EP3574083A1 - Microorganisme génétiquement optimisé pour la production de molécules d'intérêt - Google Patents
Microorganisme génétiquement optimisé pour la production de molécules d'intérêtInfo
- Publication number
- EP3574083A1 EP3574083A1 EP18702647.1A EP18702647A EP3574083A1 EP 3574083 A1 EP3574083 A1 EP 3574083A1 EP 18702647 A EP18702647 A EP 18702647A EP 3574083 A1 EP3574083 A1 EP 3574083A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- microorganism
- gene
- genetically modified
- interest
- molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1217—Phosphotransferases with a carboxyl group as acceptor (2.7.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/18—Carboxylic ester hydrolases (3.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/001—Amines; Imines
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/14—Glutamic acid; Glutamine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/42—Hydroxy-carboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/62—Carboxylic acid esters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/62—Carboxylic acid esters
- C12P7/625—Polyesters of hydroxy carboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01044—Phosphogluconate dehydrogenase (decarboxylating) (1.1.1.44)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01049—Glucose-6-phosphate dehydrogenase (1.1.1.49)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
- C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
- C12Y102/01012—Glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) (1.2.1.12)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
- C12Y207/01019—Phosphoribulokinase (2.7.1.19)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/02—Phosphotransferases with a carboxy group as acceptor (2.7.2)
- C12Y207/02003—Phosphoglycerate kinase (2.7.2.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/01—Carboxylic ester hydrolases (3.1.1)
- C12Y301/01031—6-Phosphogluconolactonase (3.1.1.31)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y401/00—Carbon-carbon lyases (4.1)
- C12Y401/01—Carboxy-lyases (4.1.1)
- C12Y401/01039—Ribulose-bisphosphate carboxylase (4.1.1.39)
Definitions
- the invention relates to a genetically modified microorganism capable of using carbon dioxide as an at least partial carbon source for the production of molecules of interest. More particularly, the invention relates to a microorganism in which at least the glycolysis pathway is at least partially inhibited. The invention also relates to processes for the production of at least one molecule of interest using such a microorganism.
- fermentation processes are used to cause molecules to be produced by a microorganism from a fermentable carbon source, such as glucose.
- Bioconversion processes have also been developed, to allow a microorganism to convert a co-substrate, not assimilable by said microorganism, into a molecule of interest.
- a source of carbon is necessary, not for the actual production of the molecule of interest, but for the production of cofactors, and more particularly of NADPH, which may be necessary for bioconversion.
- the production yield by such microbiological processes is low mainly because of cofactor requirements and the difficulty of balancing the redox metabolic reactions.
- a carbon source that can be assimilated by the microorganism is always necessary. In other words, currently to produce a molecule of interest with a microbiological process, it is necessary to provide a molecule (glucose, or other), certainly of less industrial value, but which is sufficient to make the production of certain molecules not economically attractive.
- the inventors have discovered that it is possible to increase the production yield of molecules of interest by coupling part of the Calvin cycle (PRK / RuBisCO) to at least partial inhibition of glycolysis.
- the inventors have also discovered that it is possible to increase the exogenous CO2 consumption during the production of molecules of interest, while also at least partially inhibiting the oxidative branch of the pentose phosphate pathway.
- the microorganisms thus developed make it possible to produce on a large scale and with an industrially interesting yield a large number of molecules of interest, such as amino acids, organic acids, terpenes, terpenoids, peptides, fatty acids, polyols, etc.
- the subject of the invention is therefore a genetically modified microorganism expressing a functional RuBisCO enzyme and a phosphoribulokinase (PRK), and in which the glycolysis pathway is at least partially inhibited, said microorganism being genetically modified so as to produce an exogenous molecule of interest and / or overproducing an endogenous molecule of interest, other than the enzyme RuBisCO or phosphoribulokinase.
- PRK phosphoribulokinase
- the genetically modified microorganism has an oxidative branch of the pentose phosphate pathway also at least partially inhibited.
- the invention also relates to the use of a genetically modified microorganism according to the invention, for the production or overproduction of a molecule of interest, preferentially chosen from amino acids, peptides, proteins, vitamins, sterols, flavonoids, terpenes, terpenoids, fatty acids, polyols and organic acids.
- the present invention also relates to a biotechnological process for producing or overproducing at least one molecule of interest, characterized in that it comprises a step of culturing a genetically modified microorganism according to the invention, under conditions allowing the synthesis or the bioconversion, by said microorganism, of said molecule of interest, and optionally a step of recovering and / or purifying said molecule of interest.
- It also relates to a method for producing a molecule of interest comprising (i) the insertion of at least one sequence coding for an enzyme involved in the synthesis or bioconversion of said molecule of interest in a recombinant microorganism according to the invention (ii) culturing said microorganism under conditions permitting the expression of said enzyme and optionally (iii) recovering and / or purifying said molecule of interest.
- Figure 1 General scheme of glycolysis, the pentose phosphate pathway and Entner-Doudoroff pathway;
- FIG. 1 Schematic representation of the inhibition of the glycolysis pathway, according to the invention.
- Figure 3 Schematic representation of the inhibition of the glycolysis pathway, combined with the inhibition of the oxidative branch of the pentose phosphate pathway, according to the invention.
- recombinant microorganism modified microorganism
- recombinant host cell refers to microorganisms that have been genetically engineered to express or overexpress endogenous nucleotide sequences to express heterologous nucleotide sequences. or that have an alteration of the expression of an endogenous gene.
- “Alteration” means that the expression of the gene, or level of an RNA molecule or equivalent RNA molecules encoding one or more polypeptides or polypeptide subunits, or the activity of one or more polypeptides or polypeptide subunits is regulated, such that the expression, level, or activity is greater or less than that observed in the absence of modification.
- recombinant microorganism refers not only to the particular recombinant microorganism, but to the progeny or potential progeny of such a microorganism. As some changes may occur in subsequent generations because of mutation or environmental influences, this offspring may not be identical to the parent cell, but is still included in the term as used here.
- an at least partially “inhibited” or “inactivated” metabolic pathway refers to an altered metabolic pathway, which can no longer proceed properly in the microorganism in question, compared to the same wild-type microorganism (not genetically modified to inhibit said metabolic pathway).
- the metabolic pathway can be interrupted, resulting in the accumulation of an intermediate metabolite.
- Such an interruption can be obtained for example by inhibition of the enzyme necessary for the degradation of an intermediate metabolite of the metabolic pathway in question and / or by inhibition of the expression of the gene coding for this enzyme.
- the metabolic pathway can also be attenuated, that is, slowed down. Such attenuation can be obtained for example by partial inhibition of one or more enzymes involved in the metabolic pathway and / or by partial inhibition of the expression of a gene coding for at least one of these enzymes and / or by playing cofactors needed for some reactions.
- the expression "at least partially inhibited metabolic pathway” means that the level of the metabolic pathway considered is reduced by at least 20%, more preferably at least 30%, 40%, 50%, or more, compared to the level in a wild microorganism.
- the reduction can be greater, and in particular be at least greater than 60%, 70%, 80%, 90%.
- the inhibition may be complete, in that the metabolic pathway considered is not used at all by the said microorganism. According to the invention, such an inhibition can be temporary or permanent.
- the expression "inhibition of the expression of a gene” is understood to mean that said gene is no longer expressed in the microorganism in question or that its expression is reduced, compared with the wild-type microorganism (which is not genetically modified to inhibit the formation of a particular gene). expression of the gene), leading to the absence of production of the corresponding protein or to a significant decrease in its production, and in particular to a decrease of greater than 20%, more preferably 30%, 40%, 50%, 60%, 70%, 80%, 90%.
- the inhibition can be complete, that is to say that the protein encoded by said gene is no longer produced at all.
- the inhibition of the expression of a gene can in particular be obtained by deletion, mutation, insertion and / or substitution of one or more nucleotides in the gene under consideration. Preferentially, the inhibition of the expression of the gene is obtained by total deletion of the corresponding nucleotide sequence.
- any method of inhibition of a gene known per se by those skilled in the art and applicable to a microorganism may be used.
- inhibition of gene expression can be achieved by homologous recombination (Datsenko et al., Proc Natl Acad Sci US A 2000; 97: 6640-5; Lodish et al., Molecular Cell Biology 4 th ed 2000.
- the inhibition of the expression of the gene is obtained by knockout techniques. Inhibition of gene expression can also be achieved by gene silencing using interfering, ribozyme or antisense RNAs (Daneholt, 2006. Nobel Prize in Physiology or Medicine).
- interfering RNA or "RNAi” refers to any RNAi molecule (e.g. single-stranded RNA or double-stranded RNA) that can block expression of a target gene and / or facilitate degradation. corresponding mRNA.
- Inhibition of the gene can also be achieved by genomic editing methods that allow direct genetic modifications to a given genome via the use of zinc finger nucleases (Kim et al., PNAS; 93: 1156). 1160), effector nucleases of the transcriptional activator type, called "TALEN” (Ousterout et al., Methods Mol Biol 2016, 1338: 27-42, doi: 10.1007 / 978-1-4939-2932-0_3), a system combining Cas9-like nucleases with short, regularly spaced, pooled palindromic repeats called CRISPR (Mali et al, Nat Methods, 2013 Oct; 10 (10): 957-63, doi: 10.1038 / nmeth.2649) or meganucleases (Daboussi et al., Nucleic Acids Res., 2012 40: 6367-79). Inhibition of gene expression can also be achieved by inactivation of the protein encoded by said gene.
- TALEN effector nu
- NADPH-dependent or “NADPH-consuming” biosynthesis or bioconversion is meant in the context of the invention all the biosynthetic or bioconversion pathways in which one or more enzymes require the concomitant addition of electrons obtained. by the oxidation of an NADPH cofactor.
- Routes of biosynthesis or bioconversion "NADPH-dependent” relate in particular to the synthesis of amino acids (eg arginine, lysine, methionine, threonine, proline, glutamate, homoserine, isoleucine, valine) ⁇ -aminobutyric acid, terpenoids and terpenes (eg farnesene), vitamins and precursors (eg pantoate, pantothenate, transneurosporene, phylloquinone, tocopherols), sterols (eg squalene, cholesterol, testosterone, progesterone, cortisone), flavonoids (eg frambinone, vestinone), organic acids (eg citric acid, succinic acid) oxalic acid, itaconic acid, coumaric acid, 3-hydroxypropionic acid), polyols (eg sorbitol, xylitol, glycerol), polyamines (eg sper
- exogenous refers to molecules that are not normally or naturally found in and / or produced by the microorganism of interest.
- endogenous or “native” in reference to various molecules refers to molecules that are normally or naturally found in and / or produced by the microorganism under consideration.
- the invention provides genetically modified microorganisms for the production of a molecule of interest, endogenous or exogenous.
- genetically modified microorganism is meant that the genome of the microorganism has been modified so as to integrate a nucleic sequence encoding an enzyme involved in the biosynthetic pathway or bioconversion of a molecule of interest, or encoding a biologically active fragment of it.
- Said nucleic sequence may have been introduced into the genome of said microorganism or one of its ascendants, by means of any suitable molecular cloning method.
- the genome of the microorganism refers to all the genetic material contained in said microorganism, including the extrachromosomal genetic material contained for example in plasmids, episomes, synthetic chromosomes, etc.
- the nucleic acid sequence introduced may be a heterologous sequence, that is to say one that does not exist in the natural state in said microorganism, or a homologous sequence.
- a transcriptional unit containing the nucleic sequence of interest placed under the control of one or more promoter (s) is introduced into the genome of the microorganism.
- Such a transcriptional unit also advantageously comprises the usual sequences such as transcriptional terminators and, if appropriate, other transcriptional regulation elements.
- Promoters useful in the context of the present invention include constitutive promoters, i.e., promoters that are active in most cellular states and environmental conditions, as well as inducible promoters that are activated or repressed by exogenous physical or chemical stimuli. thus inducing a variable level of expression depending on the presence or absence of these stimuli.
- constitutive promoters i.e., promoters that are active in most cellular states and environmental conditions
- inducible promoters that are activated or repressed by exogenous physical or chemical stimuli. thus inducing a variable level of expression depending on the presence or absence of these stimuli.
- the microorganism is a yeast
- inducible promoters that can be used in yeast are the tetO-2, GAL10, GAL10-CYC1 and PHO5 promoters.
- the genetically modified microorganism according to the invention has the following characteristics:
- the microorganism is a eukaryotic cell, preferably chosen from yeasts, fungi, microalgae or a prokaryotic cell, preferably a bacterium or cyanobacterium.
- the genetically modified microorganism according to the invention is a yeast, preferably chosen from ascomycete yeasts (Spermophthomceae and Saccharomycetaceae), basidiomycete yeasts (Leucosporidium, Rhodosporidium, Sporidiobolus, Filobasidium, and Filobasidiella) and deuteromycete yeasts belonging to the yeast.
- the genetically modified yeast according to the invention belongs to the genus Pichia, Kluyveromyces, Saccharomyces, Schizosaccharomyces, Candida, Lipomyces, Rhodotorula, Rhodosporidium, Yarrowia, or Debaryomyces.
- the genetically modified yeast according to the invention is chosen from among Pichia pastoris, Kluyveromyces lactis, Kluyveromyces marxianus, Saccharomyces cerevisiae, Saccharomyces carlsbergensis, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, Schizosaccharomyces pombe, Candida albicans, Candida tropicalis, Rhodotorula glutinis, Rhodosporidium toruloides, Yarrowia lipolytica, Debaryomyces hansenii and Lipomyces starkeyi.
- the genetically modified microorganism according to the invention is a fungus, and more particularly a "filamentous" fungus.
- “filamentous fungi” refers to all filamentous forms of the Eumycotina subdivision.
- the genetically modified fungus according to the invention belongs to the genus Aspergillus, Trichoderma, Neurospora, Podospora, Endothia, Mucor, Cochliobolus or Pyricularia.
- the genetically modified fungus according to the invention is chosen from Aspergillus nidulans, Aspergillus niger, Aspergillus awomari, Aspergillus oryzae, Aspergillus terreus, Neurospora crassa, Trichoderma reesei, and Trichoderma viride.
- the microorganism genetically modified according to the invention is a microalgae.
- microalgae refers to all eukaryotic-type microscopic algae, preferentially belonging to the classes or superclasses of Chlorophyceae, Chrysophyceae, Prymnesiophyceae, Diatomaceous or Bacillariophyta, Euglenophyceae, Rhodophyceae, or Trebouxiophyceae.
- the microalgae genetically modified according to the invention are chosen from Nannochloropsis sp. (eg Nannochloropsis oculata, Nannochloropsis gaditana, Nannochloropsis salina), Tetraselmis sp.
- Chlorella sp (eg Tetraselmis suecica, Tetraselmis chuii), Chlorella sp. (eg Chlorella salina, Chlorella protothecoides, Chlorella ellipsoidea, Chlorella emersonii, Chlorella minutissima, Chlorella pyrenoidosa, Chlorella sorokiniana, Chlorella vulgaris), Chlamydomonas sp. (eg Chlamydomonas reinhardtii) Dunaliella sp.
- Chlorella salina Chlorella protothecoides, Chlorella ellipsoidea, Chlorella emersonii, Chlorella minutissima, Chlorella pyrenoidosa, Chlorella sorokiniana, Chlorella vulgaris
- Chlamydomonas sp (eg Chlamydomonas reinhardtii) Dunaliella sp.
