc tgtggggccg acagctatga gatggaggaa 960

gacggcgtcc gcaagtgtaa gaagtgcgaa gggccttgcc gcaaagtgtg taacggaata 1020

ggtattggtg aatttaaaga ctcactctcc ataaatgcta cgaatattaa acacttcaaa 1080

aactgcacct ccatcagtgg cgatctccac atcctgccgg tggcatttag gggtgactcc 1140

ttcacacata ctcctcctct ggatccacag gaactggata ttctgaaaac cgtaaaggaa 1200

atcacagggt ttttgctgat tcaggcttgg cctgaaaaca ggacggacct ccatgccttt 1260

gagaacctag aaatcatacg cggcaggacc aagcaacatg gtcagttttc tcttgcagtc 1320

gtcagcctga acataacatc cttgggatta cgctccctca aggagataag tgatggagat 1380

gtgataattt caggaaacaa aaatttgtgc tatgcaaata caataaactg gaaaaaactg 1440

tttgggacct ccggtcagaa aaccaaaatt ataagcaaca gaggtgaaaa cagctgcaag 1500

gccacaggcc aggtctgcca tgccttgtgc tcccccgagg gctgctgggg cccggagccc 1560

agggactgcg tctcttgccg gaatgtcagc cgaggcaggg aatgcgtgga caagtgcaac 1620

cttctggagg gtgagccaag ggagtttgtg gagaactctg agtgcataca gtgccaccca 1680

gagtgcctgc ctcaggccat gaacatcacc tgcacaggac ggggaccaga caactgtatc 1740

cagtgtgccc actacattga cggcccccac tgcgtcaaga cctgcccggc aggagtcatg 1800

ggagaaaaca acaccctggt ctggaagtac gcagacgccg gccatgtgtg ccacctgtgc 1860

catccaaact gcacctacgg atgcactggg ccaggtcttg aaggctgtcc aacgaatggg 1920

cctaagatcc cgtccatcgc cactgggatg gtgggggccc tcctcttgct gctggtggtg 1980

gccctgggga tcggcctctt catgcgaagg cgccacatcg ttcggaagcg cacgctgcgg 2040

aggctgctgc aggagaggga gcttgtggag cctcttacac ccagtggaga agctcccaac 2100

caagctctct tgaggatctt gaaggaaact gaattcaaaa agatcaaagt gctgggctcc 2160

ggtgcgttcg gcacggtgta taagggactc tggatcccag aaggtgagaa agttaaaatt 2220

cccgtcgcta tcaaggaatt aagagaagca acatctccga aagccaacaa ggaaatcctc 2280

gatgaagcct acgtgatggc cagcgtggac aacccccacg tgtgccgcct gctgggcatc 2340

tgcctcacct ccaccgtgca gctcatcacg cagctcatgc ccttcggctg cctcctggac 2400

tatgtccggg aacacaaaga caatattggc tcccagtacc tgctcaactg gtgtgtgcag 2460

atcgcaaagg gcatgaacta cttggaggac cgtcgcttgg tgcaccgcga cctggcagcc 2520

aggaacgtac tggtgaaaac accgcagcat gtcaagatca cagattttgg gctggccaaa 2580

ctgctgggtg cggaagagaa agaataccat gcagaaggag gcaaagtgcc tatcaagtgg 2640

atggcattgg aatcaatttt acacagaatc tatacccacc agagtgatgt ctggagctac 2700

ggggtgaccg tttgggagtt gatgaccttt ggatccaagc catatgacgg aatccctgcc 2760

agcgagatct cctccatcct ggagaaagga gaacgcctcc ctcagccacc catatgtacc 2820

atcgatgtct acatgatcat ggtcaagtgc tggatgatag acgcagatag tcgcccaaag 2880

ttccgtgagt tgatcatcga attctccaaa atggcccgag acccccagcg ctaccttgtc 2940

attcaggggg atgaaagaat gcatttgcca agtcctacag actccaactt ctaccgtgcc 3000

ctgatggatg aagaagacat ggacgacgtg gtggatgccg acgagtacct catcccacag 3060

cagggcttct tcagcagccc ctccacgtca cggactcccc tcctgagctc tctgagtgca 3120

accagcaaca attccaccgt ggcttgcatt gatagaaatg ggctgcaaag ctgtcccatc 3180

aaggaagaca gcttcttgca gcgatacagc tcagacccca caggcgcctt gactgaggac 3240

agcatagacg acaccttcct cccagtgcct gaatacataa accagtccgt tcccaaaagg 3300

cccgctggct ctgtgcagaa tcctgtctat cacaatcagc ctctgaaccc cgcgcccagc 3360

agagacccac actaccagga cccccacagc actgcagtgg gcaaccccga gtatctcaac 3420

actgtccagc ccacctgtgt caacagcaca ttcgacagcc ctgcccactg ggcccagaaa 3480

ggcagccacc aaattagcct ggacaaccct gactaccagc aggacttctt tcccaaggaa 3540

