JP2002272475A - Method for detecting nucleic acid amplification product by fluorescence polarization - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for detecting a nucleic acid amplification product by the fluorescence polarization. SOLUTION: This method includes the steps of adding a fluorescence-labelled primer that hybridizes to a single-stranded loop part to a nucleic acid amplification product obtained by the loop-mediated isothermal amplification(LAMP) reaction and measuring a fluorescence-polarization degree of the reaction mixture.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a method for detecting a nucleic acid amplification product obtained by the LAMP method.

[0002]

2. Description of the Related Art The most common method for detecting an amplification product obtained by a nucleic acid amplification reaction such as a PCR (Polymerase Chain Reaction) method is to subject the solution after the amplification reaction to agarose gel electrophoresis and to apply a fluorescent light such as ethidium bromide. In this method, specific fluorescence is observed by binding an intercalator. If there is no risk of other DNA being mixed and only the presence or absence of the amplification product is to be known, it is possible to omit electrophoresis and add a fluorescent intercalator to the solution after the amplification reaction and observe the fluorescence. However, these methods require a UV lamp and a dark room to observe the fluorescence.

Recently, the present inventors have proposed a new nucleic acid amplification method, LAMP (Loop-mediated isothermal amp), which does not require complicated temperature control which is indispensable for PCR.
lification) [Notomi, T et al .: Nucl
eic Acids Res. 28 (12): e63 (2000); WO 00/28082]. LAM
In the P method, the 3 'end of the template polynucleotide itself is annealed to serve as a starting point for complementary strand synthesis, and an isothermal amplification reaction is enabled by combining a primer that anneals to the loop formed at this time. And
By this method, the simplicity of the nucleic acid amplification reaction has been dramatically improved. In order to increase the versatility of the amplification reaction by the LAMP method, it is important to simply detect an amplification product obtained by this method.

[0004]

An object of the present invention is to provide a method for easily detecting a nucleic acid amplification product by the LAMP method.

[0005]

Means for Solving the Problems The present inventors have conducted intensive studies to solve the above problems, and as a result, by applying the fluorescence amplification method to the detection of nucleic acid amplification products obtained by the LAMP method, Was found to be easily detectable, and the present invention was completed.

That is, the present invention provides the following steps: (a) the first arbitrary sequence F1c and the second arbitrary sequence F1c in order from the 3 ′ end of the target region on the polynucleotide chain toward the 3 ′ end of the polynucleotide chain; Selecting each of the arbitrary sequences F2c, a step of selecting a third arbitrary sequence R1 and a fourth arbitrary sequence R2 in order from the 5 'end of the target region toward the 5' end of the polynucleotide chain, (b A primer comprising the sequence F2 complementary to the F2c and the same sequence as the F1c on the 5 ′ side of the F2, the same sequence as the R2 and the R1 on the 5 ′ side of the sequence.
A primer comprising a sequence R1c complementary to
1c and the sequence sandwiched by the F2c, the F1c and the F2c
And a fluorescently labeled probe comprising at least a part of the complementary sequence of the sequence sandwiched by the, the sequence sandwiched by the R1 and the R2, or the complementary sequence of the sequence sandwiched by the R1 and the R2, respectively. Preparing, (c) using the polynucleotide chain as a template, performing a DNA synthesis reaction in the presence of a strand displacement polymerase and the primer, (d)
A method of detecting or quantifying a nucleic acid amplification product, comprising: a step of adding the fluorescently labeled probe to the reaction solution after the DNA synthesis reaction; and is there.

Further, the present invention provides the following steps: (a) a first arbitrary sequence F1c, a second arbitrary sequence F1c, in order from the 3 ′ end of the target region on the polynucleotide chain toward the 3 ′ end of the polynucleotide chain; The arbitrary sequence F2c and the third arbitrary sequence F3c are respectively selected, and the fourth arbitrary sequence R1 in order from the 5 ′ end of the target region toward the 5 ′ end of the polynucleotide chain,
A step of selecting a fifth arbitrary sequence R2 and a sixth arbitrary sequence R3, respectively, (b) a sequence F2 complementary to the F2c and a sequence of the F2
A primer containing the same sequence as the F1c on the 5 ′ side, the F3c
A primer comprising a sequence F3 complementary to the above, a sequence identical to the R2 and a sequence
a primer containing c, a primer containing the same sequence as the R3, and a sequence flanked by the F1c and the F2c,
Complementary sequence of the sequence sandwiched by the F1c and the F2c,
A sequence flanked by the R1 and the R2, or the R1
And preparing a fluorescently labeled probe containing at least a part of the complementary sequence of the sequence sandwiched by the R2 and (c) using the polynucleotide chain as a template in the presence of a strand displacement polymerase and the primer. A step of performing a DNA synthesis reaction, (d) a step of adding the fluorescently labeled probe to the reaction solution after the DNA synthesis reaction, and (e) a step of measuring the degree of fluorescence polarization of the reaction solution to which the fluorescently labeled probe has been added. This is a method for detecting or quantifying an amplified nucleic acid product.

[0008] Further, the present invention provides a method of manufacturing a fluorescent device, comprising: setting two or more target regions, and using a fluorescent label probe in which each probe corresponding to each target region is labeled with a different fluorescent substance capable of being distinguished from each other. A method for detecting or quantifying a nucleic acid amplification product, wherein two or more nucleic acid amplification products are simultaneously detected or quantified by measuring the degree of fluorescence polarization specific to a substance.

Further, the present invention relates to a step of adding an intercalator to the reaction solution after the DNA synthesis reaction and examining the presence or absence of an amplification product, or using an insoluble substance produced in the reaction solution after the DNA synthesis reaction as an index. The method for detecting or quantifying any of the nucleic acid amplification products described above, further comprising a step of examining the presence or absence of the product.

Further, the present invention provides the following steps: (a) a first arbitrary sequence F1c and a second arbitrary sequence F1c in order from the 3 ′ end of the target region on the polynucleotide chain toward the 3 ′ end of the polynucleotide chain; Selecting each of the arbitrary sequences F2c, a step of selecting a third arbitrary sequence R1 and a fourth arbitrary sequence R2 in order from the 5 'end of the target region toward the 5' end of the polynucleotide chain, (b A primer comprising the sequence F2 complementary to the F2c and the same sequence as the F1c on the 5 ′ side of the F2, the same sequence as the R2 and the R1 on the 5 ′ side of the sequence.
A primer comprising a sequence R1c complementary to
Step of preparing a fluorescently labeled probe containing at least a part of the sequence sandwiched between 1c and the F2c, or the complementary sequence of the sequence sandwiched by the R1 and the R2,
(c) using the polynucleotide chain as a template, performing a DNA synthesis reaction in the presence of a strand displacement polymerase, the primer and the fluorescently labeled probe, and (d) a reaction during or after the DNA synthesis reaction. A method for detecting, quantifying, or real-time monitoring of a nucleic acid amplification product, which comprises the step of measuring the degree of fluorescence polarization of a liquid.

Further, the present invention provides the following steps: (a) a first arbitrary sequence F1c, a second arbitrary sequence F1c, The arbitrary sequence F2c and the third arbitrary sequence F3c are respectively selected, and the fourth arbitrary sequence R1 in order from the 5 ′ end of the target region toward the 5 ′ end of the polynucleotide chain,
A step of selecting a fifth arbitrary sequence R2 and a sixth arbitrary sequence R3, respectively, (b) a sequence F2 complementary to the F2c and a sequence of the F2
A primer containing the same sequence as the F1c on the 5 ′ side, the F3c
A primer comprising a sequence F3 complementary to the above, a sequence identical to the R2 and a sequence
a primer containing c, a primer containing the same sequence as the R3, and a sequence flanked by the F1c and the F2c,
Or preparing a fluorescently labeled probe containing at least a part of the complementary sequence of the sequence sandwiched by the R1 and the R2, respectively, (c) using the polynucleotide chain as a template, a strand displacement polymerase, the primer and Performing a DNA synthesis reaction in the presence of the fluorescently labeled probe,
And (d) a step of measuring the degree of fluorescence polarization of the reaction solution during or after the DNA synthesis reaction.

Further, the present invention provides a method of manufacturing a fluorescent device, comprising the steps of: setting two or more target regions, and using fluorescent labeled probes in which each probe corresponding to each target region is labeled with a different fluorescent substance capable of distinguishing each other. The nucleic acid amplification product detection, quantitative quantification or real-time monitoring method described above, wherein two or more nucleic acid amplification products are simultaneously detected, quantified, or monitored in real time by measuring the degree of fluorescence polarization specific to the substance. .

[0013] Further, the present invention provides a method wherein the above-mentioned fluorescent-labeled probe is hybridized to a nucleic acid amplification product, and the action of the above strand displacement type polymerase causes DN from the 3 'end of the probe.
A A method for detecting, quantifying, or real-time monitoring of any of the nucleic acid amplification products described above, wherein the probe has a 3 ′ terminal structure capable of causing nucleotide chain elongation by a synthesis reaction.

Further, the present invention is a kit for detecting, quantifying, or real-time monitoring of a nucleic acid containing the following elements. (a) selecting the first arbitrary sequence F1c and the second arbitrary sequence F2c in order from the 3 ′ end of the target region on the polynucleotide chain toward the 3 ′ end of the polynucleotide chain, When the third optional sequence R1 and the fourth optional sequence R2 are selected in order from the 'end toward the 5' end of the polynucleotide chain, the sequence F2 complementary to the F2c is selected.
And a primer containing the same sequence as the F1c on the 5 ′ side of the F2, a primer containing the same sequence as the R2 and a sequence R1c complementary to the R1 on the 5 ′ side of the sequence, and the F1c and the The sequence sandwiched by F2c, the complementary sequence of the sequence sandwiched by the F1c and the F2c, the sequence sandwiched by the R1 and the R2, or the complement of the sequence sandwiched by the R1 and the R2 Labeled probe containing at least a part of a specific sequence, (b) a polymerase that catalyzes a strand displacement type complementary strand synthesis reaction, and (c) a nucleotide serving as a substrate for the element (b)

Further, the present invention is a kit for detecting, quantifying, or real-time monitoring of a nucleic acid containing the following elements. (A) the first arbitrary sequence F1c, the second arbitrary sequence F2c in order from the 3 'end of the target region on the polynucleotide chain constituting the nucleic acid to be detected toward the 3' end of the polynucleotide chain
And the third arbitrary sequence F3c, respectively, 5 'of the target region
When the fourth optional sequence R1, the fifth optional sequence R2, and the sixth optional sequence R3 are selected in order from the end toward the 5 'end of the polynucleotide chain, the sequence F2 complementary to the F2c is selected. And a primer containing the same sequence as the F1c on the 5 ′ side of the F2, a primer containing a sequence F3 complementary to the F3c, the same sequence as the R2 and the R1 on the 5 ′ side of the sequence.
A primer containing a sequence R1c complementary to the above, a primer containing the same sequence as the R3, and a sequence sandwiched by the F1c and the F2c, a complementary sequence of a sequence sandwiched by the F1c and the F2c, A sequence labeled by the R1 and the R2, or a fluorescent label probe comprising at least a part of a complementary sequence of the sequence sandwiched by the R1 and the R2,
(b) a polymerase that catalyzes a strand displacement type complementary strand synthesis reaction, and (c) a nucleotide serving as a substrate for the element (b)

Further, the present invention relates to a method for detecting a difference in base sequence between a first polynucleotide chain and a second polynucleotide chain, which are homologous to each other, comprising the following steps: From the 3 ′ end of the target region on the polynucleotide chain toward the 3 ′ end of the polynucleotide chain.
One arbitrary sequence F1c and the second arbitrary sequence F2c are selected, respectively, the third arbitrary sequence R1 and the fourth arbitrary sequence R2 in order from the 5 ′ end of the target region toward the 5 ′ end of the polynucleotide chain. Step (b) a primer comprising the same sequence as F1c on the 5 ′ side of the sequence F2 and the F2 complementary to the F2c, the same sequence as the R2 and the 5 ′ side of the sequence. A primer comprising a sequence R1c complementary to the R1, a sequence flanked by the F1c and the F2c, a complementary sequence of a sequence flanked by the F1c and the F2c, and a sequence flanked by the R1 and the R2. Sequence, or the R1 and the R2
Preparing a fluorescently labeled probe containing at least a part of the complementary sequence of the sequence sandwiched by (c)
In the presence of the nucleotide chain analog having a base sequence complementary to the sequence containing the base of the difference site to be detected in one polynucleotide chain, the primer and the strand displacement polymerase, the first polynucleotide chain and A step of performing a DNA synthesis reaction using each of the second polynucleotide chains as a template, (d) a step of adding the fluorescently labeled probe to a reaction solution after the DNA synthesis reaction, and (e) a reaction solution to which the fluorescently labeled probe is added Measuring the fluorescence polarization degree of the above.

