CN108018301B

CN108018301B - Method for determining core promoter of miR-27a gene and binding site of transcription factor Myod thereof

Info

Publication number: CN108018301B
Application number: CN201711315224.1A
Authority: CN
Inventors: 陶虎; 陈明新; 熊琪; 张凤; 李晓锋; 索效军; 张年; 杨前平; 刘洋; 张鹤山; �田宏; 熊军波
Original assignee: Institute of Animal Science and Veterinary of Hubei Academy of Agricultural Sciences
Current assignee: Institute of Animal Science and Veterinary of Hubei Academy of Agricultural Sciences
Priority date: 2017-12-12
Filing date: 2017-12-12
Publication date: 2021-02-26
Anticipated expiration: 2037-12-12
Also published as: CN108018301A

Abstract

The invention provides a method for determining a core promoter of a miR-27a gene, which comprises the steps of amplifying 8 miR-27a promoter deletion fragments from a mouse blood genome DNA, constructing recombinant dual-luciferase expression vectors pGL3-D1 to pGL3-D8, transferring the recombinant dual-luciferase expression vectors into CHO cells, and detecting luciferase activities of the 8 deletion fragments to obtain a core promoter region; the method identifies the core region of miR-27a, and provides a new promoter resource for genetic engineering and molecular breeding; the invention also provides a method for determining the transcription factor Myod binding site in the miR-27a gene core promoter, which comprises the steps of constructing a mutant type fluorescence expression vector by over-expressing the transcription factor Myod and the transcription factor binding site in the site-directed mutation core promoter region, detecting the activity of luciferase and determining the transcription factor binding site; provides a basis for the research of miR-27a expression regulation and control applied to the livestock high-fertility molecular regulation and control mechanism.

Description

Method for determining core promoter of miR-27a gene and binding site of transcription factor Myod thereof

Technical Field

The invention relates to the field of molecular genetics, in particular to a method for determining a core promoter of a miR-27a gene and a transcription factor Myod binding site in the core promoter of the miR-27a gene.

Background

China is a big animal husbandry country, and the animal husbandry plays an important role in national economy. Reproduction and growth are two major economic traits that determine large-scale breeding output, and in animal husbandry, the reproductive benefit of female animals accounts for a greater proportion of the total benefit. The breeding character has the defects of low heritability, long selection period, slow breeding progress and the like, and becomes a main reason for restricting the economic benefit of animal husbandry. Ovulation rate is an important component of litter size trait, and the growth and development of follicles in the ovaries determines the ovulation rate. Therefore, the exploration of the gene expression condition, the development rule and the regulation factor of the ovarian cells in the ovary has important significance for revealing the genetic regulation mechanism of the ovulation rate and breeding high-fertility varieties.

MicroRNA (miRNA) is a kind of endogenous non-coding RNA with a regulation function, is generally 16-29 nucleotides (nt) in length, and is combined with 3' -UTR of target gene mRNA to regulate and control the post-transcriptional expression of a target gene. MiRNA as a small molecular sequence can globally regulate and control the expression of genes, and the functions of the MiRNA relate to important life processes such as tissue growth, apoptosis, fat metabolism, egg cell development, spermatogenesis and the like. For follicular development, miR-27a belongs to microribonucleic acid (microRNA) and is a small molecule regulator playing an important regulation role.

miR-27a realizes the regulation and control effect on gene expression through specific recognition of a 3' -UTR region sequence of a target gene, and a precursor of the miR-27a is also regulated and controlled by a specific transcription factor. The miR-27a promoter (a DNA sequence which can be specifically recognized and combined with RNA polymerase (RNA polymerase) and is usually positioned in the 5' untranslated region of a gene and about 200bp in length) realizes the regulation effect through the interaction of cis-acting elements (cis-acting elements) and trans-acting factors (trans-acting factors) of the promoter region. Promoters function like "switches" and play the most critical role in directing gene activity. A promoter is essentially a DNA sequence which does not have the function of regulating a gene, but specifically regulates gene expression by interacting with a specific transcription factor. The research on the function of the promoter enables people to understand the regulation mechanism of the growth and development of organisms more deeply, and has important significance for researching the expression regulation of functional genes.

pGL3-Basic is a commonly used reporter gene, and because of no promoter and enhancer, the promoter activity of the inserted fragment can be detected through the expression of a luciferase reporter gene, and the strength of the promoter is compared, thereby preliminarily determining the core promoter region.

Disclosure of Invention

The invention aims to provide a method for determining a core promoter of miR-27a gene and a transcription factor Myod binding site in the core promoter of miR-27a gene, a core section of miR-27a is identified, new promoter resources are provided for genetic engineering and molecular breeding, the regulation and control effects of the activity of each deletion section of the miR-27a promoter in a cell and the transcription factor in the core promoter region are thoroughly verified, deeper cognition is brought for the expression regulation and control of miRNA, the method is applied to the research of a livestock high-fertility molecular regulation and control mechanism, and has better application prospect.

The invention is realized by the following steps:

the invention provides a method for determining a core promoter of a miR-27a gene, which comprises the following steps:

step 11, designing 8 upstream deletion fragment primers (PF1-PF8) and 1 common downstream Primer (PR) according to a 2000bp sequence (nucleotide sequence is shown as SEQ ID NO: 1) of the 5' -UTR of the mouse miR-27a in an NCBI database;

and step 12, taking the whole genome DNA of the blood of the mouse as a template, and performing amplification of the deletion fragment by using a polymerase chain reaction to obtain 8-segment length 5' -UTR sequences of the sequentially truncated miR-27a, wherein the nucleotide sequence is shown as SEQ ID NO: 11-SEQ ID NO: 18 is shown in the figure; sequentially carrying out restriction enzyme digestion, agarose gel electrophoresis and gel cutting purification on the 8-segment sequence and pGL3-Basic vector plasmid; connecting the treated 8-segment sequence with pGL3-Basic vector plasmid by using T4 ligase, then transferring into Escherichia coli DH5 alpha, and performing plate culture to obtain a single colony; finally, extracting plasmids in the bacterial liquid, and determining the completion of vector construction through sequencing;

step 13: culturing CHO cells, inoculating the CHO cells into a cell culture plate, performing transfection operation after the density reaches 80%, selecting renilla luciferase pRL-TK as an internal reference, and transfecting the CHO cells;

step 14: and after 24h of transfection, obtaining total protein by using cell lysate, adding the lysate containing a small amount of the total protein into working solution prepared in a dual-luciferase reporter gene detection kit, and carrying out dual-luciferase activity detection on the obtained total protein through a dual-luciferase reporter gene.

