EP3574083A1 - Genetically optimised microorganism for producing molecules of interest - Google Patents

Abstract

The invention relates to a genetically modified microorganism expressing a functional type I or II RuBisCO enzyme and a functional phosphoribulokinase (PRK), and in which the glycolysis pathway is at least partially inhibited, said microorganism being genetically modified such that it produces an exogenous molecule and/or overproduces an endogenous molecule. According to the invention, the oxidative branch of the pentose phosphate pathway can also be at least partially inhibited. The invention further relates to the use of such a genetically modified microorganism for producing or overproducing a molecule of interest, and to methods for the synthesis or bioconversion of molecules of interest.

Description

 Microorganism genetically optimized for the production of molecules of interest

Field of the invention

The invention relates to a genetically modified microorganism capable of using carbon dioxide as an at least partial carbon source for the production of molecules of interest. More particularly, the invention relates to a microorganism in which at least the glycolysis pathway is at least partially inhibited. The invention also relates to processes for the production of at least one molecule of interest using such a microorganism.

STATE OF THE ART For several years, numerous microbiological processes have been developed to enable the production of molecules of interest in large quantities.

Thus, fermentation processes are used to cause molecules to be produced by a microorganism from a fermentable carbon source, such as glucose.

Bioconversion processes have also been developed, to allow a microorganism to convert a co-substrate, not assimilable by said microorganism, into a molecule of interest. Here again, a source of carbon is necessary, not for the actual production of the molecule of interest, but for the production of cofactors, and more particularly of NADPH, which may be necessary for bioconversion. In general, the production yield by such microbiological processes is low mainly because of cofactor requirements and the difficulty of balancing the redox metabolic reactions. There is also the problem of the cost price of such molecules, since a carbon source that can be assimilated by the microorganism is always necessary. In other words, currently to produce a molecule of interest with a microbiological process, it is necessary to provide a molecule (glucose, or other), certainly of less industrial value, but which is sufficient to make the production of certain molecules not economically attractive.

In parallel, carbon dioxide (CO ₂ ), whose emissions to the atmosphere are increasing, is little or no use in current microbiological processes, while its consumption by microorganisms for the production of carbon dioxide molecules. interest would not only reduce production costs, but also respond to certain ecological issues. There is therefore still a need for microbiological processes to allow the production of molecules of interest in large quantities and with lower cost compared with current processes.

SUMMARY OF THE INVENTION The advantage of using genetically modified non-photosynthetic microorganisms to capture C0 ₂ and use it as a primary carbon source, as well as photosynthetic plants and microorganisms has already been demonstrated. Thus, microorganisms modified to express a functional RuBisCO (Ribulose-1,5-bisphosphate carboxylase / oxygenase-EC 4.1.1.39) and a PRK (phosphoribulokinase-EC 2.7.1.19) so as to reproduce a partial Calvin cycle and convert ribulose-5-phosphate into two molecules of 3-phosphoglycerate by capturing a molecule of carbon dioxide were developed.

By working on the solutions provided by the Calvin cycle to produce molecules of interest using CO2 as a carbon source, the inventors have discovered that it is possible to increase the production yield of molecules of interest by coupling part of the Calvin cycle (PRK / RuBisCO) to at least partial inhibition of glycolysis. The inventors have also discovered that it is possible to increase the exogenous CO2 consumption during the production of molecules of interest, while also at least partially inhibiting the oxidative branch of the pentose phosphate pathway. The microorganisms thus developed make it possible to produce on a large scale and with an industrially interesting yield a large number of molecules of interest, such as amino acids, organic acids, terpenes, terpenoids, peptides, fatty acids, polyols, etc.

The subject of the invention is therefore a genetically modified microorganism expressing a functional RuBisCO enzyme and a phosphoribulokinase (PRK), and in which the glycolysis pathway is at least partially inhibited, said microorganism being genetically modified so as to produce an exogenous molecule of interest and / or overproducing an endogenous molecule of interest, other than the enzyme RuBisCO or phosphoribulokinase.

In a particular embodiment, the genetically modified microorganism has an oxidative branch of the pentose phosphate pathway also at least partially inhibited.

The invention also relates to the use of a genetically modified microorganism according to the invention, for the production or overproduction of a molecule of interest, preferentially chosen from amino acids, peptides, proteins, vitamins, sterols, flavonoids, terpenes, terpenoids, fatty acids, polyols and organic acids.

The present invention also relates to a biotechnological process for producing or overproducing at least one molecule of interest, characterized in that it comprises a step of culturing a genetically modified microorganism according to the invention, under conditions allowing the synthesis or the bioconversion, by said microorganism, of said molecule of interest, and optionally a step of recovering and / or purifying said molecule of interest. It also relates to a method for producing a molecule of interest comprising (i) the insertion of at least one sequence coding for an enzyme involved in the synthesis or bioconversion of said molecule of interest in a recombinant microorganism according to the invention (ii) culturing said microorganism under conditions permitting the expression of said enzyme and optionally (iii) recovering and / or purifying said molecule of interest.

Description of figures

Figure 1: General scheme of glycolysis, the pentose phosphate pathway and Entner-Doudoroff pathway;

Figure 2: Schematic representation of the inhibition of the glycolysis pathway, according to the invention;

Figure 3: Schematic representation of the inhibition of the glycolysis pathway, combined with the inhibition of the oxidative branch of the pentose phosphate pathway, according to the invention.

Detailed description of the invention

Definitions The terms "recombinant microorganism", "modified microorganism" and "recombinant host cell" are used interchangeably herein and refer to microorganisms that have been genetically engineered to express or overexpress endogenous nucleotide sequences to express heterologous nucleotide sequences. or that have an alteration of the expression of an endogenous gene. "Alteration" means that the expression of the gene, or level of an RNA molecule or equivalent RNA molecules encoding one or more polypeptides or polypeptide subunits, or the activity of one or more polypeptides or polypeptide subunits is regulated, such that the expression, level, or activity is greater or less than that observed in the absence of modification.

It is understood that the terms "recombinant microorganism", "modified microorganism" and "recombinant host cell" refer not only to the particular recombinant microorganism, but to the progeny or potential progeny of such a microorganism. As some changes may occur in subsequent generations because of mutation or environmental influences, this offspring may not be identical to the parent cell, but is still included in the term as used here. In the context of the invention, an at least partially "inhibited" or "inactivated" metabolic pathway refers to an altered metabolic pathway, which can no longer proceed properly in the microorganism in question, compared to the same wild-type microorganism (not genetically modified to inhibit said metabolic pathway). In particular, the metabolic pathway can be interrupted, resulting in the accumulation of an intermediate metabolite. Such an interruption can be obtained for example by inhibition of the enzyme necessary for the degradation of an intermediate metabolite of the metabolic pathway in question and / or by inhibition of the expression of the gene coding for this enzyme. The metabolic pathway can also be attenuated, that is, slowed down. Such attenuation can be obtained for example by partial inhibition of one or more enzymes involved in the metabolic pathway and / or by partial inhibition of the expression of a gene coding for at least one of these enzymes and / or by playing cofactors needed for some reactions. The expression "at least partially inhibited metabolic pathway" means that the level of the metabolic pathway considered is reduced by at least 20%, more preferably at least 30%, 40%, 50%, or more, compared to the level in a wild microorganism. The reduction can be greater, and in particular be at least greater than 60%, 70%, 80%, 90%. According to the invention, the inhibition may be complete, in that the metabolic pathway considered is not used at all by the said microorganism. According to the invention, such an inhibition can be temporary or permanent.

According to the invention, the expression "inhibition of the expression of a gene" is understood to mean that said gene is no longer expressed in the microorganism in question or that its expression is reduced, compared with the wild-type microorganism (which is not genetically modified to inhibit the formation of a particular gene). expression of the gene), leading to the absence of production of the corresponding protein or to a significant decrease in its production, and in particular to a decrease of greater than 20%, more preferably 30%, 40%, 50%, 60%, 70%, 80%, 90%. In one embodiment, the inhibition can be complete, that is to say that the protein encoded by said gene is no longer produced at all. The inhibition of the expression of a gene can in particular be obtained by deletion, mutation, insertion and / or substitution of one or more nucleotides in the gene under consideration. Preferentially, the inhibition of the expression of the gene is obtained by total deletion of the corresponding nucleotide sequence. According to the invention, any method of inhibition of a gene, known per se by those skilled in the art and applicable to a microorganism may be used. For example, inhibition of gene expression can be achieved by homologous recombination (Datsenko et al., Proc Natl Acad Sci US A 2000; 97: 6640-5; Lodish et al., Molecular Cell Biology 4 ^th ed 2000. WH Freeman and Company, ISBN 0-7167-3136-3); random or directed mutagenesis to alter the expression of a gene and / or the activity of the encoded protein (Thomas et al., Cell 1987; 51: 503-12); modification of a promoter sequence of the gene to alter its expression (Kaufmann et al, Methods Mol Biol 2011; 765: 275-94, doi: 10.1007 / 978-1-61779-197-0_16); targeting induces local lesions in genomes (TILLING); conjugation, etc. Another particular approach is gene inactivation by insertion of a foreign sequence, for example by transposon mutagenesis using mobile genetic elements (transposons), of natural or artificial origin. According to another preferred embodiment, the inhibition of the expression of the gene is obtained by knockout techniques. Inhibition of gene expression can also be achieved by gene silencing using interfering, ribozyme or antisense RNAs (Daneholt, 2006. Nobel Prize in Physiology or Medicine). In the context of the present invention, the term "interfering RNA" or "RNAi" refers to any RNAi molecule (e.g. single-stranded RNA or double-stranded RNA) that can block expression of a target gene and / or facilitate degradation. corresponding mRNA. Inhibition of the gene can also be achieved by genomic editing methods that allow direct genetic modifications to a given genome via the use of zinc finger nucleases (Kim et al., PNAS; 93: 1156). 1160), effector nucleases of the transcriptional activator type, called "TALEN" (Ousterout et al., Methods Mol Biol 2016, 1338: 27-42, doi: 10.1007 / 978-1-4939-2932-0_3), a system combining Cas9-like nucleases with short, regularly spaced, pooled palindromic repeats called CRISPR (Mali et al, Nat Methods, 2013 Oct; 10 (10): 957-63, doi: 10.1038 / nmeth.2649) or meganucleases (Daboussi et al., Nucleic Acids Res., 2012 40: 6367-79). Inhibition of gene expression can also be achieved by inactivation of the protein encoded by said gene.

By "NADPH-dependent" or "NADPH-consuming" biosynthesis or bioconversion is meant in the context of the invention all the biosynthetic or bioconversion pathways in which one or more enzymes require the concomitant addition of electrons obtained. by the oxidation of an NADPH cofactor. Routes of biosynthesis or bioconversion "NADPH-dependent" relate in particular to the synthesis of amino acids (eg arginine, lysine, methionine, threonine, proline, glutamate, homoserine, isoleucine, valine) γ-aminobutyric acid, terpenoids and terpenes (eg farnesene), vitamins and precursors (eg pantoate, pantothenate, transneurosporene, phylloquinone, tocopherols), sterols (eg squalene, cholesterol, testosterone, progesterone, cortisone), flavonoids (eg frambinone, vestinone), organic acids (eg citric acid, succinic acid) oxalic acid, itaconic acid, coumaric acid, 3-hydroxypropionic acid), polyols (eg sorbitol, xylitol, glycerol), polyamines (eg spermidine), aromatic molecules from a stereospecific hydroxylation, via a cytochrome p450 NADP -dependent (eg phenylpropanoids, terpenes, lipids, tannins, flavors, hormones).

The term "exogenous" as used herein with reference to various molecules (nucleotide sequences, peptides, enzymes, etc.), refers to molecules that are not normally or naturally found in and / or produced by the microorganism of interest. Conversely, the term "endogenous" or "native" in reference to various molecules (nucleotide sequences, peptides, enzymes, etc.), refers to molecules that are normally or naturally found in and / or produced by the microorganism under consideration.

microorganisms

The invention provides genetically modified microorganisms for the production of a molecule of interest, endogenous or exogenous. By "genetically modified" microorganism is meant that the genome of the microorganism has been modified so as to integrate a nucleic sequence encoding an enzyme involved in the biosynthetic pathway or bioconversion of a molecule of interest, or encoding a biologically active fragment of it. Said nucleic sequence may have been introduced into the genome of said microorganism or one of its ascendants, by means of any suitable molecular cloning method. In the context of the invention, the genome of the microorganism refers to all the genetic material contained in said microorganism, including the extrachromosomal genetic material contained for example in plasmids, episomes, synthetic chromosomes, etc. The nucleic acid sequence introduced may be a heterologous sequence, that is to say one that does not exist in the natural state in said microorganism, or a homologous sequence. Advantageously, a transcriptional unit containing the nucleic sequence of interest placed under the control of one or more promoter (s) is introduced into the genome of the microorganism. Such a transcriptional unit also advantageously comprises the usual sequences such as transcriptional terminators and, if appropriate, other transcriptional regulation elements. Promoters useful in the context of the present invention include constitutive promoters, i.e., promoters that are active in most cellular states and environmental conditions, as well as inducible promoters that are activated or repressed by exogenous physical or chemical stimuli. thus inducing a variable level of expression depending on the presence or absence of these stimuli. For example, when the microorganism is a yeast, it is possible to use a constitutive promoter, such as that of a gene among TEF1, TDH3, PGI1, PGK, ADH1. Examples of inducible promoters that can be used in yeast are the tetO-2, GAL10, GAL10-CYC1 and PHO5 promoters.

In general, the genetically modified microorganism according to the invention has the following characteristics:

Expression of a functional RuBisCO (EC 4.1.1.39);

 Expression of a functional PRK (EC 2.7.1.19);

 At least partial inhibition of glycolysis; and

 Expression of at least one gene involved in the synthesis and / or bioconversion of a molecule of interest, and / or inhibition of at least one gene coding a competing activity for the synthesis and / or bioconversion of a molecule interest.

According to the invention, any microorganism can be used. Preferentially, the microorganism is a eukaryotic cell, preferably chosen from yeasts, fungi, microalgae or a prokaryotic cell, preferably a bacterium or cyanobacterium. In one embodiment, the genetically modified microorganism according to the invention is a yeast, preferably chosen from ascomycete yeasts (Spermophthomceae and Saccharomycetaceae), basidiomycete yeasts (Leucosporidium, Rhodosporidium, Sporidiobolus, Filobasidium, and Filobasidiella) and deuteromycete yeasts belonging to the yeast. with Fungi imperfecti (Sporobolomycetaceae, and Cryptococcaceae). Preferentially, the genetically modified yeast according to the invention belongs to the genus Pichia, Kluyveromyces, Saccharomyces, Schizosaccharomyces, Candida, Lipomyces, Rhodotorula, Rhodosporidium, Yarrowia, or Debaryomyces. More preferably, the genetically modified yeast according to the invention is chosen from among Pichia pastoris, Kluyveromyces lactis, Kluyveromyces marxianus, Saccharomyces cerevisiae, Saccharomyces carlsbergensis, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, Schizosaccharomyces pombe, Candida albicans, Candida tropicalis, Rhodotorula glutinis, Rhodosporidium toruloides, Yarrowia lipolytica, Debaryomyces hansenii and Lipomyces starkeyi. In another embodiment, the genetically modified microorganism according to the invention is a fungus, and more particularly a "filamentous" fungus. In the context of the invention, "filamentous fungi" refers to all filamentous forms of the Eumycotina subdivision. For example, the genetically modified fungus according to the invention belongs to the genus Aspergillus, Trichoderma, Neurospora, Podospora, Endothia, Mucor, Cochliobolus or Pyricularia. Preferably, the genetically modified fungus according to the invention is chosen from Aspergillus nidulans, Aspergillus niger, Aspergillus awomari, Aspergillus oryzae, Aspergillus terreus, Neurospora crassa, Trichoderma reesei, and Trichoderma viride. In another embodiment, the microorganism genetically modified according to the invention is a microalgae. In the context of the invention, the term "microalgae" refers to all eukaryotic-type microscopic algae, preferentially belonging to the classes or superclasses of Chlorophyceae, Chrysophyceae, Prymnesiophyceae, Diatomaceous or Bacillariophyta, Euglenophyceae, Rhodophyceae, or Trebouxiophyceae. Preferentially, the microalgae genetically modified according to the invention are chosen from Nannochloropsis sp. (eg Nannochloropsis oculata, Nannochloropsis gaditana, Nannochloropsis salina), Tetraselmis sp. (eg Tetraselmis suecica, Tetraselmis chuii), Chlorella sp. (eg Chlorella salina, Chlorella protothecoides, Chlorella ellipsoidea, Chlorella emersonii, Chlorella minutissima, Chlorella pyrenoidosa, Chlorella sorokiniana, Chlorella vulgaris), Chlamydomonas sp. (eg Chlamydomonas reinhardtii) Dunaliella sp. (eg Dunaliella tertiolecta, Dunaliella salina), Phaeodactulum tricornutum, Botrycoccus braunii, Chroomonas salina, Cyclotella cryptica, Cyclotella sp., Ettlia texensis, Euglena gracilis, Gymnodinium nelsoni, Haematococcus pluvialis, Isochrysis galbana, Monoraphidium minutum, Monoraphidium sp., Neochloris oleoabundans, Nitzschia laevis, Onoraphidium sp., Pavlova lutheri, Phaeodactylum tricornutum, Porphyridium cruentum, Scenedesmus sp. (eg Scenedesmus obliquus, Scenedesmus quadricaula, Scenedesmus sp.), Stichococcus bacillaris, Spirulina platensis, Thalassiosira sp.

In one embodiment, the genetically modified microorganism according to the invention is a bacterium, preferentially chosen from phyla Acidobacteria, Actinobacteria, Aquificae, Bacterioidetes, Chlamydiae, Chlorobi, Chloroflexi, Chrysiogenetes, Cyanobacteria, Deferribacteres, Deinococcus-Thermus, Dictyoglomi, Fibrobacteria , Firmicutes, Fusobacteria, Gemmatimonadetes, Nitrospirae, Planctomycetes, Proteobacteria, Spirochaetes, Thermodesulfobacteria, Thermomicrobia, Thermotogae, or Verrucomicrobia. Preferably, the bacterium genetically modified according to the invention belongs to the genus Acaryochloris, Acetobacter, Actinobacillus, Agrobacterium, Alicyclobacillus, Anabaena, Anacystis, Anaerobiospirillum, Aquifex, Arthrobacter, Arthrospira, Azobacter, Bacillus, Brevibacterium, Burkholderia, Chlorobium, Chromatium, Chlorobaculum, Clostridium, Corynebacterium, Cupriavidus, Cyanothece, Enterobacter, Deinococcus, Erwinia, Escherichia, Geobacter, Gloeobacter, Gluconobacter, Hydrogenobacter, Klebsiella, Lactobacillus, Lactococcus, Mannheimia, Mesorhizobium, Methylobacterium, Microbacterium, Microcystis, Nitrobacter, Nitrosomonas, Nitrospina, Nitrospira, Nostoc, Phormidium, Prochlorococcus, Pseudomonas, Ralstonia, Rhizobium, Rhodobacter, Rhodococcus, Rhodopseudomonas, Rhodospirillum, Salmonella, Scenedesmun, Serratia, Shigella, Staphylococcus, Streptomyces, Synechoccus, Synechocystis, Thermosynechococcus, Trichodesmium, or Zymomonas. More preferably, the bacterium genetically modified according to the invention is selected from the species Agwbacterium tumefaciens, Anaerobiospirillum succiniciproducens, Actinobacillus succinogenes, Aquifex aeolicus, Aquifex pyrophilus, Bacillus subtilis, Bacillus amyloliquefacines, Brevibacterium ammoniagenes, Brevibacterium immariophilum, Clostridium pasteurianum, Clostridium Ijungdahlii , Clostridium acetobutylicum, Clostridium beigerinckii, Corynebacterium glutamicum, Cupriavidus necator, Cupriavidus metallidurans, Enterobacter sakazakii, E. coli, Gluconobacter oxydans, Hydrogenobacter thermophilus, Klebsiella oxytoca, Lactococcus lactis, Lactobacillus plantarum, Mannheimia succiniciproducens, Mesorhizobium loti, Pseudomonas aeruginosa, Pseudomonas mevalonii, Pseudomonas pudica, Pseudomonas putida, Pseudomonas fluorescens, Rhizobium etli, Rhodobacter capsulatus, Rhodobacter sphaeroides, Rhodospirillum rubrum, Salmonella enterica, Salmonella typhi, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Streptomyces coelicolor, Zymomonas mobilis, Acaryochloris marina, Anabaena variabilis, Arthrospira platensis, Arthrospira maxima, Chlorobium tepidum, Chlorobaculum sp., Cyanothece sp., Gloeobacter violaceus, Microcystis aeruginosa, Nostoc punctiform, Prochlorococcus marinus, Synechococcus elongatus, Synechocystis sp., Thermosynechococcus elongatus, Trichodesmium erythraeum, and Rhodopseudomonas palustris.