Further, the present invention provides a method for detecting a difference in base sequence between a first polynucleotide chain and a second polynucleotide chain which are homologous to each other, comprising the following steps: The first arbitrary sequence F1c, the second arbitrary sequence F2c and the third arbitrary sequence F3c are selected in order from the 3 ′ end of the target region on the polynucleotide chain toward the 3 ′ end of the polynucleotide chain. Selecting a fourth optional sequence R1, a fifth optional sequence R2 and a sixth optional sequence R3 in order from the 5 'end of the target region toward the 5' end of the polynucleotide chain, (b) Sequence F2 complementary to the F2c
And a primer containing the same sequence as the F1c on the 5 ′ side of the F2, a primer containing a sequence F3 complementary to the F3c,
A primer containing the same sequence as R2 and a sequence R1c complementary to the R1 on the 5 ′ side of the sequence, a primer containing the same sequence as R3, and a sequence flanked by the F1c and the F2c, The complementary sequence of the sequence sandwiched by the F1c and the F2c, the sequence sandwiched by the R1 and the R2, or at least a part of the complementary sequence of the sequence sandwiched by the R1 and the R2 Steps of preparing fluorescently labeled probes, respectively, (c) a nucleotide chain analog having a base sequence complementary to a sequence containing a base at a different site to be detected in the first polynucleotide chain, the primer and a strand displacement type Performing a DNA synthesis reaction using the first polynucleotide chain and the second polynucleotide chain as templates in the presence of a polymerase, and (d) adding the fluorescently labeled probe to the reaction solution after the DNA synthesis reaction. Is that process, and (e) measuring the fluorescence polarization of the reaction solution was added a fluorescent-labeled probe, said detecting method comprising.

Further, the present invention provides a method for detecting a difference in base sequence between a first polynucleotide chain and a second polynucleotide chain which are homologous to each other, comprising the following steps: From the 3 ′ end of the target region on the polynucleotide chain toward the 3 ′ end of the polynucleotide chain.
One arbitrary sequence F1c and the second arbitrary sequence F2c are respectively selected, the third arbitrary sequence R1 and the fourth arbitrary sequence R2 in order from the 5 ′ end of the target region toward the 5 ′ end of the polynucleotide chain. A step of selecting each, (b) a primer comprising the sequence F2 complementary to the F2c and the same sequence as the F1c on the 5 ′ side of the F2, the same sequence as the R2 and the 5 ′ side of the sequence A primer comprising a sequence R1c complementary to the R1, and a fluorescent label comprising at least a part of a sequence interposed between the F1c and the F2c, or a complementary sequence of the sequence interposed between the R1 and the R2. Step of preparing each probe, (c) a nucleotide chain analog having a base sequence complementary to a sequence containing a base of a different site to be detected in the first polynucleotide chain, the primer, the fluorescently labeled probe and Existence of strand displacement polymerase In the presence,
Using the first polynucleotide chain and the second polynucleotide chain as templates, respectively, performing a DNA synthesis reaction, and
(d) measuring the degree of fluorescence polarization of the reaction solution to which the fluorescent label probe has been added.

Further, the present invention relates to a method for detecting a difference in base sequence between a first polynucleotide chain and a second polynucleotide chain which are homologous to each other, comprising the following steps: The first arbitrary sequence F1c, the second arbitrary sequence F2c and the third arbitrary sequence F3c are selected in order from the 3 ′ end of the target region on the polynucleotide chain toward the 3 ′ end of the polynucleotide chain. Selecting a fourth optional sequence R1, a fifth optional sequence R2 and a sixth optional sequence R3 in order from the 5 'end of the target region toward the 5' end of the polynucleotide chain, (b) Sequence F2 complementary to the F2c
And a primer containing the same sequence as the F1c on the 5 ′ side of the F2, a primer containing a sequence F3 complementary to the F3c,
A primer containing the same sequence as R2 and a sequence R1c complementary to the R1 on the 5 ′ side of the sequence, a primer containing the same sequence as R3, and a sequence flanked by the F1c and the F2c, Or preparing a complementary sequence of the sequence sandwiched by the R1 and the R2, respectively, (c) a base complementary to a sequence containing a base at a different site to be detected in the first polynucleotide chain In the presence of a nucleotide chain analog having a sequence, the primer, the fluorescently labeled probe, and a polymerase, the first polynucleotide chain and the second polynucleotide chain are used as templates, respectively.
The above-described detection method, comprising: a step of performing an NA synthesis reaction; and (d) a step of measuring the degree of fluorescence polarization of the reaction solution to which the fluorescently labeled probe has been added.

Further, the present invention relates to any one of the aforementioned detection methods wherein the nucleotide chain analog is a peptide nucleic acid. Furthermore, the present invention provides that the nucleotide chain
Any of the above detection methods, comprising 30 bases.

Furthermore, the present invention relates to F1c, F2c, F3c, R1, R2, R
(3) The method according to any one of (1) to (4) above, wherein the F2c to R2 region contains a difference in base sequence to be detected between the first polynucleotide chain and the second polynucleotide chain. Furthermore, the present invention is any one of the above detection methods, wherein the difference in the nucleotide sequence is caused by a point mutation. Furthermore, the present invention is any one of the above detection methods, wherein the difference in the nucleotide sequence is caused by a single nucleotide polymorphism.
Hereinafter, the present invention will be described in detail.

[0022]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention is a method for detecting, quantifying or real-time monitoring of a nucleic acid amplification product, which comprises detecting a LAMP reaction product by a fluorescence polarization method.
Specifically, it can be performed as follows. 1. LAMP Nucleic Acid Amplification The LAMP method forms a loop structure at the end of the base sequence to be amplified, and the elongation reaction by the polymerase occurs from that point as a starting point. And elongates the nucleic acid chain to dissociate the product of the previous elongation reaction into single strands. Since the generated single-stranded nucleic acid has a self-complementary region at its end, a loop is formed at the end and a new extension reaction starts. In the actual LAMP method, since the reaction proceeds at an isothermal temperature, the above-mentioned reactions occur simultaneously in parallel. The LAMP method is characterized by a strand displacement reaction that proceeds at an isothermal temperature,
It is mentioned that it is.

(1) LAMP method First, the outline of the LAMP method is shown (FIGS. 1 and 2). In the LAMP method, first, a template polynucleotide to be amplified is prepared. The template polynucleotide (DNA or RNA) can be prepared from a biological sample such as a tissue or a cell by a known method or by a chemical synthesis method. In this case, both sides of the target region for amplification (5 'and 3' sides of the target region)
In step (1), a template polynucleotide is prepared so that a sequence having an appropriate length (referred to as a double-sided sequence) exists (FIG. 1A). The two-sided sequence means the sequence of the region from the 5 'end of the target region to the 5' end of the polynucleotide chain, and the sequence of the region from the 3 'end of the target region to the 3' end of the polynucleotide chain. (A double arrow (← →) portion in FIG. 1A). The length of both side sequences is 10 to 1000 bases, preferably 30 to 500 bases in both the 5 ′ side and 3 ′ side of the target region.

In the template polynucleotide chain containing the target region and both side sequences (FIG. 1A), a predetermined region is arbitrarily selected from both side sequences. That is, from the 3 'end of the target region toward the 3' end of the polynucleotide chain,
The first arbitrary sequence F1c, the second arbitrary sequence F2c, and the third arbitrary sequence F3c are selected in this order (FIG. 1B). Similarly, from the 5 ′ end of the target region toward the 5 ′ end of the polynucleotide chain, a fourth optional sequence R1 and a fifth optional sequence
R2 and the sixth arbitrary sequence R3 are selected (FIG. 1)
B). Each of the first to sixth sequences is arbitrarily selected according to the sequence of the prepared polynucleotide chain.
Each of the selected regions preferably has 5 to 100 bases, more preferably 10 to 50 bases. By selecting the length of the base, the primer described later can be easily annealed.

[0025] In addition, each of the arbitrary sequences is different from the amplification product obtained by the LAMP method in that the amplification product is not an intermolecular annealing, as shown in FIG.
It is preferable to select so as to preferentially cause intramolecular annealing between the 1c sequence and the F1 sequence and between the R1 sequence and the R1c sequence to form a terminal loop structure. For example, in order to cause intramolecular annealing preferentially, in selecting an arbitrary sequence, the distance between the F1c sequence and the F2c sequence and the R1 sequence
It is important to consider the distance to the R1c sequence. Specifically, both sequences are each 0 to 500 bases, preferably 0 to 1
It is preferred to choose to exist over a distance of 00 bases, most preferably 10-70 bases. Here, the numerical values indicate the number of bases that do not include the F1c and F2c sequences themselves and the R1 and R2 sequences, respectively.

Next, a primer called an FA primer is designed and synthesized, and this is annealed to F2c. "FA primer" is a sequence complementary to the F2c region, the F2 sequence, and the same sequence as F1c (also referred to as F1c for convenience)
Is linked to the 5 ′ side of F2, the F1c sequence
It has a structure in which the 3 'ends are linked (FIG. 1C). Also, “annealing” means that the nucleotide chain is a Watson-
This refers to the formation of a double-stranded structure by base-pairing based on Click's law. After annealing the FA primer to the F2c sequence on the template polynucleotide chain, DNA strand synthesis is initiated starting from F2 in the FA primer (FIG. 1D). Subsequently, a primer containing a sequence F3 complementary to F3c (hereinafter, also referred to as F3 primer) is annealed to the F3c sequence of the template polynucleotide chain (FIG. 1D). Then, using the annealed F3 primer as a starting point, strand displacement DNA
Perform chain synthesis (FIG. 1E). “Strand-displacement DNA strand synthesis” means a reaction in which synthesis proceeds such that a strand synthesized by the F3 primer replaces a strand synthesized by the FA primer. In other words, it means that the complementary strand of the template polynucleotide chain synthesized by the FA primer is displaced so as to be separated by the strand extended from the F3 primer. By the above synthesis reaction, the following two types of nucleotide chains (i) and (ii) can be obtained.