The invention also provides a method for determining the transcription factor Myod binding site in the core promoter of the miR-27a gene, which comprises the following steps:

step 21, obtaining a core promoter of the miR-27a gene according to the method, and predicting 2 Myod binding sites (the nucleotide sequences are shown as SEQ ID NO: 19 and SEQ ID NO: 20) in the core promoter by using transcription factor prediction software;

step 22, transiently co-transfecting the prepared overexpression vector pc-Myod of Myod and the core promoter dual-luciferase report vector pGL3-D7 of miR-27a obtained in the method to CHO cells, and performing dual-luciferase activity detection after 24 hours to obtain fluorescence detection values of a test group and a control group;

step 23, changing the nucleotide sequence of the consensus part of 2 Myod binding sites by using a site-directed mutagenesis technology, wherein the sequence is shown as a sequence table SEQ ID NO: 21, constructing a mutant fluorescent expression vector pGL3-D7-mut, transiently transfecting CHO cells with an overexpression vector pc-Myod of the prepared Myod and the mutant fluorescent expression vector pGL3-D7-mut, carrying out dual-luciferase activity detection after 24 hours to obtain a detection value of an experimental group, and comparing the detection value of the experimental group with the detection value of a control group to determine a binding site of a transcription factor Myod on a miR-27a core promoter.

The invention has the following beneficial effects:

1. the core segment of miR-27a is identified, a new promoter resource is provided for genetic engineering and molecular breeding, and the method has the advantages of high sensitivity, high speed, low cost and the like.

2. The regulation and control effects of each deletion section of the miR-27a promoter on the promoter activity in cells and the transcription factor in a core promoter region are thoroughly verified, deeper cognition is brought to the expression regulation and control of miRNA, and the miRNA expression regulation and control method is applied to the research of the livestock high-fertility molecular regulation and control mechanism and has better application prospect.

Drawings

FIG. 1 is a flow chart of a method for determining a core promoter of a miR-27a gene provided by an embodiment of the invention;

FIG. 2 is a flowchart of a method for determining a transcription factor Myod binding site in a core promoter of a miR-27a gene according to an embodiment of the invention;

FIG. 3 is a structural map of the empty vector pGL 3-Basic;

FIG. 4 is a structural map of an internal reference pRL-TK vector;

FIG. 5 is a structural map of the invention for constructing a miR-27a deletion fragment dual-luciferase expression vector pGL 3;

FIG. 6 shows the results of relative luciferase activity assays after transfection of CHO cells for 24h with pGL3-D1, pGL3-D2, pGL3-D3, pGL3-D4, pGL3-D5, pGL3-D6, pGL3-D7, pGL3-D8 and pGL3-Basic, respectively. In the figure: the ordinate of the relative Luciferase Activity represents the relative Luciferase Activity value, and Basic is a blank control;

FIG. 7 shows the results of detecting relative luciferase activity of pGL3-D7 after the overexpression vectors pc-Myod and pcDNA3.1 blank control of the transcription factor Myod were co-transfected into CHO cells for 24h, respectively. In the figure: the ordinate Related Luciferase Activity represents relative Luciferase Activity value, pcDNA3.1 is blank control, P is less than 0.01;

FIG. 8 shows the results of detecting relative luciferase activities of the transcription factor Myod binding site mutant fluorescent expression vectors Myod-mut and pGL3-D7 wild-type vectors after transfection of CHO cells for 24h respectively. In the figure: the ordinate Related Luciferase Activity represents relative Luciferase Activity values, D7 for the control group,. P < 0.01.

Detailed Description

Example 1 determination of core promoter of miR-27a Gene

1. Mouse blood DNA extraction and detection

1.1 extraction of whole genome DNA of mouse blood is carried out by using a Whitecker cell/tissue genome DNA extraction kit (centrifugal column type), and the extracted DNA is stored at-20 ℃ for later use.

1.2 genomic DNA concentration determination: the DNA concentration and OD value were measured using a NanoDrop 2000 type DNA/RNA concentration measuring instrument, and the DNA in the tube was diluted accordingly in accordance with the measured concentration, dispensed at 50 ng/. mu.L, and stored at-20 ℃ for future use.

1.3 genomic DNA quality detection: mu.L of DNA was sampled and added with 4. mu.L of the loading buffer, mixed well and spotted on 1% agarose gel (EB staining solution), and 5. mu.L of DL 2000 standard molecular weight DNA Marker was spotted as a reference. Electrophoresis is carried out under the condition of 15V/cm, and then the result is observed in a gel imaging system and stored by photographing.

2. Bioinformatics analysis of miR-27a promoter

According to the sequence (accession number NC-000074.6) of the GeneBank mouse miR-27a precursor, an NCBI database retrieval tool is utilized to extend forward by 2000bp, the sequence is used as a template to obtain a fragment of a 5' -UTR region of the mouse miR-27a precursor, and the nucleotide sequence of the fragment is shown in a sequence table SEQ ID NO: 1, the preparation method is as follows. And (3) performing reaction on the nucleotide sequence of SEQ ID NO: 1 predicting the distribution of the core promoter region, cis-trans acting elements and CpG islands. The range of the design of the deletion fragment primer is determined by comprehensively considering the predicted information.