- the genetically modified microorganism according to the invention is a bacterium, preferentially chosen from phyla Acidobacteria, Actinobacteria, Aquificae, Bacterioidetes, Chlamydiae, Chlorobi, Chloroflexi, Chrysiogenetes, Cyanobacteria, Deferribacteres, Deinococcus-Thermus, Dictyoglomi, Fibrobacteria , Firmicutes, Fusobacteria, Gemmatimonadetes, Nitrospirae, Planctomycetes, Proteobacteria, Spirochaetes, Thermodesulfobacteria, Thermomicrobia, Thermotogae, or Verrucomicrobia.
- the bacterium genetically modified according to the invention belongs to the genus Acaryochloris, Acetobacter, Actinobacillus, Agrobacterium, Alicyclobacillus, Anabaena, Anacystis, Anaerobiospirillum, Aquifex, Arthrobacter, Arthrospira, Azobacter, Bacillus, Brevibacterium, Burkholderia, Chlorobium, Chromatium, Chlorobaculum, Clostridium, Corynebacterium, Cupriavidus, Cyanothece, Enterobacter, Deinococcus, Erwinia, Escherichia, Geobacter, Gloeobacter, Gluconobacter, Hydrogenobacter, Klebsiella, Lactobacillus, Lactococcus, Mannheimia, Mesorhizobium, Methylobacterium, Microbacterium, Microcystis, Nitrobacter, Nitrosomonas, Nitrospina, Nitrospira, Nostoc,
- the bacterium genetically modified according to the invention is selected from the species Agwbacterium tumefaciens, Anaerobiospirillum succiniciproducens, Actinobacillus succinogenes, Aquifex aeolicus, Aquifex pyrophilus, Bacillus subtilis, Bacillus amyloliquefacines, Brevibacterium ammoniagenes, Brevibacterium immariophilum, Clostridium pasteurianum, Clostridium Ijungdahlii , Clostridium acetobutylicum, Clostridium beigerinckii, Corynebacterium glutamicum, Cupriavidus necator, Cupriavidus metallidurans, Enterobacter sakazakii, E.
- the microorganism can naturally express functional RuBisCO and PRK. This is the case, for example, with photosynthetic microorganisms, such as microalgae or cyanobacteria.
- RuBisCO there are several forms of RuBisCO in nature (Tabita et al, J Exp Bot 2008; 59 (7): 1515-24. Doi: 10.1093 / jxb / erm361).
- Forms I, II and III catalyze the carboxylation and oxygenation reactions of ribulose-1,5-bisphosphate.
- Form I is present in eukaryotes and bacteria. It consists of two types of subunits: large subunits (RbcL) and small subunits (RbcS).
- the functional enzymatic complex is a hexadecamer consisting of eight L subunits and eight S subunits.
- RbcX (Liu et al. , Nature, 2010 Jan 14, 463 (7278): 197-202, doi: 10.1038 / nature08651).
- Form II is mainly found in proteobacteria, archaea (Archaea or archaebacteria) and dinoflagellate algae. Its structure is much simpler: it is a homodimer (consisting of two identical RbcL subunits).
- the genes encoding type I RuBisCO may be called rbcLIrbcS (eg, Synechococcus elongatus), or cbxLC / cbxSC, cfxLC / cfxSC, cbbLIcbbS (eg, Cupriavidus necator).
- the genes encoding type II RuBisCO are generally called cbbM (eg, Rhodospirillum rubrum).
- Form III is present in archaea. It is generally found in the form of RbcL subunit dimers, or dimer pentamers.
- RuBisCO may be called rbcL (for example, Thermococcus kodakarensis), cbbL (for example, Haloferax sp.).
- PRK Two classes of PRKs are known: Class I enzymes found in proteobacteria are octamers, while Class II enzymes in cyanobacteria and plants are tetramers or dimers.
- the genes encoding PRK may be called prk (eg, Synechococcus elongatus), prkA (eg, Chlamydomonas reinhardtii), prkB (eg, Escherichia coli), prkl, prk2 (eg, Leptolyngbya).
- prk eg, Synechococcus elongatus
- prkA eg, Chlamydomonas reinhardtii
- prkB eg, Escherichia coli
- prkl prk2 (eg, Leptolyngbya).
- cbbP eg, Nitrobacter vulgaris
- cfxP eg, Cupriavidus necator
- the microorganism used does not naturally express functional RuBisCO and PRK
- said microorganism is genetically modified to express a heterologous RuBisCO and PRK.
- the microorganism is transformed so as to integrate into its genome one or more expression cassettes integrating the sequences coding for said proteins, and advantageously the appropriate transcriptional factors.
- RuBisCO type I where the introduction and expression of genes encoding a specific chaperone (Rbcx) and general chaperones (GroES and GroEL, for example) are necessary to obtain a Functional RuBisCO.
- the application WO2015 / 107496 describes in detail how to genetically modify a yeast so that it expresses a RuBisCO of type I and a functional PRK. It is also possible to refer to the method described in GUADALUPE-MEDINA et al. (Biotechnology for Biofuels, 6, 125, 2013).
- the microorganism is genetically engineered to express type I RuBisCO. In another embodiment, the microorganism is genetically engineered to express an IL-type RuBisCO. In another embodiment, the microorganism is genetically modified. to express a RuBisCO type III.
- the glycolysis pathway is at least partially inhibited, so that the microorganism is no longer able to normally use this pathway ( Figure 1 - glycolysis).
- the microorganism no longer has the ability to assimilate glucose in a manner similar to a wild-type microorganism, in which the glycolysis pathway has not been inhibited (independently of any other genetic modification).
- the microorganism is genetically modified so as to inhibit, in whole or in part, the glycolysis downstream of the production of glyceraldehyde-3-phosphate (G3P).
- G3P glyceraldehyde-3-phosphate
- glycolysis is inhibited upstream of the production of 1,3-bisphospho-D-glycerate (1,3-BPG) or upstream of the production of 3-phosphoglycerate (3PG).
- glyceraldehyde-3-phosphate (G3P) and 3-phosphoglycerate (3PG) can be managed by (i) two concomitantly acting enzymes, glyceraldehyde-3-phosphate dehydrogenase (EC). 1.2.1.12, abbreviated GAPDH or more rarely G3PDH) and phosphoglycerate kinase (EC 2.7.2.3, abbreviated PGK), or (ii) by a single non-phosphorylating glyceraldehyde 3-phosphate dehydrogenase enzyme (EC 1.2.1.9, abbreviated GAPN).
- EC glyceraldehyde-3-phosphate dehydrogenase
- GAPN non-phosphorylating glyceraldehyde 3-phosphate dehydrogenase enzyme
- Glyceraldehyde-3-phosphate dehydrogenase catalyzes the reversible conversion of G3P to 1,3-bisphospho-D-glycerate (1,3-BPG), using the NADVNADH pair as the electron donor / acceptor in the sense of the reaction.
- the genes coding for GAPDH may be called gapA, gapB, gapC (eg Escherichia coli, Arabidopsis thaliana), GAPDH, GAPD, G3PD, GAPDHS (eg Homo sapiens), TDH1, TDH2, TDH3 (eg Saccharomyces cerevisiae).
- Phosphoglycerate kinase catalyzes the reversible conversion of 1,3-BPG to 3PG, using the ATP / ADP pair as a cofactor.
- the genes encoding PGK may be called PGK, PGK1, PGK2, PGK3, pgkA, PGKB, PGKC, cbbK, cbbKC, cbbKP (eg Cupriavidus necator).
- Non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase catalyzes the conversion of G3P to 3PG without passing through 1,3-BPG. This reaction is catalyzed in the presence of the cofactor couple NADPVNADPH which plays the role of electron acceptor.
- the genes encoding GAPN may be called GAPN (eg Bacillus sp., Streptococcus sp.), GAPN1 (eg Chlamydomonas sp.).
- the microorganism is genetically modified so that the expression of the gene encoding glyceraldehyde 3-phosphate dehydrogenase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
- the expression of the gene encoding phosphoglycerate kinase may also be at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
- the microorganism is genetically modified so that the expression of the gene coding for non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
- Tables 3, 4 and 5 below list, by way of example, the sequences encoding a glyceraldehyde 3-phosphate dehydrogenase, a phosphoglycerate kinase and a non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase which can be inhibited depending on the microorganism. target. The person skilled in the art knows which gene corresponds to the enzyme of interest to be inhibited as a function of the microorganism. Table 3: Examples of sequences coding for a GAPDH
- Table 5 Examples of sequences coding for a GAPN
- the production of 3-phosphoglycerate (3PG) is no longer possible through glycolysis, or at least greatly reduced, in the genetically modified microorganism according to the invention.
- the microorganism is a yeast of the genus Saccharomyces cerevisiae in which the expression of the gene TDH1 (Gene ID: 853395), TDH2 (Gene ID: 853465) and / or TDH3 (Gene ID: 853106) is less partially inhibited.
- the microorganism is a yeast of the genus Saccharomyces cerevisiae in which the expression of the PGK1 gene (Gene ID: 5230) is at least partially inhibited.
- the microorganism is a yeast of the genus Saccharomyces cerevisiae in which the expression of the PGK1 gene (Gene ID: 5230), the expression of the TDH1 gene (Gene ID: 853395), TDH2 (Gene ID: 853465 ) and / or the expression of the TDH3 gene (Gene ID: 853106) are at least partially inhibited.
- the microorganism is a bacterium of the genus Escherichia coli in which the expression of the gapA gene (Gene ID: 947679) is at least partially inhibited.
- the microorganism is a bacterium of the genus Escherichia coli in which the expression of the pgk gene (Gene ID: 947414) is at least partially inhibited.
- the microorganism is an E. coli bacterium in which the expression of the pgk gene (Gene ID: 947414), and / or the expression of the gapA gene (Gene ID: 947679) are at least partially inhibited.
- the genetically modified microorganism which expresses a functional RuBisCO and PRK, is on the other hand able to produce 3PG by capturing C0 2 , from the ribulo se-5-phosphate produced by the pentose phosphate pathway ( Figure 2).
- the enzymes necessary for the metabolism of 3PG pyruvate are not inhibited in the microorganism, said microorganism can then metabolize the 3PG to produce pyruvate and ⁇ .
- the genetically modified microorganism is able to produce pyruvate and NADPH cofactors by using CO2 as a complementary carbon source.
- the term "complementary" carbon source means that the microorganism uses CO2 as a partial carbon source, in addition to the carbon atoms provided by fermentable sugars (glucose, galactose, sucrose, fructose, etc.), which constitutes the majority or main source of carbon for the production of pyruvate.
- the genetically modified microorganism according to the invention makes it possible to increase the carbon yield by fixing and using the CO2 normally lost during glucose metabolism by means of pentose phosphates, for the production of pyruvate (and subsequently molecules of interest).
- the genetically modified microorganism according to the invention is also modified so that the oxidative branch of the pentose phosphate pathway is also at least partially inhibited.
- the microorganism is genetically modified so as to inhibit the oxidative branch of the pentose phosphate pathway upstream of the ribulose-5-phosphate production (FIG. 1 - pentose phosphate pathway).
- the interruption of the oxidative branch of the pentose phosphate pathway upstream of the production of ribulose-5-phosphate (Ru5P) specifically targets one or more reactions in the process of synthesizing Ru5P from glucose-6-phosphate (G6P ).
- This synthesis is generally catalyzed by the successive actions of three enzymes: (i) glucose-6-phosphate dehydrogenase (EC 1.1.1.49, abbreviated G6PDH), (ii) 6-phosphogluconolactonase (EC 3.1.1.31, abbreviated PGL) , and (iii) 6-phosphogluconate dehydrogenase (EC 1.1.1.44, abbreviated PGD).
- G6PDH Glucose-6-phosphate dehydrogenase catalyzes the first reaction of the pentose phosphate pathway, that is, the oxidation of glucose-6-phosphate to 6-phosphogluconolactone (6PGL), with concomitant reduction of a molecule of NADP + in NADPH.
- the genes coding for G6PDH may be called G6PD (for example in Homo sapiens), G6pdx (for example in Mus musculus), gsdA (for example in Aspergillus nidulans), zwf (for example in Escherichia coli), or ZWF1 (for example in Saccharomyces cerevisiae).
- 6-Phosphogluconolactonase is a hydrolase catalyzing the synthesis of 6-phosphogluconate (6PGA) from 6PGL.
- the genes coding for PGL may be called pgl (for example in Escherichia coli, Synechocystis sp.) Pgls (for example in Rhodobacteraceae bacterium), or SOL (for example in Saccharomyces cerevisiae).
- 6-Phosphogluconate dehydrogenase is an oxidoreductase catalyzing the synthesis of Ru5P from 6PGA, with concomitant reduction of a NADP + molecule to NADPH and emission of a CO 2 molecule.
- the genes coding for PGD may be called gnd (for example in Escherichia coli, Saccharomyces cerevisiae), PGD (for example in Homo sapiens), gntZ (for example in Bacillus subtilis), or 6-PGDH. (for example, Lactobacillus paracollinoides).
- the microorganism is genetically modified so that the expression of the gene encoding glucose-6-phosphate dehydrogenase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
- the microorganism is genetically modified so that the expression of the gene encoding 6-phosphogluconolactonase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
- the microorganism is genetically modified so that the expression of the gene encoding 6-phosphogluconate dehydrogenase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
- Tables 6, 7 and 8 below list, by way of example, the sequences encoding glucose-6-phosphate dehydrogenase, 6-phosphogluconolactonase and 6-phosphogluconate dehydrogenase which can be inhibited depending on the target microorganism.
- the person skilled in the art knows which gene corresponds to the enzyme of interest to be inhibited as a function of the microorganism.
- ribulo se-5-phosphate (Ru5P) is no longer possible via pentose phosphates, or at least greatly reduced, in the genetically modified microorganism according to the invention.
- the microorganism is a yeast of the genus Saccharomyces cerevisiae in which the expression of the ZWF1 gene is at least partially inhibited.
- the yeast of the genus Saccharomyces cerevisiae is genetically modified so that the expression of the TDH1, TDH2, TDH3 and / or PGK1 genes, and the expression of the ZWF1 gene are at least partially inhibited.
- the microorganism is a bacterium of the genus Escherichia coli in which the expression of the zw / gene is at least partially inhibited.
- the bacterium of the genus Escherichia coli is genetically modified so that the expression of the gapA and / or pgk genes and the expression of the zwf gene are at least partially inhibited.
- the microorganism is a filamentous fungus of the genus Aspergillus, such as Aspergillus niger or Aspergillus terreus, genetically modified so that the expression of the pgk and gsdA genes is partially inhibited.
- the genetically modified microorganism which expresses a functional RuBisCO and PRK, and whose glycolysis pathway and the oxidative branch of the pentose phosphate pathway are at least partially inhibited, is no longer capable of producing 3PG by way of glycolysis or Ru5P by the oxidative branch of the pentose phosphate pathway. It is however able to produce Ru5P by deflecting the production of fructose-6-phosphate (F6P) and / or glyceraldehyde-3-phosphate (G3P), produced at the beginning of glycolysis (upstream of the inhibition).
- F6P fructose-6-phosphate
- G3P glyceraldehyde-3-phosphate
- transketolase EC 2.2.1.1
- transaldolase EC 2.2.1.2
- ribose-5-phosphate isomerase EC 5.3.1.6
- ribulose-5-phosphate epimerase EC 5.1.3.1
- microorganism Since the enzymes necessary for the metabolism of 3PG to pyruvate are not inhibited in the microorganism according to the invention, said microorganism can then metabolize 3PG so as to produce pyruvate and ⁇ .
