CN117210446A

CN117210446A - Method for improving yield of heterotrophic microorganism metabolite by reconstructing Calvin cycle

Info

Publication number: CN117210446A
Application number: CN202310277052.2A
Authority: CN
Inventors: 丰婧; 杨晓妍; 陈丽媛; 范丁丁; 张桦宇; 张震; 邹亮; 李明月; 郑鹏玉; 赵长春; 吴雅琨; 尹进; 汪东升; 饶驰通; 李腾; 张浩千
Original assignee: Bluepha Co ltd
Current assignee: Bluepha Co ltd
Priority date: 2023-03-21
Filing date: 2023-03-21
Publication date: 2023-12-12
Also published as: WO2024193480A1

Abstract

The invention relates to the technical fields of genetic engineering and fermentation engineering, in particular to a method for improving the yield of heterotrophic microorganism metabolites by reconstructing the Calvin cycle. According to the invention, the expression of the related genes of the Calvin cycle is regulated and controlled, the Calvin cycle of the heterotrophic microorganism is rebuilt, the metabolism of the heterotrophic microorganism on the grease carbon source is effectively promoted, the operation of the beta-oxidation cycle is promoted, and the capability of the heterotrophic microorganism for synthesizing the target metabolite by using the grease carbon source is remarkably improved. The regulation strategy of the calvin cycle related gene can obviously improve the capability of microorganisms for synthesizing metabolic products such as PHA and the like, further effectively improve the content and the yield of the metabolic products such as PHA and the like produced by microbial fermentation, and provide a new transformation target and method for constructing engineering microorganisms of target metabolic products.

Description

Method for improving yield of heterotrophic microorganism metabolite by reconstructing Calvin cycle

Technical Field

The invention relates to the technical fields of genetic engineering and fermentation engineering, in particular to a method for improving the yield of heterotrophic microorganism metabolites by reconstructing the Calvin cycle.

Background

Polyhydroxyalkanoates (PHAs) are renewable and degradable high-molecular polymers synthesized by microorganisms and have multi-element material chemical properties, and have wide application prospects in the fields of medicine, materials and environmental protection. Polyhydroxyalkanoates are widely present in microbial cells and are mainly used as a carbon source and a carrier for storing energy.

The eutrophic bacteria (Ralstonia eutropha, cupriavidus necator) are heterotrophic microorganisms, and are also important mode bacteria for researching PHA synthesis, and how to improve the PHA yield of the eutrophic bacteria is a hot spot and a difficult point of current research.

The calvin cycle (CBB cycle), also known as photosynthetic carbon cycle, is one of the carbon sequestration pathways widely found in nature, but is mainly found in autotrophic microorganisms in the natural environment.

CBB cycle-related genes are present in two copies in eutrophic rogowski bacteria, located in genome No. 2 and large plasmid pHG1, respectively, where cbbR on genome No. 2 is responsible for modulating the CBB gene cluster on genome No. 2 and pHG1, and cbbR on large plasmid pHG1 is not regulatory due to incomplete (Genome sequence of the bioplastic-producing "Knallgas" bacterium Ralstonia eutropha H, nature biotechnology, 2006).

The prior art reports some technical schemes for reducing carbon dioxide emission by exogenously expressing CBB circulating key enzymes (such as RuBisCo) in heterotrophic microorganisms, but no report for influencing the yield of target metabolites of the heterotrophic microorganisms by using CBB circulation is currently seen.

Disclosure of Invention

The invention provides a method for improving the yield of the metabolic products of heterotrophic microorganisms by reconstructing the Calvin cycle.

The invention discovers that regulating and controlling the expression of key genes in the Calvin cycle can promote the metabolism of heterotrophic microorganisms on grease carbon sources, promote the operation of beta-oxidation cycle, further promote the metabolic flow to enter the synthesis path of metabolic products, and improve the capability of the heterotrophic microorganisms for synthesizing target metabolic products by utilizing the grease carbon sources.

Specifically, the invention provides the following technical scheme:

the invention provides the application of any one of the following genes related to the Calvin cycle or the encoding proteins thereof or biological materials containing the genes related to the Calvin cycle:

1) Use in improving the ability of a microorganism to utilize an oil anabolic product;

2) The application of the method in improving the yield of the metabolic products produced by the microorganism by utilizing the grease;

3) The application in improving the production efficiency of the microorganism to produce the metabolite by using the grease;

4) Use in the construction of an engineered microorganism for the production of metabolites using lipids;

5) The application of the microbial strain in improving the metabolic capacity of the microorganism to the grease;

6) Use in promoting the beta-oxidation cycle of a microorganism;

the calvin cycle related genes are cbbL and cbbS.