(I) The sequence “(5 ′) F3 complementary to the sequence“ (3 ′) F3c-F2c-F1c-target region-R1-R2-R3 (5 ′) ”in the template polynucleotide chain -F2-F1-target region-R1c-R2c-R3c
(Ii) a nucleotide chain that has been substituted into a single strand (stripped), that is, has a sequence identical to F1c at the 5 ′ end thereof (“5 ′”). ') F1c-F2-F1-target region-R1c-R2c-R3c (3') "(FIG. 1G) Here, in the nucleotide chain of (ii), F1 and F1c
Are complementary to each other, so that they hybridize by intrachain hydrogen bonding between F1 and F1c to form a hairpin loop (FIG. 1G). And during the hairpin loop
F2 is included.

Next, a primer called "RA primer" is annealed to the R2c sequence of the nucleotide chain of (ii). In the RA primer, the 3 'side of the sequence R1c complementary to the R1 sequence is linked to the 5' side of the R2 sequence. Then, DNA strand synthesis is started using the RA primer as a synthesis origin (FIG. 1H). When the extended DNA synthesized using the RA primer as a synthesis starting point reaches the complementary strand portion formed between F1 and F1c, the sequence of F1c is replaced by the extended DNA in the same manner as in the substitution reaction shown in FIG.1E. (FIG. 1I). Subsequently, the sequence R3c of the template polynucleotide chain has a sequence R complementary to the sequence.
The primer containing 3 (hereinafter also referred to as R3 primer) is annealed (FIG. 1I). Starting from the annealed R3 primer, strand displacement DNA synthesis is performed (Fig. 2).
J). By the above synthesis reaction, the following (iii) and (iv)
Two types of nucleotide chains are synthesized.

(Iii) The sequence "(5 ') F1c-F2-F1-target region-R1c
-R2c-R3c (3 ′) ”complementary nucleotide chain` `(3 ′)
F1-F2c-F1c-target region-R1-R2-R3 (5 ′) ”(FIG. 2K) (iv) Nucleotide chain“ (3 ′) having F1 at the most 3 ′ end and R1c at the most 5 ′ end ) F1-F2c-F1c-target region-R1-R2-R1c
(3 ′) ”(FIG. 2L) Note that the sequence (iv) described above corresponds to the sequences F1 and F1c existing on the 3 ′ side.
And a hairpin loop is formed by intrachain hydrogen bonding between the sequences R1 and R1c present on the 5 ′ side (FIG. 2L).

Next, the F2 region of the FA primer is annealed to F2c of the hairpin loop portion on the 3 'side of the (iv) nucleotide chain (FIG. 2M). Then, DNA strand synthesis is started using F1 annealed by intrachain hydrogen bonding as a synthesis starting point. In FIG. 1M, when DNA is synthesized starting from F1, the double strand formed by R1 and R1c is displaced by the strand. On the other hand, when the reaction proceeds from F2 as a starting point,
A complementary strand to the strand composed of "c-target region-R1-R2-R1c" is synthesized. At this time, the chain `` F1-target region-R1c-R2c-R1 '' synthesized starting from F1 is replaced by the chain `` F1-target region-R1c-R2c-R1 '' synthesized starting from F2. . As a result, the single-stranded overhanging structure “-target sequence-R1c-
A double-stranded DNA having "R2c-R1" is obtained. Such a single-stranded overhanging structure is a single-stranded overhanging structural portion (“R1c-R2c-R1”).
A hairpin loop is formed by forming an intrachain hydrogen bond between R1c and R1 (FIG. 2N). This construct initiates DNA strand synthesis with R1 annealed by intrachain hydrogen bonding as the origin of synthesis (FIG. 2N). By the above synthesis reaction, the following two types of nucleotide chains (v) and (vi) are obtained.

(V) The sequence "(3 ') R1-R2-R1c-target region-F1-F2
-F1c-target region-R1-R2c-R1c-target region-F1-F2c-F1c-target region-R1-R2-R1c (5 ') "(FIG. 2O) (vi) F1c at the 3'-terminal end, The sequence “(3 ′) F1c-F2-F1-target region-R1c-R2c-R1 (3 ′)” having R1 at the most 5 ′ end (FIG. 2P) The nucleotide chains of the above (v) and (vi) Both form a hairpin loop with R2c for (v) and F2 and R2c for (vi) due to intrachain hydrogen bonding. In the two sequences (v) and (vi), the RA primer anneals to the R2c portion forming a hairpin loop, DNA synthesis starting from the primer starts, and the nucleotide chain containing the target sequence (( The synthesis of a strand complementary to the sequence of vi) proceeds. Since this complementary strand is the same as the sequence shown in FIG. 2L, the reactions shown in FIGS. On the other hand, since the reaction from FIG. 1A can also proceed, a series of these synthetic reactions is repeated, and the amplification of the polynucleotide chain proceeds.

In the above amplification reaction, four primers, FA primer, RA primer, F3 primer and R3 primer,
The amplification reaction is carried out using different types of primers, but the amplification reaction can be performed under isothermal conditions by using only two primers, the FA primer and the RA primer, without using the F3 and R3 primers. Can be caused. That is, it has been considered that a primer cannot be annealed unless at least the region to be annealed is single-stranded. Therefore, conventionally, when a double-stranded nucleic acid is used as a template, a step of denaturing to a single strand has always been performed prior to annealing of the primer. However, it is possible to anneal the primer by incubating with the primer under the condition that the duplex is destabilized by some means, even if it is not necessarily a single strand. Conditions for destabilizing the duplex include, for example, the melting temperature (hereinafter, referred to as the melting temperature).
It is possible to show a method of heating up to near. Alternatively, the presence of a Tm modifier is also effective.

In the series of reactions, a buffer for giving a pH suitable for the enzymatic reaction, salts necessary for maintaining the catalytic activity of the enzyme and annealing, a protective agent for the enzyme, and, if necessary, a melting temperature.
(Tm) is carried out in the co-presence of a regulator or the like. As a buffer, Tris
A neutral to weak alkaline buffering agent such as -HCl is used. The pH is adjusted according to the DNA polymerase used. As salts, KCl, NaCl, (NH ₄ ) ₂ SO _4, etc. are appropriately added for maintaining the activity of the enzyme and adjusting the melting temperature (Tm) of the nucleic acid. Bovine serum albumin and saccharides are used as enzyme protecting agents.

Further, betaine, proline, dimethyl sulfoxide (hereinafter abbreviated as DMSO), or formamide is generally used as a regulator for the melting temperature (Tm).
By utilizing a melting temperature (Tm) adjuster, the annealing of the oligonucleotide can be adjusted under limited temperature conditions. Betaine (N, N, N, -trimethy
lglycine) and tetraalkylammonium salts
It is also effective in improving the strand displacement efficiency by the stabilize action. Betaine is 0.2 to 3.0 M in the reaction solution, preferably 0.5 to 3.0 M.
By adding about 1.5 M, the action of promoting the nucleic acid amplification reaction of the present invention can be expected. Since these melting temperature regulators act in the direction of lowering the melting temperature, empirically set conditions that provide appropriate stringency and reactivity, taking into account other reaction conditions such as salt concentration and reaction temperature. I do.

By using a Tm adjuster, suitable temperature conditions for the enzymatic reaction can be easily set. Tm varies depending on the relationship between the primer and the target base sequence. Therefore, it is desirable to adjust the amount of the Tm adjuster used so that the conditions that can maintain the enzyme activity and the incubation conditions that satisfy the conditions of the present invention match. Based on the disclosure of the present invention, it is obvious for those skilled in the art to set an appropriate amount of the Tm adjusting agent according to the base sequence of the primer. For example, Tm can be calculated based on the length of the base sequence to be annealed, its GC content, salt concentration, and the concentration of the Tm modifier.

It is presumed that annealing of the primer to the double-stranded nucleic acid under such conditions is probably unstable. However, by incubating with a strand-displacing polymerase, a complementary strand is synthesized with the primer annealed while being unstable, as a replication origin.
If the complementary strand is synthesized, the annealing of the primer will be gradually stabilized.

(2) Relationship between reaction time and melting temperature In the LAMP reaction, the following components are added to a single-stranded nucleic acid serving as a template, and the base sequences constituting the FA primer and the RA primer are complemented. The reaction proceeds by incubating at a temperature that can form a stable base pair bond with a specific base sequence and that can maintain enzyme activity.
The incubation temperature is 50-75 ° C, preferably 55-70 ° C, and the incubation time is 1 minute to 10 hours, preferably 5 minutes.
Minutes to 4 hours.

(I) Four kinds of oligonucleotides (FA primer, RA primer, F3 primer and R3 primer) (ii) DNA polymerase for performing strand displacement type complementary strand synthesis (iii) Nucleotide to be a substrate of DNA polymerase FA primer and RA used in the above LAMP method
Primers are inner primer, F3 primer and R3
The primer is also called an outer primer.

The nucleotide chain synthesis from the outer primer needs to be started after the nucleotide chain synthesis from the inner primer. As a method for achieving this, there is a method in which the concentration of the inner primer is set higher than the concentration of the outer primer. Specifically, it can be carried out by setting the concentration of the inner primer 2 to 50 times, preferably 4 to 25 times higher than the concentration of the outer primer.

A polymerase that catalyzes the above strand displacement type complementary strand synthesis reaction (also referred to as a strand displacement type polymerase)
Examples include Bst DNA polymerase, Bca (exo-) DNA polymerase, Klenow fragment of E. coli DNA polymerase I, Vent DNA polymerase, Vent (Exo-) DNA polymerase (Vent DNA polymerase excluding exonuclease activity) , DeepVent DNA polymerase, Deep
Vent (Exo-) DNA polymerase (DeepVent DNA polymerase excluding exonuclease activity), Φ29 phage DNA polymerase, MS-2 phage DNA polymerase, Z-Taq DNA polymerase (Takara Shuzo), KOD DNA polymerase (Toyobo), etc. Is mentioned.

In the amplification reaction, a buffer for giving a pH suitable for the enzyme reaction, salts necessary for maintaining or annealing the catalytic activity of the enzyme, a protective agent for the enzyme, and, if necessary, a melting temperature (T
It is performed in the coexistence of the adjusting agent of m). As a buffer, Tris-H
Those having a buffer action from neutral to weakly alkaline, such as Cl, are used. The pH is adjusted according to the DNA polymerase used. Examples of the salts include MgCl ₂ , KCl, NaCl, (NH ₄ ) ₂ SO _{4 and the} like, which are added as appropriate for maintaining the activity of the enzyme and adjusting the melting temperature (Tm) of the nucleic acid. Bovine serum albumin and saccharides are used as enzyme protecting agents. Further, dimethyl sulfoxide (DMSO) or formamide is generally used as a regulator of the melting temperature (Tm). By utilizing a melting temperature (Tm) adjuster, the annealing of the oligonucleotide can be adjusted under limited temperature conditions. Furthermore, betaine (N, N, N, -trimethylglycine) and tetraalkylammonium salts are also effective in improving the efficiency of chain displacement by their isostabilize action. Betaine is present in the reaction mixture at 0.
By the addition of about 2 to 3.0 M, preferably about 0.5 to 1.5 M, the action of promoting the nucleic acid amplification reaction of the present invention can be expected. Since these melting temperature regulators act in the direction of lowering the melting temperature, empirically set conditions that provide appropriate stringency and reactivity, taking into account other reaction conditions such as salt concentration and reaction temperature. I do.