Expression of functional RuBisCO and PRK

According to the invention, the microorganism can naturally express functional RuBisCO and PRK. This is the case, for example, with photosynthetic microorganisms, such as microalgae or cyanobacteria.

There are several forms of RuBisCO in nature (Tabita et al, J Exp Bot 2008; 59 (7): 1515-24. Doi: 10.1093 / jxb / erm361). Forms I, II and III catalyze the carboxylation and oxygenation reactions of ribulose-1,5-bisphosphate. Form I is present in eukaryotes and bacteria. It consists of two types of subunits: large subunits (RbcL) and small subunits (RbcS). The functional enzymatic complex is a hexadecamer consisting of eight L subunits and eight S subunits. The correct assembly of these subunits also requires the intervention of at least one specific chaperone: RbcX (Liu et al. , Nature, 2010 Jan 14, 463 (7278): 197-202, doi: 10.1038 / nature08651). Form II is mainly found in proteobacteria, archaea (Archaea or archaebacteria) and dinoflagellate algae. Its structure is much simpler: it is a homodimer (consisting of two identical RbcL subunits). Depending on the organism, the genes encoding type I RuBisCO may be called rbcLIrbcS (eg, Synechococcus elongatus), or cbxLC / cbxSC, cfxLC / cfxSC, cbbLIcbbS (eg, Cupriavidus necator). Depending on the organism, the genes encoding type II RuBisCO are generally called cbbM (eg, Rhodospirillum rubrum). Form III is present in archaea. It is generally found in the form of RbcL subunit dimers, or dimer pentamers. Depending on the organism, the genes encoding type III RuBisCO may be called rbcL (for example, Thermococcus kodakarensis), cbbL (for example, Haloferax sp.).

Two classes of PRKs are known: Class I enzymes found in proteobacteria are octamers, while Class II enzymes in cyanobacteria and plants are tetramers or dimers. Depending on the organism, the genes encoding PRK may be called prk (eg, Synechococcus elongatus), prkA (eg, Chlamydomonas reinhardtii), prkB (eg, Escherichia coli), prkl, prk2 (eg, Leptolyngbya). sp.), cbbP (eg, Nitrobacter vulgaris) or cfxP (eg, Cupriavidus necator).

In the case where the microorganism used does not naturally express functional RuBisCO and PRK, said microorganism is genetically modified to express a heterologous RuBisCO and PRK. Advantageously, in such a case, the microorganism is transformed so as to integrate into its genome one or more expression cassettes integrating the sequences coding for said proteins, and advantageously the appropriate transcriptional factors. Depending on the type of RuBisCO to be expressed, it may be necessary to have the microorganism also express one or more chaperone proteins, in order to promote the proper assembly of RuBisCO subunits. This is particularly the case for RuBisCO type I, where the introduction and expression of genes encoding a specific chaperone (Rbcx) and general chaperones (GroES and GroEL, for example) are necessary to obtain a Functional RuBisCO. The application WO2015 / 107496 describes in detail how to genetically modify a yeast so that it expresses a RuBisCO of type I and a functional PRK. It is also possible to refer to the method described in GUADALUPE-MEDINA et al. (Biotechnology for Biofuels, 6, 125, 2013).

In one embodiment, the microorganism is genetically engineered to express type I RuBisCO. In another embodiment, the microorganism is genetically engineered to express an IL-type RuBisCO. In another embodiment, the microorganism is genetically modified. to express a RuBisCO type III.

Tables 1 and 2 below list, by way of example, sequences encoding RuBisCO and PRK that can be used to transform a microorganism to express functional RuBisCO and PRK. Table 1: Examples of sequences coding for RuBisCO

GenBank GI Gene Organism

 rbcL BAD78320.1 56685098 Synechococcus elongatus rbcS BAD78319.1 56685097 Synechococcus elongatus cbbL2 CAJ96184.1 113529837 Cupriavidus necator

 cbbS P09658.2 6093937 Cupriavidus necator

 cbbM YP_427487.1 132036 Rhodospirillum rubrum

cbbM Q21YM9.1 115502580 Rhodoferax ferrireducens cbbM Q479W5.1 115502578 Dechloromonas aromatica rbcL 093627.5 37087684 Thermococcus kodakarensis cbbL CQR50548.1 811260688 Haloferax sp. Rainbow Hr

Table 2: Examples of sequences coding for a PRK

Inhibition of glycolysis

According to the invention, the glycolysis pathway is at least partially inhibited, so that the microorganism is no longer able to normally use this pathway (Figure 1 - glycolysis). In other words, the microorganism no longer has the ability to assimilate glucose in a manner similar to a wild-type microorganism, in which the glycolysis pathway has not been inhibited (independently of any other genetic modification).

In a particular embodiment, the microorganism is genetically modified so as to inhibit, in whole or in part, the glycolysis downstream of the production of glyceraldehyde-3-phosphate (G3P).

For example, glycolysis is inhibited upstream of the production of 1,3-bisphospho-D-glycerate (1,3-BPG) or upstream of the production of 3-phosphoglycerate (3PG).

Depending on the microorganism, the reactions involved between glyceraldehyde-3-phosphate (G3P) and 3-phosphoglycerate (3PG) can be managed by (i) two concomitantly acting enzymes, glyceraldehyde-3-phosphate dehydrogenase (EC). 1.2.1.12, abbreviated GAPDH or more rarely G3PDH) and phosphoglycerate kinase (EC 2.7.2.3, abbreviated PGK), or (ii) by a single non-phosphorylating glyceraldehyde 3-phosphate dehydrogenase enzyme (EC 1.2.1.9, abbreviated GAPN).

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) catalyzes the reversible conversion of G3P to 1,3-bisphospho-D-glycerate (1,3-BPG), using the NADVNADH pair as the electron donor / acceptor in the sense of the reaction. Depending on the organism, the genes coding for GAPDH may be called gapA, gapB, gapC (eg Escherichia coli, Arabidopsis thaliana), GAPDH, GAPD, G3PD, GAPDHS (eg Homo sapiens), TDH1, TDH2, TDH3 (eg Saccharomyces cerevisiae). ), gap, gap2, gap3 (eg Mycobacterium sp., Nostoc sp.). Phosphoglycerate kinase (PGK) catalyzes the reversible conversion of 1,3-BPG to 3PG, using the ATP / ADP pair as a cofactor. Depending on the organism, the genes encoding PGK may be called PGK, PGK1, PGK2, PGK3, pgkA, PGKB, PGKC, cbbK, cbbKC, cbbKP (eg Cupriavidus necator). Non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase (GAPN) catalyzes the conversion of G3P to 3PG without passing through 1,3-BPG. This reaction is catalyzed in the presence of the cofactor couple NADPVNADPH which plays the role of electron acceptor. Depending on the organism, the genes encoding GAPN may be called GAPN (eg Bacillus sp., Streptococcus sp.), GAPN1 (eg Chlamydomonas sp.). In a particular example, the microorganism is genetically modified so that the expression of the gene encoding glyceraldehyde 3-phosphate dehydrogenase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.

Alternatively or additionally, the expression of the gene encoding phosphoglycerate kinase may also be at least partially inhibited. Preferably, the expression of the gene is completely inhibited.

Alternatively, the microorganism is genetically modified so that the expression of the gene coding for non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited. Tables 3, 4 and 5 below list, by way of example, the sequences encoding a glyceraldehyde 3-phosphate dehydrogenase, a phosphoglycerate kinase and a non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase which can be inhibited depending on the microorganism. target. The person skilled in the art knows which gene corresponds to the enzyme of interest to be inhibited as a function of the microorganism. Table 3: Examples of sequences coding for a GAPDH

Table 4: Examples of Sequences Encoding a PGK

Table 5: Examples of sequences coding for a GAPN

In general, the production of 3-phosphoglycerate (3PG) is no longer possible through glycolysis, or at least greatly reduced, in the genetically modified microorganism according to the invention. In a particular embodiment, the microorganism is a yeast of the genus Saccharomyces cerevisiae in which the expression of the gene TDH1 (Gene ID: 853395), TDH2 (Gene ID: 853465) and / or TDH3 (Gene ID: 853106) is less partially inhibited.

In another particular embodiment, the microorganism is a yeast of the genus Saccharomyces cerevisiae in which the expression of the PGK1 gene (Gene ID: 5230) is at least partially inhibited.

In another embodiment, the microorganism is a yeast of the genus Saccharomyces cerevisiae in which the expression of the PGK1 gene (Gene ID: 5230), the expression of the TDH1 gene (Gene ID: 853395), TDH2 (Gene ID: 853465 ) and / or the expression of the TDH3 gene (Gene ID: 853106) are at least partially inhibited.

In a particular embodiment, the microorganism is a bacterium of the genus Escherichia coli in which the expression of the gapA gene (Gene ID: 947679) is at least partially inhibited.

In another particular embodiment, the microorganism is a bacterium of the genus Escherichia coli in which the expression of the pgk gene (Gene ID: 947414) is at least partially inhibited.

In another embodiment, the microorganism is an E. coli bacterium in which the expression of the pgk gene (Gene ID: 947414), and / or the expression of the gapA gene (Gene ID: 947679) are at least partially inhibited. According to the invention, the genetically modified microorganism, which expresses a functional RuBisCO and PRK, is on the other hand able to produce 3PG by capturing C0 ₂ , from the ribulo se-5-phosphate produced by the pentose phosphate pathway ( Figure 2).

The enzymes necessary for the metabolism of 3PG pyruvate are not inhibited in the microorganism, said microorganism can then metabolize the 3PG to produce pyruvate and ΓΑΤΡ.

Thus, the genetically modified microorganism is able to produce pyruvate and NADPH cofactors by using CO2 as a complementary carbon source.

In the context of the invention, the term "complementary" carbon source means that the microorganism uses CO2 as a partial carbon source, in addition to the carbon atoms provided by fermentable sugars (glucose, galactose, sucrose, fructose, etc.), which constitutes the majority or main source of carbon for the production of pyruvate.

Thus, the genetically modified microorganism according to the invention makes it possible to increase the carbon yield by fixing and using the CO2 normally lost during glucose metabolism by means of pentose phosphates, for the production of pyruvate (and subsequently molecules of interest).

Oxidative Branch Inhibition of the Pentose Phosphate Pathway

In a particular embodiment, the genetically modified microorganism according to the invention is also modified so that the oxidative branch of the pentose phosphate pathway is also at least partially inhibited.

Preferably, the microorganism is genetically modified so as to inhibit the oxidative branch of the pentose phosphate pathway upstream of the ribulose-5-phosphate production (FIG. 1 - pentose phosphate pathway).

The interruption of the oxidative branch of the pentose phosphate pathway upstream of the production of ribulose-5-phosphate (Ru5P) specifically targets one or more reactions in the process of synthesizing Ru5P from glucose-6-phosphate (G6P ). This synthesis is generally catalyzed by the successive actions of three enzymes: (i) glucose-6-phosphate dehydrogenase (EC 1.1.1.49, abbreviated G6PDH), (ii) 6-phosphogluconolactonase (EC 3.1.1.31, abbreviated PGL) , and (iii) 6-phosphogluconate dehydrogenase (EC 1.1.1.44, abbreviated PGD).

Glucose-6-phosphate dehydrogenase (G6PDH) catalyzes the first reaction of the pentose phosphate pathway, that is, the oxidation of glucose-6-phosphate to 6-phosphogluconolactone (6PGL), with concomitant reduction of a molecule of NADP ⁺ in NADPH. According to the organism, the genes coding for G6PDH may be called G6PD (for example in Homo sapiens), G6pdx (for example in Mus musculus), gsdA (for example in Aspergillus nidulans), zwf (for example in Escherichia coli), or ZWF1 (for example in Saccharomyces cerevisiae).

6-Phosphogluconolactonase (PGL) is a hydrolase catalyzing the synthesis of 6-phosphogluconate (6PGA) from 6PGL. Depending on the organism, the genes coding for PGL may be called pgl (for example in Escherichia coli, Synechocystis sp.) Pgls (for example in Rhodobacteraceae bacterium), or SOL (for example in Saccharomyces cerevisiae).

6-Phosphogluconate dehydrogenase (PGD) is an oxidoreductase catalyzing the synthesis of Ru5P from 6PGA, with concomitant reduction of a NADP ⁺ molecule to NADPH and emission of a CO ₂ molecule. Depending on the organism, the genes coding for PGD may be called gnd (for example in Escherichia coli, Saccharomyces cerevisiae), PGD (for example in Homo sapiens), gntZ (for example in Bacillus subtilis), or 6-PGDH. (for example, Lactobacillus paracollinoides).

In a particular example, the microorganism is genetically modified so that the expression of the gene encoding glucose-6-phosphate dehydrogenase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.

Alternatively or additionally, the microorganism is genetically modified so that the expression of the gene encoding 6-phosphogluconolactonase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.

Alternatively or additionally, the microorganism is genetically modified so that the expression of the gene encoding 6-phosphogluconate dehydrogenase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.

Tables 6, 7 and 8 below list, by way of example, the sequences encoding glucose-6-phosphate dehydrogenase, 6-phosphogluconolactonase and 6-phosphogluconate dehydrogenase which can be inhibited depending on the target microorganism. The person skilled in the art knows which gene corresponds to the enzyme of interest to be inhibited as a function of the microorganism.

Table 6: Examples of sequences coding for a G6PDH

GenBank GI Gene Organism

 zwf BAA15660.1 946370 Escherichia coli

 ZWF1 NP_014158.1 6324088 Saccharomyces cerevisiae gsdA CAA54841.1 1523786 Aspergillus nidulans gsdA CAK37895.1 4979751 Aspergillus niger

gsdA EAU38380.1 4316232 Aspergillus terreus Table 7: Examples of sequences coding for a PGL

Table 8: Examples of sequences coding for a PGD

In general, the production of ribulo se-5-phosphate (Ru5P) is no longer possible via pentose phosphates, or at least greatly reduced, in the genetically modified microorganism according to the invention.

In a particular embodiment, the microorganism is a yeast of the genus Saccharomyces cerevisiae in which the expression of the ZWF1 gene is at least partially inhibited.

In a particular example, the yeast of the genus Saccharomyces cerevisiae is genetically modified so that the expression of the TDH1, TDH2, TDH3 and / or PGK1 genes, and the expression of the ZWF1 gene are at least partially inhibited.

In another particular embodiment, the microorganism is a bacterium of the genus Escherichia coli in which the expression of the zw / gene is at least partially inhibited.

In a particular example, the bacterium of the genus Escherichia coli is genetically modified so that the expression of the gapA and / or pgk genes and the expression of the zwf gene are at least partially inhibited. In another example, the microorganism is a filamentous fungus of the genus Aspergillus, such as Aspergillus niger or Aspergillus terreus, genetically modified so that the expression of the pgk and gsdA genes is partially inhibited.

According to the invention, the genetically modified microorganism, which expresses a functional RuBisCO and PRK, and whose glycolysis pathway and the oxidative branch of the pentose phosphate pathway are at least partially inhibited, is no longer capable of producing 3PG by way of glycolysis or Ru5P by the oxidative branch of the pentose phosphate pathway. It is however able to produce Ru5P by deflecting the production of fructose-6-phosphate (F6P) and / or glyceraldehyde-3-phosphate (G3P), produced at the beginning of glycolysis (upstream of the inhibition). This production is possible thanks to the enzymes transketolase (EC 2.2.1.1), transaldolase (EC 2.2.1.2), ribose-5-phosphate isomerase (EC 5.3.1.6), and ribulose-5-phosphate epimerase (EC 5.1.3.1). naturally occurring and active in microorganisms (Figure 3).

Since the enzymes necessary for the metabolism of 3PG to pyruvate are not inhibited in the microorganism according to the invention, said microorganism can then metabolize 3PG so as to produce pyruvate and ΑΤΡ.

Thus, the genetically modified microorganism is able to produce pyruvate using exogenous C0 ₂ as a complementary carbon source.

Thus, the genetically modified microorganism according to the invention makes it possible to increase the carbon yield, by fixing and using exogenous CO2, for the production of pyruvate (and subsequently of molecules of interest). Again, there is an increase in carbon yield.

Inhibition of the Entner-Doudoroff pathway

In a particular embodiment, the genetically modified microorganism according to the invention has an Entner-Doudoroff pathway, and this pathway is at least partially inhibited. This pathway, mainly found in bacteria (especially Gram-type), is an alternative to glycolysis and the pentose pathway for the production of pyruvate from glucose. More precisely, this pathway is connected to the pentose phosphate pathway at the β-gluconate level to supply glycolysis at the level of pyruvate in particular.

Preferentially, the microorganism is genetically modified so as to inhibit the reactions of the Entner-Doudoroff pathway downstream of the production of 6-phosphogluconate. This Inhibition eliminates a possible competitive pathway, and ensures the availability of 6-phosphogluconate as a substrate for PRK / RuBisCO engineering.

Interruption of the Entner-Doudoroff pathway downstream of 6-phosphogluconate production specifically targets one or more reactions in the process of synthesizing pyruvate from 6-phosphogluconate. This synthesis is initiated by the successive actions of two enzymes: (i) 6-phosphogluconate dehydratase ("EDD" - EC 4.2.1.12), and (ii) 2-dehydro-3-deoxyphosphogluconate aldolase ("EDA"). - EC 4.1.2.14).

6-Phosphogluconate dehydratase catalyzes the dehydration of 6-phosphogluconate to 2-keto-3-deoxy-6-phosphogluconate. Depending on the organism, the genes encoding 6-phosphogluconate dehydratase may be called edd (GenBank NP_416365, for example, in Escherichia coli), or ilvD (for example, in Mycobacterium sp.).

2-Dehydro-3-deoxy-phosphogluconate aldolase catalyzes the synthesis of a pyruvate molecule and a glyceraldehyde-3-phosphate molecule from the 2-keto-3-deoxy-6-phosphogluconate produced by the 6- phosphogluconate dehydratase. Depending on the organism, the genes coding for 2-dehydro-3-deoxyphosphogluconate aldolase may be called eda (GenBank NP_416364, for example, in Escherichia coli), or kdgA (for example in Thermoproteus tenax), or dgaF ( for example in Salmonella typhimurium).

In a particular example, the microorganism is genetically modified so that the expression of the gene encoding 6-phosphogluconate dehydratase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.

Alternatively or additionally, the microorganism is genetically modified so that the expression of the gene coding for 2-dehydro-3-deoxyphosphogluconate aldolase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited. Tables 9 and 10 below list, by way of example, the sequences encoding a 6-phosphogluconate dehydratase and a 2-dehydro-3-deoxyphosphogluconate aldolase which can be inhibited depending on the target microorganism. The person skilled in the art knows which gene corresponds to the enzyme of interest to be inhibited as a function of the microorganism. Table 9: Examples of sequences coding for an EDD

Table 10: Examples of sequences coding for an EDA

In a general manner, in this embodiment, the production of pyruvate is no longer possible via the Entner-Doudoroff pathway, or at least greatly reduced.

In a particular embodiment, the microorganism is a bacterium of the genus Escherichia coli in which the expression of the edd gene is at least partially inhibited.

In a particular example, the bacterium of the genus Escherichia coli is genetically modified so that the expression of gapA, and edd genes are at least partially inhibited.

According to the invention, the genetically modified microorganism, which expresses a functional RuBisCO and PRK, and whose pathway of glycolysis and the Entner-Doudoroff pathway are at least partially inhibited, is no longer capable of producing 3PG by the route of glycolysis or pyruvate by the Entner-Doudoroff pathway. The carbon flux from glucose is therefore oriented preferentially towards PRK / RuBisCO engineering.

Production of molecules of interest

According to the invention, the genetically modified microorganism is transformed so as to produce an exogenous molecule of interest and / or to overproduce an endogenous molecule of interest.

In the context of the invention, a molecule of interest is preferably a small organic molecule of molecular mass less than or equal to 0.8 kDa. In general, the genetic modifications made to the microorganism, as explained above, make it possible to improve the carbon yield of the synthesis and / or bioconversion pathways of molecules of interest.

In the context of the invention, an "improved" yield is understood in terms of the amount of finished product. In general, the carbon yield corresponds in the context of the invention to the ratio of the amount of finished product / amount of fermentable sugar, especially by weight. According to the invention, the carbon yield is increased in the genetically modified microorganisms according to the invention, compared with wild microorganisms, placed under identical culture conditions. Advantageously, the carbon yield is increased by 2%, 5%, 10%, 15%, 18%, 20%, or more. The genetically modified microorganism according to the invention can produce a larger quantity of the molecules of interest (finished product) compared to the heterologous molecules produced by a microorganism genetically modified simply to produce or overproduce this molecule. According to the invention, the microorganism genetically can also overproduce an endogenous molecule compared to the wild-type microorganism. The overproduction of an endogenous molecule is mainly understood in terms of quantities. Advantageously, the genetically modified microorganism produces at least 20%, 30%, 40%, 50%, or more by weight of the endogenous molecule than the wild-type microorganism. Advantageously, the microorganism according to the invention is genetically modified so as to produce or overproduce at least one molecule among amino acids, terpenoids, terpenes, vitamins and / or precursors of vitamins, sterols, flavonoids, organic acids. polyols, polyamines, aromatic molecules obtained from stereospecific hydroxylation, via NADP-dependent cytochrome p450, etc.