- the genetically modified microorganism is able to produce pyruvate using exogenous C0 2 as a complementary carbon source.
- the genetically modified microorganism according to the invention makes it possible to increase the carbon yield, by fixing and using exogenous CO2, for the production of pyruvate (and subsequently of molecules of interest). Again, there is an increase in carbon yield.
- the genetically modified microorganism according to the invention has an Entner-Doudoroff pathway, and this pathway is at least partially inhibited.
- This pathway mainly found in bacteria (especially Gram-type), is an alternative to glycolysis and the pentose pathway for the production of pyruvate from glucose. More precisely, this pathway is connected to the pentose phosphate pathway at the ⁇ -gluconate level to supply glycolysis at the level of pyruvate in particular.
- the microorganism is genetically modified so as to inhibit the reactions of the Entner-Doudoroff pathway downstream of the production of 6-phosphogluconate.
- This Inhibition eliminates a possible competitive pathway, and ensures the availability of 6-phosphogluconate as a substrate for PRK / RuBisCO engineering.
- 6-Phosphogluconate dehydratase catalyzes the dehydration of 6-phosphogluconate to 2-keto-3-deoxy-6-phosphogluconate.
- the genes encoding 6-phosphogluconate dehydratase may be called edd (GenBank NP_416365, for example, in Escherichia coli), or ilvD (for example, in Mycobacterium sp.).
- 2-Dehydro-3-deoxy-phosphogluconate aldolase catalyzes the synthesis of a pyruvate molecule and a glyceraldehyde-3-phosphate molecule from the 2-keto-3-deoxy-6-phosphogluconate produced by the 6- phosphogluconate dehydratase.
- the genes coding for 2-dehydro-3-deoxyphosphogluconate aldolase may be called eda (GenBank NP_416364, for example, in Escherichia coli), or kdgA (for example in Thermoproteus tenax), or dgaF ( for example in Salmonella typhimurium).
- the microorganism is genetically modified so that the expression of the gene encoding 6-phosphogluconate dehydratase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
- the microorganism is genetically modified so that the expression of the gene coding for 2-dehydro-3-deoxyphosphogluconate aldolase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
- Tables 9 and 10 below list, by way of example, the sequences encoding a 6-phosphogluconate dehydratase and a 2-dehydro-3-deoxyphosphogluconate aldolase which can be inhibited depending on the target microorganism. The person skilled in the art knows which gene corresponds to the enzyme of interest to be inhibited as a function of the microorganism. Table 9: Examples of sequences coding for an EDD
- the production of pyruvate is no longer possible via the Entner-Doudoroff pathway, or at least greatly reduced.
- the microorganism is a bacterium of the genus Escherichia coli in which the expression of the edd gene is at least partially inhibited.
- the bacterium of the genus Escherichia coli is genetically modified so that the expression of gapA, and edd genes are at least partially inhibited.
- the genetically modified microorganism which expresses a functional RuBisCO and PRK, and whose pathway of glycolysis and the Entner-Doudoroff pathway are at least partially inhibited, is no longer capable of producing 3PG by the route of glycolysis or pyruvate by the Entner-Doudoroff pathway.
- the carbon flux from glucose is therefore oriented preferentially towards PRK / RuBisCO engineering.
- the genetically modified microorganism is transformed so as to produce an exogenous molecule of interest and / or to overproduce an endogenous molecule of interest.
- a molecule of interest is preferably a small organic molecule of molecular mass less than or equal to 0.8 kDa.
- the genetic modifications made to the microorganism make it possible to improve the carbon yield of the synthesis and / or bioconversion pathways of molecules of interest.
- an "improved" yield is understood in terms of the amount of finished product.
- the carbon yield corresponds in the context of the invention to the ratio of the amount of finished product / amount of fermentable sugar, especially by weight.
- the carbon yield is increased in the genetically modified microorganisms according to the invention, compared with wild microorganisms, placed under identical culture conditions.
- the carbon yield is increased by 2%, 5%, 10%, 15%, 18%, 20%, or more.
- the genetically modified microorganism according to the invention can produce a larger quantity of the molecules of interest (finished product) compared to the heterologous molecules produced by a microorganism genetically modified simply to produce or overproduce this molecule.
- the microorganism genetically can also overproduce an endogenous molecule compared to the wild-type microorganism.
- the overproduction of an endogenous molecule is mainly understood in terms of quantities.
- the genetically modified microorganism produces at least 20%, 30%, 40%, 50%, or more by weight of the endogenous molecule than the wild-type microorganism.
- the microorganism according to the invention is genetically modified so as to produce or overproduce at least one molecule among amino acids, terpenoids, terpenes, vitamins and / or precursors of vitamins, sterols, flavonoids, organic acids. polyols, polyamines, aromatic molecules obtained from stereospecific hydroxylation, via NADP-dependent cytochrome p450, etc.
- the microorganism is genetically modified to overproduce at least one amino acid, preferentially chosen from arginine, lysine, methionine, threonine, proline, glutamate, homoserine, isoleucine, valine and ⁇ -aminobutyric acid.
- the microorganism is genetically engineered to produce or overproduce terpenoid pathway molecules, such as farnesene, and the terpenes pathway.
- the microorganism is genetically modified to produce or overproduce a vitamin or a precursor, preferentially chosen from pantoate, pantothenate, transneurosporene, phylloquinone and tocopherols.
- the microorganism is genetically modified to produce or overproduce a sterol, preferably selected from squalene, cholesterol, testosterone, progesterone and cortisone.
- the microorganism is genetically modified to produce or overproduce a flavonoid, preferably selected from rambinone and vestinone.
- the microorganism is genetically modified to produce or overproduce an organic acid, preferably chosen from coumaric acid, 3-hydroxypropionic acid, citric acid, oxalic acid, succinic acid, and itaconic acid.
- an organic acid preferably chosen from coumaric acid, 3-hydroxypropionic acid, citric acid, oxalic acid, succinic acid, and itaconic acid.
- the microorganism is genetically modified to produce or overproduce a polyol, preferably selected from sorbitol, xylitol and glycerol.
- the microorganism is genetically modified to produce or overproduce a polyamine, preferentially spermidine.
- the microorganism is genetically modified to produce or overproduce an aromatic molecule from a stereospecific hydroxylation, via a NADP-dependent cytochrome p450, preferentially chosen from phenylpropanoids, terpenes, lipids, tannins, flavors, hormones.
- the genetically modified microorganism is advantageously cultured in a culture medium comprising the substrate to be converted.
- the production or overproduction of a molecule of interest by a genetically modified microorganism according to the invention is obtained by culturing said microorganism in an appropriate culture medium known to those skilled in the art.
- appropriate culture medium generally refers to a sterile culture medium providing nutrients essential or beneficial to the maintenance and / or growth of said microorganism, such as carbon sources; nitrogen sources such as ammonium sulphate; sources of phosphorus, for example, potassium phosphate monobasic; trace elements, for example, salts of copper, iodide, iron, magnesium, zinc or molybdate; vitamins and other growth factors such as amino acids or other growth promoters.
- Antifoam can be added as needed.
- this appropriate culture medium can be chemically defined or complex.
- the culture medium can thus be of identical or similar composition to a synthetic medium, as defined by Verduyn et al., (Yeast, 1992.
- the culture medium may comprise a simple carbon source, such as glucose, galactose, sucrose, molasses, or the by-products of these sugars, optionally supplemented with C0 2 as a carbon co-substrate.
- a simple carbon source such as glucose, galactose, sucrose, molasses, or the by-products of these sugars, optionally supplemented with C0 2 as a carbon co-substrate.
- the single carbon source must allow normal growth of the microorganism of interest. It is also possible in some cases to use a complex carbon source, such as lignocellulosic biomass, rice straw, or starch. The use of a complex carbon source generally requires pretreatment before use.
- the culture medium contains at least one carbon source among monosaccharides such as glucose, xylose or arabinose, disaccharides such as sucrose, organic acids such as acetate, butyrate, propionate or valerate to promote different kinds of polyhydroxyalkanoate (PHA), treated or untreated glycerol.
- monosaccharides such as glucose, xylose or arabinose
- disaccharides such as sucrose
- organic acids such as acetate, butyrate, propionate or valerate to promote different kinds of polyhydroxyalkanoate (PHA), treated or untreated glycerol.
- PHA polyhydroxyalkanoate
- any culture method allowing the production on an industrial scale of molecules of interest can be envisaged.
- the culture is done in bioreactors, especially in batch mode, fed-batch and / or continuous culture.
- the culture line associated with the production of the molecule of interest is fed-batch mode corresponding to a controlled feed into one or more substrates, for example via the addition of a concentrated solution of glucose, the concentration of which can to be between 200 gL "1 and 700 gL 1.
- a controlled vitamin supply during the process may also be beneficial to productivity (Alfenore et al., Appl Microbiol Biotechnol, 2002. 60: 67-72).
- the fermentation is generally conducted in bioreactors, with possible stages of solid and / or liquid precultures in Erlenmeyer flasks, with a suitable culture medium containing less a single carbon source and / or an exogenous CO2 input, necessary for the production of the molecule of interest.
- the culture conditions of the microorganisms according to the invention are easily adaptable by those skilled in the art, depending on the microorganism and / or the molecule to be produced / overproduced.
- the culture temperature is especially for yeasts between 20 ° C and 40 ° C, preferably between 28 ° C and 35 ° C, and more particularly about 30 ° C for S. cerevisiae.
- the culture temperature is in particular between 25 ° C and 35 ° C, preferably 30 ° C for Cupriavidus necator.
- the subject of the invention is therefore also the use of a genetically modified microorganism according to the invention, for the production or overproduction of a molecule of interest, preferentially chosen from amino acids, peptides, proteins, proteins, vitamins, sterols, flavonoids, terpenes, terpenoids, fatty acids, polyols and organic acids.
- the subject of the invention is also a biotechnological process for producing at least one molecule of interest, characterized in that it comprises a step of culturing a genetically modified microorganism according to the invention, under conditions allowing synthesis or the bioconversion, by said microorganism, of said molecule of interest, and optionally a step of recovering and / or purifying said molecule of interest.
- the microorganism is genetically modified to express at least one enzyme involved in the synthesis of said molecule of interest.
- the microorganism is genetically modified to express at least one enzyme involved in the bioconversion of said molecule of interest.
- the invention also relates to a method for producing a molecule of interest comprising (i) the insertion of at least one sequence encoding an enzyme involved in the synthesis or bioconversion of said molecule of interest in a microorganism recombinant according to the invention, (ii) the culture of said microorganism under conditions allowing the expression of said enzyme and optionally (iii) the recovery and / or purification of said molecule of interest.
- a fungus especially a filamentous fungus, such as Aspergillus niger, genetically engineered to express functional PRK and RuBisCO type I or II, and in which gene expression pgk (Gene ID: 4982539) and gsdA (Gene ID: 4979751) is at least partially inhibited.
- fungus in particular a filamentous fungus, such as Aspergillus terreus or Aspergillus niger, genetically modified to express a functional PRK and RuBisCO type I or II, and in which Expression of the pgk genes (Gene ID: 4354973) and gsdA (Gene ID: 4316232) is at least partially inhibited.
- a yeast such as a yeast of the genus Saccharomyces cerevisiae genetically modified to express a functional PRK and RuBisCO type I or II, a farnesene synthase and in which the expression of a PGK1 gene (Gene ID: 5230) is at least partially inhibited.
- a bacterium such as a bacterium of the genus Escherichia coli, genetically modified to express a functional PRK and RuBisCO type I or II, and in which the expression of the gene gapA (Gene ID: 947679) is at least partially inhibited.
- This overproduction may also occur in a strain where at least partial inhibition of the gapA gene is combined with at least partial inhibition of the zw / gene (Gene ID: 946370).
- a bacterium such as a bacterium of the genus Escherichia coli, genetically modified to express a functional PRK and RuBisCO type I or II, as well as GadB glutamate decarboxylase (Gene ID: 946058), and wherein expression of the gapA gene (Gene ID: 947679) is at least partially inhibited.
- This overproduction may also occur in a strain where at least partial inhibition of the gapA gene is combined with at least partial inhibition of the zw / gene (Gene ID: 946370).
- a bacterium such as a bacterium of the genus Escherichia coli, genetically modified to express a functional PRK and RuBisCO type I or II, and that an enzymatic activity allowing the oxidation of the glyoxylate to oxalate, preferably a glyoxylate dehydrogenase FPGLOXDH1 (mRNA: BAH29964.1), a glyoxylate oxidase GLO (mRNA: AOW73106.1), or an LDHA lactate dehydrogenase (Gene ID: 3939) and wherein the expression of gapA (Gene ID: 947679) and zwf (Gene ID: 946370) genes is at least partially inhibited.
- a bacterium such as a bacterium of the genus Escherichia coli, genetically modified to express a functional PRK and RuBisCO type I or II
- an enzymatic activity allowing the oxidation of the g
- Example 1 Bioinformatic Analysis a) Calculation of theoretical yields i) Comparison of the carbon fixation yields from glucose between a wild strain using the pentose phosphate pathway and glycolysis, and a strain modified according to the invention
- the theoretical maximum yield of pyruvate produced by the pentose phosphates is therefore 0.82 gpymvate / ggiucose (g of synthesized pyruvate, per g of glucose consumed), whereas it is 0.98 gpymvate / ggucose by the route of the pyruvate. glycolysis.
- the carbon fixation flux is redirected to the oxidative branch of the pentose phosphate pathway, then towards PRK / RuBisCO engineering (see Figure 2).
- This flow is related to the end of the glycolysis pathway, in the formation of 3-phosphoglycerate (3PG), with the following yield:
- the calculation is applied to the production of citrate in S. cerevisiae yeast, in a wild-type strain and in a strain modified according to the invention incorporating PRK / RuBisCO engineering and deleted for the PGK1 gene in a to inhibit the glycolysis pathway; and for the ZWF1 gene to inhibit the oxidative branch of the pentose pathway.
- ABF flow balance analysis
- ABF simulations were performed with the OptFlux software (Rocha et al, BMC Syst Biol, 2010 Apr 19, 4:45, 10: 1818 / 1752-0509-4-45), and the metabolic model of Saccharomyces cerevisiae MM904 (Mo et al., BMC Syst Biol 2009 Mar 25, 3:37, doi: 10.1186 / 1752-0509-3-37).
- This model has been modified to include the improvements described according to the invention, in particular a heterologous CO 2 fixation pathway with (i) addition of a PRK type reaction, (ii) addition of an RuBisCO type reaction.
- the reactions necessary to simulate the production of molecules by heterologous pathways have also been added to the model.
- a farnesene synthase-type reaction (EC 4.2.3.46 or EC 4.2.3.47) has in particular been added for the heterologous production of farnesene.
- acetoacetyl-CoA reductase (EC 1.1.1.36) and polyhydroxybutyrate synthase (EC 2.3.1.B2 or 2.3.1.B5) reactions were added to the model for simulate a heterologous ⁇ -hydroxyburyrate production pathway, the monomer of polyhydroxybutyrate.
- a reaction of glutamate decarboxylase type (EC 4.1.1.15) has been added in particular for the heterologous production of ⁇ -aminobutyric acid.
- a reaction of aconitate decarboxylase type (EC 4.1.1.6) has been added in particular for the heterologous production of itaconic acid.