2. Detection of nucleic acid amplification product by fluorescence polarization method (1) Fluorescently labeled probe Fluorescently labeled probe may be either DNA or RNA,
Depending on the type (base sequence) of the target nucleic acid and its complementary strand, those having a base sequence capable of specifically recognizing the target nucleic acid or the like and forming a stable double strand can be suitably used. In addition, the length of the base sequence, considering the specificity in hybridization, the length of the probe,
It is preferably 10 bases or more, particularly preferably 20 to 100 bases. In order for a fluorescent-labeled probe to hybridize to a nucleic acid, it is necessary that the probe hybridizing portion on the nucleic acid has a single-stranded structure. Normally, heat denaturation of the sample is performed in order to make the target nucleic acid present in the sample into a single-stranded structure. By setting so as to hybridize to the loop portion, it becomes possible to detect an amplification product without going through a heat denaturation step. Specifically, the sequence sandwiched by the F1c and the F2c set on the template polynucleotide chain of 1, the complementary sequence of the sequence sandwiched by the F1c and the F2c, the R1 and the R2 and It is preferable to design and synthesize a fluorescent-labeled probe so as to include at least a part of the sequence sandwiched by R1 or the complementary sequence of the sequence sandwiched by R1 and R2.

Further, as the probe, a probe whose 3 ′ end is chemically modified so as not to undergo an extension reaction by a nucleic acid synthetase can be used, if necessary, and is hardly subjected to nonspecific degradation. Is more preferable. This modification of the 3 'end can be performed by phosphorylating the 3' OH group or adding about two mismatched bases that do not hybridize to the target nucleic acid. Conversely, when the fluorescent-labeled probe hybridizes to the target nucleic acid, the action of the polymerase causes DNA to be removed from the 3 ′ end of the probe.
Those having a 3 ′ terminal structure that can cause nucleotide chain extension by a synthesis reaction can also be suitably used. In this case, the fluorescently labeled probe is at least one of a sequence sandwiched between the F1c and the F2c set on the one template polynucleotide chain or a complementary sequence of a sequence sandwiched between the R1 and the R2. It is preferable to design and synthesize to include the part.

The nucleotide chain constituting the fluorescent-labeled probe is prepared by a method known in the art, for example, a chemical synthesis method, a method of cutting out a region having a desired base sequence from genomic DNA using a restriction enzyme, or the like. Can be. The fluorescently labeled probe can be prepared by labeling the nucleotide chain obtained by the above method with a fluorescent substance by a conventional method. Fluorescein, fluorescein isothiocyanate (FITC), X-rhodamine (ROX), rhodamine isothiocyanate (RITC), tetramethylrhodamine isothiocyanate (TRITC), iosine isothiocyanate (EITC), pyrene And the like.

(2) Detection of Amplified Product The amplified product obtained by the LAMP method can be detected based on the following principle and procedure by the fluorescence polarization method using the fluorescently labeled probe of the above (1). The principle of fluorescence polarization is as follows. First, light emitted from a light source is filtered by a filter to an excitation wavelength of a fluorescent substance contained in a sample, and is converted into linearly polarized light by a polarizing plate. The polarized light of this excitation wavelength is projected on a cell containing a sample containing a measurement substance, and excites a fluorescent substance in the sample. The excited fluorescent substance emits fluorescence of a wavelength corresponding to the substance. At this time, the fluorescence causes dispersion of the plane of polarization according to the intensity of the molecular motion. The fluorescent light passes through a filter that transmits that wavelength, and further passes through a polarizing plate, and is converted into an electric signal by a photodetector. By rotating the polarizing plate, the fluorescence emission intensity Ipa of the polarization component in the same direction as the excitation polarization and the fluorescence emission intensity I perpendicular to the fluorescence component of the sample are measured.
Find pe. From these values, the degree of fluorescence polarization (P) is
It is calculated by the following equation.

[0046]

(Equation 1)

Here, as the molecular movement of the substance binding the fluorescent substance increases, Ipe increases, Ipa decreases, and P decreases.

Specifically, the procedure is as follows. That is, first, a fluorescently labeled probe is mixed with a sample to be measured. When a nucleic acid to be detected is present in a sample, a fluorescently labeled probe hybridizes to the nucleic acid within a certain reaction time. When a fluorescently labeled probe hybridizes to a nucleic acid, the apparent molecular weight or effective volume of the fluorescently labeled probe increases. Generally, the molecular motion in a solution is slower as the molecular weight is larger. Therefore, when the nucleic acid to be detected is present in the sample, the fluorescence polarization degree after hybridization becomes larger than the value before hybridization. When the amount of the fluorescently labeled probe and the measurement temperature are kept constant, the degree of change in the degree of fluorescence polarization before and after hybridization corresponds to the amount of the nucleic acid to be detected in the sample. Therefore, by examining the change in the degree of fluorescence polarization before and after hybridization, the target nucleic acid in the sample can be detected or quantified. The fluorescence polarization was measured using a commercially available fluorescence polarization measurement device (for example, F-4500 manufactured by Hitachi, POLAR manufactured by TECAN).
ION) or the like.

Usually, the amplification product is detected by adding the fluorescent label probe after the nucleic acid amplification reaction is completed.
By adding the fluorescent-labeled probe to the reaction system together with the primers and the like before the nucleic acid amplification reaction, the progress of the amplification reaction can be monitored in real time.

During the LAMP reaction,
The following evaluation can be performed on the reaction solution after the LAMP reaction. If the degree of fluorescence polarization of the reaction solution has increased compared to before the LAMP reaction, it can be evaluated that amplification products have been generated in the reaction solution.If not, amplification products will not be generated in the reaction solution. It can be evaluated that it has not been done.

In the embodiment in which a fluorescently labeled probe is added to the reaction solution after completion of the amplification reaction to detect or quantitate the amplification product, whether the amplification product is present in the reaction solution before adding the fluorescently labeled probe to the reaction solution. No, and only when the presence of the amplification product is confirmed, a fluorescently labeled probe is added to the reaction solution to specifically detect the nucleic acid amplification product. Thereby, the measurement of the reaction system in which the amplification reaction has not occurred can be excluded in advance, and the work efficiency can be improved. Whether or not an amplification product is present in the reaction solution can be confirmed by the following method. That is, as a first method, the presence or absence of an amplification product can be confirmed by adding an intercalator such as ethidium bromide to a part of the reaction solution, irradiating excitation light such as ultraviolet light and detecting fluorescence. As a second method, the presence or absence of an amplification product can be confirmed using an insoluble substance generated in a reaction solution after the DNA synthesis reaction as an index. Here, the insoluble substance is a pyrophosphate. Pyrophosphate ions are generated when nucleotides are incorporated into the ends of the growing nucleotide chain as the amplification reaction proceeds. The reaction solution contains magnesium ions necessary for the activity of the polymerase. The magnesium salt of pyrophosphoric acid is insoluble in water. Therefore, the presence or absence of an amplification product can be confirmed by using as an index whether or not this insoluble substance has been generated. Here, the insoluble substance is detected by centrifuging a part of the reaction solution and visually confirming the precipitated insoluble substance at the bottom of the centrifuge tube, or measuring the absorbance or scattered light intensity of the reaction solution. It can be performed by determining the turbidity of the liquid. In addition, in confirming the presence or absence of an amplification product using an insoluble substance as an index, if the pyrophosphate is decomposed into two molecules of phosphoric acid by pyrophosphatase, the amount of the insoluble substance generated is doubled, so that the detection becomes easier. Become.

Further, according to the following embodiment, it is possible to simultaneously detect two or more kinds of amplification products present in the reaction system. That is, two or more target regions in the LAMP method are set. Here, "set at two or more places" means to set one place on each of two or more kinds of polynucleotide chains and / or to set two or more places on one kind of polynucleotide chain. Then, a primer for each target region amplification and a fluorescently labeled probe for detection of each target region amplification product are prepared, a LAMP reaction is performed using the primers and the probe, and the degree of fluorescence polarization during or after the reaction is measured. Thereby, two or more nucleic acid amplification products can be simultaneously detected or quantified. It is important that the fluorescently labeled probe is labeled with different fluorescent substances that can be distinguished from each other so that different types of amplification products present in the reaction solution can be detected separately.

3. Kit for detecting, quantifying, or real-time monitoring of nucleic acid In the method for detecting, quantifying, or real-time monitoring of the amplification product in the above item 2, it is possible to package reagents necessary for performing the detection method and supply the kit. More specifically, those including the following components are mentioned.

[Components of Kit] (a) The first arbitrary sequence F1c in order from the 3 ′ end of the target region on the polynucleotide chain constituting the nucleic acid to be detected toward the 3 ′ end of the polynucleotide chain , The second arbitrary array F
2c and the third arbitrary sequence F3c, respectively,
When the fourth optional sequence R1, the fifth optional sequence R2, and the sixth optional sequence R3 are selected in order from the 5 ′ end toward the 5 ′ end of the polynucleotide chain, the sequence is complementary to the F2c. A primer containing the sequence F2 and the same sequence as the F1c on the 5 ′ side of the F2, a primer containing a sequence F3 complementary to the F3c, the same sequence as the R2 and the 5 ′ side of the sequence.
A primer containing the sequence R1c complementary to R1, a primer containing the same sequence as the R3, and the F1c and the F2c
And (b) a polymerase that catalyzes a strand displacement-type complementary strand synthesis reaction, and (c) a nucleotide that serves as a substrate for the element (b).

The components of the kit may vary depending on the embodiment of the LAMP method used. That is, if necessary,
From the above component (a), a sequence complementary to the arbitrary sequence F3c
It is possible to omit the primer containing F3 and the primer containing the same sequence as the arbitrary sequence R3. In addition, if necessary, a buffer solution that provides suitable conditions for the enzymatic reaction and reagents necessary for detecting a synthesis reaction product can be added.
Furthermore, in a preferred embodiment of the present invention, it is possible to supply reagents necessary for one reaction in a state of being dispensed into a reaction vessel.

4. Detection of differences between polynucleotide chains By using the method for detecting an LAMP amplification product by the fluorescence polarization method, it is possible to accurately and highly sensitively detect a difference in base sequence at a specific site between mutually homologous polynucleotide chains. . That is, when detecting whether a base at a specific site on a polynucleotide chain (also referred to as a “difference site to be detected”) is the same in a first polynucleotide chain and a second polynucleotide chain, First, in selecting an arbitrary sequence on the nucleotide chain,
F1c, F2c, F3c, R1, R2, R3, or F2c-R2 are selected to include the different sites to be detected. The first and second polynucleotide chains are contacted with a nucleotide chain analog having a base sequence complementary to a sequence containing a base at a different site to be detected in the first polynucleotide chain. The nucleotide chain analog binds tightly because it is completely complementary to the first polynucleotide chain. On the other hand, when the base at the different site to be detected in the second polynucleotide chain is the same base as the first polynucleotide chain, the nucleotide chain analog binds tightly as in the first polynucleotide chain. However, when the base at the different site to be detected is different from the first polynucleotide chain, the nucleotide chain analog has a lower melting point due to mispairing at the different site to be detected, and the first strand has a lower melting point. Weaker binding than with polynucleotide chains. As a result, in the amplification of a nucleotide chain in the presence of a nucleotide chain analog at a certain concentration, the rate of generation of an amplification product differs between the case where the first polypeptide chain is used as a template and the case where the second polypeptide chain is used as a template. Differences can occur. In other words, when the concentration of the nucleotide chain analog at the time of the amplification reaction is increased in order, at a certain concentration or more, a sequence having a sequence completely complementary to the nucleotide chain analog is obtained.
When one polynucleotide chain is used as a template, amplification is blocked, and when a second polynucleotide chain having a base different from the first polynucleotide at a different site to be detected is used as a template, amplification is stopped. proceed. Therefore, as a result, by examining the presence or absence of the amplification product, it becomes possible to detect a difference in the base sequence between the first nucleotide chain and the second polynucleotide chain.