The cbbL gene and the cbbS gene of the present invention are responsible for synthesizing large and small subunits of ribulose-1, 5-bisphosphate carboxylase/oxygenase (Rubisco), respectively, thereby synthesizing ribulose-1, 5-bisphosphate carboxylase/oxygenase (Rubisco).

The biological material is an expression cassette, a vector or a host cell. Wherein the expression cassette is operably linked to the promoter and the calvin cycle-related gene. Other transcription and translation regulatory elements such as terminators, enhancers and the like can also be included in the expression cassette according to the expression needs and the difference of the upstream and downstream sequences of the expression cassette. The vector is a plasmid vector, and the plasmid vectors comprise a replicative vector and a non-replicative vector, and the vector is not limited to the plasmid vector, but can be a phage, a virus and the like. The host cell may be any microbial cell, such as E.coli, eutrophic bacteria, and the like.

Specifically, the application includes: improving the expression level of the gene related to the Calvin cycle in the microorganism and/or improving the enzyme activity of the encoded protein of the gene related to the Calvin cycle.

Preferably, the expression of the calvin cycle related gene in the microorganism is increased to increase the expression level of cbbL to 2 to 141 times before regulation, and the ratio of the expression level of cbbL to cbbS is (0.5 to 1.2): 1. the improvement of the expression level of cbbL and the ratio of the expression levels of cbbL and cbbS are controlled within the above-described range, and thus the PHA productivity of the microorganism can be remarkably improved, and both the PHA content and the PHA yield thereof can be remarkably improved.

Further preferably, the ratio of the expression level of cbbL to cbbS is (0.5 to 0.97): 1. more preferably (0.57-0.91): 1.

cbbL and cbbS encode the size subunits of Rubisco enzyme, respectively, so theoretically the ratio of optimal expression levels of the two should be 1:1, however, the present invention surprisingly found that when the expression level ratio of cbbL to cbbS is controlled to be in the range of (0.5-0.97): 1, the PHA yield improving effect of the microorganism is still very outstanding; meanwhile, the improvement amplitude of the expression quantity of the cbbL needs to be controlled to be 2-141 times that before regulation so as to better ensure the improvement effect of the PHA yield.

Further preferably, the expression level of the calvin cycle-related gene in the microorganism is increased to 2 to 70 times (more preferably 2 to 65 times) the expression level of cbbL before the regulation, and the ratio of the expression level of cbbL to cbbS is (0.5 to 1.1): 1 (more preferably 0.57-0.97:1, most preferably 0.57-0.91:1).

Under the conditions that the above-mentioned ratio of the expression level of cbbL to the expression level of cbbS is satisfied, the expression level of cbbS is preferably increased to 2 to 150 times, more preferably 2 to 70 times, the expression level before the regulation.

The improvement of the expression level of the cbbL and cbbS genes can be realized by any one or a combination of the following modes 1) to 4):

1) Modifying regulatory proteins of cbbL, cbbS;

2) Modifying the transcriptional regulatory element and/or the translational regulatory element of cbbL, cbbS;

3) Modifying sequences of cbbL, cbbS genes;

4) Increasing the copy number of cbbL, cbbS.

In 1) above, the regulatory protein comprises a cbbR protein. The regulatory proteins for modifying the cbbL and the cbbS are that the regulatory mode of the cbbR on the cbbL and the cbbS genes is changed by mutating the cbbR protein, so that the expression quantity of the cbbL and the cbbS genes is improved.

In some embodiments of the invention, the cbbR protein is mutated to a cbbR mutant comprising a G205D, G D mutation. Preferably, the amino acid sequence of the cbbR mutant is shown in SEQ ID No. 5. The cbbR mutant shown in SEQ ID No.5 is particularly suitable for activating the eutrophic rogowski bacteria to improve the expression levels of cbbL and cbbS genes under heterotrophic conditions, so that the expression levels of cbbL and cbbS can be improved to be within the ratio range of the invention, and the yield of PHA is further improved remarkably.

The introduction of the cbbR mutant described above may be achieved by introducing a cbbR mutant encoding gene into a chromosome or an endogenous plasmid of the microorganism, and/or by introducing an exogenous plasmid containing a cbbR mutant encoding gene into the microorganism. Wherein the original cbbR gene on the chromosome of the microorganism is inactivated.