- a lactate dehydrogenase-type reaction (EC 1.1.1.27) has in particular been added for the heterologous production of oxalate
- the simulations were performed by applying to the model a set of constraints reproducible by those skilled in the art, aimed at simulating the in vivo culture conditions of a strain of S. cerevisiae under the conditions described according to the invention (for example, presence of non-limiting glucose in the medium, aerobic culture condition).
- the simulations are carried out by virtually inactivating the reactions of the PGK1 enzymes (for example, glutamate, ⁇ -hydroxybutyric acid, farnesene) and ZWF1 (for example, citrate production), so as to simulate the decreases in activity of glycolysis and the pentose phosphate pathway, described according to the invention.
- the PGK1 enzymes for example, glutamate, ⁇ -hydroxybutyric acid, farnesene
- ZWF1 for example, citrate production
- Table 11 Theoretical maximum production yields evaluated by ABF on a wild strain and a strain modified according to the modifications of the patent, for the production of different molecules.
- MOIX / MOIGLUC moles of X molecule produced, relative to the moles of glucose consumed
- CMolx / CMOI G L UC Molecules of carbon of X molecule produced, relative to the moles of glucose carbon consumed
- gx / gGLuc g of molecule X products, relative to the g of glucose consumed.
- the glycolysis pathway was inactivated by deletion of the PGK1 gene. Once the glycolysis is inhibited, the yeast strain obtained is no longer able to use glucose as a source of carbon and energy. It is therefore necessary to feed the biomass synthesis routes with glycerol and energetic pathways with ethanol. Strains deleted for PGK1 are cultured on YPGE (yeast extract peptone glycerol ethanol) medium.
- the deletion of the PGK1 gene was obtained in the following manner:
- the coding phase of the G418 resistance gene derived from the KanMX cassette contained on the plasmid pUG6 (P30114-Euroscarf), was amplified with the oligonucleotides CB101 (SEQ ID No. l) and CB102 (SEQ ID NO: 2):
- the underlined part of the oligonucleotides is perfectly homologous to the Kan sequence and the rest of the sequence corresponds to the regions adjacent to the coding phase of the PGK1 gene on the genome of Saccaromyces cerevisiae so as to generate a PCR amplicon containing at the ends homologous recombination sequences of the PGK1 gene locus.
- strain CEN.PK 1605 was cultured in a volume of 50 ml YPD complex (yeast extract peptone dextrose) at 30 ° C to an optical density at 600 nm of 0.8. Cells were centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant was removed and the cells resuspended in 25 ml sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature.
- YPD complex yeast extract peptone dextrose
- the cells were resuspended in 400 ⁇ l of sterile 100 mM lithium acetate.
- a transformation mix was prepared in a 2 ml tube as follows: 250 ⁇ . 50% PEG, 10 ⁇ . DNA "carrier" 5 mg / mL, 36 1M lithium acetate, 5 or 10 ⁇ ⁇ reaction purified PCR (deletion cassette) and water to 350 ⁇ .
- the tube was centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant discarded.
- the cells were resuspended in 2 mL of YPGE (yeast extract peptone glycerol ethanol), transferred to a 14 mL tube and incubated for 2 hours at 30 ° C 200 rpm. The cells were then centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed and the cells were resuspended in 1 ml sterile water and centrifuged again for 1 minute and resuspended in 100 ⁇ l sterile water and plated on 180 ⁇ g / ml YPGE + G418.
- YPGE yeast extract peptone glycerol ethanol
- RuBisCO consumes ribulose-1.5bisP and one mole of CO 2 to form the 3-phosphoglycerate downstream of the deletion PGK1 in the glycolysis pathway.
- the yeast gene In order to produce apha-farnesene, the yeast gene lacks the alpha-farnesene synthase gene (AFS1, SEQ ID No. 71, GenBank accession number AY182241).
- the seven genes required for PRK-RuBisCO engineering were cloned on four plasmid vectors capable of replicating autonomously, with compatible origins of replication and each carrying a different complementation gene. auxotrophy or antibiotic resistance to select strains containing the three or four plasmid constructs.
- Two of these plasmids are monocopies, with an Ars / CEN origin of replication and the third is multicopy with a 2 ⁇ origin.
- strain EQ-0134 was cultured in a volume of 50 ml of complex YPGE (yeast extract peptone glycerol ethanol) complex medium at 30 ° C. The cells are centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant is removed and the cells are resuspended in 25 ml sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells are resuspended in 400 ⁇ l of sterile 100 mM lithium acetate.
- complex YPGE yeast extract peptone glycerol ethanol
- the following transformation mix is prepared 250 of 50% PEG, 10 DNA "carrier” 5 mg / mL, 36 to 1 M lithium acetate, 10 ⁇ ⁇ (3 .mu.g of one of the following combinations , pFPP45 + pFPP56 + pFPP20 or pL4 + pFPP45 + pFPP56 + pFPP20) and water at 350 ⁇ .
- YNB yeast nitrogen base including ammonium sulfate
- the final mix is spread on YNB agar medium including ammonium sulfate + CSM without LUW (leucine uracil, tryptophan) + nseothenin if necessary, with glycerol and ethanol as carbon sources.
- CSM ammonium sulfate + CSM without LUW (leucine uracil, tryptophan) + nseothenin if necessary, with glycerol and ethanol as carbon sources.
- strain CEN.PK 1605 is transformed with the following plasmid combination: pL4 + pFL36 + pCM185 + pV51TEF.
- the strain of interest is cultured on YNB + CSM-LUW medium with 10 g / l of glycerol and 7.5 g / l of ethanol, under conditions in which the expression of PRK is not induced, and presence, if any, of nseothricin. Under these conditions, it is necessary to feed the strain upstream and downstream of the deletion of the PGK1 gene.
- the strains are adapted to a minimum mineral medium free of the amino acids and nitrogen bases included in the CSM-LUW, that is only YNB with 20 g / L of glucose, nseotherothin if necessary and a exogenous CO2 supply as described above. d) Production of farnesene in Erlenmeyer flask
- Saccharomyces cerevisiae strain EQ-0253 deleted in the glycolytic pathway at the PGK1 gene, is cultured to produce farnesene by overproducing NADPH without loss of CO2, using PRK and RuBisCO.
- This strain of interest is compared with a reference strain EQ-0353 producing farnesene following the introduction of a heterologous alpha-farnesene synthase, without deletion of PGK1 or addition of PRK and RuBisCO.
- EQ-0253 (CEN.PK1605 Ap gk1: an) pL4 + pFPP56 + pFPP20 + pFPP45) and EQ-0353 (CEN.PK1605) (pL4 + pFL36 + pCM185 + pV51TEF) were grown in YNB medium with 20 g / L. of D-glucose, to which 100 ⁇ g / L of nseothricin was added.
- a preculture containing 20 ml of culture medium was inoculated with 0.05 OD 50 mm into a 250 ml baffled Erlenmeyer flask, shaken at 120 rpm for 24 h at 30 ° C in a Minitron incubator where atmosphere was regulated at 10% CO2.
- 50 ml of medium was inoculated at OD 600 nm 0.05 in a 250 ml Erlenmeyer flask and stirred, 120 rpm, 24 h at 30 ° C, 10% CO 2.
- the culture also carried out in Erlenmeyer flasks (500 ml, baffled) from the second preculture, was inoculated with 0.05 OD 50 mm in 100 ml of the same culture medium, to which 50 ⁇ g / ml was added. of ampicillin, 10 ⁇ l of antifoam (Antifoam 204, Sigma, A6426) and 10% (v / v) of dodecane (Tippman et al, Talanta (2016), 146: 100-106). The cultures were shaken at 120 rpm at 30 ° C in the presence of 10% C0 2 . Growth monitoring was performed by measuring the turbidity at 600 nm.
- the initial temperature of the oven was 70 ° C (4 min) and then gradually increased to 160 ° C (7 ° C / min) and then to 240 ° C (40 ° C / min) where it was maintained for 1.05 min.
- the transfer line and source temperatures were 250 ° C and 200 ° C, respectively.
- An external calibration comprising seven points was made from the farnesene isomer mixture (Sigma, W383902) for the quantification of -farnesene produced by the strains.
- a Rezex ROA-Organic Acid H + column (8%) 150 ⁇ 7.8 mm, with a particle size of 8 ⁇ (Phenomenex, 00H-0138-KO) was used with a 4 ⁇ 3.0 mm Carbo-H pre-column.
- the column temperature was 35 ° C and the flow rate was set at 0.5 mL / min.
- the isocratic elution was carried out with a mobile aqueous phase at 5 mM H 2 SO 4 and lasted 30 min.
- a volume of 20 ⁇ ⁇ was injected for each sample.
- the identification of the compounds was based on the comparison of the retention times with the standards.
- the external calibration comprises 10 points of variable glucose concentration (0- 20 g / L).
- the ⁇ -famesene / Gic carbon yield is calculated in gram of farnesene produced per gram of glucose consumed for the two strains EQ-0253 and EQ-0353,
- the coding phase of the hygromycin B resistance gene resulting from the hphMX cassette (loxP-pAgTEF1-hph-tAgTEF1-loxP) and contained on the plasmid pUG75 (P30671) - Euroscarf,) is amplified with the oligonucleotides Sdzwf 1 and Rdzwf 1 (Table 14). This makes it possible to generate an Azwfl PCR amplicon containing, at the ends, homologous recombination sequences of the ZWF1 glucose-6-phosphate dehydrogenase gene locus.
- AAAAG AG AAAAG AAAAAAATTG ATCTATCG ATTTC AATTCAATTC AATTTAG AAAAACTC (SEQ ID NO: 6) ATCGAGCATCAAATGAAAC
- strain CEN.PK 1605 is cultured in a volume of 50 ml of YPD (yeast extract peptone dextrose, here glucose 20 g / L) rich medium at 30 ° C. up to an optical density of 600 nm. 0.8.
- the cells are centrifuged for 5 minutes at 2500 rpm at room temperature.
- the supernatant is removed and the cells are resuspended in 25 ml sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells are resuspended in 400 ⁇ l of sterile 100 mM lithium acetate.
- ⁇ l of the resuspended cells are added to the transformation mixture and incubated at 42 ° C. for 40 minutes in a water bath. After incubation, the tube is centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant is discarded. The cells are resuspended in 2 ml YPD (yeast extract peptone dextrose) medium, transferred to a 14 ml tube and incubated for 2 hours at 30 ° C. and 200 rpm. The cells are then centrifuged for 1 minute at 5000 rpm at room temperature.
- YPD yeast extract peptone dextrose
- the supernatant is removed and the cells are resuspended in 1 ml of sterile water and centrifuged again for 1 minute and resuspended in 100 ⁇ l of sterile water and spread on YPD + Hygromycin B 200 ⁇ g / ml.
- the colonies obtained were genotyped for the validation of the deletion of the ZWF1 gene and referenced EQSC-002 (CEN.PK 1605 Azwfl: ⁇ p).
- strains EQSC-002 CEN.PK 1605 Azwfl :: hph
- CEN.PK 1605 Mowfl :: hph
- CEN.PK 1605 Moat has HIS3 leu2-3.112 trp-289 ura3-52 MAL.28c
- CEN.PK 113- 7D GenBank: JRIV00000000
- the strains EQSC-002 and CEN.PK1605 are cultured in a volume of 50 ml of rich YPD complex (yeast extract peptone dextrose, here glucose 20 g / L) at 30 ° C. up to an optical density. 600nm of 0.8.
- the cells are centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant is removed and the cells are resuspended in 25 ml of sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells are resuspended in 400 ⁇ l of sterile 100 mM lithium acetate.
- a transformation mix is prepared in a 2 ml tube as follows: 250 50% of PEG, 10 of "carrier" DNA at 5 mg / ml, 36 of 1 M lithium acetate, 10 ⁇ l, purified PCR reaction (deletion cassette) and 350 ⁇ water. 50 ⁇ l of the resuspended cells are added to the transformation mixture and incubated at 42 ° C. for 40 minutes in a water bath. After incubation, the tube is centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant is discarded.
- the cells are resuspended in 2 ml YPD (yeast extract peptone dextrose), transferred to a 14 ml tube and incubated for 2 hours at 30 ° C. and 200 rpm. The cells are then centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant is removed and the cells are resuspended in 1 ml of sterile water and centrifuged again for 1 minute and resuspended in 100 ⁇ l of sterile water and spread on YPD + Hygromycin B 200 ⁇ g / ml, 50 ⁇ g / ml nseothenicin .
- YPD yeast extract peptone dextrose
- the colonies obtained were genotyped for the validation of the deletion of the IDH1 gene and are called EQSC-003 (CEN.PK 1605 Azwfl :: hph, Mdhl :: nat) and EQSC-005 (CEN.PK 1605 Aidhl :: nat) b) Inactivation of the PGK1 gene in a haploid strain of sex sign MAT alpha
- the coding phase of the G418 resistance gene from the KanMX cassette ( ⁇ -pAgTEF1-kanMX-tAgTEF1-loxP) contained on the plasmid pUG6 (P30114) - Euroscarf is amplified with the oligonucleotides Sdpgk1 and Rdpgk1 (Table 13) making it possible to generate a pgkl PCR amplicon containing at the ends homologous recombination sequences of the PGK1 3-phosphoglycerate kin
- Strain CEN.PK 1606 (Matte HIS3 leu2-3.112 trp-289 ura3-52 MAL.28c) resulting from the commercial strain CEN.PK 113-7D (GenBank: JRIV00000000) is transformed with the PCR fragment for the inactivation of PGK1 gene.
- the strain CEN.PK 1606 is cultured in a volume of 50 ml of complex YPD (yeast extract peptone dextrose, here glucose 20g / L) rich medium at 30 ° C up to an optical density 600 nm of 0. 8.
- the cells are centrifuged for 5 minutes at 2500 rpm at room temperature.
- the supernatant is removed and the cells are resuspended in 25 ml sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells are resuspended in 400 ⁇ l of sterile 100 mM lithium acetate.
- a transformation mix is prepared in a 2 ml tube as follows: 250 50% of PEG, 10 of "carrier” DNA at 5 mg / ml, 36 of 1 M lithium acetate, 10 ⁇ l, purified PCR reaction (deletion cassette) and 350 ⁇ water.
- ⁇ l of the resuspended cells are added to the transformation mixture and incubated at 42 ° C. for 40 minutes in a water bath. After incubation, the tube is centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant is discarded.
- the cells are resuspended in 2 ml of YPGE (yeast extract peptone glycerol 20 g / l, ethanol 30 g / l), transferred to a 14 ml tube and incubated for 2 hours at 30 ° C. and 200 rpm. The cells are then centrifuged for 1 minute at 5000 rpm at room temperature.
- YPGE yeast extract peptone glycerol 20 g / l, ethanol 30 g / l
- the supernatant is removed and the cells are resuspended in 1 ml of sterile water and centrifuged again for 1 minute and resuspended in 100 ⁇ l of sterile water and spread on YPGE + 150 ⁇ , G418.
- the colonies obtained were genotyped for the validation of the deletion of the PGK1 gene and referenced EQSC-008 (CEN.PK 1605, Apgkl :: kan).
- kan is validated by growth tests on YPGE (yeast extract peptone glycerol ethanol) agar medium supplemented with G418 150 ⁇ g / mL or Hygromycin B 200 ⁇ g / mL or nseothricin 50 ⁇ g / mL.
- YPGE yeast extract peptone glycerol ethanol
- the strain obtained is referenced as EQSC-009 (CEN.PK 1607, MAT ⁇ / MAT alpha, ZWF1 / Azwfl :: hph, ⁇ / Aidhl :: nat, PGK1 / Apgk1 :: kan).