More specifically, as shown in FIG. 3, an arbitrary sequence F1c is selected so as to include a different site A to be detected in the first polynucleotide chain. Next, a nucleotide chain analog (for example, a peptide nucleic acid) containing a sequence complementary to F1c is added to a reaction system containing the first polynucleotide chain and the second polynucleotide chain as templates. The nucleotide chain analog is completely complementary to the F1c of the first polynucleotide chain and thus binds tightly to the F1c sequence. On the other hand, in the reaction system containing the second polynucleotide chain, the difference site N to be detected on the second polynucleotide chain is A as in the first polynucleotide chain.
If, the nucleotide chain analog binds tightly to the F1c sequence, but if not A, the nucleotide chain analog
The binding affinity for the F1c sequence is reduced. As a result, under a certain amplification reaction condition, as shown in FIG. 3, if N = A, the amplification reaction is inhibited and blocked by the strong binding of the nucleotide chain analog to the F1c sequence.
If N ≠ A, the binding strength of the nucleotide chain analog to the F1c sequence is not as high as N = A, and the amplification reaction proceeds. Therefore, by examining the presence or absence of the generation of an amplification product, it becomes possible to determine whether or not the different sites to be detected on the first polynucleotide chain and the second polynucleotide chain are the same base. That is, in the presence of a nucleotide chain analog having a base sequence complementary to the sequence containing the base at the different site to be detected, the following nucleotide chain amplification using the first polynucleotide chain and the second polynucleotide chain as templates, respectively: When an amplification product is not obtained when the reaction is carried out and any of the first polynucleotide chain and the second polynucleotide chain is used as a template, the difference site to be detected on the two polynucleotide chains is the same base. When the first polynucleotide chain is used as a template, an amplification product is obtained, and when the second polynucleotide chain is used as a template, an amplification product is obtained. Difference sites to be detected on two polynucleotide chains can be determined to be different bases.

The nucleotide chain analogs include peptide nucleic acid (PNA), polythioamide, polysulfinamide, polysulfonamide and the like. In particular, PNA can be suitably used in the present invention because it has the following advantages. That is, since PNA binds more tightly to complementary DNA than DNA, PNA / DNA duplex has higher thermal stability than the corresponding DNA / DNA duplex. For example, the melting point of a 15 base long PNA / DNA duplex is about 15 ° C. higher than the corresponding DNA / DNA duplex. PNA has higher specificity for complementary strand DNA than DNA. For example, a decrease in melting point caused by a single base pair mismatch in a duplex consisting of 15 bases in length is caused by DNA / DN
The temperature is about 11 ° C. in the case of A duplex, while it is about 15 ° C. in the case of PNA / DNA duplex. Since PNA has higher solubility in aqueous solution than DNA, it can be used at a higher concentration than DNA during the reaction. Unlike DNA, PNA is not recognized by a DNA polymerase, so that the nucleotide chain does not extend beyond the PNA due to the action of the DNA polymerase. PNA is neutral while DNA has acidic properties as a substance. PNA is not degraded by proteases and nucleases and has a wide range of pH stability.

The PNA has a structure in which the deoxyribose main chain of an oligonucleotide is substituted with a peptide main chain. Peptide backbones include N- (2-aminoethyl) glycine repeat units linked by amide bonds. Examples of the base to be bound to the peptide main chain of PNA include naturally occurring bases such as thymine, cytosine, adenine, guanine, inosine, uracil, 5-methylcytosine, thiouracil and 2,6-diaminopurine, bromothymine, azaadenine and azaguanine. And the like. The length of the peptide nucleic acid used in the detection method of the present invention is usually 8 to 30 bases, preferably 10 to 30 bases.
20 bases.

The above-mentioned peptide nucleic acid is first produced by a known production method (WO96 / 40685), after producing a monomer to which each nucleobase is bonded, and then reacting the obtained monomer according to a known general peptide synthesis method. Can be obtained. For example, the reaction may be carried out so as to have a desired base sequence using an automatic synthesizer according to a solid phase synthesis method. In the above method, commercially available reagents and raw materials can be used. If necessary, commercially available reagents can be appropriately derivatized according to a conventional method, for example, N-terminal and C-terminal which do not participate in the reaction of the amino acid used as the raw material. , A side chain functional group, etc., for protection. The obtained nucleobase-bound PNA can be easily isolated and purified by ordinary separation means such as high performance liquid chromatography, electrophoresis chromatography, solvent extraction, and salting out.

The point mutation or single nucleotide polymorphism is set by setting the above-mentioned difference site to be detected at a position on the nucleotide chain where a point mutation or single nucleotide polymorphism is expected to be present. It is possible to detect. Many genetic diseases are known to be caused by point mutations. In order to prevent, test and diagnose these genetic diseases, it is important to examine whether or not point mutations exist in the causative gene. The detection method of the present invention can be suitably used for detecting such a point mutation. In addition, there are patients who show side effects and patients who do not show side effects even if the same medicine is administered. It is said that single nucleotide polymorphism is a major cause of this individual difference. Therefore, by identifying the genotype of the single nucleotide polymorphism site in each individual, so-called tailor-made medical treatment (also referred to as custom-made medical treatment) in which the optimal drug is administered to each patient at the optimal amount and at the correct time can be performed. . The detection method can be suitably used for detecting such a single nucleotide polymorphism.

[0062]

(Reaction solution composition)

組成 Composition of reaction solution (in 25 μL) ─────────────────── 20 mM Tris-HCl pH 8.8 10 mM KCl 10 mM (NH ₄ ) ₂ SO ₄ 4 mM MgSO ₄ 0.1% TritonX-100 0.8 M betaine 0.4 mM dNTPs 8 U Bst DNA polymerase (NEB) 800 nM M13FA primer 800 nM M13RA primer 200 nM M13F3 primer 200 nM M13R3 primer ──────────────────

The above reaction solution was added at 95 ° C. as a template for LAMP reaction.
6 × 10 ⁵ molecules of M13 phage DNA heat-denatured for 5 minutes were added, and an amplification reaction was performed at 65 ° C. for 1 hour. At this time, sterilized water containing no DNA was used as a negative control. In the amplification reaction, the following sequence (SEQ ID NO: 1) contained in the template was used as the target polynucleotide.

[0064] 5'-gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtt tcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggc tttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacag ctatgaccatgattacgaattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgcaagct tggcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcag cacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgca gcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgcg atcttcctgaggccgatacggtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccatctaca ccaacgtaacctatcccattacggtca-3 '(SEQ ID NO: 1)

The inner primer (M13FA primer and M13RA primer) and the outer primer (M13F3 primer and M13R3 primer) in the above reaction solution
Was designed as follows based on the nucleotide sequence shown in SEQ ID NO: 1.

[Inner primer] -M13FA primer 5'-cgactctagaggatccccgggtactttttgttgtgtggaattgtgagcggat-3 '(SEQ ID NO: 2) -M13RA primer 5'-acaacgtcgtgactgggaaaaccctttttgtgcgggcctcttcgctattac-3' (SEQ ID NO: 3)

[Outer primer] -M13F3 primer 5'-actttatgcttccggctcgta-3 '(SEQ ID NO: 4) -M13R3 primer 5'-gttgggaagggcgatcg-3' (SEQ ID NO: 5)

(2) Fluorescent Labeled Probe Next, a DNA probe was designed and synthesized so as to be in the same direction as F1 defined by the primer, and the resulting D
The following fluorescently labeled probe was prepared by labeling the 5 'end of the NA probe with FITC. -FITC -M13 probe (FITC) -5'-gaattcgtaatcatggtcatagctgtttcctgtgtgaaat-3 '(SEQ ID NO: 6)

(3) Detection of LAMP reaction product After confirming the LAMP reaction product by 2% agarose gel electrophoresis,
1 or 5 μl of each of those not containing the LAMP reaction product (LAMP N) and those containing the LAMP reaction product (LAMP P), and 1 pmol of single-stranded M13 phage DNA (ssM13) were used as detection samples. Here, ssM13 was used as a positive control for hybridization. First, a heat-denatured LAMP reaction product or ssM13 and a 0.5 nM FITC-M13 probe were combined with a hybridization buffer [1 M NaCl / TE buffer (10 M
mM Tris-HCl pH8.0 / 1mM EDTA pH8.0)]
After holding at 10 ° C. for 10 minutes, the degree of fluorescence polarization was measured using a fluorescence polarization multiplate reader Polarion manufactured by TECAN. At the time of measurement, the center wavelengths of the excitation light and the fluorescence side filter were 485 and 535 nm, respectively. Quadruple measurement was performed for all samples, and measurement was performed three times at regular intervals in order to check temporal changes.

FIG. 4 shows the results. As is clear from FIG. 4, in the sample containing the LAMP reaction product (及 び and ● in FIG. 4) and the sample containing ssM13 (■ in FIG. 4), F
The hybridization degree of the ITC-M13 probe resulted in an increase in the degree of fluorescence polarization. On the other hand, in the sample containing no LAMP reaction product (△ and 中 in FIG. 4), no increase in the fluorescence polarization was observed, indicating that the hybridization was specific. From the above results, it was found that the LAMP product can be specifically detected by the fluorescence polarization method.

Example 2 Detection of Mixed LAMP Reaction Products Using One Kind of Fluorescently Labeled Probe Using a fluorescently labeled probe that hybridizes to one of the two kinds of mixed LAMP reaction products, the target LAMP reaction was performed. It was investigated whether the product could be detected specifically.

(1) Hepatitis B virus (HB
V) Amplification of DNA [Reaction solution composition] ─────────────────── Reaction solution composition (in 25 μL) ────────────── ───── 20 mM Tris-HCl pH 8.8 10 mM KCl 10 mM (NH ₄ ) ₂ SO ₄ 4 mM MgSO ₄ 0.1% TritonX-100 1.0 M betaine 0.4 mM dNTPs 8 U Bst DNA polymerase (NEB) 1600 nM HBVFA primer 1600nM HBVRA primer 200nM HBVF3 primer 200nM HBVR3 primer ───────────────────

The above reaction solution was added at 95 ° C. as a template for the LAMP reaction.
Add 6 × 10 ³ molecules of HBV DNA heat-denatured at
For one hour. At this time, sterilized water containing no DNA was used as a negative control. In this amplification reaction, the following sequence (SEQ ID NO: 7) contained in the template was used as the target polynucleotide.

[0074] 5'-tggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggcta tcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggt tcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatcaaccaccagcacggggcc atgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcgga cggaaactgcacttg-3 '(SEQ ID NO: 7)

The inner primer (HBVFA primer and HBVRA primer) and the outer primer (HBVF3 primer and HBVR3 primer) in the above reaction solution
Was designed as follows based on the nucleotide sequence shown in SEQ ID NO: 7.