gccaagccaa atggcatctt taagggctcc acagctgaaa atgcagaata cctaagggtc 3600

gcgccacaaa gcagtgaatt tattggagca tga 3633

<210> 2

<211> 156

<212> DNA

<213> homo sapiens (homo sapiens) EGFR gene the 21st exon

<400> 2

ggcatgaact acttggagga ccgtcgcttg gtgcaccgcg acctggcagc caggaacgta 60

ctggtgaaaa caccgcagca tgtcaagatc acagattttg ggctggccaa actgctgggt 120

gcggaagaga aagaatacca tgcagaagga ggcaaa 156

<210> 3

<211> 24

<212> artificial sequence

<213> detects L858R downstream primer

<400> 3

aaacaataca gctagtggga aggc 24

<210> 4

<211> 22

<212> artificial sequence

The special upstream primer of <213>

<400> 4

tcaagatcac agattttggg c g 22

<210> 5

<211> 22

<212> artificial sequence

<213> the 2nd bit mismatch upstream primer

<400> 5

tcaagatcac agattttggg gg 22

<210> 6

<211> 22

<212> artificial sequence

<213> the 3rd bit mismatch upstream primer

<400> 6

tcaagatcac agattttgg cc g 22

<210> 7

<211> 22

<212> artificial sequence

<213> the 4th bit mismatch upstream primer

<400> 7

tcaagatcac agattttg cg c g 22

<210> 8

<211> 14

<212> artificial sequence

<213> Sense probes

<400> 8

ttgggggggc caaa 14

<210> 9

<211> 14

<212> artificial sequence

<213> antisense probe

<400> 9

tttggccccc ccaa 14

Claims

1. based on the test kit that Taqman-ARMS technology for detection gene mutation typing uses, it is characterized in that: described test kit comprises ARMS primer and the Taqman-MGB probe in the mutational site of testing goal gene, the upstream primer of described ARMS primer or 3 ' end of downstream primer are mutational site, and will be positioned at the Nucleotide missense mutation of the 1st, upstream, mutational site;

Described Taqman-MGB probe is the Taqman probe in the amplified production positive-sense strand mutational site of specific recognition ARMS primer, and 3 ' end of described probe is combined with minor groove binding molecule;

Described ARMS primer is the nucleotide sequence shown in SEQ ID No:3 and SEQ ID No:5;

The nucleotide sequence of described Taqman-MGB probe is as shown in SEQ ID No:9.

2. test kit according to claim 1, is characterized in that: described test kit is by PCR damping fluid, dNTPs, primer pair, Taqman-MGB probe, MgCl ₂, Taq DNA polymerase and template DNA composition, during each component reaction, final concentration is:

PCR buffer Final concentration 0.5 ~ 2.5 ×;

dNTPs 0. 1～0.75mM；

Primer pair upstream and downstream primer final concentration is respectively 150 ~ 350nM;

Template DNA 0.01 ~ 10ng/ μ L;

Taq DNA polymerase 0.01 ~ 1.0U/ μ L;

MgCl ₂final concentration is 1.5 ~ 3.5mM;

Taqman-MGB probe final concentration is 50 ~ 200nM.

3. test kit according to claim 2, is characterized in that: described PCR damping fluid, dNTPs, primer pair, Taqman-MGB probe, MgCl ₂, Taq DNA polymerase and template DNA final concentration consist of:

PCR buffer Final concentration 1 ×;

dNTPs 0.25mM；

Primer pair upstream and downstream primer final concentration is respectively 250nM;

Template DNA 0.05 ~ 1.5ng/ μ L;

Taq DNA polymerase 0.01 ~ 1.0U/ μ L;

MgCl ₂final concentration is 2.0 ~ 2.5mM;

Taqman-MGB probe final concentration is 50nM.