- the previously described strain EQSC-009 (CEN.PK 1607, MAT / alpha MATT, ZWF1 / Azwulf :: hph, JIH / Aidhl :: nat, PGK1 / 'Apgk1 :: kan) is grown on YPGE agar medium.
- yeast extract peptone glycerol ethanol overnight at 30 ° C.
- the cells are then placed in liquid culture in a deficient medium (Medium Sporulation, 1% potassium acetate + leucine + uracil + tryptophan) to induce the meiosis of diploid cells and thus leading to the formation of tetrads containing four haploid spores.
- a deficient medium Medium Sporulation, 1% potassium acetate + leucine + uracil + tryptophan
- Tetrads are plated on YNB.GE medium (yeast nitrogen base, glycerol, ethanol) + leucine + uracil + tryptophan + lg / L glutamic acid + methionine 20mg / L + cysteine 40mg / L and immediately dissected (using a micro-dissector) to isolate the spores on the same medium. The spores are germinated for several days at 30 ° C.
- the genetic content of the haploid cells thus obtained is tested by growth on selective media: YPGE (yeast extract peptone glycerol ethanol) supplemented with G418 150 ⁇ g / mL or hygromycin B 200 ⁇ g / mL or nseothricin 50 ⁇ g / mL and their sexual sign is tested by crossing with two strain of sex sign MAT a or MAT alpha.
- the colonies obtained are genotyped for the validation of the deletion of the genes PGK1, IDH1, ZWF1 and the absence of transcripts corresponding to these genes is validated by real-time PCR after retro-transcription of the ribonucleic acids.
- One of the obtained strain is referenced EQSC-004 (CEN.PK 1606 MAT alpha ⁇ zwfl :: hph, Aidhl :: nat, Apgklr .kan)
- PRK-RuBisCO enzymes The six genes required for PRK-RuBisCO engineering (table 15 below) are cloned on three plasmid vectors capable of autonomously replicating, with compatible origins of replication and each carrying a different auxotrophy complementation gene. to select the strains containing the three plasmid constructs (see WO 2015107496). Two of these plasmids are monocopy with an ARS / CEN origin of replication and the third is multicopy with a 2 ⁇ origin.
- the EQSC-004 strain (CEN.PK 1606 Azwfl :: hph, Aidhl :: nat, Apgkl :: kan) was cultured in a volume of 50 ml of rich YPGE complex (yeast extract peptone) medium. glycerol ethanol) at 30 ° C up to an optical density of 600 nm of 0.8. The cells are centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant is removed and the cells are resuspended in 25 ml of sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature.
- YPGE complex yeast extract peptone
- glycerol ethanol glycerol ethanol
- the cells are resuspended in 400 ⁇ l of sterile 100 mM lithium acetate.
- resuspended cells 50 ⁇ of resuspended cells are added to the transformation mix and incubated at 42 0 C for 40 minutes in a water bath. After incubation, the tube is centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant is discarded. The cells are resuspended in 2 mL YPGE (yeast extract peptone glycerol ethanol) + 2 mg / L Doxycycline, transferred to a 14 mL tube and incubated for 2 hours at 30 ° C at 200 rpm. The cells are then centrifuged for 1 minute at 5000 rpm at room temperature.
- YPGE yeast extract peptone glycerol ethanol
- the supernatant is removed and the cells are resuspended in 1 ml of sterile water and centrifuged again for 1 minute and resuspended in 100 ⁇ l of sterile water and spread on YNB.GE (yeast nitrogen base, glycerol, ethanol) + glutamic acid 1 g / L + methionine 20 mg / L + cysteine 40 mg / L + doxycycline 2 mg / L.
- the strain obtained is referenced: EQSC-006 (CEN.PK 1606 Azwfl :: hph, tddhlr.nat, Apgkl :: kan) (pFPP45 + pFPP56 + pFPP20).
- strain EQSC-005 (CEN.PK 1605 Aidhl :: nat) was cultured in a volume of 50 ml of complex YPGE (yeast extract peptone glycerol ethanol) complex at 30 ° C. 600nm optical density of 0.8.
- the cells are centrifuged for 5 minutes at 2500 rpm at room temperature.
- the supernatant is removed and the cells are resuspended in 25 ml of sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells are resuspended in 400 ⁇ l of sterile 100 mM lithium acetate.
- ⁇ l of the resuspended cells are added to the transformation mixture and incubated at 42 ° C. for 40 minutes in a water bath. After incubation, the tube is centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant is discarded. The cells are resuspended in 2 ml YPD (yeast extract peptone dextrose), transferred to a 14 ml tube and incubated for 2 hours at 30 ° C. at 200 rpm. The cells are then centrifuged for 1 minute at 5000 rpm at room temperature.
- YPD yeast extract peptone dextrose
- strains EQSC-006 and EQSC-007 to growth on YNB (yeast nitrogen base) with glucose and C0 2 .
- the batch cultures carried out in Erlenmeyer flasks are carried out with the appropriate culture medium and an exogenous CO2 supply of 10%, in a stirred incubator (120 RPM, 30 ° C.), with an inoculation at 0.05 OD 600 nm measured at using an EON spectrophotometer (BioTek Instruments).
- the strain of interest is cultured on YNB + CSM-LUW medium with 10 g / l of glycerol and 7.5 g / l of ethanol, + glutamate at 50 mg / l under conditions in which the expression of PRK no. is not induced.
- the strains are adapted to a minimum mineral medium free of all the amino acids except those indicated below, and nitrogenous bases included in the CSM-LUW, or only YNB with final concentrations. , 20 g / L glucose, 1 g / L glutamate, 40 mg / L L-cysteine and 20 mg / L L-methionine and an exogenous CO2 supply as described above. e) Production of citrate in Erlenmeyer flasks
- Saccharomyces cerevisiae strain EQSC-006 deleted in the glycolytic pathway at the PGK1 gene, in the oxidative part of pentose phosphate and in the Krebs cycle is cultured to produce citrate without loss of CO2, using PRK and a RuBisCO.
- This strain of interest is compared with a reference strain EQSC-007 producing citrate following the inactivation of the IDH1 gene, without deletion of PGK1 or ZWF1 nor addition of PRK and RuBisCO.
- EQSC-006 CEN.PK 1605 Azwfl :: p, Aidhl :: nat, Apgk1 :: k, pFPP45 + pFPP56 + pFPP20
- EQSC-007 CEN.PK 1605 Aidhl :: nat, pV51TEF + pFL36 + pCM185
- YNB Yeast Nitrogen Base
- a preculture containing 20 ml of culture medium was inoculated D06oo 0.05 nm in a baffled Erlenmeyer flask of 250 ml was put in stirring at 120 rpm at 30 ° C.
- 50 ml of medium was inoculated with 0.05 OD 50 mm into a 250 ml Erlenmeyer flask and stirred at 120 rpm at 30 ° C.
- the culture was made in Erlenmeyer flasks (500 ml, baffled) from the second preculture, inoculated with 0.05 OD 50 mm in 100 ml of the same medium, at 30 ° C, 120 rpm.
- Isocratic elution at a flow rate of 0.5 ml / min was carried out with a 0.037% (v / v) aqueous solution of formic acid whose pH was adjusted to 4.5 with ammonium hydroxide.
- the oven temperature of the column was 65 ° C.
- the conditions of analysis in mass spectrometry were: negative electrospray mode, 450 ° C source temperature, 3 kV needle voltage, 50 V cone voltage.
- An external calibration comprising seven points was carried out from a commercial solution of sodium citrate.
- a Rezex ROA-Organic Acid H + column (8%) 150 ⁇ 7.8 mm, with a particle size of 8 ⁇ (Phenomenex, 00H-0138-KO) was used with a 4 ⁇ 3.0 mm Carbo-H pre-column.
- the oven temperature for the column was 35 ° C and the flow rate was set at 0.5 mL / min.
- Isocratic elution of 30 min was carried out with a mobile aqueous phase at 5 mM H 2 SO 4.
- a volume of 20 ⁇ was injected for each sample. The identification of the compounds was based on the comparison of the retention times with the standards.
- the external calibration included 10 points of variable glucose concentration (0 to 20 g / L).
- the Ydtrate / Gic mass yield was calculated in grams of citrate produced per gram of glucose consumed for both EQSC-006 and EQSC-007, Ydtrate / GIC citrate (mg / Lacquers) strains.
- Example 4 Improvement of Glutamate Production in E. coli
- the deletion of the alpha-ketoglutarate dehydrogenase gene increases glutamate production (Usuda et al., J Biotechnol 2010 May 3; 147 (1): 17-30. doi: 10.1016 / j.jbiotec.2010.02.018).
- the strain obtained is called EQ.EC002: MG1655 AsucA b) Deletion of Voperon edd-eda coding the Entner-Doudoroff metabolic pathway
- the deletion of the edd-eda operon is carried out by homologous recombination and the use of the Quick & Easy E. coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges.
- Oligonucleotides designed to amplify an expression cassette of a FRT-PKG-gb2-neo-FRT resistance gene and having a 5 'homologous sequence on 50 nucleotides to adjacent regions of the deletion locus, i.e. ie at positions 1932065-1932115 and 1934604-1934654 on the chromosome thus generating recombination arms of the cassette on the bacterial genome on either side of the entire operon.
- the strain of Escherichia coli K-12, EQ.EC002 is transformed by electroporation with the plasmid pRedET according to the kit protocol.
- the colonies obtained are selected on rich medium complex LB agar 0.2% glucose, tetracycline 0.0003%.
- Plasmid p707-Flpe (supplied in the Quick & Easy E. coli Gene Deletion Red® kit / ET® Recombination by Gene bridges) is transformed by electroporation according to the kit protocol. The cells are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and added with 0.3% L-arabinose. Counter-selection of the clones obtained is performed by verifying that they are no longer able to grow on the same medium supplemented with kanamycin 0.0015%.
- the strain obtained is called EQ.EC003: MG1655 AsucA Aedd-eda c) Deletion of gapA gene
- the deletion of the gapA gene is carried out by homologous recombination and the use of the Quick & Easy E. coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges.
- Oligonucleotides designed to amplify an expression cassette of a FRT-PKG-gb2-neo-FRT resistance gene and having a homologous sequence on 50 nucleotides to the adjacent regions of the deletion locus, that is to say the coding phase of the gene (gapA) (GenBank: X02662.1) thus generating recombination arms of the cassette on the bacterial genome.
- the strain of Escherichia coli K-12, EQ.EC003 is transformed by electroporation with the plasmid pRedET according to the kit protocol.
- the colonies obtained are selected on rich medium complex LB agar 0.2% glucose, tetracycline 0.0003%.
- ribosome binding sequences presented in Table 19 below, with varying translation efficiencies (Levin-Karp et al, ACS Synth Biol 2013 Jun 21; 2 (6): 327-36, doi: 101021 / sb400002n, Zelcbuch et al., Nucleic Acids Res, 2013 May, 41 (9): e98) are inserted between the coding phase of each gene.
- the succession of each coding phase intercalated by an RBS sequence is constructed by successive insertions in a vector pZAl l (Expressys) which contains a PLtetO-1 promoter, a pl5A average replication origin and an ampicillin resistance gene.
- A (SEQ ID NO: 9) AGGAGGTTTGGA
- the clones are selected on LB medium supplemented with glycerol 2 g / L and pyruvate 5 g / L and with 100 mg / L ampicillin. After obtaining a sufficient quantity of biomass, cultures with a volume greater than or equal to 50 ml in a Erlenmeyer flask of at least 250 ml are inoculated in order to adapt the strain to the use of the PRK / RuBisCO engineering. This adaptation is carried out on the LB culture medium with 2 g / l of glucose, and an exogenous C0 2 feed at 37 ° C. as described above.
- the cells from 500 ml of LB culture are inoculated in 20 ml of MS medium (40 g / l glucose, 1 g / l MgSO 4 .7H 2 O, 20 g / L of (NH 4 ) 2 SO 4 , 1 g / L KH 2 PO 4 , 10 mg / L FeSO 4 .7H 2 O, 10 mg / L MnSO 4 .7H 2 O, 2 g / L of yeast, 30 g / l of CaCO 3 , 100 mg / l of ampicillin at a pressure of 0.1 C0 2 atmosphere.
- MS medium 40 g / l glucose, 1 g / l MgSO 4 .7H 2 O, 20 g / L of (NH 4 ) 2 SO 4 , 1 g / L KH 2 PO 4 , 10 mg / L FeSO 4 .7H 2 O, 10 mg / L MnSO 4 .7H 2 O, 2 g / L
- Glutamate and residual glucose are measured with an organic analyzer (Sakura seiki).
- the Y p / S carbon yield is calculated in grams of glutamate produced per gram of glucose consumed.
- the deletion of the zwf gene (GenelD: 946370) is carried out by homologous recombination and the use of the Quick & Easy E.coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges, as detailed in Example 4A. .
- the strain obtained is called EQ.ECO10: MG1655 AsucA Azwf c) Deletion of the gapA gene
- the deletion of the gapA gene in the strain of Escherichia coli K-12, EQ.ECO10 is carried out by homologous recombination and the use of the Quick & Easy E.coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges, as detailed in Example 4A].
- ribosome binding sequences shown in Table 17 (see Example 4A)
- RBSs ribosome binding sequences
- Table 17 Table 17
- variable translational efficiencies (Levin-Karp et al., ACS Synth Biol 2013 Jun 21; 2 (6): 327-36, doi: 101021 / sb400002n; Zelcbuch et al., Nucleic Acids Res. 2013 May; 41 (9): e98) are inserted between the coding phase of each gene.
- the sequence of each coding phase intercalated by an RBS sequence is constructed by successive insertions in a vector pZAl 1 (Expressys) which contains a PLtetO-1 promoter, an average replication origin pl5A and an ampicillin resistance gene.
- icfA carbonic anhydrase
- EQ.EC 014 (EQ.EC 011+ pEQECOOO): MG1655 AsucA AzwfAgapA (RuBisCO + PRK) EQ.EC 015 - »(EQ.EC 011+ pEQEC007): MG1655 AsucA Azwf AgapA (RuBisCO + PRK + Carbonic Anhydrase)
- the cells from 500 ml of LB culture are inoculated into 20 ml of MS medium (40 g / l glucose, 1 g / l MgSO 4 .7H 2 O, 20 g / l of (NH 4 ) 2 S0 4 , 1 g / L KH 2 PO 4 , 10 mg / L FeSO 4 .7H 2 O, 10 mg / L MnSO 4 .7H 2 O, 2 g / L yeast extract, 30 g / L L of CaC0 3 , 100 mg / L of ampicillin at a pressure of 0.1 C0 2 atmosphere.
- MS medium 40 g / l glucose, 1 g / l MgSO 4 .7H 2 O, 20 g / l of (NH 4 ) 2 S0 4 , 1 g / L KH 2 PO 4 , 10 mg / L FeSO 4 .7H 2 O, 10 mg / L MnSO 4 .7H 2 O, 2
- Glutamate and residual glucose are measured with a bio-analyzer (YSI Inc.).
- the Y p / S carbon yield is calculated in grams of glutamate produced per gram of glucose consumed.
- the strain obtained is called EQ.EC002: MG1655 AsucA b) Deletion of the zwf gene Deletion of the zwf gene (GenelD: 946370) is carried out by homologous recombination and the use of the Quick & Easy E. coli Gene Deletion Red® / ET® Recombination Kit Kit according to the protocol of the supplier Gene bridges, as detailed in Example 4A].