[0076] [inner primer] · HBVFA primer 5'-gataaaacgccgcagacacatccttccaacctcttgtcctccaa-3 '(SEQ ID NO: 8) · HBVRA primer 5'-cctgctgctatgcctcatcttctttgacaaacgggcaacatacctt-3' (SEQ ID NO: 9) [outer primer] · HBVF3 primer 5'-caaaattcgcagtccccaac-3 '(SEQ ID NO: 10) HBVR3 primer 5'-ggtggttgatgttcctgga-3' (SEQ ID NO: 11)

(2) Fluorescent Labeled Probe Next, a DNA probe was designed and synthesized so as to be in the same direction as F1 defined by the above primer, and the resulting D
The following fluorescently labeled probe was prepared by labeling the 5 'end of the NA probe with FITC. -FITC -HBV probe (FITC) -5'-agcgatagccaggacaaa-3 '(SEQ ID NO: 12)

(3) Detection of LAMP reaction product After confirming HBV LAMP reaction product by 2% agarose gel electrophoresis, 1 μl containing only HBV LAMP reaction product (HB), M13 LAMP prepared in Example 1 1 μl containing only the reaction product (M13), 1 μl of HBV LAMP reaction product and M13 LAMP
2 μl containing both 1 μl of the reaction product (HB + M13) and one containing no LAMP reaction product (HB N or M13)
N) 1 μl each was used as a sample to be detected. Example 1
Similarly to the above, the heat-denatured LAMP reaction product and the FITC-M13 probe or the FITC-HBV probe 0.5 nM were added to the hybridization buffer, heated at 40 ° C. for 10 minutes, and then the fluorescence polarization was measured. Duplicate measurements were performed on all samples, and five measurements were made at regular intervals to see changes over time.

FIG. 5 shows the results obtained by using the FITC-M13 probe as the fluorescent label probe, and FIG. 6 shows the results obtained by using the FITC-HBV probe. As is clear from FIG. 5, FITC-M13
When the probe was used, the fluorescence polarization degree was increased in the sample containing the LAMP reaction product of M13 (▲ and ○ in FIG. 5) due to the hybridization of the FITC-M13 probe. Sample containing no reaction product (Fig. 5
In the middle, Δ, ●, and □), no increase in the degree of fluorescence polarization was observed. As is clear from FIG. 6, when the FITC-HBV probe was used, in the sample containing the LAMP reaction product of HBV (Δ and ○ in FIG. 6), the FITC-HBV probe hybridized. Although the degree of polarization is increasing,
Samples containing no HBV LAMP reaction product (in FIG. 6, ▲,
In ● and □), no increase in the degree of fluorescence polarization was observed.
Thus, even if two types of LAMP products are mixed, they show almost the same degree of fluorescence polarization as when they are used alone.
No other LAMP reaction product was found to inhibit hybridization. From the above results, it was found that the target LAMP reaction product can be specifically detected using a fluorescently labeled probe that hybridizes to one of the two types of LAMP reaction products that are mixed.

Example 3 Detection of Mixed LAMP Reaction Products Using Two Types of Fluorescent Labeled Probes Two types of mixed LAMP reaction products were detected using two types of fluorescently labeled probes.
It was examined whether each LAMP product can be specifically detected. (1) Amplification of hepatitis C virus (HCV) DNA by LAMP reaction [Reaction solution composition] ─────────────────── Reaction solution composition (in 25 μL) ─── ──────────────── 20 mM Tris-HCl pH 8.8 10 mM KCl 10 mM (NH ₄ ) ₂ SO ₄ 4 mM MgSO ₄ 0.1% TritonX-100 0.8 M betaine 0.4 mM dNTPs 8 U Bst DNA polymerase (NEB) 800 nM HCVFA primer 800 nM HCVRA primer 200 nM HCVF3 primer 200 nM HCVR3 primer ───────────────────

The above reaction solution was added at 95 ° C. as a template for the LAMP reaction.
Add 6 × 10 ³ molecules of HBV DNA heat-denatured at
For one hour. At this time, sterilized water containing no DNA was used as a negative control. In this amplification reaction, the following sequence (SEQ ID NO: 13) contained in the template was used as the target polynucleotide.

[0082] 5'-atcactcccctgtgaggaactactgtcttcacgcagaaagcgtctagccatggcgttagtatgagtgtc gtgcagcctccaggaccccccctcccgggagagccatagtggtctgcggaaccggtgagtacaccggaattg ccaggacgaccgggtcctttcttggatcaacccgctcaatgcctggagatttgggcgtgcccccgcgagact gctagccgagtagtgttgggtcgcgaaaggccttgtggtactgcctgatagggtgcttgcgagtgccccggg aggtctcgtagaccgtgcaccatgagtacgaatcctaaacctcaaagaaaaaccaaacgtaacaccaaccgc cgcccacaggacgtcaagttcccgggcggtggtcagatcgttggtggagtttacttgttgccgcg-3 '(SEQ ID NO 13)

The inner primer (HCVFA primer and HCVRA primer) and the outer primer (HCVF3 primer and HCVR3 primer) in the above reaction solution
Was designed as follows based on the nucleotide sequence shown in SEQ ID NO: 13.

[0084] [Inner primers] · HCVFA primer 5'-gagcgggttgatccaagaaaggactttagccatagtggtctgcgga-3 '(SEQ ID NO: 14) · HCVRA primer 5'-ctagccgagtagtgttgggtcgctttgcactcgcaagcaccctatc-3' (SEQ ID NO: 15) [Outer primers] · HCVF3 primer 5'-gcagaaagcgtctagccatgg-3 '(SEQ ID NO: 16) HCVR3 primer 5'-tcatgatgcacggtctacgaga-3' (SEQ ID NO: 17)

(2) Fluorescent Labeled Probe Next, the following hybridization probe was set so as to be in the same direction as F1 defined by the primer. In addition, the hybridization probe is obtained by a known method.
The one labeled at the 5 ′ end with ROX (X-Rhodamine) was used. -ROX -HCV probe (ROX) -5'-ccggtcgtcctggcaattccggtgtactcaccggt-3 '(SEQ ID NO: 18)

(3) Detection of LAMP reaction product After confirming the LAMP reaction product of HCV by 2% agarose gel electrophoresis, 1 μm containing only the LAMP reaction product of HCV (HCV P) was used.
1, 1 μl containing only the M13 LAMP reaction product prepared in Example 1 (M13 P), 1 μl of HCV LAMP reaction product and M13
Containing both 1 μl of LAMP reaction product (M13 + HCV) 2
μl and those without any LAMP reaction products (M13
N or HCV N) 1 μl each was used as a sample to be detected. As in Example 1, heat-denatured LAMP reaction product and
FITC-M13 probe, ROX-HCV probe, or 0.5 nM mixed probe of FITC-M13 probe and ROX-HCV probe was added to the hybridization buffer and heated at 40 ° C for 20 minutes, and then used for FITC filter or ROX. The fluorescence polarization was measured using a filter. The center wavelengths of the excitation light and the fluorescence side filter when measuring the ROX-labeled probe were 59
The measurement was performed at 0 and 635 nm, and a triple measurement was performed for all samples.

FIG. 7 shows the results when the FITC filter was used, and FIG. 8 shows the results when the ROX filter was used. As is clear from FIG. 7, when the measurement was performed with the FITC filter, both when the FITC-M13 probe alone was hybridized and when the mixed probe of the FITC-M13 probe and the ROX-HCV probe were hybridized. In FIG. 7, the sample containing the LAMP reaction product of M13 (in FIG. 7, M13
P and M13 + HCV), the fluorescence polarization increased, but the L of M13
Sample containing no AMP reaction product (M13N, HCV N
And HCV P) did not show an increase in the degree of fluorescence polarization. Also, as is clear from FIG. 8, when the measurement was performed with the ROX filter, when the ROX-HCV probe alone was hybridized and when the mixed probe of the FITC-M13 probe and the ROX-HCV probe was hybridized. In both cases, the sample containing the LAMP reaction product of HCV (FIG. 8)
Medium, HCV P and M13 + HCV), the fluorescence polarization was increased, but the sample containing no HCV LAMP reaction product (M in FIG. 8, M
13N, M13P and HCV N) did not show an increase in the degree of fluorescence polarization. As described above, even when two types of LAMP products are mixed, the degree of fluorescence polarization is almost the same as when they are used alone, and it was not observed that the other LAMP products inhibit hybridization. From the above results, it was found that two types of LAMP reaction products mixed can be specifically detected using a mixed probe containing two types of fluorescently labeled probes.

Example 4 In the presence of a fluorescently labeled probe
LAMP reaction A LAMP reaction was performed in the presence of a fluorescently labeled probe, and the obtained amplification product was detected by a fluorescence polarization method. That is, the heat-denatured M13 was used as a template in the LAMP reaction solution shown in Example 1.
6 to 6000 molecules of DNA and 25 nM of FITC-M13 probe were added, and an amplification reaction was performed at 65 ° C. for 1 hour. As a control for the LAMP reaction, an amplification reaction was performed without adding the FITC-M13 probe. In both reactions, sterile water without DNA was used as a negative control as a subject. FITC-M1
After the LAMP reaction was performed by adding 3 probes, 5 μl of the LAMP product was added to the same hybridization buffer as in Example 1.
Was immediately added and the degree of fluorescence polarization was measured at 40 ° C. Also FI
Heat-denatured LA without TC-M13 probe added
5 μl of the MP reaction product and 5 nM of the FITC-M13 probe were added to the hybridization buffer, and the fluorescence polarization was measured immediately at 40 ° C. Do double measurements on all samples,
Ten measurements were taken at regular intervals to see the change over time.

FIG. 9 shows the results when the FITC-M13 probe was added after the LAMP reaction, and FIG. 10 shows the results when the FITC-M13 probe was added before the LAMP reaction. In the figure, 図
Means 6,000 molecules of FITC-M13 probe, ▲ means 60
When 0 molecules of FITC-M13 probe were added, ○ indicates that 60 molecules of FITC-M13 probe was added, and ● indicates 6 molecules of FITC-M13.
In the case where the -M13 probe was added, □ indicates the case where the FITC-M13 probe was not added. As is clear from FIG.
If the TC-M13 probe was added after the LAMP reaction,
The greater the amount of template in the reaction, the more the degree of polarization changed, which became evident over time. On the other hand, when amplification was performed with the addition of the FITC-M13 probe, the difference between those amplified immediately after the start of measurement and those not amplified was clearly seen from FIG. The degree of increase was constant. This is the FITC added during amplification
It was considered that the labeled probe was used as a loop primer, and the amplification reaction reached a plateau early on.

Example 5 Simultaneous Amplification and Detection of Two Templates in the Presence of Two Fluorescent Labeled Probes Simultaneously Amplify Two Templates in the Presence of Two Fluorescent Labeled Probes It was examined whether or not can be specifically detected. The template used was M13 phage DNA
And HCV DNA, the amount of HCV DNA was fixed (600 molecules) and M13
Was added in an amount of 1 to 100,000 times for simultaneous amplification. Specifically, in the LAMP reaction solution shown in Example 1, 6 to 60 million molecules of heat-denatured M13 DNA as a template, and heat-denatured HCV DNA
600 molecules, HCVFA primer 800nM, HCVRA primer 80
0 nM, HCVF3 primer 200 nM, HCVR3 primer 200 nM, F
25 nM of the ITC-M13 probe and 25 nM of the ROX-HCV probe were added, and an amplification reaction was performed at 65 ° C for 1 hour. As a negative control, sterilized water containing neither M13 phage DNA nor HCV DNA was used as a subject. 5 μl of the LAMP reaction product was added to the hybridization buffer and heated at 40 ° C. for 60 minutes.
The degree of fluorescence polarization was measured using a filter for ROX or a filter for ROX. Duplicate measurements were performed on all samples.