In a particular example, the microorganism is genetically modified to overproduce at least one amino acid, preferentially chosen from arginine, lysine, methionine, threonine, proline, glutamate, homoserine, isoleucine, valine and γ-aminobutyric acid.

In one particular example, the microorganism is genetically engineered to produce or overproduce terpenoid pathway molecules, such as farnesene, and the terpenes pathway.

In a particular example, the microorganism is genetically modified to produce or overproduce a vitamin or a precursor, preferentially chosen from pantoate, pantothenate, transneurosporene, phylloquinone and tocopherols. In a particular example, the microorganism is genetically modified to produce or overproduce a sterol, preferably selected from squalene, cholesterol, testosterone, progesterone and cortisone.

In a particular example, the microorganism is genetically modified to produce or overproduce a flavonoid, preferably selected from rambinone and vestinone.

In a particular example, the microorganism is genetically modified to produce or overproduce an organic acid, preferably chosen from coumaric acid, 3-hydroxypropionic acid, citric acid, oxalic acid, succinic acid, and itaconic acid.

In a particular example, the microorganism is genetically modified to produce or overproduce a polyol, preferably selected from sorbitol, xylitol and glycerol.

In a particular example, the microorganism is genetically modified to produce or overproduce a polyamine, preferentially spermidine.

In a particular example, the microorganism is genetically modified to produce or overproduce an aromatic molecule from a stereospecific hydroxylation, via a NADP-dependent cytochrome p450, preferentially chosen from phenylpropanoids, terpenes, lipids, tannins, flavors, hormones.

In the case where the molecule of interest is obtained by bioconversion, the genetically modified microorganism is advantageously cultured in a culture medium comprising the substrate to be converted. In general, the production or overproduction of a molecule of interest by a genetically modified microorganism according to the invention is obtained by culturing said microorganism in an appropriate culture medium known to those skilled in the art.

The term "appropriate culture medium" generally refers to a sterile culture medium providing nutrients essential or beneficial to the maintenance and / or growth of said microorganism, such as carbon sources; nitrogen sources such as ammonium sulphate; sources of phosphorus, for example, potassium phosphate monobasic; trace elements, for example, salts of copper, iodide, iron, magnesium, zinc or molybdate; vitamins and other growth factors such as amino acids or other growth promoters. Antifoam can be added as needed. According to the invention, this appropriate culture medium can be chemically defined or complex. The culture medium can thus be of identical or similar composition to a synthetic medium, as defined by Verduyn et al., (Yeast, 1992. 8: 501-17), adapted by Visser et al., (Biotechnology and bioengineering, 2002, 79: 674-81), or commercially available such as YNB (Yeast Nitrogen Base). , MP Biomedicals or Sigma-Aldrich).

In particular, the culture medium may comprise a simple carbon source, such as glucose, galactose, sucrose, molasses, or the by-products of these sugars, optionally supplemented with C0 ₂ as a carbon co-substrate. According to the present invention, the single carbon source must allow normal growth of the microorganism of interest. It is also possible in some cases to use a complex carbon source, such as lignocellulosic biomass, rice straw, or starch. The use of a complex carbon source generally requires pretreatment before use.

In a particular embodiment, the culture medium contains at least one carbon source among monosaccharides such as glucose, xylose or arabinose, disaccharides such as sucrose, organic acids such as acetate, butyrate, propionate or valerate to promote different kinds of polyhydroxyalkanoate (PHA), treated or untreated glycerol.

Depending on the molecules to be produced and / or overproduced, it is possible to play on the nutritional factor intake (N, O, P, S, K, Mg, Fe, Mn, Co, Cu, Ca, Sn, Koller and ah, Microbiology Monographs, G.-Q. Chen, 14: 85-119, (2010)). This is particularly the case for promoting the synthesis and intracellular accumulation of polyhydroalkanoate (PHA) including polyhydroxybutyrate (PHB).

According to the invention, any culture method allowing the production on an industrial scale of molecules of interest can be envisaged. Advantageously, the culture is done in bioreactors, especially in batch mode, fed-batch and / or continuous culture. Preferably, the culture line associated with the production of the molecule of interest is fed-batch mode corresponding to a controlled feed into one or more substrates, for example via the addition of a concentrated solution of glucose, the concentration of which can to be between 200 gL ^"1 and 700 gL ^1. A controlled vitamin supply during the process may also be beneficial to productivity (Alfenore et al., Appl Microbiol Biotechnol, 2002. 60: 67-72). to add a solution of ammonium salts to limit the nitrogen supply.The fermentation is generally conducted in bioreactors, with possible stages of solid and / or liquid precultures in Erlenmeyer flasks, with a suitable culture medium containing less a single carbon source and / or an exogenous CO2 input, necessary for the production of the molecule of interest. In general, the culture conditions of the microorganisms according to the invention are easily adaptable by those skilled in the art, depending on the microorganism and / or the molecule to be produced / overproduced. For example, the culture temperature is especially for yeasts between 20 ° C and 40 ° C, preferably between 28 ° C and 35 ° C, and more particularly about 30 ° C for S. cerevisiae. The culture temperature is in particular between 25 ° C and 35 ° C, preferably 30 ° C for Cupriavidus necator.

The subject of the invention is therefore also the use of a genetically modified microorganism according to the invention, for the production or overproduction of a molecule of interest, preferentially chosen from amino acids, peptides, proteins, proteins, vitamins, sterols, flavonoids, terpenes, terpenoids, fatty acids, polyols and organic acids.

The subject of the invention is also a biotechnological process for producing at least one molecule of interest, characterized in that it comprises a step of culturing a genetically modified microorganism according to the invention, under conditions allowing synthesis or the bioconversion, by said microorganism, of said molecule of interest, and optionally a step of recovering and / or purifying said molecule of interest.

In a particular embodiment, the microorganism is genetically modified to express at least one enzyme involved in the synthesis of said molecule of interest.

In another particular embodiment, the microorganism is genetically modified to express at least one enzyme involved in the bioconversion of said molecule of interest.

The invention also relates to a method for producing a molecule of interest comprising (i) the insertion of at least one sequence encoding an enzyme involved in the synthesis or bioconversion of said molecule of interest in a microorganism recombinant according to the invention, (ii) the culture of said microorganism under conditions allowing the expression of said enzyme and optionally (iii) the recovery and / or purification of said molecule of interest.

For example, it is possible to overproduce citrate by a fungus, especially a filamentous fungus, such as Aspergillus niger, genetically engineered to express functional PRK and RuBisCO type I or II, and in which gene expression pgk (Gene ID: 4982539) and gsdA (Gene ID: 4979751) is at least partially inhibited. It is also possible to overproduce itaconic acid by a fungus, in particular a filamentous fungus, such as Aspergillus terreus or Aspergillus niger, genetically modified to express a functional PRK and RuBisCO type I or II, and in which Expression of the pgk genes (Gene ID: 4354973) and gsdA (Gene ID: 4316232) is at least partially inhibited.

Similarly, it is possible to produce farnesene by a yeast such as a yeast of the genus Saccharomyces cerevisiae genetically modified to express a functional PRK and RuBisCO type I or II, a farnesene synthase and in which the expression of a PGK1 gene (Gene ID: 5230) is at least partially inhibited. It is also possible to overproduce glutamate by a bacterium, such as a bacterium of the genus Escherichia coli, genetically modified to express a functional PRK and RuBisCO type I or II, and in which the expression of the gene gapA (Gene ID: 947679) is at least partially inhibited. This overproduction may also occur in a strain where at least partial inhibition of the gapA gene is combined with at least partial inhibition of the zw / gene (Gene ID: 946370).

Similarly, it is also possible to overproduce γ-aminobutyric acid by a bacterium, such as a bacterium of the genus Escherichia coli, genetically modified to express a functional PRK and RuBisCO type I or II, as well as GadB glutamate decarboxylase (Gene ID: 946058), and wherein expression of the gapA gene (Gene ID: 947679) is at least partially inhibited. This overproduction may also occur in a strain where at least partial inhibition of the gapA gene is combined with at least partial inhibition of the zw / gene (Gene ID: 946370).

Similarly, it is possible to overproduce succinic acid and oxalic acid with a bacterium, such as a bacterium of the genus Escherichia coli, genetically modified to express a functional PRK and RuBisCO type I or II, and that an enzymatic activity allowing the oxidation of the glyoxylate to oxalate, preferably a glyoxylate dehydrogenase FPGLOXDH1 (mRNA: BAH29964.1), a glyoxylate oxidase GLO (mRNA: AOW73106.1), or an LDHA lactate dehydrogenase (Gene ID: 3939) and wherein the expression of gapA (Gene ID: 947679) and zwf (Gene ID: 946370) genes is at least partially inhibited. EXAMPLES

Example 1: Bioinformatic Analysis a) Calculation of theoretical yields i) Comparison of the carbon fixation yields from glucose between a wild strain using the pentose phosphate pathway and glycolysis, and a strain modified according to the invention

In order to evaluate the benefit provided by the modifications described according to the invention, theoretical yield calculations have been made on the basis of the stoichiometry of the reactions involved. Two cases were analyzed: the improvement provided by the PRK-RuBisCO (i) engineering in an inhibited strain for glycolysis on the yield of a NADPH-dependent biosynthetic pathway (for example, farnesene synthesis), and (ii) in an inhibited strain for glycolysis and the oxidative branch of the pentose phosphate pathway on the yield of a biosynthetic pathway of interest (eg, citrate synthesis). In the context of the improvement of NADPH-dependent biosynthetic pathways, the theoretical balance of the formation of NADPH and of glyceraldehyde-3-phosphate (G3-P) from glucose by way of pentose phosphates was calculated according to equation below (1):

(1) 3 Glucose + 5 ATP + 6 NADP ⁺ + 3 H ₂ 0 → 5 G3-P + 5 ADP + 6 NADPH + 11 H ⁺ + 3 C0 ₂

Going down to the formation of pyruvate from G3P, the following balance is obtained: (2) 3 Glucose + 5 ADP + 6 NADP ⁺ + 5 NAD ⁺ + 5 Pi → 5 Pyruvate + 5 ATP + 6 NADPH + 5 NADH + 11 H ⁺ + 3 C0 ₂ + 2 H ₂ 0

If the balance is standardized for one mole of glucose, the following yield is obtained:

(3) Glucose + 1.67 ADP + 2 NADP ⁺ + 1.67 NAD ⁺ + 1.67 Pi → 1.67 Pyruvate + 1.67 ATP + 2 NADPH + 1.67 NADH + 3.67 H ⁺ + C0 ₂ + 0.67 H ₂ 0 Thus, using pentoses phosphates, 1.67 moles of pyruvate and 2 moles of NADPH are produced from one mole of glucose. One mole of carbon is however lost by decarboxylation, during the formation of ribulose-5-phosphate by the 6- phosphogluconate dehydrogenase (EC 1.1.1.44). In comparison, the formation of pyruvate by way of glycolysis gives the following yield:

(4) Glucose + 2 ADP + 2 NAD ⁺ + 2 P _; → 2 Pyruvate + 2 ATP + 2 NADH + 2H ⁺ + 2H ₂ 0

The theoretical maximum yield of pyruvate produced by the pentose phosphates is therefore 0.82 gpymvate / ggiucose (g of synthesized pyruvate, per g of glucose consumed), whereas it is 0.98 gpymvate / ggucose by the route of the pyruvate. glycolysis.

By integrating the PRK / RuBisCO engineering in an inhibited strain for glycolysis (for example APGK1 in the context of the yeast S. cerevisiae), the carbon fixation flux is redirected to the oxidative branch of the pentose phosphate pathway, then towards PRK / RuBisCO engineering (see Figure 2). This flow is related to the end of the glycolysis pathway, in the formation of 3-phosphoglycerate (3PG), with the following yield:

(5) Glucose + 2 ATP + 2 NADP ⁺ + 2H ₂ 0 → 2 3PG + 2 ADP + 2 NADPH + 6H ⁺

Down to the formation of pyruvate from 3PG, we arrive at the following balance:

(6) Glucose + 2 NADP ⁺ → 2 Pyruvate + 2 NADPH + 4H ⁺ The integration of the modifications according to the invention into a microorganism makes it possible to recover the carbon molecule otherwise lost by the decarboxylation in the pentose pathway. The theoretical maximum yield of carbon fixation is therefore 0.98 gpymvate / ggiucose, which makes it possible to improve by 20.5% the yield obtained by the production of pyruvate by way of pentose phosphates, while producing NADPH. In a second case (see Figure 3), the PRK / RuBisCO engineering is integrated into a strain that is both inhibited for glycolysis (for example APGK1 in the context of the yeast S. cerevisiae), and for the branch oxidative pathway of pentose phosphates (eg AZWF1 in the context of the yeast S. cerevisiae). The theoretical balance of the formation of NADPH and 3-phosphoglycerate (3PG) from glucose then becomes (7) 2.5 Glucose + 6 ATP + 3 CO ₂ + 3H ₂ 0 → 6 3PG + 6 ADP + 12H ⁺

Down to the formation of pyruvate from 3PG, we arrive at the next balance sheet

(8) 2.5 Glucose + 3 C0 ₂ → 6 Pyruvate + + 3 H ₂ 0 + 6 H ⁺ If the balance is standardized for one mole of glucose, the following yield is obtained: (9) Glucose + 1.2 C0 ₂ → 2.4 Pyruvate + 1.2 H ₂ 0 + 2.4 H ⁺

The integration of the modifications according to the invention makes it possible to fix an additional 1.2 molecule of carbon per mole of glucose consumed. The corresponding theoretical maximum yield is 1.17 gpymvate / ggiucose, ie ca. 20% improvement, compared to the carbon fixation yield of glycolysis. ii) Application to citrate production

In a second case, the calculation is applied to the production of citrate in S. cerevisiae yeast, in a wild-type strain and in a strain modified according to the invention incorporating PRK / RuBisCO engineering and deleted for the PGK1 gene in a to inhibit the glycolysis pathway; and for the ZWF1 gene to inhibit the oxidative branch of the pentose pathway.

The production of citrate from pyruvate is summarized by the following balance equation:

(11) 2 Pyruvate + ATP + NAD ⁺ + 2H ₂ O → Citrate + ADP + NADH + P _; + 3H ⁺

This synthesis does not require NADPH, but 2 moles of pyruvate. Optimally, a wild strain obtains these 2 moles of pyruvate by glycolysis, from one mole of glucose according to equation (4), with the following balance:

(12) Glucose + ADP + 3 NAD ⁺ + P _; → Citrate + ATP + 3 NADH + 5H ⁺

The corresponding gdtrate / ggiucose yield is 1.07

 In the context of a strain modified according to the invention, inhibited for the glycolysis pathway and the pentose phosphate pathway, the 2 necessary pyruvates are obtained with only 0.83 mol of glucose (see equation 9), with the following balance sheet :

(13) 0.83 Glucose + CO ₂ + ATP + NAD ⁺ + H ₂ O → Citrate + ADP + NADH + P _; + 5 H ⁺

The corresponding gdtrate / ggiucose yield is 1.28, which is a theoretical maximum increase of approximately 20% relative to the yield of the wild-type strain. b) Simulation of biosynthetic yields by flow balance analysis

In a bioinformatic approach, analyzes of the type "flow balance analysis" (ABF) were also performed to simulate the impact of the modifications described according to the invention on the yield of different biosynthetic pathways. ABFs rely on mathematical models to simulate metabolic networks on a genome scale (Orth et al., Nat Biotechnol 2010; 28: 245-248). The reconstructed networks contain the known metabolic reactions of a given organism and integrate the needs of the cell, in particular to ensure cell maintenance, or growth. ABFs make it possible to calculate the flow of metabolites through these networks, making it possible to predict theoretical growth rates as well as production yields of metabolites. i) Procedure

ABF simulations were performed with the OptFlux software (Rocha et al, BMC Syst Biol, 2010 Apr 19, 4:45, 10: 1818 / 1752-0509-4-45), and the metabolic model of Saccharomyces cerevisiae MM904 (Mo et al., BMC Syst Biol 2009 Mar 25, 3:37, doi: 10.1186 / 1752-0509-3-37). This model has been modified to include the improvements described according to the invention, in particular a heterologous CO ₂ fixation pathway with (i) addition of a PRK type reaction, (ii) addition of an RuBisCO type reaction.

In particular embodiments, the reactions necessary to simulate the production of molecules by heterologous pathways have also been added to the model.

In a particular embodiment, a farnesene synthase-type reaction (EC 4.2.3.46 or EC 4.2.3.47) has in particular been added for the heterologous production of farnesene.

In a second particular embodiment, the acetoacetyl-CoA reductase (EC 1.1.1.36) and polyhydroxybutyrate synthase (EC 2.3.1.B2 or 2.3.1.B5) reactions were added to the model for simulate a heterologous β-hydroxyburyrate production pathway, the monomer of polyhydroxybutyrate.

In another particular embodiment, a reaction of glutamate decarboxylase type (EC 4.1.1.15) has been added in particular for the heterologous production of γ-aminobutyric acid. In another particular embodiment, a reaction of aconitate decarboxylase type (EC 4.1.1.6) has been added in particular for the heterologous production of itaconic acid.

In another particular embodiment, a lactate dehydrogenase-type reaction (EC 1.1.1.27) has in particular been added for the heterologous production of oxalate

The simulations were performed by applying to the model a set of constraints reproducible by those skilled in the art, aimed at simulating the in vivo culture conditions of a strain of S. cerevisiae under the conditions described according to the invention (for example, presence of non-limiting glucose in the medium, aerobic culture condition).

In particular embodiments, the simulations are carried out by virtually inactivating the reactions of the PGK1 enzymes (for example, glutamate, β-hydroxybutyric acid, farnesene) and ZWF1 (for example, citrate production), so as to simulate the decreases in activity of glycolysis and the pentose phosphate pathway, described according to the invention.

The simulations are performed in parallel on an unmodified "wild-type" model, in order to evaluate the impact of the improvements described according to the invention on the production yield of the biosynthetic pathways tested. ii) Results

The theoretical yields obtained and the percentages of improvement provided by the invention are described in Table 11 below.

Table 11: Theoretical maximum production yields evaluated by ABF on a wild strain and a strain modified according to the modifications of the patent, for the production of different molecules.

 MOIX / MOIGLUC: moles of X molecule produced, relative to the moles of glucose consumed

CMolx / CMOI _G L _UC: Molecules of carbon of X molecule produced, relative to the moles of glucose carbon consumed

 gx / gGLuc: g of molecule X products, relative to the g of glucose consumed.

EXAMPLE 2 Improvement of Farnesene Production in S. cerevisiae A yeast strain Saccharomyces cerevisiae, CEN.PK 1605 (Matte HIS3 leu2-3.112 trpl-289 ura3-52 MAL.28c) resulting from the commercial strain CEN.PK 113 -7D (GenBank: JRIV00000000) is engineered to produce NADPH without loss of CO ₂ and thus allow the improvement of alpha-farnesene production from glucose. a) Inactivation of the glycolysis pathway

For this, the glycolysis pathway was inactivated by deletion of the PGK1 gene. Once the glycolysis is inhibited, the yeast strain obtained is no longer able to use glucose as a source of carbon and energy. It is therefore necessary to feed the biomass synthesis routes with glycerol and energetic pathways with ethanol. Strains deleted for PGK1 are cultured on YPGE (yeast extract peptone glycerol ethanol) medium.

The deletion of the PGK1 gene was obtained in the following manner: The coding phase of the G418 resistance gene, derived from the KanMX cassette contained on the plasmid pUG6 (P30114-Euroscarf), was amplified with the oligonucleotides CB101 (SEQ ID No. l) and CB102 (SEQ ID NO: 2):

SEQ ID NO: 1: CB101 (forward): 5'-

ACAGATCATCAAGGAAGTAATTATCTACTTTTTACAACAAATATAAAACAATGGG TAAGGAAAAGACTC ACGTTTC-3 '

 SEQ ID NO: 2: CB102 (reverse): 5'-

GGGAAAGAGAAAAGAAAAAAATTGATCTATCGATTTCAATTCAATTCAATTTAGA AAAACTCATCGAGCATCAAATGAAAC -3 'The underlined part of the oligonucleotides is perfectly homologous to the Kan sequence and the rest of the sequence corresponds to the regions adjacent to the coding phase of the PGK1 gene on the genome of Saccaromyces cerevisiae so as to generate a PCR amplicon containing at the ends homologous recombination sequences of the PGK1 gene locus.