- the strain obtained is called EQ.EC010: MG1655 AsucA Azwf c) Deletion of the gapA gene
- the deletion of the gapA gene in the strain of Escherichia coli K-12, EQ.ECO10 is carried out by homologous recombination and the use of the Quick & Easy E.coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges, as detailed in Example 4A].
- the deletions are verified by genotyping and sequencing and the name of the strains obtained is:
- Table 22 genes encoding type II RuBisCO, phosphoribulokinase, carbonic anhydrase, glutamate dehydrogenase and pyruvate carboxylase.
- ribosome binding sequences shown in Table 17 (see Example 4A)
- RBSs ribosome binding sequences
- Table 17 The succession of each coding phase intercalated by an RBS sequence is constructed by successive insertions in a vector pZAl l (Expressys) which contains a PLtetO-1 promoter, a pl5A average replication origin and an ampicillin resistance gene.
- pZAl l Expressys
- pycA pyruvate carboxylase
- CA carbonic anhydrase
- CA carbonic anhydrase
- EQ.EC 017 (EQ.EC 011+ pEQEC009): MG1655 AsucA Azwf AgapA (RuBisCO + PRK + glutamate dehydrogenase + pyruvate carboxylase)
- EQ.EC 018 (EQ.EC 011+ pEQECO10): MG1655 AsucA Azwf AgapA (RuBisCO + PRK + carbonic anhydrase + glutamate dehydrogenase + pyruvate carboxylase + carbonic anhydrase)
- the cells from 500 ml of LB culture are inoculated into 20 ml of MS medium (40 g / l glucose, 1 g / l MgSO 4 .7H 2 O, 20 g / l of (NH 4 ) 2 S0 4 , 1 g / L KH 2 PO 4 , 10 mg / L FeSO 4 .7H 2 O, 10 mg / L MnSO 4 .7H 2 O, 2 g / L yeast extract, 30 g / L L of CaC0 3 , 100 mg / L of ampicillin at a pressure of 0.1 C0 2 atmosphere.
- MS medium 40 g / l glucose, 1 g / l MgSO 4 .7H 2 O, 20 g / l of (NH 4 ) 2 S0 4 , 1 g / L KH 2 PO 4 , 10 mg / L FeSO 4 .7H 2 O, 10 mg / L MnSO 4 .7H 2 O, 2
- Glutamate and residual glucose are measured with a bio-analyzer (YSI Inc.).
- the Y p / S carbon yield is calculated in grams of glutamate produced per gram of glucose consumed.
- This C. necator H16 strain has a mega plasmid pHG1 and two chromosomes. Deletion of the gapA gene is achieved by generating a vector containing the Bacillus substilis sac B suicide gene for gram negative bacteria (Quandt et al., Gene 1993 May 15; 127 (1): 15-21; Lindenkamp et al., Appl Environ Microbiol 2010 Aug; 76 (16): 5373-82 and Appl Environ Microbiol, 2012 Aug; 78 (15): 5375-83). a) Inactivation of the Entner-Doudorojf metabolic pathway
- Two PCR amplicons corresponding to the adjacent regions of the edd and eda genes are cloned by restriction according to the procedure described in Srinivasan et al. (Appl., Environ Microbiol., 2002 Dec, 68 (12): 5925-32), in the plasmid pJQ200mpl8Cm.
- the modified plasmid pJQ200mpl 8Cm is then transformed into a strain of E. coli S 17-1 by transformation by the calcium chloride method.
- the transfer of the genetic material in C. necator is done by conjugation by depositing on a plate a culture deposition point of C.
- necator on a box containing a cell layer of S 17-1 bacteria.
- the selection is done on NT medium (Nutrient browth) at 30 ° C in the presence of 10% sucrose as a selection (Hogrefe et al., Bacteriol 1984 Apr; 158 (l): 43-8) and validated on a mineral medium containing 50 ⁇ g / ml chloramphenicol.
- Two PCR amplicons corresponding to the adjacent regions of the gapA gene are cloned by restriction according to the procedure described in Lindenkamp et al. 2012, in the plasmid pjQ200mpl8Tc.
- the modified plasmid pjQ200mpl8Tc : Aga /? A is then transformed into a strain of E. coli S 17-1 by transformation by the calcium chloride method.
- the transfer of the genetic material is done by conjugation by depositing on a plate a culture deposition point of C. necator on a box containing a cell layer of S 17-1 bacteria.
- the selection is made on NT medium (Nutrient browth) at 30 ° in the presence of 10% sucrose as a selection (Hogrefe et al., J Bacteriol 1984 Apr; 158 (l): 43-8.) And validated on a medium. mineral containing 25 ⁇ g / ml tetracycline.
- EQCN_003 H16 Aedd-eda AgapA.
- the strain EQCN_003, deleted in the glycolytic pathway at the gapA gene and in the Entner Doudoroff pathway at the edd-eda genes, is cultured in order to improve the production yield of the PHB by fixing exogenous C0 2 via the use of PRK and RuBisCO enzymes. b) Production of PHB in a bioreactor
- the inoculum from a frozen stock is spread on a solid medium at a rate of 50 to 100 ⁇ ⁇ from a cryotube incubated at 30 ° C for 48 to 96 h, in the presence of fructose.
- Expression of the genes encoding RuBisCO and PRK are maintained in C. necator in aerobic heterotrophic conditions (Rie Shimizu et al., Sci Rep. 2015; 5: 11617. Published online 2015 Jul 1.).
- the strain of interest EQCN_003 improving the production yield of PHB is compared with a reference strain H16 naturally accumulating PHB under heterotrophic conditions in the presence of a nutritional limitation.
- the productivity of the strains is compared in bioreactors.
- the cultures carried out in bioreactors are inoculated from solid and / or liquid amplification chains into Erlenmeyer flasks under the conditions described above.
- the bioreactors, Mycontrol type (Applikon Biotechnology, Delft, Netherlands) of 750 ml or Biostat B (Sartorius Stedim, Goettingen, Germany) of 2.5 L, are inoculated at a density equivalent to 0.01 DO ⁇ 20nm.
- the accumulation of PHB is decoupled from growth.
- the culture is regulated at 30 ° C, aeration is between 0.1 VVM (gas volume / liquid volume / min) and 1 VVM to maintain a minimum concentration of dissolved oxygen greater than 20% (30 ° C, 1 bar), the agitation is adapted according to the scale of the bioreactor used.
- the inlet gas flow rate consists of air optionally supplemented with CO2.
- the CO2 supplementation is between 1 and 10%.
- the pH is regulated at 7 by a solution of ammonia at 14 or 7%.
- the fed-batch culture mode allows a non-limiting carbon substrate contribution associated with a phosphorus or nitrogen limitation, while maintaining a constant carbon / phosphorus or carbon / nitrogen ratio.
- the extraction and quantification of PHBs are carried out according to the method of Brandi et al. (Appl Environ Microbiol 2013 Jul; 79 (14): 4433-9).
- the protocol consists of adding 1 ml of chloroform to 10 mg of lyophilized cells, followed by addition of 850 ⁇ l of methanol and 150 ⁇ l of sulfuric acid. The mixture is heated 2.5 h at 100 ° C, cooled and 500 ⁇ of water are added. The two phases are separated by centrifugation and the organic phase is dried by the addition of sodium sulfate. The samples are filtered and analyzed as described by Millier et al. (Appl Environ Microbiol 2013 Jul; 79 (14): 4433-9). Comparing the wild C.
- An Escherichia coli strain K-12 genetically engineered to increase the yield of its glutamate production according to Example 4B] can be further modified to allow the constitutive expression of gadB glutamate decarboxylase (Gene ID: 946058) and thus increase the production yield of ⁇ -aminobutyric acid.
- gadB glutamate decarboxylase Gene ID: 946058
- alpha-ketoglutarate dehydrogenase gene also makes it possible to increase the production of glutamate (Usuda et al., J. Biotechnol, 2010 May 3, 147 (1): 17-30, doi: 10.1016 / j.jbiotec. 2010.02.018).
- the gadB gene coding phase (Gene ID: 946058) is amplified from the genome of the MG1655 AsucA strain with primers homologous to the Escherichia coli K-12 genome spanning positions 1570595 to 1570645 and 1572095 to 1572045. Each of these primers are coupled to homologous floating sequences on 18 nucleotides at the ends of the fragment obtained by amplification of the pZE21MCS vector excluding the multiple cloning site. The two amplicons are combined according to the protocol of the In-Fusion® HD Cloning Kit User Manual - Clontech kit to form the plasmid pEQEC030 allowing the constitutive overexpression of the gadB gene. b) Insertion of the engineering needed for CO2 fixation
- CDS coding sequences
- Table 24 are amplified and assembled into blocks according to the protocol provided with the NEBuilder® HiFi DNA Assembly Master Mix kit (E2321) to obtain 3 integration blocks described in
- ribosome binding sequences shown in Table 19 (Example 4B)
- variable translation efficiencies (Levin-Karp et al., ACS Synth Biol. 2013 Jun 21; 2 (6): 327-36, doi: 101021 / sb400002n; Zelcbuch et al., Nucleic Acids Res. 2013 May; 41 (9): e98) are inserted between the coding phase of each gene.
- each coding phase intercalated by an RBS sequence is constructed by successive insertions in a vector pZAl l (Expressys) which contains a PLtetO-1 promoter, a pl5A average replication origin and an ampicillin resistance gene.
- pZAl l Expressys
- GABA gamma-aminobutyrate
- EQ.EC 013 (EQ.EC 002+ pZAll + pEQ030): MG1655 AsucA + (gadB)
- EQ.EC 020 (EQ.EC 011 + pEQ030 + pEQEC006): MG1655 AsucA Azwf AgapA +
- cells from 500 ml of LB culture are inoculated into 20 ml of MS medium (40 g / l glucose, 1 g / l MgSO 4 .7H 2 O, 20 g / l of (NH 4 ) 2 S0 4 , 1 g / L KH 2 PO 4 , 10 mg / L FeSO 4 .7H 2 O, 10 mg / L MnSO 4 .7H 2 O, 2 g / L yeast extract, 30 g / L CaC0 3, 100 mg / L ampicillin and 30 mg / L kanamycin at a pressure of 0.1 atmosphere C0 2 at 30 ° C at pH 3.5.
- MS medium 40 g / l glucose, 1 g / l MgSO 4 .7H 2 O, 20 g / l of (NH 4 ) 2 S0 4 , 1 g / L KH 2 PO 4 , 10 mg / L FeSO 4 .7H 2 O, 10 mg / L
- the concentration of GABA is measured by high performance liquid chromatography (HPLC), using an OptimaPak C18 column (4.6 x 150 mm, RS tech Corporation, Daejeon, Korea). The samples are centrifuged at 12,000 rpm for 5 minutes, 100 ⁇ l of the supernatant transferred to a new Eppendorf tube. In these tubes were added the following reagents: 200 ⁇ ⁇ buffer 1 M sodium bicarbonate pH 9.8, 100 ⁇ ⁇ dansyl chloride 80 g / L in acetonitrile and 600 ⁇ ⁇ of bidistilled water. The mixture is incubated at 80 ° C. for 40 minutes. The reaction is stopped by adding 100 ⁇ ⁇ of 2% acetic acid.
- HPLC high performance liquid chromatography
- the mixture is centrifuged at 12,000 rpm for 5 minutes.
- the supernatant is then filtered through a 0.2 ⁇ Millipore filter and analyzed by HPLC on an Agilent system using a UV detector.
- Derivatized samples are separated using a binary nonlinear gradient using eluent A [tetrahydrofuran / methanol / 50mM sodium acetate pH 6.2 (5: 75: 420, by volume)] and eluent B ( methanol). Residual glucose is measured with a bio-analyzer (YSI Inc.).
- the Y p / S carbon yield is calculated in grams of GABA produced per gram of glucose consumed. This yield increases significantly by 15% for the strain EQ.EC 020 AsucA Azwf AgapA (RubisCO + PRK) + (GadB) compared with the control strains EQ.EC 013 AsucA (GadB).
- Escherichia coli strain K-12 genetically engineered to allow the constitutive expression of FGHLOXDH1 glyoxylate dehydrogenase (Gene ID: 946058) from Fomitopsis palustris, to reduce icd gene expression (Gene ID: 945702), and to inactivate the genes aceB (GenelD 948512) and sdhA (Gene ID: 945402), would increase the production yield of succinate and oxalic acid.
- FGHLOXDH1 glyoxylate dehydrogenase Gene ID: 946058
- Fomitopsis palustris to reduce icd gene expression
- aceB GenelD 948512
- sdhA Gene ID: 945402
- isocitrate dehydrogenase (icd) expression makes it possible to redirect the metabolic flow towards the glyoxylic shunt.
- aceB malate synthase
- sdhA succinate dehydrogenase
- Deletion of the succinate dehydrogenase gene enhances succinate production under aerobic conditions (Yang et al., Microbiol Res 2014 May-Jun; 169 (5-6): 432-40).
- the deletion of the malate synthase gene allows the accumulation of glyoxylate which will be converted to oxalate by the constitutive expression of glyoxylate dehydrogenase.
- a strain of Escherichia coli K-12 MG1655 whose sdhA gene has been deleted is used.
- This strain is derived from a gene deletion library (Baba et al., Mol Syst Biol., 2006; 2: 2006.0008) in Escherichia coli K-12 and provided by the Coli Genetic Stock Center under the name JW0715-2 and with the reference 8302. (JW0713-1: MG1655 AsdhA :: Kan).
- the plasmid p707-Flpe (supplied in the Quick & Easy E. coli Gene Deletion Red® kit / ET® Recombination by Gene bridges) is transformed by electroporation according to the kit protocol.
- the cells are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and added with 0.3% L-arabinose.
- a counter selection of the clones obtained is performed by verifying that they are no longer able to grow on the same medium supplemented with kanamycin 0.0015%.
- the strain obtained is called EQ.EC040: MG1655 AsdhA b) Deletion of the aceB gene
- the deletion of the aceB gene (GenelD 948512) is carried out by homologous recombination and the use of the Quick & Easy E. coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges.
- Oligonucleotides designed to amplify an expression cassette of a FRT-PKG-gb2-neo-FRT resistance gene and having a 50 nucleotide homologous sequence to adjacent regions of the deletion locus, i.e. at the positions of 4215428 to 4215478. and 4217129. to 4217079 on the chromosome thus generating recombination arms of the cassette on the bacterial genome on either side of the coding sequence of the aceB gene.
- the strain of Escherichia coli K-12, EQ.EC040 is transformed by electroporation with the plasmid pRedET according to the kit protocol.
- the colonies obtained are selected on rich medium complex LB agar 0.2% glucose, tetracycline 0.0003%.
- Plasmid p707-Flpe (supplied in the Quick & Easy E. coli Gene Deletion Red® kit / ET® Recombination by Gene bridges) is transformed by electroporation according to the kit protocol. The cells are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and added with 0.3% L-arabinose. Counter-selection of the clones obtained is carried out by verifying that they are no longer able to grow on the same medium supplemented with kanamycin 0.0015%.
- the strain obtained is called EQ.EC041: MG1655 AsdhA AaceB c) Change of the promoter of the icd gene .