The results are shown in FIG. HC with a certain amount of mold
V was amplified without being affected even when M13 DNA was mixed in an amount of 1 to 1000 times. As for M13, the same sensitivity as when amplification was performed alone was obtained, and it was found that amplification was not affected by HCV. From the above results, it was found that after simultaneous amplification of two types of templates in the presence of two types of fluorescently labeled probes, each of them can be specifically detected by fluorescence polarization.

[0092]

According to the present invention, a simple method for detecting a nucleic acid amplification product obtained by the LAMP method is provided. The detection method is useful in various application fields to which the LAMP method is applied (microorganism test, genetic test).

[0093]

[Sequence List] SEQUENCE LISTING <110> EIKEN CHEMICAL CO., LTD. <120> A method for detecting amplified nucleic acid with fluorescence polarization. <130> P00-1037 <160> 18 <170> PatentIn Ver. 2.0 <210> 1 <211> 600 <212> DNA <213> phage M13 <400> 1 gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 60 cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct 120 cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat 180 tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg aattcgagct 240 cggtacccgg ggatcctcta gagtcgacct gcaggcatgc aagcttggca ctggccgtcg 300 ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc cttgcagcac 360 atcccccttt cgccagctgg cgtaatagcg aagaggcccg caccgatcgc ccttcccaac 420 agttgcgcag cctgaatggc gaatggcgct ttgcctggtt tccggcacca gaagcggtgc 480 cggaaagctg gctggagtgc gatcttcctg aggccgatac ggtcgtcgtc ccctcaaact 540 ggcagatgca cggttacgat gcgcccatct acaccaacgt aacctatccc attacggtca 600 <210> 2 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 2 cgactctaga ggatccccgg gtactttttg ttgtgtggaa ttgtgagcgg at 52 <210> 3 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 3 acaacgtcgt gactgggaaa accctttttg tgcgggcctc ttcgctatta c 51 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 4 actttatgct tccggctcgta 21 <210> 5 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 5 gttgggaagg gcgatcg 17 <210> 6 <211> 40 <212 > DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 6 gaattcgtaa tcatggtcat agctgtttcc tgtgtgaaat 40 <210> 7 <211> 300 <212> DNA <213> Artificial Sequence <220> < 223> Description of Artificial Sequence: synthetic DNA <400> 7 tggccaaaat tcgcagtccc caacctccaa tcactcacca acctcttgtc ctccaatttg 60 tcctggctat cgctggatgt gtctgcggcg t tttatcata ttcctcttca tcctgctgct 120 atgcctcatc ttcttgttgg ttcttctgga ctaccaaggt atgttgcccg tttgtcctct 180 acttccagga acatcaacca ccagcacggg gccatgcaag acctgcacga ttcctgctca 240 aggaacctct atgtttccct cttgttgctg tacaaaacct tcggacggaa actgcacttg 300 <210> 8 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 8 gataaaacgc cgcagacaca tccttccaac ctcttgtcct ccaa 44 <210> 9 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 9 cctgctgcta tgcctcatct tctttgacaa acgggcaaca tacctt 46 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 10 caaaattcgc agtccccaac 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 11 ggtggttgat gttcctgga 19 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> < 223> Description of Artificial Sequence: synthe tic DNA <400> 12 agcgatagcc aggacaaa 18 <210> 13 <211> 422 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 13 atcactcccc tgtgaggaac tactgtcttc acgcagaaag cgtctagcca tggcgttagt 60 atgagtgtcg tgcagcctcc aggacccccc ctcccgggag agccatagtg gtctgcggaa 120 ccggtgagta caccggaatt gccaggacga ccgggtcctt tcttggatca acccgctcaa 180 tgcctggaga tttgggcgtg cccccgcgag actgctagcc gagtagtgtt gggtcgcgaa 240 aggccttgtg gtactgcctg atagggtgct tgcgagtgcc ccgggaggtc tcgtagaccg 300 tgcaccatga gtacgaatcc taaacctcaa agaaaaacca aacgtaacac caaccgccgc 360 ccacaggacg tcaagttccc gggcggtggt cagatcgttg gtggagttta cttgttgccg 420 cg 422 <210> 14 <211 > 46 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 14 gagcgggttg atccaagaaa ggactttagc catagtggtc tgcgga 46 <210> 15 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 15 ctagccgagt agtgttgggt cgctttgcac tcgc aagcac cctatc 46 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 16 gcagaaagcg tctagccatg g 21 <210> 17 <211> 22 < 212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic DNA <400> 17 tcatgatgca cggtctacga ga 22 <210> 18 <211> 35 <212> DNA <213> Artificial Sequence <220> < 223> Description of Artificial Sequence: synthetic DNA <400> 18 ccggtcgtcc tggcaattcc ggtgtactca ccggt 35

[0094]

[Sequence List Free Text]

 SEQ ID NO: 2: Synthetic DNA SEQ ID NO: 3: Synthetic DNA SEQ ID NO: 4: Synthetic DNA SEQ ID NO: 5: Synthetic DNA SEQ ID NO: 8: Synthetic DNA SEQ ID NO: 9: Synthetic DNA SEQ ID NO: 10: Synthetic DNA SEQ ID NO: 11: synthetic DNA SEQ ID NO: 12: synthetic DNA SEQ ID NO: 14: synthetic DNA SEQ ID NO: 15: synthetic DNA SEQ ID NO: 17: synthetic DNA SEQ ID NO: 18: synthetic DNA

[Brief description of the drawings]

FIG. 1 is a diagram showing an outline of an amplification method by the LAMP method.

FIG. 2 is a diagram showing an outline of an amplification method by the LAMP method.

FIG. 3 is a schematic diagram showing one embodiment of the method for detecting a difference between gene sequences of the present invention.

FIG. 4 is a diagram showing the results of measuring the degree of fluorescence polarization in detecting the LAMP reaction product of M13.

FIG. 5 is a diagram showing the results of measuring the degree of fluorescence polarization in detecting the LAMP reaction product of M13.

FIG. 6 is a view showing the results of measuring the degree of fluorescence polarization in the detection of HBV LAMP reaction products.

FIG. 7 is a view showing a measurement result of a fluorescence polarization degree when a filter for FITC is used.

FIG. 8 is a view showing a measurement result of a fluorescence polarization degree when a filter for ROX is used.

FIG. 9 is a diagram showing the results of measurement of the degree of fluorescence polarization when the FITC-M13 probe was added after the LAMP reaction.

FIG. 10 is a diagram showing the results of measurement of the degree of fluorescence polarization when the FITC-M13 probe was added before the LAMP reaction.

FIG. 11 is a view showing the results of measurement of the degree of fluorescence polarization when M13 DNA and HCV DNA were simultaneously amplified in the presence of the FITC-M13 probe and the ROX-HCV probe.

 ──────────────────────────────────────────────────続 き Continued on the front page F term (reference) 4B024 AA11 CA01 CA09 CA11 HA13 4B063 QA01 QA18 QQ42 QR08 QR32 QR42 QR56 QR62 QS03 QS24 QS25 QS32 QX02

Claims (19)