3. Primer design

Taking a miR-27a precursor promoter region as a template, designing a Touch-down PCR Primer (Nhe I and HindIII enzyme cutting sites are respectively added at the 5' end and are shown in a box part in the Primer, and the previous 3 basic groups are protection basic groups) for obtaining 8 deletion fragments (D1-D8) of the miR-27a precursor by amplification by using Primer 5 software, wherein the sequence of the Primer is as follows:

sequence of primer PF1 upstream of D1: CTAGCTAGCCTTGCTTTCCTTTGCCTTTC (SEQ ID NO: 2 of the sequence Listing);

sequence of primer PF2 upstream of D2: CTAGCTAGCGAAAGAAACCTGTCATCTCTCCAA (SEQ ID NO: 3 of the sequence Listing); sequence of upstream primer PF3 of D3: CTAGCTAGCTGGCACGCAGGACACTACTCTA (SEQ ID NO: 4 of the sequence Listing);

the sequence of the upstream primer PF4 of D4 is CTAGCTAGCAACTCATCATGTAGCTTAAGCA (SEQ ID NO: 5 of the sequence Listing);

sequence of upstream primer PF5 of D5: CTAGCTAGCTTTCCTCCTGCCCTTCA (SEQ ID NO: 6 of the sequence Listing);

sequence of upstream primer PF6 of D6: CTAGCTAGCAAGTAGAGGAGGGCTAGGGT (SEQ ID NO: 7 of the sequence Listing);

sequence of upstream primer PF7 of D7: CTAGCTAGCATGCTCCAATCTCACTGTCTC (SEQ ID NO: 8 of the sequence Listing);

sequence of upstream primer PF8 of D8: CTAGCTAGCTCACTGTGCCTCGGACGGCT (SEQ ID NO: 9 of the sequence Listing);

sequence of common downstream primer PR: CCCAAGCTTTTTGCTGTGGACCTTGCTCA (SEQ ID NO: 10 of the sequence Listing).

4. Amplification of miR-27a promoter deletion fragment and PCR product recovery

Using the designed primers SEQ ID NO: 2 to SEQ ID NO: 9 and SEQ ID NO: 10 forming a primer pair, and amplifying 8 deletion fragments (the product lengths are 1698bp, 1493bp, 1279bp, 1088bp, 800bp, 478bp, 283bp and 214bp) of the miR-27a promoter by using the whole genome DNA of the blood of the mouse as a template and adopting a Touch-down PCR strategy.

Touch-down PCR reaction procedure was as follows:

the PCR reaction (50. mu.L) was as follows:

5. and (3) adding 0.5 mu L of Loading Buffer into 5 mu L of PCR amplification product, uniformly mixing, then spotting on 2% agarose gel, taking 5 mu L of DNA standard molecular weight DL 2000Marker as a reference, carrying out 15V/cm electrophoresis, and after the electrophoresis is finished, observing the result in a gel imaging system, and photographing and storing.

The PCR product was recovered by cutting with a gel recovery kit from Omega Bio-tek, and the specific procedures were performed according to the kit instructions.

6. Cloning and sequencing verification

The recovered PCR product was ligated to pMD18-T vector from TAKARA, 10. mu.L of the total ligation reaction system, and ligated at 16 ℃ for 1 hour.

PCR reaction (10. mu.L):

adding 10 μ L of the ligation product into 50 μ L of DH5 α competent cells under sterile conditions, mixing, standing in ice bath for 30min, performing heat shock at 42 ℃ for 90s, immediately placing on ice for 2-3min, adding 400 μ L of LB liquid medium without AMP antibiotic, placing on a constant temperature shaking table at 37 ℃ for 45min, centrifuging at low speed (<5000g), keeping 150 μ L of supernatant, and discarding the rest. The remaining supernatant was blown, homogenized and then spread evenly on a plate (containing 100mg/L of Amp), placed flat in a 37 ℃ incubator for about 1 hour, and then inverted overnight. Single colonies with normal morphology on the plate were picked with a pipette tip and placed in a 1.5mL Ependorff tube containing 400. mu.L of LB liquid medium (containing 100mg/L Amp) and shake-cultured at 37 ℃ for 8 h. mu.L of the bacterial solution was used as a template for PCR amplification, and the PCR amplification system and procedure were as described above. The PCR amplification products were detected by electrophoresis on 2% agarose gel and recorded by photography on a gel imaging system. And (3) carrying out PCR detection on the bacterial liquid, wherein the result is positive, and the bacterial liquid containing the recombinant plasmid is sent to Beijing Okkomy Splendid Biotech limited for sequencing, and comparing the sequencing result to know that the cloning is successful.

7. Construction of miR-27a promoter deletion fragment luciferase report vector

7.1 amplification of vector pGL3 Basic, vector pGL3 Basic containing Renilla luciferase gene (FIG. 3), E.coli DH 5. alpha. amplification, extraction of vector DNA using endotoxin-removing plasmid miniprep extraction kit (Omega E.Z.N.A.TM.endo-Free plasmid Mini KitISpin), the specific steps are described in the kit instructions.

7.2 double digestion

The purified PCR product was recovered from pGL3 Basic plasmid extracted in 6 and 5, and double digested with restriction enzymes Nhe I and HindIII, respectively, all of which were purchased from NEB.

Double digestion reaction system (10 μ L):

the system was digested at 37 ℃ for 3 h. The enzyme digestion product is electrophoresed in 2% agarose gel and recovered by a column centrifugation method.

7.3 connection

The 8 deletion fragments of the purified digested pGL3 Basic and miR-27a vectors (FIG. 5) were ligated with T4 ligase at 16 ℃ for 2 h.

Ligation system (10 μ L):

7.4 cloning and sequencing validation

Cloning and sequencing verification of the recombinant pGL3 vector were performed using the method in 6.

7.5 extraction of recombinant plasmids

Vector DNA was extracted using a small endotoxin-removing plasmid extraction kit (Omega E.Z.N.A.TM. Endo-Free plasmid Mini kit, the specific steps are described in the kit instructions.