- the replacement of the native promoter of the icd gene (Gene ID: 945702) by a weaker promoter is carried out by homologous recombination and the use of the Quick & Easy E. coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges . . Introduction of the weak P oxbl promoter
- the promoter of the icd gene is replaced by a cassette coupling the P 0 xbi promoter, characterized as weak, and a cassette of an antibiotic resistance gene to allow the selection of the insertion of the P ox bi cassette with gene of resistance to an antibiotic.
- Amplification of a fusion fragment using the NEBuilder® HiFi DNA Assembly Master Mix Kit (E2321) allows the substitution promoter to be associated with an antibiotic selection cassette.
- Plasmid p707-Flpe (supplied in the Quick & Easy E. coli Gene Deletion Red® kit / ET® Recombination by Gene bridges) is transformed by electroporation according to the kit protocol.
- the cells are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and added with 0.3% L-arabinose.
- Counter-selection of the clones obtained is carried out by verifying that they are no longer able to grow on the same medium supplemented with kanamycin 0.0015%.
- the strain obtained is called EQ.EC042: MG1655 AsdhA AaceB Foot :: P ox bi d) Deletion of the zwf gene
- Deletion of the zwf gene (GenelD: 946370) is carried out by homologous recombination and the use of the Quick & Easy E.coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges.
- the strain of Escherichia coli K-12, EQ.EC042 is transformed by electroporation with the plasmid pRedET according to the kit protocol.
- the colonies obtained are selected on rich medium complex LB agar 0.2% glucose, tetracycline 0.0003%.
- Plasmid p707-Flpe (supplied in the Quick & Easy E. coli Gene Deletion Red® kit / ET® Recombination by Gene bridges) is transformed by electroporation according to the kit protocol. The cells are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and added with 0.3% L-arabinose. Counter-selection of the clones obtained is performed by verifying that they are no longer able to grow on the same medium supplemented with kanamycin 0.0015%.
- the strain obtained is called EQ.EC043: MG1655 AsdhA AaceB Foot :: P ox bi Azwf e) Deletion of gapA gene
- the deletion of the gapA gene is carried out by homologous recombination and the use of the Quick & Easy E.coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges.
- Oligonucleotides designed to amplify an expression cassette of a FRT-PKG-gb2-neo-FRT resistance gene and having a 5 'homologous sequence on 50 nucleotides to the adjacent regions of the deletion locus, ie the coding phase of the gene (gapA) (GenBank: X02662.1) thus generating recombination arms of the cassette on the bacterial genome.
- the strain of Escherichia coli K-12, EQ.EC043 is transformed by electroporation with the plasmid pRedET according to the kit protocol.
- the colonies obtained are selected on rich medium complex LB agar 0.2% glucose, tetracycline 0.0003%.
- the transformation of the amplicon obtained in the first step in the presence of the recombinase RedET is induced by 0.3% arabinose in liquid LB for 1H.
- a second electroporation of the cells expressing RedET by the deletion cassette is carried out and the colonies are selected on LB agar supplemented with 0.2% glycerol and 0.3% pyruvate, 0.0003% tetracycline and added with 0.3% L-arabinose and kanamycin 0.0015. %.
- Plasmid p707-Flpe (supplied in the Quick & Easy E. coli Gene Deletion Red® kit / ET® Recombination by Gene bridges) is transformed by electroporation according to the kit protocol.
- the cells are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and added with 0.3% L-arabinose.
- a counter selection of the clones obtained is carried out by verifying that they are no longer able to grow on the same medium supplemented with kanamycin 0.0015%.
- the strain obtained is called EQ.EC044: MG1655 AsdhA AaceB Foot :: P ox bi tozwf AgapA f) Overexpression constitutive of genes FPGLOXDH1 and aceA
- CDS The coding sequences (CDS) of the genes FPGLOXDH1 (Gene ID: 946058) and aceA (Gene ID: 948517) subcloned in a bacterial expression vector pZE21MCS (EXPRESSYS) in the form of synthetic operons according to the structure described in Table 24
- This vector has a ColEl origin of replication and an antibiotic resistance gene kanamycin.
- Each of these primers is coupled to 18 nucleotide homologous floating sequences at the ends of the fragment obtained by the amplification of the pZE21MCS vector excluding the multiple cloning site.
- the two amplicons are combined according to the In-Fusion® HD Cloning Kit User Manual - Clontech protocol to form the plasmid pEQEC035 allowing constitutive overexpression of the FPGLOXDH1 and aceA genes.
- CDS coding sequences of the genes described in Table 2 are amplified and assembled in blocks according to the protocol provided with the NEBuilder® HiFi DNA Assembly Master Mix kit (E2321) so as to obtain 3 integration blocks described in Table 26. Each block is then amplified according to the In-Fusion® HD Cloning Kit User Manual - Clontech kit protocol to form the plasmids described below in Table 24.
- CDS A RBS1 CDS B RBS2 RBS3 CDS D
- ribosome binding sequences shown in Table 19 (Example 4B), having variable translational efficiencies (Levin-Karp et al, ACS Synth Biol 2013 Jun 21; 2 (6): 327-36. Doi: 10.1021 / sb400002n; Zelcbuch et al., Nucleic Acids Res. 2013 May; 41 (9): e98) are inserted between the coding phase of each gene.
- each coding phase intercalated by an RBS sequence is constructed by successive insertions in a vector pZAl 1 (Expressys) which contains a PLtetO-1 promoter, an average replication origin pl5A and an ampicillin resistance gene.
- EQ.EC045 (EQ.EC042 + pZAll + pZE21MCS): MG1655 AsdhA AaceB P icd :: P oxbl
- EQ.EC046 (EQ.EC045 + pEQEC006 + pEQEC035): MG1655 AsdhA AaceB P icd :: P oxbl Azwf AgapA + (FPGLOXDHl + aceA) + (RuBisCO + PRK)
- the cells from 500 ml of LB culture are inoculated into 20 ml of MS medium (40 g / l of glucose, 1 g / l MgSO 4 .7H 2 O, 20 g / l).
- MS medium 40 g / l of glucose, 1 g / l MgSO 4 .7H 2 O, 20 g / l.
- the concentration of succinate is measured by high performance liquid chromatography (HPLC), the culture samples are centrifuged at 12,000 g for 5 min. . Succinate dosage
- the culture supernatant is filtered through a 0.2 ⁇ Millipore filter and analyzed on an Agilent HPLC system (series 1100) equipped with a cation exchange column. (Aminex HPX87-H, Bio-Rad, Hercules, CA, USA), a UV absorbance detector (Agilent Technologies, G1315D) and a refractive index (RI) detector (Agilent Technologies, HP 1047 A).
- the samples are separated on a mobile phase of 5 mM H 2 SO 4 at a flow rate of 0.4 ml / min.
- the oven temperature of the column is 65 ° C.
- Residual glucose is measured with a bio analyzer (Ysi Inc.) or HPLC-refractometry with an Aminex HPX87-H column.
- the Y p / S carbon yield is calculated in gram of succinate produced per gram of glucose consumed.
- the pellets are washed twice with 10 mM potassium phosphate buffer (pH 7.5) containing 2 mM EDTA and stored at -20 ° C.
- Samples (1 ml) are transferred to a pre-cooled tube with 0.75 g of glass beads (425-600 ⁇ ) and introduced into a Fast Prep machine (Thermo Scientific, Erembodegem, The Netherlands) and subjected to 4 gusts of 20 seconds at the speed setting 6.
- the lysates are centrifuged for 20 min at 40 ° C. and 36,000 g. Total protein assays are performed according to Lowry's method (Lowry et al., 1951).
- the oxaloacetate acetyl hydrolase activity (EC 3.7.1.1) is measured using a modification of the direct optical determination of oxaloacetate (OAA) at 255 nm as described in (Lenz et al., 1976). The disappearance of the enol tautomer of ⁇ is monitored at 255 nm at 25 ° C. in a Hitachi model 100-60 spectrophotometer (Hitachi, Tokyo, Japan), using quartz cuvettes.
- OOA direct optical determination of oxaloacetate
- the reaction mixture of 1 ml contains 100 mM imidazole-HCl (pH 7.5), 0.9 mM MnCl 2 .2H 2 O, 1 mM OAA, 20 ⁇ l of cell extract (controls with different volumes of cell extracts confirm the linearity between the enzyme activity and the amount of cell extract).
- the reaction is started by adding the cell extract.
- the Y p / S carbon yield is calculated in grams of doxalate produced per gram of glucose consumed.
- RNA constructs i) Sequences of the guide RNAs to target the gene to be inactivated In each of these two genes, a nucleotide sequence punctuated by an NGG motif (underlined CRISPR target sequence) was determined (Table 27). In both cases, this sequence is specific to the targeted gene but also unique in the genome of Aspergillus niger. These sequences are used to express an RNAguide (gRNA) which by forming a hetero duplex with the homologous region of the genome of Aspergillus niger directs the action of the CAS9 endonuclease to induce a double strand break specifically on the chosen locus.
- gRNA RNAguide
- Plasmid pFC332 (Addgene # 87845) described in Sarkari et al. (Bioresour Technol 2017 Dec; 245 (Pt B): 1327-1333) contains an expression cassette of a gRNA, a cassette allowing the functional expression of the endonuclease Cas9 and an Hph cassette allowing the selection of this plasmid .
- the plasmid further contains the AMA1-2.8 fragment which allows transient propagation of the plasmid.
- an origin of replication for E. coli is also present.
- the gRNA cassette between FS A and FS B can be easily exchanged.
- This plasmid is modified by amplifying the different parts of this plasmid, in order to eliminate the antibiotic selection cassette and to modify the nucleotides allowing the specificity of the gRNA in favor of the sequences described in Table 27 to form the plasmids pEQ0610 for target pgkA and pEQOol 1 to target gsdA.
- the donor plasmid consists of an In-Fusion® HD Cloning Kit User Manual - Clontech assembly between the plasmid pUC19 (GenBank: M77789.2) and the genomic targeting sequences (LA and RA) of approximately 1500 bp each, homologues at the chosen location for integration.
- the LA and RA sequences are flanked 5 'and 3', respectively, of the locus sequence targeted by the ARNguide.
- the genomic DNA / RNAide heterodimer is recognized by the double-stranded cleavage Cas9 endonuclease (locus 1: pgkA, locus2: gsdA) (Table 28).
- the RA and LA fragments are amplified with the primers for the pgkA gene and the gsdA gene (Table 29).
- the sequences of the amplicons are given in the listing sequence (SEQ ID NO: 55 to SEQ ID NO: 58).
- An 18 nucleotide extension on all the forward primers of the three fragments is added according to the In-Fusion® HD Cloning Kit User Manual - Clontech protocol, in order to allow a functional assembly of the plasmids (pEQ0600 or pEQ0601) and the introduction of two restriction endonuclease sites of type II (restriction enzymes I-Ceul and I-Sce) I which have large asymmetric recognition sites (12 to 40 base pairs).
- Promoters and terminators are identified on the basis of GenBank data.
- the promoters chosen are determined from the +1 transcription point and go back 1.4Kb upstream so as to cover both the "core" sequences (TATA box) and the trans-activator sequences allowing the optimal functionality of the promoter concerned.
- the cut is performed 500 bp after the stop codon of the gene.
- each integration block of 4 expression cassettes is defined as follows: the first level comprises simple elements, namely promoters, coding sequences (CDS) and terminators.
- the promoters (CDS)
- Table 30 and terminators (Table 31), whose sequences are provided in the listing sequence (SEQ ID NO: 59-62), are amplified and assembled with the engineering CDSs according to Table 32.
- the CDSs whose sequences are provided in the listing sequence (SEQ ID NO: 63-66), are amplified according to the protocol provided with the NEBuilder® HiFi DNA Assembly Master Mix kit (E2321) to obtain the functional expression cassettes compiled in the table .
- Each 4 gene integration block is organized to include 4 different couples (promoter / terminator) in order to limit trans interference.
- Each 6-gene integration block is organized to include 6 different couples (promoter / terminator) in order to limit transcriptional interferences Donor fragment for insertion into the genome's target locus
- Table 30 Native localization of Aspergillus niger promoters used in genomic combinatorics to insert the 6 genes of CO 2 fixation engineering into the genome of Aspergillus niger.
- Table 31 Native localization of Aspergillus Niger terminators used in genomic combinatorics to insert the 6 genes of C02 fixation engineering into the genome of Aspergillus niger.
- TetrpC A AN 0648 TGATTTAATAGCTCCATGTCAAC G G GTAAACG ACTCATAG G AG AGTTG AAG nidulans (SEQ ID No. 37) (SEQ ID No. 41)
- TnaD A AN 1006 ACGGGTTCGCATAGGTTTGG G G ATATTTG ACG ACG ATTCTG AG G Nidulans (SEQ ID No. 38) (SEQ ID NO: 42)
- TgpdA A. niger An l6g01 G AATC AG G ACG G CAAACTG AAT CGTG GTCTAG CTG CCCTCC (SEQ I D
- A. niger strain CBS 513-88 is cultured at 30 ° C. in an Erlenmeyer flask with 250 ml of transformation medium (Kusters-van Someren et al., Curr Genet, 1991 Sep; 20 (4): 293-9 ). After a growth of 16 h at 250 rpm, the mycelium is harvested by filtration on Miracloth (Calbiochem) and washed with deionized water. The protoplasts are carried out in the presence of 5 gL -1 of lysing enzymes from Trichoderma harzianum (St.
- the protoplasts are washed with cold STC (1.2 M sorbitol, 10 mM Tris / HCl 50 mM CaCl 2, pH 7.5) and then resuspended in 100 ⁇ l of STC and used directly for transformation.
- cold STC 1.2 M sorbitol, 10 mM Tris / HCl 50 mM CaCl 2, pH 7.5
- the plasmid pEQ0610 is transformed with a donor fragment to integrate part of the engineering into the genome while inactivating the pgkA gene.
- the plasmid pEQ0611 is co transformed with a donor fragment to integrate the other part of the engineering into the genome while inactivating the gsdA gene.
- plasmid pCAS_pyrG2 Due to the presence of the AMA1_2.8 replication origin, the plasmid pCAS_pyrG2 is easily lost resulting in only transient expression of the Cas9 protein, thus reducing the risk of non-targeted adverse effects.
- lC ⁇ g linear cassettes and plasmid 5 .mu.g was mixed with 100 ⁇ ⁇ STC solution containing at least 10 7 protoplasts and 330 ⁇ ⁇ of polyethylene glycol (PEG) solution freshly prepared (PEG 6000 25%, CaCl 2 50 mM, Tris / 10 mM HCl pH 7.5) and kept on ice for 20 minutes. After mixing with a solution of 2 ml of additional PEG and incubating at room temperature for 10 minutes, the protoplast mixture is diluted with 4 ml of STC.
- PEG polyethylene glycol
- the transformants are selected on MM plates supplemented with 150 ⁇ g / ml hygromycin B or MM plates supplemented with Bleomycin 50 ⁇ g / ml. All transformants are purified by isolation of single colonies on the selection medium at least twice. The insertion of the fragments is verified by sequencing the target locus with the appropriate control primers.
- Fungal cell genomic DNA is isolated with a modified protocol, using the Wizard® genomic DNA purification kit (Promega, Wisconsin, USA).
- the mycelium is cultured overnight in CM (30 ° C., 150 rpm) in 290 ⁇ l of 50 mM EDTA solution and 10 ⁇ l of lyticase (10 mg / ml) to remove the cell wall. After 90 minutes of incubation at 37 ° C., the suspension is centrifuged and the supernatant is discarded.