For the transformation reaction according to those skilled in the art (Methods in Yeast Genetics, Cold Spring Harbor lab race manual, 1997, Gietz and Schiest, 1995, Methods in Molecular and Cellular Biology [5]: 225-269), strain CEN.PK 1605 was cultured in a volume of 50 ml YPD complex (yeast extract peptone dextrose) at 30 ° C to an optical density at 600 nm of 0.8. Cells were centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant was removed and the cells resuspended in 25 ml sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells were resuspended in 400 μl of sterile 100 mM lithium acetate. In parallel, a transformation mix was prepared in a 2 ml tube as follows: 250 μΐ. 50% PEG, 10 μΐ. DNA "carrier" 5 mg / mL, 36 1M lithium acetate, 5 or 10 μΐ _^ reaction purified PCR (deletion cassette) and water to 350 μΐ.

50 μl of the resuspended cells were added to the transformation mixture and incubated at 42 ^° C. for 40 minutes in a water bath.

After incubation, the tube was centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant discarded. The cells were resuspended in 2 mL of YPGE (yeast extract peptone glycerol ethanol), transferred to a 14 mL tube and incubated for 2 hours at 30 ° C 200 rpm. The cells were then centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed and the cells were resuspended in 1 ml sterile water and centrifuged again for 1 minute and resuspended in 100 μl sterile water and plated on 180 μg / ml YPGE + G418.

The colonies obtained were genotyped for the validation of the deletion of the PGK1 gene and referenced EQ-0134 (CEN.PK1605 Apgk1: ± year). b) Introduction of PRK enzymes - RuBisCO - alpha-farnesene synthase

In order to reconstitute an alternative pathway to glycolysis and to allow the Apgkl strain to grow on glucose, said strain has been modified to allow combinatorial expression:

A gene encoding a phosphoribulokinase PRK that grafted onto the pentose phosphate pathway by consuming ribulose-5P to give ribulose-1.5bisP and

• Type I RuBisCO (with RbcL and RbcS structural genes and RbcX, GroES and GroEL chaperones). RuBisCO consumes ribulose-1.5bisP and one mole of CO ₂ to form the 3-phosphoglycerate downstream of the deletion PGK1 in the glycolysis pathway.

This alternative pathway once again allows the strain to consume glucose as the main source of carbon and energy.

In order to produce apha-farnesene, the yeast gene lacks the alpha-farnesene synthase gene (AFS1, SEQ ID No. 71, GenBank accession number AY182241).

Also, the seven genes required for PRK-RuBisCO engineering (Table 12) were cloned on four plasmid vectors capable of replicating autonomously, with compatible origins of replication and each carrying a different complementation gene. auxotrophy or antibiotic resistance to select strains containing the three or four plasmid constructs.

Two of these plasmids are monocopies, with an Ars / CEN origin of replication and the third is multicopy with a 2μ origin.

Table 12: Description of expression cassettes and plasmid composition

Genes derived from Synechococcus elongatus such as rbcL, rbcS, rbcX and prk (as described in WO 2015107496A1) and alpha-farnesene synthase from Malus domestica (Tippmann et al., Biotechnol Bioeng. 2016 Jan; 113 (I): 72-81) were optimized for codon use in yeast Saccharomyces cerevisiae.

According to the protocol previously described for the transformation of yeasts, strain EQ-0134 was cultured in a volume of 50 ml of complex YPGE (yeast extract peptone glycerol ethanol) complex medium at 30 ° C. The cells are centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant is removed and the cells are resuspended in 25 ml sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells are resuspended in 400 μl of sterile 100 mM lithium acetate. Meanwhile, the following transformation mix is prepared 250 of 50% PEG, 10 DNA "carrier" 5 mg / mL, 36 to 1 M lithium acetate, 10 μΐ _^ (3 .mu.g of one of the following combinations , pFPP45 + pFPP56 + pFPP20 or pL4 + pFPP45 + pFPP56 + pFPP20) and water at 350 μΐ.

50 μl of the resuspended cells were added to the transformation mixture and incubated at 42 ^° C. for 40 minutes in a water bath. After incubation, the tube was centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant discarded. The cells were resuspended in 2 mL of YNB (yeast nitrogen base including ammonium sulfate) with glycerol and ethanol, transferred to a 14 mL tube and incubated for 2 hours at 30 ° C. under a 10% enriched at-sphere. C0 ₂ . The final mix is spread on YNB agar medium including ammonium sulfate + CSM without LUW (leucine uracil, tryptophan) + nseothenin if necessary, with glycerol and ethanol as carbon sources.

According to the previously described protocol, strain CEN.PK 1605 is transformed with the following plasmid combination: pL4 + pFL36 + pCM185 + pV51TEF.

The clones obtained were genotyped for all the genes of the engineering then adapted on liquid medium YNB ammonium sulphate and glucose. · EQ-0153 (CEN.PK1605 Apgk1: ± m) pFPP45 + pFPP56 + pFPP20)

 • EQ-0253 (CEN.PK1605 Apgkl :: kan) (pL4 + pFPP56 + pFPP20 + pFPP45)

• EQ-0353 (CEN.PK1605) (pL4 + pFL36 + pCM185 + pV51TEF) c) Adaptation of strains EQ-0153 and EQ-0253 to growth in liquid medium with glucose and C0 ₂ . The batch cultures carried out in Erlenmeyer flasks are carried out with the appropriate culture medium and an exogenous CO2 supply of 10%, in a stirred incubator (120 RPM, 30 ° C.), with inoculation at 0.05 OD 600 nm measured using an EON spectrophotometer (BioTek Instruments). The strain of interest is cultured on YNB + CSM-LUW medium with 10 g / l of glycerol and 7.5 g / l of ethanol, under conditions in which the expression of PRK is not induced, and presence, if any, of nseothricin. Under these conditions, it is necessary to feed the strain upstream and downstream of the deletion of the PGK1 gene.

After obtaining a sufficient quantity of biomass, cultures of a volume greater than or equal to 50 ml in Erlenmeyer flask of at least 250 ml are sown in order to adapt the strain to the use of PRK engineering. RuBisCO. This adaptation is carried out on the YNB + CSM-LUW culture medium with 20 g / l of glucose, in the presence, if appropriate, of nseothricin and an exogenous C0 ₂ feed as described above.

After observation of a significant growth start, the strains are adapted to a minimum mineral medium free of the amino acids and nitrogen bases included in the CSM-LUW, that is only YNB with 20 g / L of glucose, nseotherothin if necessary and a exogenous CO2 supply as described above. d) Production of farnesene in Erlenmeyer flask

Saccharomyces cerevisiae strain EQ-0253, deleted in the glycolytic pathway at the PGK1 gene, is cultured to produce farnesene by overproducing NADPH without loss of CO2, using PRK and RuBisCO.

This strain of interest is compared with a reference strain EQ-0353 producing farnesene following the introduction of a heterologous alpha-farnesene synthase, without deletion of PGK1 or addition of PRK and RuBisCO.

Strains EQ-0253 (CEN.PK1605 Ap gk1: an) pL4 + pFPP56 + pFPP20 + pFPP45) and EQ-0353 (CEN.PK1605) (pL4 + pFL36 + pCM185 + pV51TEF) were grown in YNB medium with 20 g / L. of D-glucose, to which 100 μg / L of nseothricin was added. A preculture containing 20 ml of culture medium was inoculated with 0.05 OD 50 mm into a 250 ml baffled Erlenmeyer flask, shaken at 120 rpm for 24 h at 30 ° C in a Minitron incubator where atmosphere was regulated at 10% CO2. From the first preculture, 50 ml of medium was inoculated at OD 600 _nm 0.05 in a 250 ml Erlenmeyer flask and stirred, 120 rpm, 24 h at 30 ° C, 10% CO 2. The culture, also carried out in Erlenmeyer flasks (500 ml, baffled) from the second preculture, was inoculated with 0.05 OD 50 mm in 100 ml of the same culture medium, to which 50 μg / ml was added. of ampicillin, 10 μl of antifoam (Antifoam 204, Sigma, A6426) and 10% (v / v) of dodecane (Tippman et al, Talanta (2016), 146: 100-106). The cultures were shaken at 120 rpm at 30 ° C in the presence of 10% C0 ₂ . Growth monitoring was performed by measuring the turbidity at 600 nm.

To extract the farnesene, 500 μΐ of organic phase was collected and centrifuged at 5,000 g for 5 min for complete separation of the two phases. The organic phase was stored at 4 ° C until GC-MS analysis. Detection and quantification of α-farnesene was performed by simple quadrupole mass spectrometry. A Zebron ZB-FFAP column was used with hydrogen as a carrier gas at a flow rate set at 2.95 ml / min. The inlet temperature was 260 ° C, 1 μΐ of sample was injected in splitless mode. The initial temperature of the oven was 70 ° C (4 min) and then gradually increased to 160 ° C (7 ° C / min) and then to 240 ° C (40 ° C / min) where it was maintained for 1.05 min. For mass spectrometric detection, the transfer line and source temperatures were 250 ° C and 200 ° C, respectively. Mass acquisition was made between t = 10 min and t = 20 min. An external calibration comprising seven points was made from the farnesene isomer mixture (Sigma, W383902) for the quantification of -farnesene produced by the strains.

To quantify the glucose consumed by the strains, 500 μΐ of the culture medium were taken from the same farnesene extraction OD, centrifuged at 5,000 g, 5 min at 4 ° C. The supernatant was filtered (Minicart RC4, sartorius 0.45μιη) and stored in a vial at -20 ° C. The glucose contained in this sample was quantified by HPLC-UV Ultimate 3000 (Thermo Scientific) equipped with a pump, a refrigerant autosampler at 8 ° C and a refractive index detector (RI, precision instruments IOTA 2 ). A Rezex ROA-Organic Acid H ⁺ column (8%) 150 × 7.8 mm, with a particle size of 8 μιη (Phenomenex, 00H-0138-KO) was used with a 4 × 3.0 mm Carbo-H pre-column. The column temperature was 35 ° C and the flow rate was set at 0.5 mL / min. The isocratic elution was carried out with a mobile aqueous phase at 5 mM H ₂ SO 4 and lasted 30 min. A volume of 20 _^ μΐ was injected for each sample. The identification of the compounds was based on the comparison of the retention times with the standards. The external calibration comprises 10 points of variable glucose concentration (0- 20 g / L).

The Υα-famesene / Gic carbon yield is calculated in gram of farnesene produced per gram of glucose consumed for the two strains EQ-0253 and EQ-0353,

 _ farnesene (mg / L aqueous)

 I a-farnesene / Glc- ', "~" ·

 glucose (mg / slime)

Table 13: Mass yield of cc-farnesene on D-glucose

 The increase in the mass yield of α-farnesene on D-glucose observed was 9.6% for strain EQ-0253, compared to control strain EQ-0353.

Example 3: Improvement of citrate production in S. cerevisiae

a) Inactivation of the ZWF1 gene and of the IDH1 gene in a haploid strain of MAT n

• Inactivation of the ZWFl gene

The coding phase of the hygromycin B resistance gene, resulting from the hphMX cassette (loxP-pAgTEF1-hph-tAgTEF1-loxP) and contained on the plasmid pUG75 (P30671) - Euroscarf,) is amplified with the oligonucleotides Sdzwf 1 and Rdzwf 1 (Table 14). This makes it possible to generate an Azwfl PCR amplicon containing, at the ends, homologous recombination sequences of the ZWF1 glucose-6-phosphate dehydrogenase gene locus.

Table 14: Oligonucleotides

Name Sequence

 Sdzwf 1 AAG AGTAAATCCAATAG AATAG AAAACCACATAAG G CAAGATG G GTAAAAAG CCTG AACTC (SEQ ID NO: 3) ACCG

 Rdzwfl ATTTCAGTG ACTTAG CCG ATAAATG AATGTG CTTG CA 1 1 1 1 1 1 1 ATTCCTTTGCCCTCGGACG (SEQ ID # 4)

 Sd pgkl ACAGATCATCAAGGAAGTAATTATCTAC 1 1 1 1 1 ACAACAAATATAAAACAATGGGTAAGGAA (SEQ ID NO: 5) AAGACTCACGTTTC

 AAAAG AG AAAAG AAAAAAATTG ATCTATCG ATTTC AATTCAATTC AATTTAG AAAAACTC (SEQ ID NO: 6) ATCGAGCATCAAATGAAAC

 Sdid hl TCTCCCTATCCTCATTCTTCTCCC 1 1 1 1 CCTCCATAATTGTAAGAGAAAAATGGGTACCACTCT (SEQ ID NO: 7) TGACGACACGG

Rdid hl AATTTG AACAC ACTTAAGTTG CAG AACAAAAAAAAG GGG AATTG 1 1 1 1 C ATTAG GGG CAG G (SEQ ID NO: 8) G CATG CTCATGTAG AG C The underlined part of the oligonucleotides corresponds to the part perfectly homologous to the sequence of the selection gene, the remainder of the sequence corresponding to the regions adjacent to the coding phase of the target gene to be deleted on the genome of Saccaromyces cerevisiae.

The strain previously described CEN.PK 1605 (Mat has HIS3 leu2-3.112 trp1-29 ura3-52 MAL.28c) resulting from the commercial strain CEN.PK 113-7D (GenBank: JRIV00000000) is transformed with the Azwfl PCR fragment described below. above.

For the transformation reaction, strain CEN.PK 1605 is cultured in a volume of 50 ml of YPD (yeast extract peptone dextrose, here glucose 20 g / L) rich medium at 30 ° C. up to an optical density of 600 nm. 0.8. The cells are centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant is removed and the cells are resuspended in 25 ml sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells are resuspended in 400 μl of sterile 100 mM lithium acetate.

Parallel, preparing a mix of processing in a 2 ml microcentrifuge tube as follows: 250 μΐ _^ of 50% PEG, 10 DNA "carrier" 5 mg / mL, 36 to 1 M lithium acetate, 10 μΐ purified PCR reaction (deletion cassette) and water at 350 μΐ.

50 μl of the resuspended cells are added to the transformation mixture and incubated at 42 ^° C. for 40 minutes in a water bath. After incubation, the tube is centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant is discarded. The cells are resuspended in 2 ml YPD (yeast extract peptone dextrose) medium, transferred to a 14 ml tube and incubated for 2 hours at 30 ° C. and 200 rpm. The cells are then centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant is removed and the cells are resuspended in 1 ml of sterile water and centrifuged again for 1 minute and resuspended in 100 μl of sterile water and spread on YPD + Hygromycin B 200 μg / ml.

The colonies obtained were genotyped for the validation of the deletion of the ZWF1 gene and referenced EQSC-002 (CEN.PK 1605 Azwfl: ± p).

• Inactivation of the IDH1 gene

Inactivation of this gene accumulates citrate (Rodriguez et al., Microb Cell Fact 2016 Mar 3, 15:48). The coding phase of the nseothorin resistance gene from the natMX cassette (loxP-pAgTEF1-nat-tAgTEF1-loxP) contained on the plasmid (pUG74 (P30670) - Euroscarf) is amplified with the oligonucleotides Sdidhl and Rdidhl (Table 13 ). This makes it possible to generate an Aidhl PCR amplicon containing, at the ends, homologous recombination sequences of the gene locus of the IDH1 isocitrate dehydrogenase subunit gene.

The previously described strains, EQSC-002 (CEN.PK 1605 Azwfl :: hph) and CEN.PK 1605 (Mat has HIS3 leu2-3.112 trp-289 ura3-52 MAL.28c) resulting from the commercial strain CEN.PK 113- 7D (GenBank: JRIV00000000) are transformed with the PCR fragment for inactivation of the IDH1 gene. For the transformation reaction, the strains EQSC-002 and CEN.PK1605 are cultured in a volume of 50 ml of rich YPD complex (yeast extract peptone dextrose, here glucose 20 g / L) at 30 ° C. up to an optical density. 600nm of 0.8. The cells are centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant is removed and the cells are resuspended in 25 ml of sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells are resuspended in 400 μl of sterile 100 mM lithium acetate.

In parallel, a transformation mix is prepared in a 2 ml tube as follows: 250 50% of PEG, 10 of "carrier" DNA at 5 mg / ml, 36 of 1 M lithium acetate, 10 μl, purified PCR reaction (deletion cassette) and 350 μΐ water. 50 μl of the resuspended cells are added to the transformation mixture and incubated at 42 ^° C. for 40 minutes in a water bath. After incubation, the tube is centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant is discarded. The cells are resuspended in 2 ml YPD (yeast extract peptone dextrose), transferred to a 14 ml tube and incubated for 2 hours at 30 ^° C. and 200 rpm. The cells are then centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant is removed and the cells are resuspended in 1 ml of sterile water and centrifuged again for 1 minute and resuspended in 100 μl of sterile water and spread on YPD + Hygromycin B 200 μg / ml, 50 μg / ml nseothenicin .

The colonies obtained were genotyped for the validation of the deletion of the IDH1 gene and are called EQSC-003 (CEN.PK 1605 Azwfl :: hph, Mdhl :: nat) and EQSC-005 (CEN.PK 1605 Aidhl :: nat) b) Inactivation of the PGK1 gene in a haploid strain of sex sign MAT alpha The coding phase of the G418 resistance gene from the KanMX cassette (ΙοχΡ-pAgTEF1-kanMX-tAgTEF1-loxP) contained on the plasmid pUG6 (P30114) - Euroscarf is amplified with the oligonucleotides Sdpgk1 and Rdpgk1 (Table 13) making it possible to generate a pgkl PCR amplicon containing at the ends homologous recombination sequences of the PGK1 3-phosphoglycerate kinase gene locus.

Strain CEN.PK 1606 (Matte HIS3 leu2-3.112 trp-289 ura3-52 MAL.28c) resulting from the commercial strain CEN.PK 113-7D (GenBank: JRIV00000000) is transformed with the PCR fragment for the inactivation of PGK1 gene.

For the transformation reaction the strain CEN.PK 1606 is cultured in a volume of 50 ml of complex YPD (yeast extract peptone dextrose, here glucose 20g / L) rich medium at 30 ° C up to an optical density 600 nm of 0. 8. The cells are centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant is removed and the cells are resuspended in 25 ml sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells are resuspended in 400 μl of sterile 100 mM lithium acetate.

In parallel, a transformation mix is prepared in a 2 ml tube as follows: 250 50% of PEG, 10 of "carrier" DNA at 5 mg / ml, 36 of 1 M lithium acetate, 10 μl, purified PCR reaction (deletion cassette) and 350 μΐ water.

50 μl of the resuspended cells are added to the transformation mixture and incubated at 42 ^° C. for 40 minutes in a water bath. After incubation, the tube is centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant is discarded. The cells are resuspended in 2 ml of YPGE (yeast extract peptone glycerol 20 g / l, ethanol 30 g / l), transferred to a 14 ml tube and incubated for 2 hours at 30 ^° C. and 200 rpm. The cells are then centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant is removed and the cells are resuspended in 1 ml of sterile water and centrifuged again for 1 minute and resuspended in 100 μl of sterile water and spread on YPGE + 150 μηη, G418.

The colonies obtained were genotyped for the validation of the deletion of the PGK1 gene and referenced EQSC-008 (CEN.PK 1605, Apgkl :: kan).

c) Construction of an inactivated strain for IDH1, ZWF1 and PGK1 by crossing The haploid strains of opposite sexual signs EQSC-003 (CEN.PK 1605 Azwfl :: hph, Aidhl :: nat) and EQSC-008 (CEN.PK1606 Apgkl :: kan) are grown overnight on an agar medium: YPD (yeast extract peptone dextrose) for strain EQSC-008 and YPGE (yeast extract peptone glycerol ethanol) for strain EQSC003, at 30 ° C. Then the 2 strains are crossed by direct contact on an agar medium YPGE (yeast extract peptone glycerol ethanol) + G418 150 μg / mL + hygromycin B 200 μg / mL. The double selection G418 and hygromycin B eliminates the two parental strains, only the diploid strains MAT a / MAT alpha, ZWFl / Azwfl :: hph, JDHl / Aidhl :: nat, VG \ IApgkl :: kan grow on this medium . An isolated diploid isolate from this cross is taken. The presence of the 3 cassettes Azwfl :: hph, Aidhl :: nat, Apgklr. kan is validated by growth tests on YPGE (yeast extract peptone glycerol ethanol) agar medium supplemented with G418 150 μg / mL or Hygromycin B 200 μg / mL or nseothricin 50 μg / mL. The strain obtained is referenced as EQSC-009 (CEN.PK 1607, MAT α / MAT alpha, ZWF1 / Azwfl :: hph, ΙΌΗΙ / Aidhl :: nat, PGK1 / Apgk1 :: kan). The previously described strain EQSC-009 (CEN.PK 1607, MAT / alpha MATT, ZWF1 / Azwulf :: hph, JIH / Aidhl :: nat, PGK1 / 'Apgk1 :: kan) is grown on YPGE agar medium. (yeast extract peptone glycerol ethanol) overnight at 30 ° C. The cells are then placed in liquid culture in a deficient medium (Medium Sporulation, 1% potassium acetate + leucine + uracil + tryptophan) to induce the meiosis of diploid cells and thus leading to the formation of tetrads containing four haploid spores. Tetrads are plated on YNB.GE medium (yeast nitrogen base, glycerol, ethanol) + leucine + uracil + tryptophan + lg / L glutamic acid + methionine 20mg / L + cysteine 40mg / L and immediately dissected (using a micro-dissector) to isolate the spores on the same medium. The spores are germinated for several days at 30 ° C. The genetic content of the haploid cells thus obtained is tested by growth on selective media: YPGE (yeast extract peptone glycerol ethanol) supplemented with G418 150 μg / mL or hygromycin B 200 μg / mL or nseothricin 50 μg / mL and their sexual sign is tested by crossing with two strain of sex sign MAT a or MAT alpha. The colonies obtained are genotyped for the validation of the deletion of the genes PGK1, IDH1, ZWF1 and the absence of transcripts corresponding to these genes is validated by real-time PCR after retro-transcription of the ribonucleic acids. One of the obtained strain is referenced EQSC-004 (CEN.PK 1606 MAT alpha Δ zwfl :: hph, Aidhl :: nat, Apgklr .kan)

d) Introduction of PRK-RuBisCO enzymes The six genes required for PRK-RuBisCO engineering (table 15 below) are cloned on three plasmid vectors capable of autonomously replicating, with compatible origins of replication and each carrying a different auxotrophy complementation gene. to select the strains containing the three plasmid constructs (see WO 2015107496). Two of these plasmids are monocopy with an ARS / CEN origin of replication and the third is multicopy with a 2μ origin.