8. Application of miR-27a deletion fragment luciferase report carrier

8.1 transfection of CHO cells with luciferase reporter vectors

(1) 1 day before transfection, 5X 10⁴Inoculating the cells into a 24-pore plate, and continuously culturing until the cell density reaches 80%;

(2) adding 0.8 μ g plasmid transfected into each well into 50 μ L OPTI-MEM medium, mixing, adding 2.0 μ L Lipofectamine 2000 and 1/20 μ g pRL-TK (FIG. 3) into 50 μ L OPTI-MEM medium, mixing, and standing at room temperature for 5 min;

(3) and (3) uniformly mixing the two mixed solutions in the step (2), and standing at room temperature for 20 min.

(4) During this time, the original cell culture medium in each well was aspirated and washed twice with OPTI-MEM.

(5) The mixture in (3) was added to 100. mu.L of each well of cells, and the mixture was made up to 500. mu.L with OPTI-MEM.

(6) Standing at 37 deg.C for 5% CO₂After 24h of culture in a cell incubator, the cells were collected, lysed with 1 XPLB (Passive lysis buffer), and the obtained protein was stored in a-70 ℃ refrigerator.

8.2 Dual luciferase Activity assays

By using

Reporter Assay System the relative fluorescence activity of fluorescent carriers was detected in a multifunctional microplate reader: adding 10 μ L of the obtained cell lysate into an enzyme label plate, firstly adding 50 μ L of LARII to read the activity value A of the firefly luciferase in the sample, and adding 50 μ L of Stop&Glo Reagent reads the activity value B of renilla luciferase in the sample. The A/B ratio represents the activity of the fluorescent carrier, and single-factor variance analysis is carried out on the obtained result by adopting SAS8.0 software, and P is<The difference is significant at 0.05, P<The difference was very significant at 0.01. The detection results of the relative fluorescence activity of the 8 miR-27a deletion fragments are shown in FIG. 5. The results show that pGL3-D1, pGL3-D2, pGL3-D3, pGL3-D4, pGL3-D5, pGL3-D6 and pGL3-D7 have significantly increased fluorescence activity in CHO cells compared with the blank control pGL3-basic, which indicates that the first 7 deletion fragment regions have stronger promoter activity, and pGL3-D8 has no significant difference compared with the blank control pGL 3-basic. Therefore, pGL3-D7 is the core promoter of miR-27a, and has the sequence as follows: ATGCTCCAATCTCACTGTCTCTTCTTTCTCTCTTTAGGTGCTACACTCCGCTCCCACCTGCTG CCCCCC, and theWithin the region of the promoter there is a transcription factor binding site that is capable of up-regulating the activity of the miR-27a promoter.

Example 2 method for determining transcription factor Myod binding site in core promoter of miR-27a gene

1. Regulation and control effect of over-expressed transcription factor Myod on miR-27a core promoter fluorescence activity

The prepared core promoter dual-luciferase reporter vector pGL3-D7 of the Myod over-expression vector pc-Myod and miR-27a is transiently co-transfected into CHO cells, and dual-luciferase activity detection is carried out after 24 hours, and the result shows (figure 7) that the over-expression of Myod can obviously improve the fluorescence activity of the miR-27a core promoter, and Myod has the capability of promoting miR-27a to start activity.

2. Activity detection of transcription factor Myod binding site mutant luciferase report vector

The site-directed mutagenesis technology is utilized to change the consensus parts of 2 Myod binding sites, and the sequences are respectively shown as SEQ ID NO: 21, mutant fluorescent expression vector pGL3-D7-mut was constructed. CHO cells were transiently transfected with the non-mutated wild-type pGL3-D7 as a control and found (FIG. 8): once the transcription factor Myod is positioned at the binding site in the miR-27a core promoter region, the fluorescence activity of the mutant dual-luciferase expression vector is obviously reduced, which indicates that the mutant dual-luciferase expression vector loses the binding capacity with the transcription factor Myod and loses the activation function of the transcription factor on a promoter. Therefore, the core promoter internal transcription factor Myod binding site of the miR-27a gene is determined to be a mutated site.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

The sequence table related by the invention is as follows:

SEQ ID NO：1

ACCAGCCCGACCCTGATGTTTTATAAAGAAGACGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTGTCTGGTCTTTGTGCATGACAGTGCAGTACACTCAGAGACCAGAAGAGGGAGTGAAATCCCCAGAAGCTGGAGTTACAGGTAGTTGTGACAGGTGCTGAGATCCAAACTCGGGCCCTCTGCAAGAGCAGTAGCCACTCTTAACCACTGAGTCAGCTCTTTATCTGAAACAAGGTCACTTGTGTCACTATGTAGCCCTGGATGGTCTGAAACTCCCTACACAGACCAAGCTGGCCTTGAACTCTTAGAGATAGTACTGTCCAAGGCCTGGTTCTTGCTTTCCTTTGCCTTTCAAGTGCTGGGACTAACAGTGTGCACCACCATTCTTAAGTTTATTTTTATTGTCTGTTTGTGAATGTTTGCTTACGCGTACGTCTGTGCACCATATGTATGCCTGGTACCCACAGGGGCCAGTGGGGAGCGTTGGAGCTCTTGGGAATGGAGCTATAGATAGCTGTGCTTGTCATGTAGGTTCTGGGAAAGAAACCTGTCATCTCTCCAACATTGAAATTCTTTAAACAATTTTTAAAAATTGTGTGTGTGTGTTCCCAAGTGCAGAGATCAGAGGACAACTTGCAAGGGTCCGTATGCTTTTCTTCTTCGTGGTTCTTGGGTTTGAGCTCAGGGCATTGGGCTCCATAGCAGCTCTGCTCACTTGCTGGATCAGCTTGCTGGCCCCTGAAAACTTTAACTGGCACGCAGGACACTACTCTACATTGGGTAGGCCCCAAATTTTGTGGCTTGCCCTGGTACTGGGTGCTAAATACCTTCTCTGTAAGTTTTCACTGGCCTTCCTAGTAGAAGGTTTGGGGTTTTGTTGTTTTATTTTTGTTTTTCTTCTATTTAAGACTAGGGTCTCAAACTGTAGCCCAGTTAGGCCTAAAACTCATCATGTAGCTTAAGCAGGCTTTTGACTCCATTCTTGGCAACCTTCCTGCCTCAGTTTCCTCAATGCTGAGATAAACGTGAGCCACCAACTGCAACTGTTGTAGTCTGCTTTACAGATGGGGAAACTGAGGCTTGGAAGGCCTAGGGGAAACTTTACTGAGGTGTTATTGTTGGGGTGCATCGGCCTGCTTCTCCTTGCTTGGGCCCTAGGTGGTGTGGGGTGGGGGTGGGGTTATGTCTGAGCTGGCTGGGGAGGAGAGGGCTGAGGTGGGAGGCCCTGGAGTTTCCTCCTGCCCTTCAGGCTTCTAGGAAGTGGCGCCAGCTGGGGTGAGGTCACTTCCTCCCTCCAACCGTCCACCTCCCTCAGCTTCCTCTCCATGGCCCCATTTGGCCTGCTTTGGGCTCAGGGCTGTGGGTGGGGATAGAAGCAGAGTGGGAAGCAGCTGGGAAGGCTCTGCAGCCCCTTTGGCCTTAGGGCTTCAGGCACCTCCCGCTTTGTAGGGCTGGGGTAGAGGCACTGCTGGGTGCCCAGCATCCAGCAGCCTCGCTCCAACCTTCCTACGGATCGATGCTCCTCTTTTTTGGGAATGCTTCTTCCCTCTTGGAAGTAGAGGAGGGCTAGGGTGTGGATCAGCAAGCTGAGTTTAGATTCTGTCCCCAGCACCACTTAAACTGTGTGTGGTGAGGTGTACCTATAATCCTAGACTCCAGAGGTAGAGGCAGGAAGAACTGGTGCATTCGGAAACCTTGTGTTCAGCTATGTGAGACCCAGCCTGGTCAAGATAGGCAGGCAAGCAAGAATGCTCCAATCTCACTGTCTCTTCTTTCTCTCTTTAGGTGCTACACTCCGCTCCCACCTGCTGCCCCCCTCACTGTGCCTCGGACGGCTGGGGTTCCTGGGGATGGGATTTGATGCCAGTCACAAATCACATTGCCAGGGATTTCCAACTGACCCTGTGCTCTGCCTTGGGGGCTCCTGTCGCCAAGGATGTCTGTCTTGGGTACTGGGTAACAGAGAAGCCTATCATGACAAC

SEQ ID NO：2

SEQ ID NO：3

SEQ ID NO：4

SEQ ID NO：5

SEQ ID NO：6

SEQ ID NO：7

SEQ ID NO：8

SEQ ID NO：9

SEQ ID NO：10

SEQ ID NO：11

CTTGCTTTCCTTTGCCTTTCAAGTGCTGGGACTAACAGTGTGCACCACCATTCTTAAGTTTATTTTTATTGTCTGTTTGTGAATGTTTGCTTACGCGTACGTCTGTGCACCATATGTATGCCTGGTACCCACAGGGGCCAGTGGGGAGCGTTGGAGCTCTTGGGAATGGAGCTATAGATAGCTGTGCTTGTCATGTAGGTTCTGGGAAAGAAACCTGTCATCTCTCCAACATTGAAATTCTTTAAACAATTTTTAAAAATTGTGTGTGTGTGTTCCCAAGTGCAGAGATCAGAGGACAACTTGCAAGGGTCCGTATGCTTTTCTTCTTCGTGGTTCTTGGGTTTGAGCTCAGGGCATTGGGCTCCATAGCAGCTCTGCTCACTTGCTGGATCAGCTTGCTGGCCCCTGAAAACTTTAACTGGCACGCAGGACACTACTCTACATTGGGTAGGCCCCAAATTTTGTGGCTTGCCCTGGTACTGGGTGCTAAATACCTTCTCTGTAAGTTTTCACTGGCCTTCCTAGTAGAAGGTTTGGGGTTTTGTTGTTTTATTTTTGTTTTTCTTCTATTTAAGACTAGGGTCTCAAACTGTAGCCCAGTTAGGCCTAAAACTCATCATGTAGCTTAAGCAGGCTTTTGACTCCATTCTTGGCAACCTTCCTGCCTCAGTTTCCTCAATGCTGAGATAAACGTGAGCCACCAACTGCAACTGTTGTAGTCTGCTTTACAGATGGGGAAACTGAGGCTTGGAAGGCCTAGGGGAAACTTTACTGAGGTGTTATTGTTGGGGTGCATCGGCCTGCTTCTCCTTGCTTGGGCCCTAGGTGGTGTGGGGTGGGGGTGGGGTTATGTCTGAGCTGGCTGGGGAGGAGAGGGCTGAGGTGGGAGGCCCTGGAGTTTCCTCCTGCCCTTCAGGCTTCTAGGAAGTGGCGCCAGCTGGGGTGAGGTCACTTCCTCCCTCCAACCGTCCACCTCCCTCAGCTTCCTCTCCATGGCCCCATTTGGCCTGCTTTGGGCTCAGGGCTGTGGGTGGGGATAGAAGCAGAGTGGGAAGCAGCTGGGAAGGCTCTGCAGCCCCTTTGGCCTTAGGGCTTCAGGCACCTCCCGCTTTGTAGGGCTGGGGTAGAGGCACTGCTGGGTGCCCAGCATCCAGCAGCCTCGCTCCAACCTTCCTACGGATCGATGCTCCTCTTTTTTGGGAATGCTTCTTCCCTCTTGGAAGTAGAGGAGGGCTAGGGTGTGGATCAGCAAGCTGAGTTTAGATTCTGTCCCCAGCACCACTTAAACTGTGTGTGGTGAGGTGTACCTATAATCCTAGACTCCAGAGGTAGAGGCAGGAAGAACTGGTGCATTCGGAAACCTTGTGTTCAGCTATGTGAGACCCAGCCTGGTCAAGATAGGCAGGCAAGCAAGAATGCTCCAATCTCACTGTCTCTTCTTTCTCTCTTTAGGTGCTACACTCCGCTCCCACCTGCTGCCCCCCTCACTGTGCCTCGGACGGCTGGGGTTCCTGGGGATGGGATTTGATGCCAGTCACAAATCACATTGCCAGGGATTTCCAACTGACCCTGTGCTCTGCCTTGGGGGCTCCTGTCGCCAAGGATGTCTGTCTTGGGTACTGGGTAACAGAGAAGCCTATCATGACAACTGGCCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAAGGTCCACAGCAAA

SEQ ID NO：12

GAAAGAAACCTGTCATCTCTCCAACATTGAAATTCTTTAAACAATTTTTAAAAATTGTGTGTGTGTGTTCCCAAGTGCAGAGATCAGAGGACAACTTGCAAGGGTCCGTATGCTTTTCTTCTTCGTGGTTCTTGGGTTTGAGCTCAGGGCATTGGGCTCCATAGCAGCTCTGCTCACTTGCTGGATCAGCTTGCTGGCCCCTGAAAACTTTAACTGGCACGCAGGACACTACTCTACATTGGGTAGGCCCCAAATTTTGTGGCTTGCCCTGGTACTGGGTGCTAAATACCTTCTCTGTAAGTTTTCACTGGCCTTCCTAGTAGAAGGTTTGGGGTTTTGTTGTTTTATTTTTGTTTTTCTTCTATTTAAGACTAGGGTCTCAAACTGTAGCCCAGTTAGGCCTAAAACTCATCATGTAGCTTAAGCAGGCTTTTGACTCCATTCTTGGCAACCTTCCTGCCTCAGTTTCCTCAATGCTGAGATAAACGTGAGCCACCAACTGCAACTGTTGTAGTCTGCTTTACAGATGGGGAAACTGAGGCTTGGAAGGCCTAGGGGAAACTTTACTGAGGTGTTATTGTTGGGGTGCATCGGCCTGCTTCTCCTTGCTTGGGCCCTAGGTGGTGTGGGGTGGGGGTGGGGTTATGTCTGAGCTGGCTGGGGAGGAGAGGGCTGAGGTGGGAGGCCCTGGAGTTTCCTCCTGCCCTTCAGGCTTCTAGGAAGTGGCGCCAGCTGGGGTGAGGTCACTTCCTCCCTCCAACCGTCCACCTCCCTCAGCTTCCTCTCCATGGCCCCATTTGGCCTGCTTTGGGCTCAGGGCTGTGGGTGGGGATAGAAGCAGAGTGGGAAGCAGCTGGGAAGGCTCTGCAGCCCCTTTGGCCTTAGGGCTTCAGGCACCTCCCGCTTTGTAGGGCTGGGGTAGAGGCACTGCTGGGTGCCCAGCATCCAGCAGCCTCGCTCCAACCTTCCTACGGATCGATGCTCCTCTTTTTTGGGAATGCTTCTTCCCTCTTGGAAGTAGAGGAGGGCTAGGGTGTGGATCAGCAAGCTGAGTTTAGATTCTGTCCCCAGCACCACTTAAACTGTGTGTGGTGAGGTGTACCTATAATCCTAGACTCCAGAGGTAGAGGCAGGAAGAACTGGTGCATTCGGAAACCTTGTGTTCAGCTATGTGAGACCCAGCCTGGTCAAGATAGGCAGGCAAGCAAGAATGCTCCAATCTCACTGTCTCTTCTTTCTCTCTTTAGGTGCTACACTCCGCTCCCACCTGCTGCCCCCCTCACTGTGCCTCGGACGGCTGGGGTTCCTGGGGATGGGATTTGATGCCAGTCACAAATCACATTGCCAGGGATTTCCAACTGACCCTGTGCTCTGCCTTGGGGGCTCCTGTCGCCAAGGATGTCTGTCTTGGGTACTGGGTAACAGAGAAGCCTATCATGACAACTGGCCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAAGGTCCACAGCAAA

SEQ ID NO：13

TGGCACGCAGGACACTACTCTACATTGGGTAGGCCCCAAATTTTGTGGCTTGCCCTGGTACTGGGTGCTAAATACCTTCTCTGTAAGTTTTCACTGGCCTTCCTAGTAGAAGGTTTGGGGTTTTGTTGTTTTATTTTTGTTTTTCTTCTATTTAAGACTAGGGTCTCAAACTGTAGCCCAGTTAGGCCTAAAACTCATCATGTAGCTTAAGCAGGCTTTTGACTCCATTCTTGGCAACCTTCCTGCCTCAGTTTCCTCAATGCTGAGATAAACGTGAGCCACCAACTGCAACTGTTGTAGTCTGCTTTACAGATGGGGAAACTGAGGCTTGGAAGGCCTAGGGGAAACTTTACTGAGGTGTTATTGTTGGGGTGCATCGGCCTGCTTCTCCTTGCTTGGGCCCTAGGTGGTGTGGGGTGGGGGTGGGGTTATGTCTGAGCTGGCTGGGGAGGAGAGGGCTGAGGTGGGAGGCCCTGGAGTTTCCTCCTGCCCTTCAGGCTTCTAGGAAGTGGCGCCAGCTGGGGTGAGGTCACTTCCTCCCTCCAACCGTCCACCTCCCTCAGCTTCCTCTCCATGGCCCCATTTGGCCTGCTTTGGGCTCAGGGCTGTGGGTGGGGATAGAAGCAGAGTGGGAAGCAGCTGGGAAGGCTCTGCAGCCCCTTTGGCCTTAGGGCTTCAGGCACCTCCCGCTTTGTAGGGCTGGGGTAGAGGCACTGCTGGGTGCCCAGCATCCAGCAGCCTCGCTCCAACCTTCCTACGGATCGATGCTCCTCTTTTTTGGGAATGCTTCTTCCCTCTTGGAAGTAGAGGAGGGCTAGGGTGTGGATCAGCAAGCTGAGTTTAGATTCTGTCCCCAGCACCACTTAAACTGTGTGTGGTGAGGTGTACCTATAATCCTAGACTCCAGAGGTAGAGGCAGGAAGAACTGGTGCATTCGGAAACCTTGTGTTCAGCTATGTGAGACCCAGCCTGGTCAAGATAGGCAGGCAAGCAAGAATGCTCCAATCTCACTGTCTCTTCTTTCTCTCTTTAGGTGCTACACTCCGCTCCCACCTGCTGCCCCCCTCACTGTGCCTCGGACGGCTGGGGTTCCTGGGGATGGGATTTGATGCCAGTCACAAATCACATTGCCAGGGATTTCCAACTGACCCTGTGCTCTGCCTTGGGGGCTCCTGTCGCCAAGGATGTCTGTCTTGGGTACTGGGTAACAGAGAAGCCTATCATGACAACTGGCCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAAGGTCCACAGCAAA

SEQ ID NO：14

AACTCATCATGTAGCTTAAGCAGGCTTTTGACTCCATTCTTGGCAACCTTCCTGCCTCAGTTTCCTCAATGCTGAGATAAACGTGAGCCACCAACTGCAACTGTTGTAGTCTGCTTTACAGATGGGGAAACTGAGGCTTGGAAGGCCTAGGGGAAACTTTACTGAGGTGTTATTGTTGGGGTGCATCGGCCTGCTTCTCCTTGCTTGGGCCCTAGGTGGTGTGGGGTGGGGGTGGGGTTATGTCTGAGCTGGCTGGGGAGGAGAGGGCTGAGGTGGGAGGCCCTGGAGTTTCCTCCTGCCCTTCAGGCTTCTAGGAAGTGGCGCCAGCTGGGGTGAGGTCACTTCCTCCCTCCAACCGTCCACCTCCCTCAGCTTCCTCTCCATGGCCCCATTTGGCCTGCTTTGGGCTCAGGGCTGTGGGTGGGGATAGAAGCAGAGTGGGAAGCAGCTGGGAAGGCTCTGCAGCCCCTTTGGCCTTAGGGCTTCAGGCACCTCCCGCTTTGTAGGGCTGGGGTAGAGGCACTGCTGGGTGCCCAGCATCCAGCAGCCTCGCTCCAACCTTCCTACGGATCGATGCTCCTCTTTTTTGGGAATGCTTCTTCCCTCTTGGAAGTAGAGGAGGGCTAGGGTGTGGATCAGCAAGCTGAGTTTAGATTCTGTCCCCAGCACCACTTAAACTGTGTGTGGTGAGGTGTACCTATAATCCTAGACTCCAGAGGTAGAGGCAGGAAGAACTGGTGCATTCGGAAACCTTGTGTTCAGCTATGTGAGACCCAGCCTGGTCAAGATAGGCAGGCAAGCAAGAATGCTCCAATCTCACTGTCTCTTCTTTCTCTCTTTAGGTGCTACACTCCGCTCCCACCTGCTGCCCCCCTCACTGTGCCTCGGACGGCTGGGGTTCCTGGGGATGGGATTTGATGCCAGTCACAAATCACATTGCCAGGGATTTCCAACTGACCCTGTGCTCTGCCTTGGGGGCTCCTGTCGCCAAGGATGTCTGTCTTGGGTACTGGGTAACAGAGAAGCCTATCATGACAACTGGCCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAAGGTCCACAGCAAA

SEQ ID NO：15

TTTCCTCCTGCCCTTCAGGCTTCTAGGAAGTGGCGCCAGCTGGGGTGAGGTCACTTCCTCCCTCCAACCGTCCACCTCCCTCAGCTTCCTCTCCATGGCCCCATTTGGCCTGCTTTGGGCTCAGGGCTGTGGGTGGGGATAGAAGCAGAGTGGGAAGCAGCTGGGAAGGCTCTGCAGCCCCTTTGGCCTTAGGGCTTCAGGCACCTCCCGCTTTGTAGGGCTGGGGTAGAGGCACTGCTGGGTGCCCAGCATCCAGCAGCCTCGCTCCAACCTTCCTACGGATCGATGCTCCTCTTTTTTGGGAATGCTTCTTCCCTCTTGGAAGTAGAGGAGGGCTAGGGTGTGGATCAGCAAGCTGAGTTTAGATTCTGTCCCCAGCACCACTTAAACTGTGTGTGGTGAGGTGTACCTATAATCCTAGACTCCAGAGGTAGAGGCAGGAAGAACTGGTGCATTCGGAAACCTTGTGTTCAGCTATGTGAGACCCAGCCTGGTCAAGATAGGCAGGCAAGCAAGAATGCTCCAATCTCACTGTCTCTTCTTTCTCTCTTTAGGTGCTACACTCCGCTCCCACCTGCTGCCCCCCTCACTGTGCCTCGGACGGCTGGGGTTCCTGGGGATGGGATTTGATGCCAGTCACAAATCACATTGCCAGGGATTTCCAACTGACCCTGTGCTCTGCCTTGGGGGCTCCTGTCGCCAAGGATGTCTGTCTTGGGTACTGGGTAACAGAGAAGCCTATCATGACAACTGGCCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAAGGTCCACAGCAAA

SEQ ID NO：16

AAGTAGAGGAGGGCTAGGGTGTGGATCAGCAAGCTGAGTTTAGATTCTGTCCCCAGCACCACTTAAACTGTGTGTGGTGAGGTGTACCTATAATCCTAGACTCCAGAGGTAGAGGCAGGAAGAACTGGTGCATTCGGAAACCTTGTGTTCAGCTATGTGAGACCCAGCCTGGTCAAGATAGGCAGGCAAGCAAGAATGCTCCAATCTCACTGTCTCTTCTTTCTCTCTTTAGGTGCTACACTCCGCTCCCACCTGCTGCCCCCCTCACTGTGCCTCGGACGGCTGGGGTTCCTGGGGATGGGATTTGATGCCAGTCACAAATCACATTGCCAGGGATTTCCAACTGACCCTGTGCTCTGCCTTGGGGGCTCCTGTCGCCAAGGATGTCTGTCTTGGGTACTGGGTAACAGAGAAGCCTATCATGACAACTGGCCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAAGGTCCACAGCAAA

SEQ ID NO：17

ATGCTCCAATCTCACTGTCTCTTCTTTCTCTCTTTAGGTGCTACACTCCGCTCCCACCTGCTGCCCCCCTCACTGTGCCTCGGACGGCTGGGGTTCCTGGGGATGGGATTTGATGCCAGTCACAAATCACATTGCCAGGGATTTCCAACTGACCCTGTGCTCTGCCTTGGGGGCTCCTGTCGCCAAGGATGTCTGTCTTGGGTACTGGGTAACAGAGAAGCCTATCATGACAACTGGCCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAAGGTCCACAGCAAA

SEQ ID NO：18

TCACTGTGCCTCGGACGGCTGGGGTTCCTGGGGATGGGATTTGATGCCAGTCACAAATCACATTGCCAGGGATTTCCAACTGACCCTGTGCTCTGCCTTGGGGGCTCCTGTCGCCAAGGATGTCTGTCTTGGGTACTGGGTAACAGAGAAGCCTATCATGACAACTGGCCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAAGGTCCACAGCAAA

SEQ ID NO：19

CCCACCTGCTGCC

SEQ ID NO：20

ACCTGCTGCCCCC

SEQ ID NO：21

Claims

1. a method for determining a core promoter of a miR-27a gene is characterized by comprising the following steps of:

step 11, according to the sequence as shown in SEQ ID NO: 1, designing 8 upstream deletion fragment primers PF1-PF8 and 1 common downstream primer PR according to a 2000bp nucleotide sequence of a 5' -UTR of a mouse miR-27a shown in the specification; the nucleotide sequence of the primer is shown as SEQ ID NO: 2-SEQ ID NO: 10 is shown in the figure;

and step 12, taking the whole genome DNA of the blood of the mouse as a template, and utilizing Polymerase Chain Reaction (PCR) to amplify the deletion segment to obtain 8-segment length 5' -UTR sequence segments of miR-27a truncated in sequence, wherein the nucleotide sequence is shown as SEQ ID NO: 11-SEQ ID NO: 18 is shown in the figure; sequentially carrying out restriction enzyme digestion, agarose gel electrophoresis and gel cutting purification on the 8-segment sequence and pGL3-Basic vector plasmid; connecting the treated 8-segment sequence with pGL3-Basic vector plasmid by using T4 ligase, then transferring into Escherichia coli DH5 alpha, and performing plate culture to obtain a single colony; finally, extracting plasmids in the bacterial liquid, and determining the completion of vector construction through sequencing;

step 13, culturing the CHO cells, inoculating the CHO cells into a cell culture plate, performing transfection operation after the density reaches 80%, selecting renilla luciferase pRL-TK as an internal reference, and transfecting the CHO cells;

and step 14, after transfection is carried out for 24 hours, obtaining total protein by using cell lysate, adding the lysate containing a small amount of the total protein into a working solution prepared in a dual-luciferase reporter gene detection kit, and carrying out dual-luciferase activity detection on the obtained total protein through a dual-luciferase reporter gene.

2. The method for determining the core promoter of miR-27a gene, according to claim 1, wherein in step 13, CHO cells are cultured, inoculated into a 24-well cell culture plate, and subjected to transfection operation after reaching 80% density, and in the transfection, the CHO cells are transfected by mixing recombinant plasmid/Lipofectamine 3000 in OPTI-DMEM.

3. The method for determining the core promoter of the miR-27a gene, as claimed in claim 1, wherein total protein is obtained by using cell lysate 24h after transfection in step 14, 10ul of the protein-containing lysate is added to a working solution prepared in a dual-luciferase reporter gene detection kit, and a fluorescence value is read by using a microplate reader.

4. The method for determining the core promoter of miR-27a gene, according to claim 1, wherein the dual-luciferase reporter gene is the firefly luciferase gene.

5. A method for determining a core promoter transcription factor Myod binding site of a miR-27a gene is characterized by comprising the following steps of:

step 21, obtaining a core promoter of the miR-27a gene according to the method of any one of claims 1-4, and predicting 2 Myod binding sites in the core promoter by using transcription factor prediction software, wherein the nucleotide sequence of the core promoter is shown in SEQ ID NO: 19 and SEQ ID NO: 20 is shown in the figure;

step 22, transiently co-transfecting the prepared Myod overexpression vector and the miR-27a core promoter dual-luciferase reporter vector obtained by the method of any one of claims 1-4 to CHO cells, and detecting the activity of dual-luciferase after 24 hours to obtain a fluorescence detection value;

step 23, changing the common part of 2 Myod binding sites by using site-directed mutagenesis technology, wherein the sequence is shown in a sequence table SEQ ID NO: 21, constructing a mutant fluorescence expression vector, transiently transfecting the over-expression vector of the Myod in the step 22 and the mutant fluorescence expression vector to CHO cells, detecting the activity of dual-luciferase after 24 hours to obtain an experimental group detection value, and comparing the experimental group detection value with the control group fluorescence detection value to determine the binding site of the transcription factor Myod on the miR-27a core promoter.