[Claims] 1. The following steps: (a) a first arbitrary sequence F1c and a second arbitrary sequence F2c in order from the 3 ′ end of a target region on a polynucleotide chain toward the 3 ′ end of the polynucleotide chain; Respectively, selecting a third optional sequence R1 and a fourth optional sequence R2 in order from the 5 'end of the target region toward the 5' end of the polynucleotide chain, (b) the F2c On the 5 'side of the complementary sequence F2 and the F2, a primer comprising the same sequence as the F1c, a sequence R1c identical to the R2 and a sequence R1c complementary to the R1 on the 5' side of the sequence.
A primer comprising, and a sequence sandwiched by the F1c and the F2c, a complementary sequence of a sequence sandwiched by the F1c and the F2c, a sequence sandwiched by the R1 and the R2, or the R1 and the Step of preparing fluorescently labeled probes each containing at least a part of the complementary sequence of the sequence sandwiched by R2, (c) DNA synthesis in the presence of a strand displacement polymerase and the primer using the polynucleotide chain as a template A nucleic acid comprising the steps of: performing a reaction, (d) adding the fluorescently labeled probe to the reaction solution after the DNA synthesis reaction, and (e) measuring the degree of fluorescence polarization of the reaction solution to which the fluorescently labeled probe has been added. A method for detecting or quantifying an amplification product. 2. The following steps: (a) a first arbitrary sequence F1c and a second arbitrary sequence F2c in order from the 3 ′ end of the target region on the polynucleotide chain toward the 3 ′ end of the polynucleotide chain; And the third optional sequence F3c, respectively, the fourth optional sequence R1 in order from the 5 'end of the target region toward the 5' end of the polynucleotide chain,
A step of selecting a fifth arbitrary sequence R2 and a sixth arbitrary sequence R3, respectively, (b) a primer comprising the same sequence as the F1c on the 5 ′ side of the sequence F2 and F2 complementary to the F2c, A primer containing a sequence F3 complementary to F3c, a primer containing the same sequence as the R2 and a sequence R1c complementary to the R1 on the 5 ′ side of the sequence, a primer containing the same sequence as the R3, and A sequence flanked by the F1c and the F2c, the F1c
And the complementary sequence of the sequence flanked by F2c and the R1
And the sequence sandwiched by the R2, or the R1 and the
Preparing a fluorescently labeled probe containing at least a part of the complementary sequence of the sequence sandwiched by R2, (c) using the polynucleotide chain as a template, DNA synthesis in the presence of a strand displacement polymerase and the primer A nucleic acid comprising the steps of: performing a reaction, (d) adding the fluorescently labeled probe to the reaction solution after the DNA synthesis reaction, and (e) measuring the degree of fluorescence polarization of the reaction solution to which the fluorescently labeled probe has been added. A method for detecting or quantifying an amplification product. 3. The method according to claim 1, wherein the target region is set at two or more locations, and each probe corresponding to each target region is labeled with a different fluorescent substance that can be distinguished from each other. The method for detecting or quantifying a nucleic acid amplification product according to claim 1 or 2, wherein two or more kinds of nucleic acid amplification products are simultaneously detected or quantified by measuring the degree of fluorescence polarization. 4. A step of adding an intercalator to the reaction solution after the DNA synthesis reaction, and examining the presence or absence of an amplification product;
A detection or quantification of the nucleic acid amplification product according to any one of claims 1 to 3, further comprising a step of examining the presence or absence of the amplification product using an insoluble substance generated in the reaction solution after the A synthesis reaction as an index. Method. 5. The following steps: (a) a first arbitrary sequence F1c and a second arbitrary sequence F2c in order from the 3 ′ end of the target region on the polynucleotide chain toward the 3 ′ end of the polynucleotide chain; Respectively, selecting a third optional sequence R1 and a fourth optional sequence R2 in order from the 5 'end of the target region toward the 5' end of the polynucleotide chain, (b) the F2c On the 5 'side of the complementary sequence F2 and the F2, a primer comprising the same sequence as the F1c, a sequence R1c identical to the R2 and a sequence R1c complementary to the R1 on the 5' side of the sequence.
And preparing a fluorescently labeled probe comprising at least a part of a sequence sandwiched by the F1c and the F2c, or at least a part of a sequence complementary to the sequence sandwiched by the R1 and the R2, A) performing a DNA synthesis reaction in the presence of a strand displacement polymerase, the primer and the fluorescently labeled probe using the polynucleotide chain as a template, and (d) reaction of the reaction solution during or after the DNA synthesis reaction. A method for detecting, quantifying, or real-time monitoring of a nucleic acid amplification product, which comprises a step of measuring the degree of fluorescence polarization. 6. The following steps: (a) a first arbitrary sequence F1c and a second arbitrary sequence F2c in order from the 3 ′ end of the target region on the polynucleotide chain toward the 3 ′ end of the polynucleotide chain; And the third optional sequence F3c, respectively, the fourth optional sequence R1 in order from the 5 'end of the target region toward the 5' end of the polynucleotide chain,
Selecting a fifth optional sequence R2 and a sixth optional sequence R3, respectively, (b) a primer comprising the same sequence as the F1c on the 5 ′ side of the sequence F2 and F2 complementary to the F2c, A primer comprising the sequence F3 complementary to F3c, a primer comprising the sequence R1c complementary to the sequence R1 and the sequence R1c on the 5 ′ side of the sequence, a primer comprising the sequence identical to the R3, and A step of preparing a fluorescently labeled probe containing at least a part of a sequence sandwiched between the F1c and the F2c, or a complementary sequence of the sequence sandwiched by the R1 and the R2, respectively, (c) the polynucleotide chain Performing a DNA synthesis reaction in the presence of a strand-displacing polymerase, the primer and the fluorescently labeled probe using as a template, and (d) measuring the degree of fluorescence polarization of the reaction solution during or after the DNA synthesis reaction. A nucleus comprising: Detection of the amplified product, quantitative or real-time monitoring method. 7. The method according to claim 6, wherein the target regions are set at two or more locations, and each probe corresponding to each target region is labeled with a different fluorescent substance that can be distinguished from each other. 7. The method for detecting, quantitatively quantifying or real-time monitoring of nucleic acid amplification products according to claim 5, wherein two or more nucleic acid amplification products are simultaneously detected, quantified or monitored in real time by measuring the degree of fluorescence polarization. . 8. The 3′-terminal structure which, when hybridized with the nucleic acid amplification product, causes a nucleotide chain extension from the 3 ′ end of the probe by a DNA synthesis reaction due to the action of the strand displacement polymerase. The method for detecting, quantifying or monitoring a nucleic acid amplification product according to any one of claims 5 to 7, which is provided in a probe. 9. A kit for detecting, quantifying, or real-time monitoring of a nucleic acid comprising the following elements: (a) selecting the first arbitrary sequence F1c and the second arbitrary sequence F2c in order from the 3 ′ end of the target region on the polynucleotide chain toward the 3 ′ end of the polynucleotide chain, When the third optional sequence R1 and the fourth optional sequence R2 are selected in order from the 'end toward the 5' end of the polynucleotide chain, the sequence F2 complementary to the F2c is selected.
And a primer containing the same sequence as the F1c on the 5 ′ side of the F2, a primer containing the same sequence as the R2 and a sequence R1c complementary to the R1 on the 5 ′ side of the sequence, and the F1c and the The sequence sandwiched by F2c, the complementary sequence of the sequence sandwiched by the F1c and the F2c, the sequence sandwiched by the R1 and the R2, or the complement of the sequence sandwiched by the R1 and the R2 (B) a polymerase that catalyzes a strand displacement type complementary strand synthesis reaction, and (c) a nucleotide serving as a substrate for the element (b) 10. A kit for detecting, quantifying or real-time monitoring of a nucleic acid comprising the following elements: (A) the first arbitrary sequence F1c, the second arbitrary sequence F2c in order from the 3 'end of the target region on the polynucleotide chain constituting the nucleic acid to be detected toward the 3' end of the polynucleotide chain
And the third arbitrary sequence F3c, respectively, 5 'of the target region
When the fourth optional sequence R1, the fifth optional sequence R2, and the sixth optional sequence R3 are selected in order from the end toward the 5 'end of the polynucleotide chain, the sequence F2 complementary to the F2c is selected. And a primer containing the same sequence as the F1c on the 5 ′ side of the F2, a primer containing a sequence F3 complementary to the F3c, the same sequence as the R2 and the R1 on the 5 ′ side of the sequence.
A primer containing a sequence R1c complementary to the above, a primer containing the same sequence as the R3, and a sequence sandwiched by the F1c and the F2c, a complementary sequence of a sequence sandwiched by the F1c and the F2c, A fluorescent label probe containing at least a part of a sequence sandwiched by the R1 and the R2, or at least a part of a sequence complementary to the sequence sandwiched by the R1 and the R2, (b) a strand displacement type complementary strand synthesis reaction; Polymerase that catalyzes, and (c) nucleotides that serve as substrates for element (b) 11. A method for detecting a difference in base sequence between a first polynucleotide chain and a second polynucleotide chain which are homologous to each other, comprising the following steps: (a) a first polynucleotide chain; From the 3 ′ end of the upper target region toward the 3 ′ end of the polynucleotide chain,
One arbitrary sequence F1c and the second arbitrary sequence F2c are respectively selected, the third arbitrary sequence R1 and the fourth arbitrary sequence R2 in order from the 5 ′ end of the target region toward the 5 ′ end of the polynucleotide chain. (B) a primer comprising the sequence F2 complementary to the F2c and the same sequence as the F1c on the 5 ′ side of the F2, the same sequence as the R2 and the 5 ′ side of the sequence. Sequence R1c complementary to the R1
A primer comprising, and a sequence sandwiched by the F1c and the F2c, a complementary sequence of a sequence sandwiched by the F1c and the F2c, a sequence sandwiched by the R1 and the R2, or the R1 and the Step of preparing a fluorescently labeled probe containing at least a part of the complementary sequence of the sequence sandwiched by R2, (c) for a sequence containing a base at a different site to be detected in the first polynucleotide chain Performing a DNA synthesis reaction using the first polynucleotide chain and the second polynucleotide chain as templates, respectively, in the presence of a nucleotide chain analog having a complementary base sequence, the primer and the strand displacement polymerase, (d ) Adding the fluorescently labeled probe to the reaction solution after the DNA synthesis reaction; and (e) measuring the degree of fluorescence polarization of the reaction solution to which the fluorescently labeled probe has been added. Method. 12. A method for detecting a difference in base sequence between a first polynucleotide chain and a second polynucleotide chain which are homologous to each other, comprising the following steps: (a) a first polynucleotide chain; The first arbitrary sequence F1c, the second arbitrary sequence F2c and the third arbitrary sequence F3c are selected in order from the 3 ′ end of the target region toward the 3 ′ end of the polynucleotide chain, and the target region is selected. A step of selecting a fourth optional sequence R1, a fifth optional sequence R2 and a sixth optional sequence R3 in order from the 5 'end toward the 5' end of the polynucleotide chain, (b) for the F2c On the 5 ′ side of the complementary sequence F2 and the F2, a primer containing the same sequence as the F1c, a primer containing the sequence F3 complementary to the F3c, the same sequence as the R2 and the 5 ′ side of the sequence A primer containing the sequence R1c complementary to the R1, and a primer containing the same sequence as the R3. Chromatography, as well as sequence flanked by said said F1c F2c, the F1c
And the complementary sequence of the sequence flanked by F2c and the R1
And the sequence sandwiched by the R2, or the R1 and the
Step of preparing a fluorescently labeled probe containing at least a part of the complementary sequence of the sequence sandwiched by R2, (c) for a sequence containing a base at a different site to be detected in the first polynucleotide chain Performing a DNA synthesis reaction using the first polynucleotide chain and the second polynucleotide chain as templates, respectively, in the presence of a nucleotide chain analog having a complementary base sequence, the primer and the strand displacement polymerase, (d The above-described detection method, comprising: a step of adding the fluorescently labeled probe to the reaction solution after the DNA synthesis reaction; and (e) measuring a fluorescence polarization degree of the reaction solution to which the fluorescently labeled probe has been added. 13. A method for detecting a difference in base sequence between a first polynucleotide chain and a second polynucleotide chain which are homologous to each other, comprising the following steps: (a) a first polynucleotide chain; From the 3 ′ end of the upper target region toward the 3 ′ end of the polynucleotide chain,
One arbitrary sequence F1c and the second arbitrary sequence F2c are respectively selected, the third arbitrary sequence R1 and the fourth arbitrary sequence R2 in order from the 5 ′ end of the target region toward the 5 ′ end of the polynucleotide chain. (B) a primer comprising the sequence F2 complementary to the F2c and the same sequence as the F1c on the 5 ′ side of the F2, the same sequence as the R2 and the 5 ′ side of the sequence. Sequence R1c complementary to the R1
And preparing a fluorescently labeled probe comprising at least a part of a sequence sandwiched between the F1c and the F2c, or a complementary sequence of the sequence sandwiched by the R1 and the R2, respectively. A) in the presence of a nucleotide chain analog having a base sequence complementary to the sequence containing the base at the different site to be detected in the first polynucleotide chain, the primer, the fluorescently labeled probe and a strand displacement polymerase; Using the first polynucleotide chain and the second polynucleotide chain as templates, respectively, performing a DNA synthesis reaction, and Detection method. 14. A method for detecting a difference in base sequence between a first polynucleotide chain and a second polynucleotide chain which are homologous to each other, comprising the following steps: (a) a first polynucleotide chain; The first arbitrary sequence F1c, the second arbitrary sequence F2c and the third arbitrary sequence F3c are selected in order from the 3 ′ end of the target region toward the 3 ′ end of the polynucleotide chain, and the target region is selected. A step of selecting a fourth optional sequence R1, a fifth optional sequence R2 and a sixth optional sequence R3 in order from the 5 'end toward the 5' end of the polynucleotide chain, (b) for the F2c On the 5 ′ side of the complementary sequence F2 and the F2, a primer containing the same sequence as the F1c, a primer containing the sequence F3 complementary to the F3c, the same sequence as the R2 and the 5 ′ side of the sequence A primer containing the sequence R1c complementary to the R1, and a primer containing the same sequence as the R3. And preparing a sequence flanked by the F1c and the F2c, or a complementary sequence of the sequence flanked by the R1 and the R2, respectively. (C) detecting in the first polynucleotide chain In the presence of a nucleotide chain analog having a base sequence complementary to a sequence containing a base to be a different site, the primer, the fluorescently labeled probe and a polymerase, the first polynucleotide chain and the second polynucleotide chain The above-described detection method, comprising: performing a DNA synthesis reaction as a template; and (d) measuring the degree of fluorescence polarization of the reaction solution to which the fluorescent-labeled probe has been added. 15. The detection method according to claim 11, wherein the nucleotide chain analog is a peptide nucleic acid. 16. The detection method according to claim 11, wherein the nucleotide chain analog comprises 8 to 30 bases. 17.F1c, F2c, F3c, R1, R2, R3, or F2c to R2
The detection method according to any one of claims 11 to 16, wherein the region contains a difference in base sequence to be detected between the first polynucleotide chain and the second polynucleotide chain. 18. The detection method according to claim 11, wherein the difference in the nucleotide sequence is caused by a point mutation. 19. The detection method according to claim 11, wherein the difference in the nucleotide sequence is caused by a single nucleotide polymorphism.