Table 15: Description of expression cassettes and plasmid composition

According to the transformation protocol previously described the EQSC-004 strain (CEN.PK 1606 Azwfl :: hph, Aidhl :: nat, Apgkl :: kan) was cultured in a volume of 50 ml of rich YPGE complex (yeast extract peptone) medium. glycerol ethanol) at 30 ° C up to an optical density of 600 nm of 0.8. The cells are centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant is removed and the cells are resuspended in 25 ml of sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells are resuspended in 400 μl of sterile 100 mM lithium acetate. Parallel, preparing a mix of processing in a 2 ml microcentrifuge tube as follows: 250 μΐ _^ of 50% PEG, 10 μΐ. of "carrier" DNA at 5 mg / mL, 36 μM. of 1 M lithium acetate, 10 μΐ. g) a combination of pFPP45 + pFPP56 + pFPP20 and water at 350 μΐ.

50 μΐ of resuspended cells are added to the transformation mix and incubated at 42 ⁰ C for 40 minutes in a water bath. After incubation, the tube is centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant is discarded. The cells are resuspended in 2 mL YPGE (yeast extract peptone glycerol ethanol) + 2 mg / L Doxycycline, transferred to a 14 mL tube and incubated for 2 hours at 30 ° C at 200 rpm. The cells are then centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant is removed and the cells are resuspended in 1 ml of sterile water and centrifuged again for 1 minute and resuspended in 100 μl of sterile water and spread on YNB.GE (yeast nitrogen base, glycerol, ethanol) + glutamic acid 1 g / L + methionine 20 mg / L + cysteine 40 mg / L + doxycycline 2 mg / L. The strain obtained is referenced: EQSC-006 (CEN.PK 1606 Azwfl :: hph, tddhlr.nat, Apgkl :: kan) (pFPP45 + pFPP56 + pFPP20).

According to the previously described transformation protocol, strain EQSC-005 (CEN.PK 1605 Aidhl :: nat) was cultured in a volume of 50 ml of complex YPGE (yeast extract peptone glycerol ethanol) complex at 30 ° C. 600nm optical density of 0.8. The cells are centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant is removed and the cells are resuspended in 25 ml of sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells are resuspended in 400 μl of sterile 100 mM lithium acetate.

Parallel, preparing a mix of processing in a 2 ml microcentrifuge tube as follows: 250 μΐ _^ of 50% PEG, 10 μΐ, DNA "carrier" 5 mg / mL, 36 μΐ, lithium acetate 1 M, 10 μg, g) of a combination pV51TEF + pFL36 + pCM185 and water at 350 μΐ.

50 μl of the resuspended cells are added to the transformation mixture and incubated at 42 ^° C. for 40 minutes in a water bath. After incubation, the tube is centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant is discarded. The cells are resuspended in 2 ml YPD (yeast extract peptone dextrose), transferred to a 14 ml tube and incubated for 2 hours at 30 ^° C. at 200 rpm. The cells are then centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant is removed and the cells are resuspended in 1 ml of sterile water and centrifuged again for 1 minute and resuspended in 100 μl of sterile water and plated on YNBD (yeast nitrogen base dextrose) + doxycycline at 2 mg / L. The strain obtained is referenced: EQSC-007 (CEN.PK 1605 Mdhl :: nat) (pV51TEF + pFL36 + pCM185). d) Adaptation and evolution phase of strains EQSC-006 and EQSC-007

Adaptation of strains EQSC-006 and EQSC-007 to growth on YNB (yeast nitrogen base) with glucose and C0 ₂ .

The batch cultures carried out in Erlenmeyer flasks are carried out with the appropriate culture medium and an exogenous CO2 supply of 10%, in a stirred incubator (120 RPM, 30 ° C.), with an inoculation at 0.05 OD 600 nm measured at using an EON spectrophotometer (BioTek Instruments). The strain of interest is cultured on YNB + CSM-LUW medium with 10 g / l of glycerol and 7.5 g / l of ethanol, + glutamate at 50 mg / l under conditions in which the expression of PRK no. is not induced.

After obtaining a sufficient quantity of biomass, cultures of a volume greater than or equal to 50 ml in Erlenmeyer flask of at least 250 ml are sown in order to adapt the strain to the use of PRK engineering. RuBisCO. This adaptation is carried out on the YNB + CSM-LUW culture medium with 20 g / l of glucose, 50 mg / l glutamate and an exogenous CO2 supply as described above.

After observation of a significant growth start, the strains are adapted to a minimum mineral medium free of all the amino acids except those indicated below, and nitrogenous bases included in the CSM-LUW, or only YNB with final concentrations. , 20 g / L glucose, 1 g / L glutamate, 40 mg / L L-cysteine and 20 mg / L L-methionine and an exogenous CO2 supply as described above. e) Production of citrate in Erlenmeyer flasks

Saccharomyces cerevisiae strain EQSC-006, deleted in the glycolytic pathway at the PGK1 gene, in the oxidative part of pentose phosphate and in the Krebs cycle is cultured to produce citrate without loss of CO2, using PRK and a RuBisCO. This strain of interest is compared with a reference strain EQSC-007 producing citrate following the inactivation of the IDH1 gene, without deletion of PGK1 or ZWF1 nor addition of PRK and RuBisCO.

Strains EQSC-006 (CEN.PK 1605 Azwfl :: p, Aidhl :: nat, Apgk1 :: k, pFPP45 + pFPP56 + pFPP20) and EQSC-007 (CEN.PK 1605 Aidhl :: nat, pV51TEF + pFL36 + pCM185) were cultured in Yeast Nitrogen Base (YNB) medium supplemented with 20 g / L of D-glucose (YNB D20).

In order to establish the mass citrate yields on glucose, a preculture containing 20 ml of culture medium was inoculated D06oo 0.05 _nm in a baffled Erlenmeyer flask of 250 ml was put in stirring at 120 rpm at 30 ° C. From the first preculture, 50 ml of medium was inoculated with 0.05 OD 50 mm into a 250 ml Erlenmeyer flask and stirred at 120 rpm at 30 ° C. The culture was made in Erlenmeyer flasks (500 ml, baffled) from the second preculture, inoculated with 0.05 OD 50 mm in 100 ml of the same medium, at 30 ° C, 120 rpm. Growth monitoring was carried out by measuring the turbidity at 600 nm. For quantification citrate, 500 μΐ _^ of the culture medium were collected, centrifuged at 5000 g, 5 min, 4 ° C. The supernatant was filtered (Minicart RC4, sartorius 0.45μιη) and stored in a vial at -20 ° C. before HPLC analysis (Thermo Scientific UltiMate 3000 HPLC) coupled to a single quadrupole mass spectrometer. 20 μΐ _^ of each sample was injected onto a column Aminex HPX-87H H ^+, 300 mm x 7.8 mm (Biorad, 125-0140). Isocratic elution at a flow rate of 0.5 ml / min was carried out with a 0.037% (v / v) aqueous solution of formic acid whose pH was adjusted to 4.5 with ammonium hydroxide. The oven temperature of the column was 65 ° C. The conditions of analysis in mass spectrometry were: negative electrospray mode, 450 ° C source temperature, 3 kV needle voltage, 50 V cone voltage. An external calibration comprising seven points was carried out from a commercial solution of sodium citrate.

To quantify the glucose consumed by the strains, 500 μΐ of the culture medium were taken at the same DOOOO nm of culture as for the quantification of citrate, centrifuged at 5,000 g, 5 min at 4 ° C. The supernatant was filtered (Minicart RC4, sartorius 0.45μιη) and stored in a vial at -20 ° C. The glucose contained in this sample was quantified by HPLC-RI Ultimate 3000 (Thermo Scientific) equipped with a pump, a refrigerant autosampler at 8 ° C and a refractive index detector (RI, precision instruments IOTA 2 ). A Rezex ROA-Organic Acid H ⁺ column (8%) 150 × 7.8 mm, with a particle size of 8 μιη (Phenomenex, 00H-0138-KO) was used with a 4 × 3.0 mm Carbo-H pre-column. The oven temperature for the column was 35 ° C and the flow rate was set at 0.5 mL / min. Isocratic elution of 30 min was carried out with a mobile aqueous phase at 5 mM H 2 SO 4. A volume of 20 μΐ was injected for each sample. The identification of the compounds was based on the comparison of the retention times with the standards. The external calibration included 10 points of variable glucose concentration (0 to 20 g / L). The Ydtrate / Gic mass yield was calculated in grams of citrate produced per gram of glucose consumed for both EQSC-006 and EQSC-007, Ydtrate / GIC citrate (mg / Lacquers) strains.

glucose (mg / slime)

Table 16: Mass yield, citrate on D-glucose

An increase in the mass yield, citrate on D-glucose, of 19.5% was observed for the strain EQSC-006 compared to the control strain EQSC-007.

Example 4: Improvement of Glutamate Production in E. coli The deletion of the alpha-ketoglutarate dehydrogenase gene increases glutamate production (Usuda et al., J Biotechnol 2010 May 3; 147 (1): 17-30. doi: 10.1016 / j.jbiotec.2010.02.018).

In these examples, a strain of Escherichia coli K12 MG1655 whose sucA gene has been deleted was therefore used. This strain is derived from a gene deletion library (Baba et al., Mol Syst Biol, 2006; 2: 2006.0008) from Escherichia coli and provided by Coli Genetic Stock Center under the name JW0715-2 and with reference 8786. (JW0715-2: MG1655 AsucA :: Kan)

4 A] Improvement of glutamate production by inactivation of glvolysis a) Removal of the selection cassette by specific recombination of FTR regions by Flp recombinase In order to be able to reuse the same deletion strategy as that used to construct strain JW0715- 2 above (Rodriguez et al, 2016), the selection cassette was deleted using a recombinase. The plasmid p707-Flpe (supplied in the Quick & Easy E. coli Gene Deletion Red® kit / ET® Recombination by Gene bridges) is transformed by electroporation according to the kit protocol. The cells are selected on LB agar supplemented with 0.2% glucose, tetracycline

0.0003. and added with 0.3% L-arabinose. Counter-selection of the clones obtained is performed by verifying that they are no longer able to grow on the same medium supplemented with kanamycin 0.0015%.

The strain obtained is called EQ.EC002: MG1655 AsucA b) Deletion of Voperon edd-eda coding the Entner-Doudoroff metabolic pathway

The deletion of the edd-eda operon is carried out by homologous recombination and the use of the Quick & Easy E. coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges.

1. Oligonucleotides designed to amplify an expression cassette of a FRT-PKG-gb2-neo-FRT resistance gene and having a 5 'homologous sequence on 50 nucleotides to adjacent regions of the deletion locus, i.e. ie at positions 1932065-1932115 and 1934604-1934654 on the chromosome thus generating recombination arms of the cassette on the bacterial genome on either side of the entire operon.

 2. The strain of Escherichia coli K-12, EQ.EC002 is transformed by electroporation with the plasmid pRedET according to the kit protocol. The colonies obtained are selected on rich medium complex LB agar 0.2% glucose, tetracycline 0.0003%.

3. The transformation of the amplicon obtained in the first step in the presence of recombinase RedET, induced by arabinose 0.3% liquid LB for 1 h. To do this, a second electroporation of the cells expressing RedET by the deletion cassette is carried out and the colonies are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and added with 0.3% L-arabinose and kanamycin. 0.0015%.

4. Plasmid p707-Flpe (supplied in the Quick & Easy E. coli Gene Deletion Red® kit / ET® Recombination by Gene bridges) is transformed by electroporation according to the kit protocol. The cells are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and added with 0.3% L-arabinose. Counter-selection of the clones obtained is performed by verifying that they are no longer able to grow on the same medium supplemented with kanamycin 0.0015%.

5. The strain obtained is called EQ.EC003: MG1655 AsucA Aedd-eda c) Deletion of gapA gene The deletion of the gapA gene is carried out by homologous recombination and the use of the Quick & Easy E. coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges.

1. Oligonucleotides designed to amplify an expression cassette of a FRT-PKG-gb2-neo-FRT resistance gene and having a homologous sequence on 50 nucleotides to the adjacent regions of the deletion locus, that is to say the coding phase of the gene (gapA) (GenBank: X02662.1) thus generating recombination arms of the cassette on the bacterial genome.

 2. The strain of Escherichia coli K-12, EQ.EC003 is transformed by electroporation with the plasmid pRedET according to the kit protocol. The colonies obtained are selected on rich medium complex LB agar 0.2% glucose, tetracycline 0.0003%.

 3. The transformation of the amplicon obtained in the first step in the presence of the RedET recombinase which will be induced by 0.3% arabinose in liquid LB for 1 h. To do this, a second electroporation of the cells expressing RedET by the deletion cassette is carried out and the colonies are selected on LB agar supplemented with 0.2% glycerol and 0.3% pyruvate, 0.0003% tetracycline and added with 0, 3% L-arabinose and kanamycin 0.0015%.

Deletions are verified by genotyping and sequencing and the names of the strains obtained are

• EQ.EC002: MG1655 _AsucA

 • EQ.EC003: MG \ 655 AsucA Aedd-eda

 • EQ.EC004: MG1655 AsucA Aedd-eda AgapA :: kan

d) Insertion of the engineering needed for CO2 fixation

For the recombinant expression of the different components of a type I RuBisCO in E. coli the genes described in Table 17 below are cloned in the form of a synthetic operon containing the genes described in Table 18 below. . Table 17: genes encoding a PRK system and RuBisCO type I

Table 18: Composition of expression cassettes

To control the level of expression of these genes, ribosome binding sequences (RBSs) presented in Table 19 below, with varying translation efficiencies (Levin-Karp et al, ACS Synth Biol 2013 Jun 21; 2 (6): 327-36, doi: 101021 / sb400002n, Zelcbuch et al., Nucleic Acids Res, 2013 May, 41 (9): e98) are inserted between the coding phase of each gene. The succession of each coding phase intercalated by an RBS sequence is constructed by successive insertions in a vector pZAl l (Expressys) which contains a PLtetO-1 promoter, a pl5A average replication origin and an ampicillin resistance gene.

Table 19: Intercistronic RBS Sequences

Name RBS Sequences

 A (SEQ ID NO: 9) AGGAGGTTTGGA

 B (SEQ ID NO: 10) AACAAAATGAGGAGGTACTGAG

C (SEQ ID NO ^: 11) AAGTTAAGAGGCAAGA

 D (SEQ ID NO: 12) TTCGCAGGGGGAAG

 E (SEQ ID NO: 13) TAAGCAGGACCGGCGGCG

F (SEQ ID NO: 14) CACCATACACTG Several strains are made by electroporating the different vectors presented according to the plan above

EQ.EC 005 - "(EQ.EC 003+ pZAl l): MG1655 AsucA Aedd-eda

EQ.EC 006 · * (EQ.EC 004+ pEQEC005): MG1655 AsucA Aedd-eda A gapA :: kan (RuBisCO) EQ.EC 007 (EQ.EC 004+ pEQECOOO): MG1655 AsucA Aedd-eda A gapA :: kan (RuBisCO + PRK)

EQ.EC 009 · * (EQ.EC 004+ pEQEC008): MG1655 AsucA Aedd-eda AgapA :: kan (PRK)

The clones are selected on LB medium supplemented with glycerol 2 g / L and pyruvate 5 g / L and with 100 mg / L ampicillin. After obtaining a sufficient quantity of biomass, cultures with a volume greater than or equal to 50 ml in a Erlenmeyer flask of at least 250 ml are inoculated in order to adapt the strain to the use of the PRK / RuBisCO engineering. This adaptation is carried out on the LB culture medium with 2 g / l of glucose, and an exogenous C0 ₂ feed at 37 ° C. as described above. e) Production of Glutamate For the production of glutamate, the cells from 500 ml of LB culture are inoculated in 20 ml of MS medium (40 g / l glucose, 1 g / l MgSO ₄ .7H ₂ O, 20 g / L of (NH ₄ ) ₂ SO ₄ , 1 g / L KH ₂ PO ₄ , 10 mg / L FeSO ₄ .7H ₂ O, 10 mg / L MnSO ₄ .7H ₂ O, 2 g / L of yeast, 30 g / l of CaCO ₃ , 100 mg / l of ampicillin at a pressure of 0.1 C0 ₂ atmosphere.

Glutamate and residual glucose are measured with an organic analyzer (Sakura seiki). The Y _p / _S carbon yield is calculated in grams of glutamate produced per gram of glucose consumed.

This yield increases significantly by 10% for the EQ.EC 007 strains (RuBisCO + PRK) compared with the control strains EQ.EC 005 (empty), EQ.EC 006 (RuBisCO alone). The control strain EQ.EC 009 (PRK alone) is not viable. 4B] Improvement of production by inactivation of glvcolvse and oxidative pathway of pentose phosphates a) Removal of the selection cassette by specific recombination of FTR regions by Flp recombinase This step is performed identically to Example 4A] above. The strain obtained is called EQ.EC002: MG1655 AsucA b) Deletion of the zwf gene

The deletion of the zwf gene (GenelD: 946370) is carried out by homologous recombination and the use of the Quick & Easy E.coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges, as detailed in Example 4A. .

The strain obtained is called EQ.ECO10: MG1655 AsucA Azwf c) Deletion of the gapA gene

The deletion of the gapA gene in the strain of Escherichia coli K-12, EQ.ECO10 is carried out by homologous recombination and the use of the Quick & Easy E.coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges, as detailed in Example 4A].

The deletions are verified by genotyping and sequencing and the name of the strains obtained is:

• EQ.EC002: MG1655 AsucA

· EQ.ECO10: MG1655 AsucA Azwf

 • EQ.EC011: MG1655 AsucA Azwf AgapA

d) Insertion of the engineering needed for CO2 fixation

For the recombinant expression of the different components of the functional PRK / RuBisCO system in E. coli the genes described in Table 20 and encoding RuBisCO type I, a phosphoribulokinase, a chaperone and a carbonic anhydrase are cloned in the form of a synthetic operon containing the genes described above (Table 21). Table 20: Gene Coding for RuBisCO Type I, Phosphoribulokinase and Carbonic Anase

Table 21: Plasmid Name and Composition of the Expression Cassettes

To control the level of expression of these genes, ribosome binding sequences (RBSs) shown in Table 17 (see Example 4A)), having variable translational efficiencies (Levin-Karp et al., ACS Synth Biol 2013 Jun 21; 2 (6): 327-36, doi: 101021 / sb400002n; Zelcbuch et al., Nucleic Acids Res. 2013 May; 41 (9): e98) are inserted between the coding phase of each gene. The sequence of each coding phase intercalated by an RBS sequence is constructed by successive insertions in a vector pZAl 1 (Expressys) which contains a PLtetO-1 promoter, an average replication origin pl5A and an ampicillin resistance gene. The addition of carbonic anhydrase (icfA) also allows interconversion of bicarbonate ions into available C0 ₂ molecules and improves the efficiency of RuBisCO.

Several strains are made by electroporating the different vectors presented according to the plan below

EQ.EC 012 - »(EQ.EC 002+ pZAl l): MG1655 AsucA

EQ.EC 014 (EQ.EC 011+ pEQECOOO): MG1655 AsucA AzwfAgapA (RuBisCO + PRK) EQ.EC 015 - »(EQ.EC 011+ pEQEC007): MG1655 AsucA Azwf AgapA (RuBisCO + PRK + Carbonic Anhydrase)

After transformation, the clones are selected on LB glycerol medium, pyruvate, supplemented with 100 mg / L of ampicillin. A phase of adaptation and evolution of strains with the PRK and RuBiSCO engineering is carried out as described in Example 4A]. e) Glutamate production

For the production of glutamate, the cells from 500 ml of LB culture are inoculated into 20 ml of MS medium (40 g / l glucose, 1 g / l MgSO ₄ .7H ₂ O, 20 g / l of (NH ₄ ) ₂ S0 ₄ , 1 g / L KH ₂ PO ₄ , 10 mg / L FeSO ₄ .7H ₂ O, 10 mg / L MnSO ₄ .7H ₂ O, 2 g / L yeast extract, 30 g / L L of CaC0 ₃ , 100 mg / L of ampicillin at a pressure of 0.1 C0 ₂ atmosphere.