- the mycelium pellet is resuspended in 300 ⁇ l of nucleic acid lysis solution and 100 ⁇ l of protein precipitation solution. The samples are incubated on ice for 5 minutes and centrifuged.
- the DNA is precipitated with isopropanol and washed with 70% ethanol.
- the DNA pellet is rehydrated with a DNA rehydration solution containing RNase (100 ⁇ g / ml). The successful transformation and integration of the expression cassettes was verified by PCR.
- Niger GSDA : p PmbfA -RbcL-trpC; PcoxA p RbcS-Tnia D; picdA p -H ph-TgpdA;
- gsdA PmbfAp-RbcL-trpc; PcoxA p RbcS-Tnia D; picdAp-H ph-TgpdA;
- CBS 513-88 pgkA : Pm bfA p -GrES-trpc; PcoxA p -G roEL-Tnia D; picdA p -Ble-TgpdA;
- PsrpB p -PRK-glaAt Conidia (10 8 .L _1 ) from strains EQ1500 and EQ1502 are inoculated and cultured at 30 ° C. on a rotary shaker (180 rpm) in shake flasks containing Vogel's medium without MnSO 4 with a total content in glucose of 15% and a total nitrogen content of 0.2% and 10% CO2.
- the determination of glucose and organic acids was carried out as previously described (Blumhoff et al, 2013, Steiger et al., 2016) on an HPLC (Shimadzu, Kyoto, Japan) equipped with an Aminex HPX-87 H column (300 x 7.8 mm, BioRad, Hercules, CA).
- a refractive index detector (RID-10A, Shimadzu) is used for the detection of glucose and citric acid, while a PDA detector (SPD-M20A, Shimadzu) at 300 nm is used to detect the cis-aconitic and trans-aconitic acid.
- the column is used at 60 ° C. at a flow rate of 0.6 ml / min and with an aqueous solution of 0.004 M H 2 SO 4 as a mobile phase. The culture was performed in three biological replicates. d) Analytical method
- a culture sample is centrifuged at 14,000 xg for 5 min.
- the supernatant is filtered through a filter having a pore size of 0.45 ⁇ m.
- the filtrate is maintained at -20 ° C. until analysis.
- the concentration of citrate and oxalate is detected and quantified with ultraviolet light at 210 nm using an Amethyst C18-H column (250 x 4.6 mm, Sepax Technologies, Newark, DE, USA). Elution is carried out at 30 ° C. with 0.03% H 3 PO 4 at a flow rate of 0.8 ml / min. Reducing sugar is detected with the 3,5-dinitrosalicylic acid method.
- Determination of the biomass 5 ml of sample are filtered through Miracloth (Calbiochem, San Diego, CA, USA) to collect the hyphae and washed with distilled water. The hyphae are heated to 105 ° C in a "Miracloth". To calculate the cell dry weight (DCW), the Miracloth weight is measured previously and deducted from the total weight to generate the net weight, then the net weight per unit volume is calculated as DCW. After a complete analysis, the comparison of the yield of citric acid production as a function of the glucose consumption is 18% greater in the EQ1502 engineered strain compared to the EQ1500 wild type strain.
- RNAguide RNA guide
- the sequence identified in the second intron the first 20 nucleotides have a unique pattern in the genome, even allowing 2 mismatches.
- the sequence identified in the fourth intron the first 20 nucleotides have a unique pattern in the genome, even allowing 2 mismatchs.
- Table 35 Target Sequence for ARNguide
- Plasmid pFC332 (Addgene # 87845) described in Sakari et al. (Bioresour technol 2017, 245 (Pt B): 1327-1333) contains a gRNA expression cassette, a cassette allowing the functional expression of the Cas9 endonuclease and an Hph cassette allowing the selection of this plasmid.
- the plasmid further contains the AMA1-2.8 fragment which allows transient propagation of the plasmid.
- an origin of replication for E. coli is also present.
- the gRNA cassette between FS A and FS B can be easily exchanged.
- this plasmid is modified by amplifying the different parts of this plasmid in order to eliminate the antibiotic selection cassette and to modify the nucleotides allowing the specificity of the gRNA in favor of the sequences described in FIG. Table 35 to form the plasmids pEQ0615 to target pgkA and pEQ0616 to target gsdA in the Aspergillus terreus genome.
- the donor plasmid consists of an In-Fusion® HD Cloning Kit User Manual - Clontech assembly between the plasmid pUC19 (GenBank: M77789.2) and genomic targeting sequences (LA and RA) of about 1500 bp each homologous to the locus chosen for integration.
- the LA and RA sequences are flanked 5 'and 3', respectively, of the locus sequence targeted by the ARNguide.
- the genomic DNA / RNA hybrid heterodimer is recognized by the double-stranded cleavage Cas9 endonuclease (locus 1: pgkA, locus2: gsdA) (Table 35).
- the RA and LA fragments are amplified with the primers described in Table 36 for the pgkA gene and in Table 37 for the gsdA gene.
- the sequences of the amplicons are in the listing sequence (SEQ ID Nos. 67 to 70).
- Promoters and terminators are identified on the basis of GenBank data.
- the promoters chosen are determined from the +1 transcription point and go back 1.4Kb upstream so as to cover both the "core" sequences (TATA box) and the trans-activator sequences allowing the optimal functionality of the promoter concerned.
- the cut is performed 500 bp after the stop codon of the gene.
- each integration block of 4 expression cassettes is defined as follows: the first level comprises simple elements, namely promoters, coding sequences (CDS) and terminators.
- the promoters (CDS)
- Table 31 are amplified and assembled with the engineering CDS according to Table 32.
- the CDS are amplified according to the protocol provided with the NEBuilder® HiFi DNA Assembly Master Mix Kit (E2321) to obtain the expression cassettes functionalities compiled in the table.
- Each 4 gene integration block is organized to include 4 different terminator promoter pairs in order to limit trans interferences.
- Each 6 gene integration block is organized to include 6 different terminator promoter pairs so as to limit transcriptional interferences.
- the different multiple expression cassettes (RbcS, RbcL and RbcX or GroES, GroEL and PRK are amplified and assembled around an antibiotic selection cassette (Table 38), according to the In-Fusion® HD Cloning Kit User Manual protocol. - Clontech, to form the donor plasmids (pEQ0606 or pEQ0607).
- Transformation of the DNA to Aspergillus terreus was performed according to the strategy applied for Aspergillus niger (Example 8) using A. terreus strain NIH262.
- ⁇ contains 0.8 g of KH 2 PO 4 , 3 g of NH 4 NO 3 , 1 g of MgSO 4 . 7H20, 5 g of CaCl 2 .2 H 2 0, 1.67 mg of FeCl 3 .6H 2 0, 8 mg of ZnSO 4 .7H 2 O and 15 mg of CuSO 4 .7H 2 O per liter.
- Culturing is carried out under stirring with 25 ml of medium in Erlenmeyer flasks 125 ml at 33 ° C in a rotary shaker at 200 rpm for 7-10 days in an environment of 10% C0 2.
- the pH is not controlled during the fermentation and the shaking of the flasks is maintained during the fermentation. sampling for time studies to ensure a continuous supply of oxygen.All experiments are performed in triplicate.
- Medium posers are obtained from Sigma Chemical, St. Louis, Missouri.
- each sugar was dissolved in deionized water and passed through a column (440 x 45 mm) of Dowex 50-X8 cation exchange resin (100/200 mesh) (Bio-Rad Laboratories, Hercules, CA) to remove manganese, if any.
- d) Analytical procedures The concentration of the cell mass is determined from the dry weight of the cells. The cell mass present in the fermentation broth is harvested by centrifugation at 10,000 g for 10 minutes and rinsed thoroughly three times with deionized water. The rinsed cell mass was thoroughly dried at 80 ° C until a constant weight was obtained. The fermentation broth after centrifugation (10,000 g, 10 min) is stored at -20 ° C.
- the Aminex HPX 87P column is maintained at 85 ° C and the glucose is eluted with Milli-Q acidified deionized water (Millipore, Bedford, MA) at a flow rate of 0.6 ml min -1 .
- the Aminex HPX 87H column is maintained at 65 ° C. and the sugars and organic acids are eluted with 5 mM H 2 SO 4 prepared using Milli-Q deionized filtered water at a flow rate of 0.5 ml min -1 .
- ppb level is determined using an Optima 7000DV Optima 7000DV inductively coupled plasma (ICP-OES) spectrometer from Perkin-Elmer (Waltham, MA) by the procedure described by Bakota et al (Eur J Lipid Sci Technol., 2015; 117: 1452-1462.
- ICP-OES Optima 7000DV inductively coupled plasma
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR1750694A FR3062394B1 (fr) | 2017-01-27 | 2017-01-27 | Microorganisme genetiquement optimise pour la production de molecules d'interet |
PCT/EP2018/052005 WO2018138289A1 (fr) | 2017-01-27 | 2018-01-26 | Microorganisme génétiquement optimisé pour la production de molécules d'intérêt |
Publications (1)
Publication Number | Publication Date |
---|---|
EP3574083A1 true EP3574083A1 (fr) | 2019-12-04 |
Family
ID=59070757
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP18702647.1A Pending EP3574083A1 (fr) | 2017-01-27 | 2018-01-26 | Microorganisme génétiquement optimisé pour la production de molécules d'intérêt |
Country Status (8)
Country | Link |
---|---|
US (2) | US20200277592A1 (fr) |
EP (1) | EP3574083A1 (fr) |
JP (2) | JP7240329B2 (fr) |
KR (1) | KR102643557B1 (fr) |
CN (1) | CN110678541A (fr) |
BR (1) | BR112019015458A2 (fr) |
FR (1) | FR3062394B1 (fr) |
WO (1) | WO2018138289A1 (fr) |
Families Citing this family (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2016511639A (ja) * | 2013-02-22 | 2016-04-21 | テフニスヘ ユニヴェルシテイト デルフト | 生産物の収量を高める方法で使用される組み換え微生物 |
US10689670B2 (en) * | 2016-06-14 | 2020-06-23 | Dsm Ip Assets B.V. | Recombinant yeast cell |
JP6917434B2 (ja) * | 2019-10-25 | 2021-08-11 | 長瀬産業株式会社 | 好気性菌の代謝酵素破壊株およびその培養法 |
CN112852664B (zh) * | 2021-01-14 | 2022-07-15 | 西华大学 | 一种酿酒酵母以及提高酿酒酵母产γ-氨基丁酸的方法 |
CN112941061B (zh) * | 2021-03-19 | 2021-09-07 | 中国农业大学 | 一种Tk-Rubisco突变体、线性组装材料及其制备方法和应用 |
CN114164237B (zh) * | 2021-11-04 | 2023-03-17 | 山东阜丰发酵有限公司 | 一种生产琥珀酸的方法 |
CN114181879B (zh) * | 2021-12-09 | 2022-11-22 | 中国科学院深圳先进技术研究院 | 具有自养能力的底盘细胞及其构建方法和应用 |
CN115851779B (zh) * | 2022-10-29 | 2024-03-26 | 昆明理工大学 | 一种葡萄糖-6-磷酸脱氢酶基因RkZWF1及其应用 |
CN117210446A (zh) * | 2023-03-21 | 2023-12-12 | 北京蓝晶微生物科技有限公司 | 一种重建卡尔文循环提高异养微生物代谢产物产量的方法 |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2002529079A (ja) * | 1998-11-10 | 2002-09-10 | マキシジェン, インコーポレイテッド | 改変されたリブロース1,5−ビスホスフェートカルボキシラーゼ/オキシゲナーゼ |
US7826975B2 (en) | 2002-07-10 | 2010-11-02 | The Penn State Research Foundation | Method for redesign of microbial production systems |
WO2009036095A1 (fr) * | 2007-09-10 | 2009-03-19 | Joule Biotechnologies, Inc. | Organismes collecteurs de lumière synthétisés par génie génétique |
FR3016371B1 (fr) | 2014-01-16 | 2018-02-02 | Institut National De La Recherche Agronomique | Levures modifiees pour utiliser le dioxyde de carbone |
US10294482B2 (en) * | 2014-05-22 | 2019-05-21 | Yeda Research And Development Co. Ltd. | Recombinant microorganisms capable of carbon fixation |
-
2017
- 2017-01-27 FR FR1750694A patent/FR3062394B1/fr active Active
-
2018
- 2018-01-26 KR KR1020197024086A patent/KR102643557B1/ko active IP Right Grant
- 2018-01-26 BR BR112019015458-2A patent/BR112019015458A2/pt unknown
- 2018-01-26 WO PCT/EP2018/052005 patent/WO2018138289A1/fr unknown
- 2018-01-26 JP JP2019561349A patent/JP7240329B2/ja active Active
- 2018-01-26 EP EP18702647.1A patent/EP3574083A1/fr active Pending
- 2018-01-26 CN CN201880021659.1A patent/CN110678541A/zh active Pending
- 2018-01-26 US US16/480,569 patent/US20200277592A1/en not_active Abandoned
-
2022
- 2022-01-12 US US17/573,877 patent/US12018300B2/en active Active
- 2022-11-14 JP JP2022182031A patent/JP2023011947A/ja active Pending
Also Published As
Publication number | Publication date |
---|---|
BR112019015458A2 (pt) | 2020-03-31 |
JP7240329B2 (ja) | 2023-03-15 |
US20200277592A1 (en) | 2020-09-03 |
FR3062394B1 (fr) | 2021-04-16 |
WO2018138289A1 (fr) | 2018-08-02 |
KR20190115447A (ko) | 2019-10-11 |
JP2023011947A (ja) | 2023-01-24 |
CN110678541A (zh) | 2020-01-10 |
JP2020506723A (ja) | 2020-03-05 |
US20220348897A1 (en) | 2022-11-03 |
FR3062394A1 (fr) | 2018-08-03 |
US12018300B2 (en) | 2024-06-25 |
KR102643557B1 (ko) | 2024-03-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US12018300B2 (en) | Genetically optimised microorganism for producing molecules of interest | |
US10006065B2 (en) | Microbial engineering for the production of fatty acids and fatty acid derivatives | |
EP1680504B1 (fr) | Souches de microorganismes optimisees pour des voies de biosynthese consommatrices de nadph | |
US9862977B2 (en) | Engineered microbes and methods for microbial oil production | |
EP3574082A1 (fr) | Microorganisme génétiquement optimisé pour la production de molécules d'intérêt | |
US11142770B2 (en) | Isolated oleaginous yeast | |
US9879248B2 (en) | Engineered microbes and methods for microbial oil overproduction from cellulosic materials | |
KR20120108538A (ko) | 말로닉 세미알데히드 환원 경로를 이용한 3-하이드록시프로피온산의 생산방법 | |
WO2019185861A1 (fr) | Microorganisme modifié à activité rubisco améliorée | |
EP4330399A1 (fr) | Cellules de levure génétiquement modifiées et procédés d'utilisation pour augmenter le rendement lipidique | |
CN117940571A (zh) | 重组酵母细胞 | |
BE1021047B1 (fr) | Actinobacillus succinogenes genetiquement modifiee et son utilisation pour la production d'acide succinique |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
17P | Request for examination filed |
Effective date: 20190719 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
AX | Request for extension of the european patent |
Extension state: BA ME |
|
DAV | Request for validation of the european patent (deleted) | ||
DAX | Request for extension of the european patent (deleted) | ||
19U | Interruption of proceedings before grant |
Effective date: 20211207 |
|
19W | Proceedings resumed before grant after interruption of proceedings |
Effective date: 20221004 |
|
RAP3 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: EPPEN EUROPE |