Glutamate and residual glucose are measured with a bio-analyzer (YSI Inc.). The Y _p / _S carbon yield is calculated in grams of glutamate produced per gram of glucose consumed.

This yield increases significantly by 15% for the EQ.EC 014 (RubisCO + PRK) and EQ.EC 015 (RubisCO + PRK + Carbonic Anhydrase) strains compared to the EQ.EC 012 (empty) control strains.

4C] Improvement of production by inactivation of glvcolvse and oxidative pathway of pentose phosphates, and overexpression of pyruvate decarboxylase and glutamate dehydrogenase. a) Elimination of the selection cassette by specific recombination of the FTR regions by the Flp recombinase

This step is performed identically to Example 4A] above. The strain obtained is called EQ.EC002: MG1655 AsucA b) Deletion of the zwf gene Deletion of the zwf gene (GenelD: 946370) is carried out by homologous recombination and the use of the Quick & Easy E. coli Gene Deletion Red® / ET® Recombination Kit Kit according to the protocol of the supplier Gene bridges, as detailed in Example 4A]. The strain obtained is called EQ.EC010: MG1655 AsucA Azwf c) Deletion of the gapA gene

The deletion of the gapA gene in the strain of Escherichia coli K-12, EQ.ECO10 is carried out by homologous recombination and the use of the Quick & Easy E.coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges, as detailed in Example 4A]. The deletions are verified by genotyping and sequencing and the name of the strains obtained is:

• EQ.EC002: MG1655 AsucA

 • EQ.ECO10: MG1655 AsucA Azwf

 • EQ.EC011: MG1655 AsucA Azwf AgapA d) Integration of engineering, in particular necessary for the fixation of CO2

For the recombinant expression of the different components of the functional PRK / RuBisCO system in E. coli the genes described in Table 22 and encoding a type II RuBisCO, a phosphoribulokinase and a carbonic anhydrase are cloned in the form of a synthetic operon containing the genes described above (Table 23).

Table 22: genes encoding type II RuBisCO, phosphoribulokinase, carbonic anhydrase, glutamate dehydrogenase and pyruvate carboxylase.

GenBank Organism Genes

 cbbM YP_427487.1 Rhodospirillum rubrum

 Prk BAD78757.1 Synechococcus elongatus

 CA YP_427143.1 Rhodospirillum rubrum

 gdhA NP_416275.1 Escherichia coli K-12

pycA NP_389369.1 Bacillus subtilis

Table 23: Plasmid Name and Composition of the Expression Cassettes

To control the level of expression of these genes, ribosome binding sequences (RBSs) shown in Table 17 (see Example 4A)), having variable translational efficiencies are inserted between the coding phase of each gene. The succession of each coding phase intercalated by an RBS sequence is constructed by successive insertions in a vector pZAl l (Expressys) which contains a PLtetO-1 promoter, a pl5A average replication origin and an ampicillin resistance gene. The addition of a glutamate dehydrogenase (gdhA) and a pyruvate carboxylase (pycA) allow a better production of glutamic acid. The addition of a carbonic anhydrase (CA) further allows an interconversion of bicarbonate ions to available C0 ₂ molecules and improves the efficiency of RuBisCO.

Several strains are made by electroporating the various vectors presented according to the following plan: EQ.EC 016 - "(EQ.EC 002+ pEQECOl 1): MG1655 AsucA (glutamate dehydrogenase + pyruvate carboxylase)

EQ.EC 017 (EQ.EC 011+ pEQEC009): MG1655 AsucA Azwf AgapA (RuBisCO + PRK + glutamate dehydrogenase + pyruvate carboxylase)

EQ.EC 018 (EQ.EC 011+ pEQECO10): MG1655 AsucA Azwf AgapA (RuBisCO + PRK + carbonic anhydrase + glutamate dehydrogenase + pyruvate carboxylase + carbonic anhydrase)

After transformation, the clones are selected on LB glycerol medium, pyruvate, supplemented with 100 mg / L of ampicillin. A phase of adaptation and evolution of strains with the PRK and RuBiSCO engineering is carried out as described in Example 4A]. e) Glutamate production

For the production of glutamate, the cells from 500 ml of LB culture are inoculated into 20 ml of MS medium (40 g / l glucose, 1 g / l MgSO ₄ .7H ₂ O, 20 g / l of (NH ₄ ) ₂ S0 ₄ , 1 g / L KH ₂ PO ₄ , 10 mg / L FeSO ₄ .7H ₂ O, 10 mg / L MnSO ₄ .7H ₂ O, 2 g / L yeast extract, 30 g / L L of CaC0 ₃ , 100 mg / L of ampicillin at a pressure of 0.1 C0 ₂ atmosphere.

Glutamate and residual glucose are measured with a bio-analyzer (YSI Inc.). The Y _p / _S carbon yield is calculated in grams of glutamate produced per gram of glucose consumed.

This yield increases significantly by 15% for the strains EQ.EC 017 and EQ.EC 018 compared to the control strain EQ.EC 016.

Example 5: Improvement of polyhydroxybutyrate production in C. necator

The increase of the reducing power obtained thanks to the genetic modifications proposed according to the invention can also have a considerable gain on already existing metabolic pathways.

This is the case for the bacterial strain Cupriadus necator ATCC 17699 which naturally produces polyhydroxybutyrate (PHB). This bacterium is able to develop both in autotrophic conditions and in heterotrophic conditions. The deletion of the gapA gene (glyceraldehyde-3-phosphate dehydrogenase NC_008313.1) makes it possible to deviate the metabolic flux on the pentose phosphate pathway and to increase the NADPH reduced nucleotide pool making it possible to increase the production yield of PHB.

This C. necator H16 strain has a mega plasmid pHG1 and two chromosomes. Deletion of the gapA gene is achieved by generating a vector containing the Bacillus substilis sac B suicide gene for gram negative bacteria (Quandt et al., Gene 1993 May 15; 127 (1): 15-21; Lindenkamp et al., Appl Environ Microbiol 2010 Aug; 76 (16): 5373-82 and Appl Environ Microbiol, 2012 Aug; 78 (15): 5375-83). a) Inactivation of the Entner-Doudorojf metabolic pathway

Two PCR amplicons corresponding to the adjacent regions of the edd and eda genes (upstream from edd and downstream from eda) are cloned by restriction according to the procedure described in Srinivasan et al. (Appl., Environ Microbiol., 2002 Dec, 68 (12): 5925-32), in the plasmid pJQ200mpl8Cm. The modified plasmid pJQ200mpl 8Cm :: Aedd-eda is then transformed into a strain of E. coli S 17-1 by transformation by the calcium chloride method. The transfer of the genetic material in C. necator is done by conjugation by depositing on a plate a culture deposition point of C. necator on a box containing a cell layer of S 17-1 bacteria. The selection is done on NT medium (Nutrient browth) at 30 ° C in the presence of 10% sucrose as a selection (Hogrefe et al., Bacteriol 1984 Apr; 158 (l): 43-8) and validated on a mineral medium containing 50 μg / ml chloramphenicol.

Deletions are validated by genotyping and sequencing. The strain EQCN_002 obtained is thus deleted for the genes of the Entner-Doudoroff edd-eda metabolic pathway. EQCN_002: H16 Aedd-eda. b) Inactivation of the glycolysis pathway

Two PCR amplicons corresponding to the adjacent regions of the gapA gene are cloned by restriction according to the procedure described in Lindenkamp et al. 2012, in the plasmid pjQ200mpl8Tc. The modified plasmid pjQ200mpl8Tc :: Aga /? A is then transformed into a strain of E. coli S 17-1 by transformation by the calcium chloride method. The transfer of the genetic material is done by conjugation by depositing on a plate a culture deposition point of C. necator on a box containing a cell layer of S 17-1 bacteria. The selection is made on NT medium (Nutrient browth) at 30 ° in the presence of 10% sucrose as a selection (Hogrefe et al., J Bacteriol 1984 Apr; 158 (l): 43-8.) And validated on a medium. mineral containing 25 μg / ml tetracycline.

Deletions are validated by genotyping and sequencing. The strain EQCN_003 obtained is thus deleted for the gapA gene. EQCN_003: H16 Aedd-eda AgapA.

The strain EQCN_003, deleted in the glycolytic pathway at the gapA gene and in the Entner Doudoroff pathway at the edd-eda genes, is cultured in order to improve the production yield of the PHB by fixing exogenous C0 ₂ via the use of PRK and RuBisCO enzymes. b) Production of PHB in a bioreactor

The inoculum from a frozen stock is spread on a solid medium at a rate of 50 to 100 μΐ _^ from a cryotube incubated at 30 ° C for 48 to 96 h, in the presence of fructose. Expression of the genes encoding RuBisCO and PRK are maintained in C. necator in aerobic heterotrophic conditions (Rie Shimizu et al., Sci Rep. 2015; 5: 11617. Published online 2015 Jul 1.).

Batch cultures in Erlenmeyer flasks (10 mL in 50 mL, then 50 mL in 250 mL) are performed with the appropriate culture medium, 20 g / L fructose and 10% exogenous CO ₂ supply. in shaking incubator (100-200 RPM, 30 ° C), with a minimum inoculation of 0.01.

The strain of interest EQCN_003 improving the production yield of PHB is compared with a reference strain H16 naturally accumulating PHB under heterotrophic conditions in the presence of a nutritional limitation. The productivity of the strains is compared in bioreactors. The cultures carried out in bioreactors are inoculated from solid and / or liquid amplification chains into Erlenmeyer flasks under the conditions described above. The bioreactors, Mycontrol type (Applikon Biotechnology, Delft, Netherlands) of 750 ml or Biostat B (Sartorius Stedim, Goettingen, Germany) of 2.5 L, are inoculated at a density equivalent to 0.01 DOδ20nm. The accumulation of PHB is decoupled from growth. The culture is regulated at 30 ° C, aeration is between 0.1 VVM (gas volume / liquid volume / min) and 1 VVM to maintain a minimum concentration of dissolved oxygen greater than 20% (30 ° C, 1 bar), the agitation is adapted according to the scale of the bioreactor used. The inlet gas flow rate consists of air optionally supplemented with CO2. The CO2 supplementation is between 1 and 10%. The pH is regulated at 7 by a solution of ammonia at 14 or 7%. The fed-batch culture mode allows a non-limiting carbon substrate contribution associated with a phosphorus or nitrogen limitation, while maintaining a constant carbon / phosphorus or carbon / nitrogen ratio. The extraction and quantification of PHBs are carried out according to the method of Brandi et al. (Appl Environ Microbiol 2013 Jul; 79 (14): 4433-9). The protocol consists of adding 1 ml of chloroform to 10 mg of lyophilized cells, followed by addition of 850 μl of methanol and 150 μl of sulfuric acid. The mixture is heated 2.5 h at 100 ° C, cooled and 500 μΐ of water are added. The two phases are separated by centrifugation and the organic phase is dried by the addition of sodium sulfate. The samples are filtered and analyzed as described by Millier et al. (Appl Environ Microbiol 2013 Jul; 79 (14): 4433-9). Comparing the wild C. necator H16 cultures and the EQCN_003: H16 Aedd-eda AgapA strain, there is a 5% increase in the carbon yield, corresponding here to the gram ratio of PHB per gram of fructose consumed. Example 6 Improvement of GABA Production in E. coli

An Escherichia coli strain K-12, genetically engineered to increase the yield of its glutamate production according to Example 4B], can be further modified to allow the constitutive expression of gadB glutamate decarboxylase (Gene ID: 946058) and thus increase the production yield of γ-aminobutyric acid.

The deletion of the alpha-ketoglutarate dehydrogenase gene also makes it possible to increase the production of glutamate (Usuda et al., J. Biotechnol, 2010 May 3, 147 (1): 17-30, doi: 10.1016 / j.jbiotec. 2010.02.018).

In this example, the following strains obtained according to Example 4B] are used: · EQ.EC002: MG1655_AsucA

 • EQ.EC010: MG1655_AsucA Azwf

 • EQ.EC011: MG1655 AsucA Azwf AgapA a) Overexpression of the gadB gene is subcloned into a bacterial expression vector pZE21MCS (EXPRESSYS). This vector has a ColEl origin of replication and an antibiotic resistance gene kanamycin.

Promptly, the gadB gene coding phase (Gene ID: 946058) is amplified from the genome of the MG1655 AsucA strain with primers homologous to the Escherichia coli K-12 genome spanning positions 1570595 to 1570645 and 1572095 to 1572045. Each of these primers are coupled to homologous floating sequences on 18 nucleotides at the ends of the fragment obtained by amplification of the pZE21MCS vector excluding the multiple cloning site. The two amplicons are combined according to the protocol of the In-Fusion® HD Cloning Kit User Manual - Clontech kit to form the plasmid pEQEC030 allowing the constitutive overexpression of the gadB gene. b) Insertion of the engineering needed for CO2 fixation

 For the recombinant expression of the different components of a functional type I RuBisCO in E. coli, the genes described in Table 17 (Example 4A)) are cloned in the form of a synthetic operon following the constructional structure. described in Table 22.

The assembly of the different vectors

 The coding sequences (CDS) of the genes described in

 Table 24 are amplified and assembled into blocks according to the protocol provided with the NEBuilder® HiFi DNA Assembly Master Mix kit (E2321) to obtain 3 integration blocks described in

 Table 24. Each block is then amplified according to the In-Fusion® HD Cloning Kit User Manual - Clontech kit protocol to form the plasmids described below in FIG.

 Table 24.

Table 24: Composition of expression cassettes

To control the level of expression of these genes, ribosome binding sequences (RBS) shown in Table 19 (Example 4B)), with variable translation efficiencies (Levin-Karp et al., ACS Synth Biol. 2013 Jun 21; 2 (6): 327-36, doi: 101021 / sb400002n; Zelcbuch et al., Nucleic Acids Res. 2013 May; 41 (9): e98) are inserted between the coding phase of each gene. The succession of each coding phase intercalated by an RBS sequence is constructed by successive insertions in a vector pZAl l (Expressys) which contains a PLtetO-1 promoter, a pl5A average replication origin and an ampicillin resistance gene. The addition of a glutamate decarboxylase (gadB) also allows a conversion of glutamate to gamma-aminobutyrate (GABA). Several strains are made by electroporating the different vectors presented according to the plan below

EQ.EC 013 (EQ.EC 002+ pZAll + pEQ030): MG1655 AsucA + (gadB)

EQ.EC 020 (EQ.EC 011 + pEQ030 + pEQEC006): MG1655 AsucA Azwf AgapA +

 (gadB) + (RuBisCO + PRK)

After transformation, the clones are selected on LB glycerol medium, pyruvate, supplemented with 100 mg / l ampicillin and 30 mg / l kanamycin. A phase of adaptation and evolution of strains with the PRK and RuBiSCO engineering is carried out as described in Example 4A]. c) Production of GABA

For the production of GABA, cells from 500 ml of LB culture are inoculated into 20 ml of MS medium (40 g / l glucose, 1 g / l MgSO ₄ .7H ₂ O, 20 g / l of (NH ₄ ) ₂ S0 ₄ , 1 g / L KH ₂ PO ₄ , 10 mg / L FeSO ₄ .7H ₂ O, 10 mg / L MnSO ₄ .7H ₂ O, 2 g / L yeast extract, 30 g / L CaC0 _3, 100 mg / L ampicillin and 30 mg / L kanamycin at a pressure of 0.1 atmosphere C0 ₂ at 30 ° C at pH 3.5.

The concentration of GABA is measured by high performance liquid chromatography (HPLC), using an OptimaPak C18 column (4.6 x 150 mm, RS tech Corporation, Daejeon, Korea). The samples are centrifuged at 12,000 rpm for 5 minutes, 100 μl of the supernatant transferred to a new Eppendorf tube. In these tubes were added the following reagents: 200 μΐ _^ buffer 1 M sodium bicarbonate pH 9.8, 100 μΐ _^ dansyl chloride 80 g / L in acetonitrile and 600 μΐ _^ of bidistilled water. The mixture is incubated at 80 ^° C. for 40 minutes. The reaction is stopped by adding 100 μΐ _^ of 2% acetic acid. The mixture is centrifuged at 12,000 rpm for 5 minutes. The supernatant is then filtered through a 0.2 μιη Millipore filter and analyzed by HPLC on an Agilent system using a UV detector. Derivatized samples are separated using a binary nonlinear gradient using eluent A [tetrahydrofuran / methanol / 50mM sodium acetate pH 6.2 (5: 75: 420, by volume)] and eluent B ( methanol). Residual glucose is measured with a bio-analyzer (YSI Inc.).

The Y _p / _S carbon yield is calculated in grams of GABA produced per gram of glucose consumed. This yield increases significantly by 15% for the strain EQ.EC 020 AsucA Azwf AgapA (RubisCO + PRK) + (GadB) compared with the control strains EQ.EC 013 AsucA (GadB).

Example 7 Improvement of succinate and oxalate production in E. coli

Escherichia coli strain K-12, genetically engineered to allow the constitutive expression of FGHLOXDH1 glyoxylate dehydrogenase (Gene ID: 946058) from Fomitopsis palustris, to reduce icd gene expression (Gene ID: 945702), and to inactivate the genes aceB (GenelD 948512) and sdhA (Gene ID: 945402), would increase the production yield of succinate and oxalic acid.

The reduction of isocitrate dehydrogenase (icd) expression makes it possible to redirect the metabolic flow towards the glyoxylic shunt. The inactivation of malate synthase (aceB) and succinate dehydrogenase (sdhA) makes it possible not to reconsomerate respectively the glyoxylate and the succinate produced. Deletion of the succinate dehydrogenase gene enhances succinate production under aerobic conditions (Yang et al., Microbiol Res 2014 May-Jun; 169 (5-6): 432-40). The deletion of the malate synthase gene allows the accumulation of glyoxylate which will be converted to oxalate by the constitutive expression of glyoxylate dehydrogenase.

In this example, a strain of Escherichia coli K-12 MG1655 whose sdhA gene has been deleted is used. This strain is derived from a gene deletion library (Baba et al., Mol Syst Biol., 2006; 2: 2006.0008) in Escherichia coli K-12 and provided by the Coli Genetic Stock Center under the name JW0715-2 and with the reference 8302. (JW0713-1: MG1655 AsdhA :: Kan). a) Elimination of the Selection Cassette by Specific Recombination of the FTR Regions by the Flp Recombinase In order to be able to reuse the same deletion strategy as that used to construct the JW0715-2 strain above (Rodriguez et al, 2016), the cassette selection is deleted using a recombinase.

The plasmid p707-Flpe (supplied in the Quick & Easy E. coli Gene Deletion Red® kit / ET® Recombination by Gene bridges) is transformed by electroporation according to the kit protocol. The cells are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and added with 0.3% L-arabinose. A counter selection of the clones obtained is performed by verifying that they are no longer able to grow on the same medium supplemented with kanamycin 0.0015%.

The strain obtained is called EQ.EC040: MG1655 AsdhA b) Deletion of the aceB gene The deletion of the aceB gene (GenelD 948512) is carried out by homologous recombination and the use of the Quick & Easy E. coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges.

Oligonucleotides designed to amplify an expression cassette of a FRT-PKG-gb2-neo-FRT resistance gene and having a 50 nucleotide homologous sequence to adjacent regions of the deletion locus, i.e. at the positions of 4215428 to 4215478. and 4217129. to 4217079 on the chromosome thus generating recombination arms of the cassette on the bacterial genome on either side of the coding sequence of the aceB gene.

The strain of Escherichia coli K-12, EQ.EC040 is transformed by electroporation with the plasmid pRedET according to the kit protocol. The colonies obtained are selected on rich medium complex LB agar 0.2% glucose, tetracycline 0.0003%.

The transformation of the amplicon obtained in the first step in the presence of recombinase RedET, induced by arabinose 0.3% liquid LB for 1H. To do this, a second transformation of the deletion cassette is carried out by electroporation in cells expressing RedET and the colonies are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and 0.3% L added. -arabinose and kanamycin 0.0015%.

Plasmid p707-Flpe (supplied in the Quick & Easy E. coli Gene Deletion Red® kit / ET® Recombination by Gene bridges) is transformed by electroporation according to the kit protocol. The cells are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and added with 0.3% L-arabinose. Counter-selection of the clones obtained is carried out by verifying that they are no longer able to grow on the same medium supplemented with kanamycin 0.0015%.

The strain obtained is called EQ.EC041: MG1655 AsdhA AaceB c) Change of the promoter of the icd gene . Strategy

 The replacement of the native promoter of the icd gene (Gene ID: 945702) by a weaker promoter is carried out by homologous recombination and the use of the Quick & Easy E. coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges . . Introduction of the weak P oxbl promoter

The promoter of the icd gene is replaced by a cassette coupling the P ₀ xbi promoter, characterized as weak, and a cassette of an antibiotic resistance gene to allow the selection of the insertion of the P _ox bi cassette with gene of resistance to an antibiotic.

Oligonucleotides designed to amplify an expression cassette of a FRT-PKG-gb2-neo-FRT resistance gene and having a 50 nucleotide homologous sequence at the left-adjacent region of the foot promoter locus (Genomic target LA) for the trace oligo that is to say at the positions of 1194911 to 1194961 on the genome, and the sequence Spacer R (Table 23) for the oligo reverse allow the amplification of a fragment allowing the assembly with the fragment P ₀ xbi. Oligonucleotides designed to amplify the promoter P _ox bi from plasmid PSF- OXB1 (Sigma # OGS553) and having a 5 'sequence homologous over 50 nucleotides to the right flanking region of the locus Foot promoter (Genomic target RA) for the oligo reverse, that is to say at the positions of 1195173 to 1195123 on the genome, and the Spacer S sequence (Table 25) for the oligo produce the amplification of the P _ox bi fragment. Amplification of a fusion fragment using the NEBuilder® HiFi DNA Assembly Master Mix Kit (E2321) allows the substitution promoter to be associated with an antibiotic selection cassette.

Table 25: Sequences of the primers to amplify the OXB1 gene promoter

Name Homology sequences with PSF-OXB1 vector

POXB1-S (SEQ ID NO: 15) TCGTTGCGTTACACACAC

 POXB1-R (SEQ ID NO: 16) TGTGTCGAGTGGATGGTAG

 Spacer S (SEQ ID NO: 17) GCATGAATTCG

Spacer R (SEQ ID NO: 18) CGAATTCATGC The Escherichia coli strain K-12, EQ.EC041 is transformed by electroporation with the plasmid pRedET according to the kit protocol. The colonies obtained are selected on rich medium complex LB agar 0.2% glucose, tetracycline 0.0003%.

The transformation of the amplicon obtained in the first step in the presence of recombinase RedET, induced by arabinose 0.3% in liquid LB for 1h. To do this, a second transformation of the deletion cassette is carried out by electroporation in cells expressing RedET and the colonies are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and 0.3% L added. -arabinose and kanamycin 0.0015%.

Plasmid p707-Flpe (supplied in the Quick & Easy E. coli Gene Deletion Red® kit / ET® Recombination by Gene bridges) is transformed by electroporation according to the kit protocol. The cells are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and added with 0.3% L-arabinose. Counter-selection of the clones obtained is carried out by verifying that they are no longer able to grow on the same medium supplemented with kanamycin 0.0015%. The strain obtained is called EQ.EC042: MG1655 AsdhA AaceB Foot :: P _ox bi d) Deletion of the zwf gene

Deletion of the zwf gene (GenelD: 946370) is carried out by homologous recombination and the use of the Quick & Easy E.coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges. Oligonucleotides designed to amplify an expression cassette of a FRT-PKG-gb2-neo-FRT resistance gene and having a 50 nucleotide homologous sequence to adjacent regions of the deletion locus, i.e. at positions 1934789 to 1934839 and 1936364 to 1936314 on the chromosome thus generating recombination arms of the cassette on the bacterial genome on either side of the entire operon. The strain of Escherichia coli K-12, EQ.EC042 is transformed by electroporation with the plasmid pRedET according to the kit protocol. The colonies obtained are selected on rich medium complex LB agar 0.2% glucose, tetracycline 0.0003%.

The transformation of the amplicon obtained in the first step in the presence of recombinase RedET, induced by 0.3% arabinose in liquid LB for 1 h. To do this, a second transformation of the deletion cassette is performed by electroporation in cells expressing RedET and colonies are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and added with 0.3% L-arabinose and 0.0015% kanamycin.

Plasmid p707-Flpe (supplied in the Quick & Easy E. coli Gene Deletion Red® kit / ET® Recombination by Gene bridges) is transformed by electroporation according to the kit protocol. The cells are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and added with 0.3% L-arabinose. Counter-selection of the clones obtained is performed by verifying that they are no longer able to grow on the same medium supplemented with kanamycin 0.0015%.

The strain obtained is called EQ.EC043: MG1655 AsdhA AaceB Foot :: P _ox bi Azwf e) Deletion of gapA gene

The deletion of the gapA gene is carried out by homologous recombination and the use of the Quick & Easy E.coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges.

Oligonucleotides designed to amplify an expression cassette of a FRT-PKG-gb2-neo-FRT resistance gene and having a 5 'homologous sequence on 50 nucleotides to the adjacent regions of the deletion locus, ie the coding phase of the gene (gapA) (GenBank: X02662.1) thus generating recombination arms of the cassette on the bacterial genome.

The strain of Escherichia coli K-12, EQ.EC043 is transformed by electroporation with the plasmid pRedET according to the kit protocol. The colonies obtained are selected on rich medium complex LB agar 0.2% glucose, tetracycline 0.0003%.

The transformation of the amplicon obtained in the first step in the presence of the recombinase RedET is induced by 0.3% arabinose in liquid LB for 1H. To do this, a second electroporation of the cells expressing RedET by the deletion cassette is carried out and the colonies are selected on LB agar supplemented with 0.2% glycerol and 0.3% pyruvate, 0.0003% tetracycline and added with 0.3% L-arabinose and kanamycin 0.0015. %.

Plasmid p707-Flpe (supplied in the Quick & Easy E. coli Gene Deletion Red® kit / ET® Recombination by Gene bridges) is transformed by electroporation according to the kit protocol. The cells are selected on LB agar supplemented with 0.2% glucose, 0.0003% tetracycline and added with 0.3% L-arabinose. A counter selection of the clones obtained is carried out by verifying that they are no longer able to grow on the same medium supplemented with kanamycin 0.0015%. The strain obtained is called EQ.EC044: MG1655 AsdhA AaceB Foot :: P _ox bi tozwf AgapA f) Overexpression constitutive of genes FPGLOXDH1 and aceA

The coding sequences (CDS) of the genes FPGLOXDH1 (Gene ID: 946058) and aceA (Gene ID: 948517) subcloned in a bacterial expression vector pZE21MCS (EXPRESSYS) in the form of synthetic operons according to the structure described in Table 24 This vector has a ColEl origin of replication and an antibiotic resistance gene kanamycin.

Each of these primers is coupled to 18 nucleotide homologous floating sequences at the ends of the fragment obtained by the amplification of the pZE21MCS vector excluding the multiple cloning site. The two amplicons are combined according to the In-Fusion® HD Cloning Kit User Manual - Clontech protocol to form the plasmid pEQEC035 allowing constitutive overexpression of the FPGLOXDH1 and aceA genes. g) Insertion of the engineering needed for CO2 fixation

 For recombinant expression of the different components of a functional type I RuBisCO in E. coli, the genes described in Table 17 (Example 4A)) are cloned in the form of a synthetic operon.

The coding sequences (CDS) of the genes described in Table 2 are amplified and assembled in blocks according to the protocol provided with the NEBuilder® HiFi DNA Assembly Master Mix kit (E2321) so as to obtain 3 integration blocks described in Table 26. Each block is then amplified according to the In-Fusion® HD Cloning Kit User Manual - Clontech kit protocol to form the plasmids described below in Table 24.

 Table 26: Composition of expression cassettes

Structure of the synthetic operon

 Block Type 1 Block I I Block I I I

Plasmid

 CDS

 CDS A RBS1 CDS B RBS2 RBS3 CDS D

 VS

 pZAll pZAll

 pEQEC006 pZAll rbcS D rbcL B rbcX F prk pZE21MCS pZE21MCS

pEQEC035 pZE21MCS FPG LOXDH 1 D aceA To control the level of expression of these genes, ribosome binding sequences (RBSs) shown in Table 19 (Example 4B), having variable translational efficiencies (Levin-Karp et al, ACS Synth Biol 2013 Jun 21; 2 (6): 327-36. Doi: 10.1021 / sb400002n; Zelcbuch et al., Nucleic Acids Res. 2013 May; 41 (9): e98) are inserted between the coding phase of each gene. The sequence of each coding phase intercalated by an RBS sequence is constructed by successive insertions in a vector pZAl 1 (Expressys) which contains a PLtetO-1 promoter, an average replication origin pl5A and an ampicillin resistance gene.

Several strains are made by electroporating the different vectors presented according to the plan below

EQ.EC045 (EQ.EC042 + pZAll + pZE21MCS): MG1655 AsdhA AaceB P _icd :: P _oxbl

EQ.EC046 (EQ.EC045 + pEQEC006 + pEQEC035): MG1655 AsdhA AaceB P _icd :: P _oxbl Azwf AgapA + (FPGLOXDHl + aceA) + (RuBisCO + PRK)

After transformation, the clones are selected on LB glycerol medium, pyruvate, supplemented with 100 mg / l ampicillin and 30 mg / l kanamycin. A phase of adaptation and evolution of strains with the PRK and RuBiSCO engineering is carried out as described in Example 4A]. h) Production of succinate and oxalate

For the production of succinate and oxalate, the cells from 500 ml of LB culture are inoculated into 20 ml of MS medium (40 g / l of glucose, 1 g / l MgSO ₄ .7H ₂ O, 20 g / l). L (NH ₄ ) ₂ SO ₄ , 1 g / L KH ₂ PO ₄ , 10 mg / L FeSO ₄ .7H ₂ O, 10 mg / L MnSO ₄ .7H ₂ O, 2 g / L of yeast extract 30 g / l of CaCO ₃ , 100 mg / l of ampicillin and 30 mg / l of kanamycin at a pressure of 0.1 C0 ₂ atmosphere at 30 ^° C. at a pH of 3.5.

The concentration of succinate is measured by high performance liquid chromatography (HPLC), the culture samples are centrifuged at 12,000 g for 5 min. . Succinate dosage

The culture supernatant is filtered through a 0.2 μιη Millipore filter and analyzed on an Agilent HPLC system (series 1100) equipped with a cation exchange column. (Aminex HPX87-H, Bio-Rad, Hercules, CA, USA), a UV absorbance detector (Agilent Technologies, G1315D) and a refractive index (RI) detector (Agilent Technologies, HP 1047 A). The samples are separated on a mobile phase of 5 mM H 2 SO 4 at a flow rate of 0.4 ml / min. The oven temperature of the column is 65 ^° C.

Residual glucose is measured with a bio analyzer (Ysi Inc.) or HPLC-refractometry with an Aminex HPX87-H column. The Y _p / _S carbon yield is calculated in gram of succinate produced per gram of glucose consumed.

This yield increases significantly by 6% for the engineering strain EQ.EC046 compared to the control strain EQ.EC045 (empty). ii) Voxalate dosage

The pellets are washed twice with 10 mM potassium phosphate buffer (pH 7.5) containing 2 mM EDTA and stored at -20 ^° C. Samples (1 ml) are transferred to a pre-cooled tube with 0.75 g of glass beads (425-600 μιη) and introduced into a Fast Prep machine (Thermo Scientific, Erembodegem, The Netherlands) and subjected to 4 gusts of 20 seconds at the speed setting 6. The lysates are centrifuged for 20 min at ^{40 °} C. and 36,000 g. Total protein assays are performed according to Lowry's method (Lowry et al., 1951). The oxaloacetate acetyl hydrolase activity (EC 3.7.1.1) is measured using a modification of the direct optical determination of oxaloacetate (OAA) at 255 nm as described in (Lenz et al., 1976). The disappearance of the enol tautomer of ΓΟΑΑ is monitored at 255 nm at 25 ^° C. in a Hitachi model 100-60 spectrophotometer (Hitachi, Tokyo, Japan), using quartz cuvettes. The reaction mixture of 1 ml contains 100 mM imidazole-HCl (pH 7.5), 0.9 mM MnCl ₂ .2H ₂ O, 1 mM OAA, 20 μl of cell extract (controls with different volumes of cell extracts confirm the linearity between the enzyme activity and the amount of cell extract). The reaction is started by adding the cell extract.

The Y _p / _S carbon yield is calculated in grams of doxalate produced per gram of glucose consumed.

This yield increases significantly by 3% for the engineering strain EQ.EC046 compared with the control strain EQ.EC045 (empty). Example 8: Improvement of citrate production in Aspergillus niger a) Strategy

The inactivation of the pgkA gene (Locus tag An08g02260), leading to the non-functionality of the glycolysis pathway, and that of the gsdA gene (Locus tag An02gl2140), which inhibits the oxidative part of the pentose phosphate pathway, are exploited. to integrate the 6 genes allowing the functional expression of the enzymes PRK and RuBisCO, namely RbcS, RbcL, RbcX, GroES, GroEL and PRK allowing the fixation of the C0 ₂ . b) DNA constructs i) Sequences of the guide RNAs to target the gene to be inactivated In each of these two genes, a nucleotide sequence punctuated by an NGG motif (underlined CRISPR target sequence) was determined (Table 27). In both cases, this sequence is specific to the targeted gene but also unique in the genome of Aspergillus niger. These sequences are used to express an RNAguide (gRNA) which by forming a hetero duplex with the homologous region of the genome of Aspergillus niger directs the action of the CAS9 endonuclease to induce a double strand break specifically on the chosen locus.

Table 27: Target sequence for gRNA

Plasmid pFC332 (Addgene # 87845) described in Sarkari et al. (Bioresour Technol 2017 Dec; 245 (Pt B): 1327-1333) contains an expression cassette of a gRNA, a cassette allowing the functional expression of the endonuclease Cas9 and an Hph cassette allowing the selection of this plasmid . The plasmid further contains the AMA1-2.8 fragment which allows transient propagation of the plasmid. Finally, an origin of replication for E. coli is also present. In order to target another gene, the gRNA cassette between FS A and FS B can be easily exchanged. This plasmid is modified by amplifying the different parts of this plasmid, in order to eliminate the antibiotic selection cassette and to modify the nucleotides allowing the specificity of the gRNA in favor of the sequences described in Table 27 to form the plasmids pEQ0610 for target pgkA and pEQOol 1 to target gsdA.

Donor plasmid

Regions of homologies with the genome

The donor plasmid consists of an In-Fusion® HD Cloning Kit User Manual - Clontech assembly between the plasmid pUC19 (GenBank: M77789.2) and the genomic targeting sequences (LA and RA) of approximately 1500 bp each, homologues at the chosen location for integration. The LA and RA sequences are flanked 5 'and 3', respectively, of the locus sequence targeted by the ARNguide. The genomic DNA / RNAide heterodimer is recognized by the double-stranded cleavage Cas9 endonuclease (locus 1: pgkA, locus2: gsdA) (Table 28). The RA and LA fragments are amplified with the primers for the pgkA gene and the gsdA gene (Table 29). The sequences of the amplicons are given in the listing sequence (SEQ ID NO: 55 to SEQ ID NO: 58). An 18 nucleotide extension on all the forward primers of the three fragments is added according to the In-Fusion® HD Cloning Kit User Manual - Clontech protocol, in order to allow a functional assembly of the plasmids (pEQ0600 or pEQ0601) and the introduction of two restriction endonuclease sites of type II (restriction enzymes I-Ceul and I-Sce) I which have large asymmetric recognition sites (12 to 40 base pairs). These are recognition sequences of 18 base pairs, so rare. The fact that the cleavage is asymmetrical at the recognition site makes it possible to release a fragment devoid of sequences derived from the bacterial vector pUC19. These two enzymes make it possible to extract by restriction the integration block after amplification by cloning in E. coli. Table 28: Amplification of regions of homologies for the gene

Table 29: Amplification of regions of homologies for the gene

Expression cassettes of engineering

 Promoters and terminators are identified on the basis of GenBank data. The promoters chosen are determined from the +1 transcription point and go back 1.4Kb upstream so as to cover both the "core" sequences (TATA box) and the trans-activator sequences allowing the optimal functionality of the promoter concerned.

For terminators, the cut is performed 500 bp after the stop codon of the gene.

The structure of each integration block of 4 expression cassettes is defined as follows: the first level comprises simple elements, namely promoters, coding sequences (CDS) and terminators. The promoters (

Table 30) and terminators (Table 31), whose sequences are provided in the listing sequence (SEQ ID NO: 59-62), are amplified and assembled with the engineering CDSs according to Table 32. The CDSs, whose sequences are provided in the listing sequence (SEQ ID NO: 63-66), are amplified according to the protocol provided with the NEBuilder® HiFi DNA Assembly Master Mix kit (E2321) to obtain the functional expression cassettes compiled in the table . Each 4 gene integration block is organized to include 4 different couples (promoter / terminator) in order to limit trans interference. Each 6-gene integration block is organized to include 6 different couples (promoter / terminator) in order to limit transcriptional interferences Donor fragment for insertion into the genome's target locus

The different multiple expression cassettes (RbcS, RbcL and RbcX) or (GroES, GroEL and PRK) are amplified and assembled around an antibiotic selection cassette (

Table), according to the protocol of the In-Fusion® HD Cloning Kit User Manual - Clontech, to form the donor plasmids (pEQ0602 or pEQ0603).

Table 30: Native localization of Aspergillus niger promoters used in genomic combinatorics to insert the 6 genes of CO 2 fixation engineering into the genome of Aspergillus niger.

Table 31: Native localization of Aspergillus Niger terminators used in genomic combinatorics to insert the 6 genes of C02 fixation engineering into the genome of Aspergillus niger.

Terminators Organism Gene I D Primer forward Primer reverse

 TetrpC A. AN 0648 TGATTTAATAGCTCCATGTCAAC G G GTAAACG ACTCATAG G AG AGTTG AAG nidulans (SEQ ID No. 37) (SEQ ID No. 41)

FGSC A4

 TnaD A. AN 1006 ACGGGTTCGCATAGGTTTGG G G ATATTTG ACG ACG ATTCTG AG G Nidulans (SEQ ID No. 38) (SEQ ID NO: 42)

FGSC A4

 TglaA A. niger An03g06 CGACCGCGACGGTGACTGAC CCGGAGATCCTGATCATCCG (SEQ I D

 CBS 513-550 (SEQ ID No. 39) No. 43)

 oo

 TgpdA A. niger An l6g01 G AATC AG G ACG G CAAACTG AAT CGTG GTCTAG CTG CCCTCC (SEQ I D

 CBS 513-830 (SEQ ID No. 40) No. 44)

88 Table 32: Assembly of expression cassettes

Cassette Gene GenBank Optimization Promoter Codon Expression Terminator

 CASE 1 RbcL BAD78320.1 Yes PmbfAp trpct

 CAS 2 RbcS BAD78319.1 Yes PcoxAp TniaD

 CAS 3 RbcX BAD80711.1 Yes PsrpBp glaAt

 CASE 4 HPH pUG75 (P30671) Not picdAp TgpdA

 CASE 5 GroES U00096 No PmbfAp trpct

 CASE 6 GroEL AP009048 No PcoxAp TniaD

 CASE 7 PRK BAD78757.1 Yes PsrpBp glaAt

 CASE 8 Wheat pUG66 (P30116) No picdAp TgpdA

Table 33: Assembly of Plasmids

Plasmid Sequence Promoter Gene Terminator Ori Sequence Marker genomic selection Genomic

 pEQ0600 LAI RAI coli Ampicillin pEQ0601 LA2 RA2 coli Ampicillin

 PmbfAp RbcL trpct coli Ampiciline and pEQ0602 PcoxAp RbcS TniaD coli Hydromycin

 LA2 PsrpBp RbcX glaAt RA2 coli B

 picdAp Hph TgpdA coli

PmbfAp GroES Trpct coli Ampiciline and pEQ0603

 PcoxAp GroEL TniaD coli Bleomycin

LAI RAI

 PsrpBp PRK GlaAt coli

picdAp Ble TgpdA coli

c) Transformation of Aspergillus niger

The transformation of DNA in Aspergillus niger is constrained by the presence of the fungal cell wall, and is extremely inefficient compared to yeast or Escherichia coli. Nevertheless, the transformation of protoplasts prepared from fungal hyphae or conidiospores into germination by treatment with cell wall degrading enzymes such as the cocktail "Trichoderma harzianum Lysing Enzyme®, Streptomyces griseus chitinase and Helix pomatia β-glucuronidase" ( Bekker et al., J. Microbiol Methods, 2009 Mar; 76 (3): 305-6) provides transformants.

A. niger strain CBS 513-88 is cultured at 30 ^° C. in an Erlenmeyer flask with 250 ml of transformation medium (Kusters-van Someren et al., Curr Genet, 1991 Sep; 20 (4): 293-9 ). After a growth of 16 h at 250 rpm, the mycelium is harvested by filtration on Miracloth (Calbiochem) and washed with deionized water. The protoplasts are carried out in the presence of 5 gL ^-1 of lysing enzymes from Trichoderma harzianum (St. Louis Sigma, MO, USA), 0.075 Uml-1 chitinase of Streptomyces griseus (Sigma) and 460 Uml-1 glucuronidase of Helix, pomatia (Sigma) in KMC (0.7M KCl, 50 mM CaCl 2, 20 mM Mes / NaOH, pH 5.8) for 2 hours at 37 ^° C. and 120 rpm Protoplastation is monitored every 30 minutes with a microscope The protoplasts are filtered through a Miracloth filter and collected by centrifugation at 2000 xg and ^{40 °} C. for 10 minutes The protoplasts are washed with cold STC (1.2 M sorbitol, 10 mM Tris / HCl 50 mM CaCl 2, pH 7.5) and then resuspended in 100 μl of STC and used directly for transformation.

In order to integrate a metabolic pathway into the A. niger genome, co-transformation of a plasmid and a linear fragment is necessary. The plasmid pEQ0610 is transformed with a donor fragment to integrate part of the engineering into the genome while inactivating the pgkA gene. Similarly, the plasmid pEQ0611 is co transformed with a donor fragment to integrate the other part of the engineering into the genome while inactivating the gsdA gene. These sequences serve firstly as templates for homologous recombination and secondly as selection markers: during integration with the functional expression of antibiotic resistance genes Hph or Ble. Strains are directly selected on minimal medium plates with addition of Hygromycin B or Bleomycin allowing direct selection on the integration event. Due to the presence of the AMA1_2.8 replication origin, the plasmid pCAS_pyrG2 is easily lost resulting in only transient expression of the Cas9 protein, thus reducing the risk of non-targeted adverse effects. lC ^ g linear cassettes and plasmid 5 .mu.g was mixed with 100 μΐ _^ STC solution containing at least 10 ⁷ protoplasts and 330 μΐ _^ of polyethylene glycol (PEG) solution freshly prepared (PEG 6000 25%, CaCl ₂ 50 mM, Tris / 10 mM HCl pH 7.5) and kept on ice for 20 minutes. After mixing with a solution of 2 ml of additional PEG and incubating at room temperature for 10 minutes, the protoplast mixture is diluted with 4 ml of STC.

The transformants are selected on MM plates supplemented with 150 μg / ml hygromycin B or MM plates supplemented with Bleomycin 50 μg / ml. All transformants are purified by isolation of single colonies on the selection medium at least twice. The insertion of the fragments is verified by sequencing the target locus with the appropriate control primers.

Fungal cell genomic DNA is isolated with a modified protocol, using the Wizard® genomic DNA purification kit (Promega, Wisconsin, USA). The mycelium is cultured overnight in CM (30 ^° C., 150 rpm) in 290 μl of 50 mM EDTA solution and 10 μl of lyticase (10 mg / ml) to remove the cell wall. After 90 minutes of incubation at 37 ^° C., the suspension is centrifuged and the supernatant is discarded. The mycelium pellet is resuspended in 300 μl of nucleic acid lysis solution and 100 μl of protein precipitation solution. The samples are incubated on ice for 5 minutes and centrifuged. The DNA is precipitated with isopropanol and washed with 70% ethanol. The DNA pellet is rehydrated with a DNA rehydration solution containing RNase (100 μg / ml). The successful transformation and integration of the expression cassettes was verified by PCR.

Table 34: Strains used for the yield study

Genome Strains Genetic Modification

 A. niger

 EQ1500

 CBS 513-88

A. Niger GSDA:: _p PmbfA -RbcL-trpC; PcoxA _p RbcS-Tnia D; picdA _p -H ph-TgpdA;

EQ1501

 CBS 513-88 PsrpBp-RbcX-glaAt

gsdA :: PmbfAp-RbcL-trpc; PcoxA _p RbcS-Tnia D; picdAp-H ph-TgpdA;

A. niger PsrpBp-RbcX-glaAt

 EQ1502

CBS 513-88 pgkA :: Pm bfA _p -GrES-trpc; PcoxA _p -G roEL-Tnia D; picdA _p -Ble-TgpdA;

PsrpB _p -PRK-glaAt Conidia (10 ⁸ .L ^_1 ) from strains EQ1500 and EQ1502 are inoculated and cultured at 30 ° C. on a rotary shaker (180 rpm) in shake flasks containing Vogel's medium without MnSO ₄ with a total content in glucose of 15% and a total nitrogen content of 0.2% and 10% CO2. The determination of glucose and organic acids was carried out as previously described (Blumhoff et al, 2013, Steiger et al., 2016) on an HPLC (Shimadzu, Kyoto, Japan) equipped with an Aminex HPX-87 H column (300 x 7.8 mm, BioRad, Hercules, CA). A refractive index detector (RID-10A, Shimadzu) is used for the detection of glucose and citric acid, while a PDA detector (SPD-M20A, Shimadzu) at 300 nm is used to detect the cis-aconitic and trans-aconitic acid. The column is used at 60 ^° C. at a flow rate of 0.6 ml / min and with an aqueous solution of 0.004 M H ₂ SO ₄ as a mobile phase. The culture was performed in three biological replicates. d) Analytical method

For quantification of extracellular metabolites, a culture sample is centrifuged at 14,000 xg for 5 min. The supernatant is filtered through a filter having a pore size of 0.45 μm. The filtrate is maintained at -20 ^° C. until analysis. The concentration of citrate and oxalate is detected and quantified with ultraviolet light at 210 nm using an Amethyst C18-H column (250 x 4.6 mm, Sepax Technologies, Newark, DE, USA). Elution is carried out at 30 ° C. with 0.03% H ₃ PO ₄ at a flow rate of 0.8 ml / min. Reducing sugar is detected with the 3,5-dinitrosalicylic acid method. Determination of the biomass: 5 ml of sample are filtered through Miracloth (Calbiochem, San Diego, CA, USA) to collect the hyphae and washed with distilled water. The hyphae are heated to 105 ° C in a "Miracloth". To calculate the cell dry weight (DCW), the Miracloth weight is measured previously and deducted from the total weight to generate the net weight, then the net weight per unit volume is calculated as DCW. After a complete analysis, the comparison of the yield of citric acid production as a function of the glucose consumption is 18% greater in the EQ1502 engineered strain compared to the EQ1500 wild type strain.

Example 9: Improvement of Itaconate Production in Aspergillus terreus a) Strategy

The inactivation of the pgkA gene (Locus tag (ATEG_00224), leading to the non-functionality of the glycolysis pathway, and that of the gsdA gene (Locus tag ATEG_01623), which inhibits the oxidative part of the pentose phosphate pathway, are set to profit to integrate the 6 genes allowing the functional expression of the PRK and RuBisCO enzymes, namely rbcS, rbcL, rbcX, gwES, groEL and prk allowing the fixation of C0 ₂ . b) DNA Constructions

 i) Sequences of the guide RNAs to target the gene to be inactivated In each of these two genes a nucleotide sequence punctuated by an NGG motif (underlined CRISPR target sequence) was determined (Table 35). In both cases, this sequence is specific to the targeted gene but also unique in the genome of Aspergillus terreus. These sequences are used to express an RNAguide (gRNA) which by forming a hetero-duplex with the homologous region of the Aspergillus terreus genome directs the action of the CAS9 endonuclease to induce a double-strand break specifically on the chosen locus. For pgkA, the sequence identified in the second intron, the first 20 nucleotides have a unique pattern in the genome, even allowing 2 mismatches. For gsdA the sequence identified in the fourth intron, the first 20 nucleotides have a unique pattern in the genome, even allowing 2 mismatchs. Table 35: Target Sequence for ARNguide

Plasmid pFC332 (Addgene # 87845) described in Sakari et al. (Bioresour technol 2017, 245 (Pt B): 1327-1333) contains a gRNA expression cassette, a cassette allowing the functional expression of the Cas9 endonuclease and an Hph cassette allowing the selection of this plasmid. The plasmid further contains the AMA1-2.8 fragment which allows transient propagation of the plasmid. Finally, an origin of replication for E. coli is also present.

In order to target another gene, the gRNA cassette between FS A and FS B can be easily exchanged. Thus this plasmid is modified by amplifying the different parts of this plasmid in order to eliminate the antibiotic selection cassette and to modify the nucleotides allowing the specificity of the gRNA in favor of the sequences described in FIG. Table 35 to form the plasmids pEQ0615 to target pgkA and pEQ0616 to target gsdA in the Aspergillus terreus genome. ii) Donor Plasmid

Regions of homology with the genome The donor plasmid consists of an In-Fusion® HD Cloning Kit User Manual - Clontech assembly between the plasmid pUC19 (GenBank: M77789.2) and genomic targeting sequences (LA and RA) of about 1500 bp each homologous to the locus chosen for integration. The LA and RA sequences are flanked 5 'and 3', respectively, of the locus sequence targeted by the ARNguide. The genomic DNA / RNA hybrid heterodimer is recognized by the double-stranded cleavage Cas9 endonuclease (locus 1: pgkA, locus2: gsdA) (Table 35). The RA and LA fragments are amplified with the primers described in Table 36 for the pgkA gene and in Table 37 for the gsdA gene. The sequences of the amplicons are in the listing sequence (SEQ ID Nos. 67 to 70).

An extension of 18 nucleotides on all the forward primers of the three fragments is added according to the In-Fusion® HD Cloning Kit User Manual - Clontech protocol in order to allow a functional assembly of the plasmids (pEQ0604 or pEQ0605) (33) and the introduction of two restriction endonuclease sites of type II (restriction enzymes I-Ceul and I-SceI) which have large asymmetric recognition sites (12 to 40 base pairs). These are recognition sequences of 18 base pairs, so rare and not present in the assembly described. The fact that the cleavage is asymmetric at the recognition site makes it possible to release a fragment devoid of sequences of the bacterial vector pUC19. These two enzymes make it possible to extract by restriction the integration block after amplification by cloning in E. coli.

Table 36: Amplification of Homology Regions for the pgkA Gene

Amplicon Primer position Primer sequence

 5 'pgkA_Aterreus Forwa rd CTTG G G G AATTG G G ACACG (SEQ ID NO: 47)

 Reverse TCTTG CCG ATG AG CTTCTCC (SEQ ID No. 48)

 3 'pgkA_Aterreus Forwa rd CAGATCATCCTCCTGGAGAACC (SEQ ID NO: 49)

Reverse ACG G CACG AATGTTCACCTG (SEQ ID NO: 50) Table 37: Amplification of homology regions for the gsdA gene

Expression cassettes of engineering

Promoters and terminators are identified on the basis of GenBank data. The promoters chosen are determined from the +1 transcription point and go back 1.4Kb upstream so as to cover both the "core" sequences (TATA box) and the trans-activator sequences allowing the optimal functionality of the promoter concerned.

For terminators the cut is performed 500 bp after the stop codon of the gene.

The structure of each integration block of 4 expression cassettes is defined as follows: the first level comprises simple elements, namely promoters, coding sequences (CDS) and terminators. The promoters (

Table 30) and Terminators (

Table 31), are amplified and assembled with the engineering CDS according to Table 32. The CDS are amplified according to the protocol provided with the NEBuilder® HiFi DNA Assembly Master Mix Kit (E2321) to obtain the expression cassettes functionalities compiled in the table. Each 4 gene integration block is organized to include 4 different terminator promoter pairs in order to limit trans interferences. Each 6 gene integration block is organized to include 6 different terminator promoter pairs so as to limit transcriptional interferences.

Donor fragment for insertion into the genome's target locus

The different multiple expression cassettes (RbcS, RbcL and RbcX or GroES, GroEL and PRK are amplified and assembled around an antibiotic selection cassette (Table 38), according to the In-Fusion® HD Cloning Kit User Manual protocol. - Clontech, to form the donor plasmids (pEQ0606 or pEQ0607).

Table 38: Plasmid assembly

c) Transformation of Aspergillus terreus

Transformation of the DNA to Aspergillus terreus was performed according to the strategy applied for Aspergillus niger (Example 8) using A. terreus strain NIH262.

Table 39: Strains used for yield study

Culture of strains of A. terreus EQ1600 and EQ1602 on glucose 3%. The optimized medium composition described by Hevekerl et al. (Appl Microbiol Biotechnol 2014; 98: 6983-6989) is used. Π contains 0.8 g of KH ₂ PO ₄ , 3 g of NH ₄ NO ₃ , 1 g of MgSO ₄ . 7H20, 5 g of CaCl ₂ .2 H ₂ 0, 1.67 mg of FeCl ₃ .6H ₂ 0, 8 mg of ZnSO ₄ .7H ₂ O and 15 mg of CuSO ₄ .7H ₂ O per liter. To mimic the typical sugar concentration obtained from wheat straw hydrolyzate (150 g / L) pretreated with dilute acid (0.75% v / v, 160 ° C, 10 min) and enzymatically saccharified (pH 5.0, 45 ° C, 72 h), an adequate amount of glucose at 30 g L ^-1 is used The sugars and all other components are added from sterile stock solutions The pH of the medium without CaCl 2 ₂ is adjusted to 3.1 with H ₂ S0 ₄ 0.5M before inoculating the preparation of spores for strains EQ1600 and EQ1602. Culturing is carried out under stirring with 25 ml of medium in Erlenmeyer flasks 125 ml at 33 ° C in a rotary shaker at 200 rpm for 7-10 days in an environment of 10% C0 _2. The pH is not controlled during the fermentation and the shaking of the flasks is maintained during the fermentation. sampling for time studies to ensure a continuous supply of oxygen.All experiments are performed in triplicate. Medium posers are obtained from Sigma Chemical, St. Louis, Missouri. For these experiments, each sugar was dissolved in deionized water and passed through a column (440 x 45 mm) of Dowex 50-X8 cation exchange resin (100/200 mesh) (Bio-Rad Laboratories, Hercules, CA) to remove manganese, if any. d) Analytical procedures The concentration of the cell mass is determined from the dry weight of the cells. The cell mass present in the fermentation broth is harvested by centrifugation at 10,000 g for 10 minutes and rinsed thoroughly three times with deionized water. The rinsed cell mass was thoroughly dried at 80 ° C until a constant weight was obtained. The fermentation broth after centrifugation (10,000 g, 10 min) is stored at -20 ^° C. before analysis of glucose, itaconic acid and by-products (succinic acid, α-ketoglutaric acid, malic acid, cis-acid and the like). -aconitic, and trans-aconitic acid) using a high performance liquid chromato graphy (HPLC). Shimadzu Prominence HPLC equipment (Shimadzu America, Inc., Columbia, MD) is used. Two columns (Aminex HPX-87P column, 300 x 7.8 mm with ash cartridge and Carbo-P cartridge, and an Aminex HPX 87H column, 300 x 7.8 mm with Microguard Cation H cartridge (Bio-Rad) ) are respectively used for the analysis of sugars and organic acids. The Aminex HPX 87P column is maintained at 85 ° C and the glucose is eluted with Milli-Q acidified deionized water (Millipore, Bedford, MA) at a flow rate of 0.6 ml min ^-1 . The Aminex HPX 87H column is maintained at 65 ° C. and the sugars and organic acids are eluted with 5 mM H 2 SO 4 prepared using Milli-Q deionized filtered water at a flow rate of 0.5 ml min ^-1 . detection is performed using a refractive index detector for sugars and a UV detector at 210 nm for organic acids Propionic acid (1%, weight / volume) is used as an internal standard to estimate liquid lost during aerobic fermentation 7-10 days at 33 ° C under 10% CO2 All HPLC standards, including organic acids, are purchased from Sigma The manganese concentration (ppb level) is determined using an Optima 7000DV Optima 7000DV inductively coupled plasma (ICP-OES) spectrometer from Perkin-Elmer (Waltham, MA) by the procedure described by Bakota et al (Eur J Lipid Sci Technol., 2015; 117: 1452-1462.

On the basis of the results of the production of itaconic acid from glucose, an increment of mass yield, of itaconic acid from glucose, of 15% is observed for the strain with EQ1602 engineering compared to the reference strain EQ1600 .

Claims

A genetically modified microorganism expressing a functional RuBisCO enzyme and a phosphoribulokinase (PRK), and in which the glycolysis pathway is at least partially inhibited, upstream of the production of 1,3-bisphospho-D-glycerate (1,3 -BPG) or upstream of the production of 3-phosphoglycerate (3PG), and downstream of the production of glyceraldehyde-3-phosphate (G3P), said microorganism being genetically modified so as to produce an exogenous molecule of interest and / or overproducing an endogenous molecule of interest, other than the enzyme RuBisCO or phosphoribulokinase. 2- genetically modified microorganism according to claim 1, wherein the oxidative branch of the pentose phosphate pathway is also at least partially inhibited.

3- genetically modified microorganism according to claim 1 or 2, said microorganism being genetically modified to express a recombinant enzyme RuBisCO and / or PRK. 4- genetically modified microorganism according to one of claims 2 to 3, said microorganism being genetically modified so as to inhibit the oxidative branch of the pentose phosphate pathway upstream of the production of ribulose-5-phosphate.

The microorganism genetically modified according to claim 4, wherein the exogenous molecule and / or the endogenous molecule is chosen from amino acids, peptides, proteins, vitamins, sterols, flavonoids, terpenes, terpenoids, fatty acids, polyols and organic acids.

6-microorganism genetically modified according to one of claims 1 to 5, said microorganism being a eukaryotic cell, preferably selected from yeasts, fungi, microalgae, or a prokaryotic cell, preferably a bacterium. 7- genetically modified microorganism according to one of claims 1 to 6, wherein the expression of the gene encoding glyceraldehyde 3-phosphate dehydrogenase is at least partially inhibited.

8- genetically modified microorganism according to one of claims 1 to 7, wherein the expression of the gene encoding phosphoglycerate kinase is at least partially inhibited. 9- microorganism genetically modified according to claim 7 or 8, wherein the expression of the gene encoding glucose-6-phosphate dehydrogenase or 6-phosphogluconolactonase or 6-phosphogluconate dehydrogenase is at least partially inhibited. 10- microorganism genetically modified according to one of claims 1 to 9, said microorganism being a yeast genus Saccharomyces cerevisiae genetically modified to express a RuBisCO type I or II and a phosphoribulokinase (PRK) functional, and wherein the expression of TDH1 gene, TDH2 and / or TDH3 is at least partially inhibited. 11- microorganism genetically modified according to one of claims 1 to 10, said microorganism being a yeast Saccharomyces cerevisiae genetically modified to express a RuBisCO type I or II and a phosphoribulokinase (PRK) functional, and wherein the expression of PGK1 gene is at least partially inhibited.

12- microorganism genetically modified according to claim 10 or 11, wherein the expression of the ZWF1 gene is at least partially inhibited.

13- microorganism genetically modified according to one of claims 1 to 9, said microorganism being a filamentous fungus genus Aspergillus genetically modified to express a RuBisCO type I or II and a phosphoribulokinase (PRK) functional, and wherein the expression of pgk and gsdA genes is at least partially inhibited. 14- microorganism genetically modified according to one of claims 1 to 9, said microorganism being an E. coli bacterium genetically modified to express a functional RuBisCO type I or II and a phosphoribulokinase (PRK), and wherein the expression of the gene gapA and / or pgk, and optionally the zwf gene, is at least partially inhibited.

15- Use of a genetically modified microorganism according to one of claims 1 to 14, for the production or overproduction of a molecule of interest, preferably chosen from amino acids, peptides, proteins, vitamins, sterols, flavonoids, terpenes, terpenoids, fatty acids, polyols and organic acids.

16- Use according to claim 15 for the production or overproduction of glutamate, citrate, itaconate or GABA.

17. A biotechnological process for producing at least one molecule of interest, characterized in that it comprises a step of culturing a genetically modified microorganism according to one of claims 1 to 14, under conditions allowing the synthesis or bioconversion by said microorganism, said molecule of interest, and optionally a step of recovery and / or purification of said molecule of interest.

18. A biotechnological process according to claim 17, wherein the molecule of interest is chosen from amino acids, peptides, proteins, vitamins, sterols, flavonoids, terpenes, terpenoids, fatty acids, polyols. and organic acids.

19. The biotechnological process according to claim 17, wherein the molecule of interest is chosen from glutamate, citrate, itaconate or GABA.

 20- biotechnological process according to one of claims 17 to 19, wherein the microorganism is genetically modified to express at least one enzyme involved in the bioconversion or synthesis of said molecule of interest.

21- biotechnological process according to one of claims 17 to 19, wherein the microorganism is genetically modified to at least partially inhibit an enzyme involved in the degradation of said molecule of interest. 22- A process for producing a molecule of interest comprising (i) the insertion of at least one sequence coding for an enzyme involved in the synthesis or bioconversion of said molecule of interest in a recombinant microorganism according to one of the claims 1 to 14, (ii) culturing said microorganism under conditions permitting the expression of said enzyme and optionally (iii) recovering and / or purifying said molecule of interest. 23- A process for producing a molecule of interest comprising (i) inhibiting the expression of at least one gene coding for an enzyme involved in the degradation of said molecule of interest in a recombinant microorganism according to one of claims 1 to 14, (ii) culturing said microorganism under conditions permitting the expression of said enzyme and optionally (iii) recovering and / or purifying said molecule of interest.