In some embodiments of the invention, in order to enable stable expression of the introduced exogenous plasmid after transfer into the microorganism, the exogenous plasmid is a stable expression plasmid, and stable expression of the plasmid may be achieved by carrying in the plasmid a synthetic gene (e.g., proC gene) of a metabolite necessary for strain growth, while inactivating the synthetic gene in the genome. It will be appreciated by those skilled in the art that the method of stabilizing the expression plasmid is not limited thereto, and that other means for stabilizing the expression of the desired gene in the plasmid vector may be employed.

In some embodiments of the invention, the objective of stable expression of a plasmid vector is achieved by knocking out the proC gene in the original genome and inserting the proC gene in an exogenous plasmid.

In the above 2), the transcription regulatory element includes a promoter, a terminator, an enhancer, and the like. The translation regulatory elements include ribosome binding sites and the like. The modified transcriptional regulatory element and/or translational regulatory element is a sequence that alters a regulatory element responsible for cbbL, cbbS transcription, translation, for example: other transcriptional regulatory elements and translational regulatory elements are inserted upstream of the gene coding regions of cbbL and cbbS, or mutations are made on the basis of the original transcriptional regulatory elements and translational regulatory elements (e.g., the binding region sequence of cbbR in the promoter is mutated so that the promoter is no longer under the control of cbbR), or the original transcriptional regulatory elements and translational regulatory elements are replaced with other transcriptional regulatory elements and translational regulatory elements, etc. Preferably, the original cbbR gene on the chromosome of the microorganism is inactivated.

In some embodiments of the invention, a promoter is inserted 5' of the cbbL gene coding region to increase the expression level of the cbbL, cbbS genes. The promoter is preferably a constitutive promoter, more preferably a p53 promoter (p 53 promoter is SEQ ID NO:53 of patent CN 108977890B), a p52 promoter (p 52 promoter is SEQ ID NO:52 of patent CN 108977890B) or a p68 promoter (p 68 promoter is SEQ ID NO:68 of patent CN 108977890B). Preferably, the original cbbR gene of the chromosome is inactivated simultaneously.

In some embodiments of the invention, the 5' end of the cbbL gene coding region is inserted with a p53 promoter (p 53 promoter is SEQ ID NO:53 of patent CN 108977890B), a p52 promoter (p 52 promoter is SEQ ID NO:52 of patent CN 108977890B) or a p68 promoter (p 68 promoter is SEQ ID NO:68 of patent CN 108977890B) to increase the expression level of the cbbL, cbbS genes, and the terminator between the cbbS and cbbX genes is not knocked out. Preferably, the original cbbR gene of the chromosome is inactivated simultaneously.

In the above 3), the expression level of the cbbL and cbbS genes can be increased by optimizing the codons of the cbbL and cbbS genes without changing the coding protein sequences of the cbbL and cbbS genes.

In 4) above, increasing the copy number of cbbL, cbbS may be achieved by increasing the copy number of cbbL, cbbS genes on the chromosome and/or on the endogenous plasmid, or by introducing an exogenous plasmid containing cbbL, cbbS genes. When exogenous plasmids are introduced, the cbbL and cbbS genes may be on the same plasmid, or on different plasmids.

In some embodiments of the invention, an exogenous plasmid containing the cbbL and cbbS genes is introduced, wherein the cbbL gene initiates transcription with the p53 promoter and the cbbS gene initiates transcription with the p47 promoter (p 47 promoter is SEQ ID NO:47 of patent CN 108977890B).

In order to enable stable expression of the introduced exogenous plasmid after transfer into the microorganism, the exogenous plasmid is a stable expression plasmid, and stable expression of the plasmid can be achieved by carrying a synthetic gene (e.g., proC gene) of a metabolite necessary for strain growth in the plasmid, while inactivating the synthetic gene in the genome. It will be appreciated by those skilled in the art that the method of stabilizing the expression plasmid is not limited thereto, and that other means for stabilizing the expression of the desired gene in the plasmid vector may be employed.

The above-described enhancement of the enzymatic activity of the cbbL, cbbS gene encoding a protein can be achieved by altering the amino acid sequence of the encoded protein.

It should be understood that, in the specific embodiments, the foregoing means are used as examples, and on the basis that the purpose of regulating cbbL and cbbS genes of the present invention is known to those skilled in the art, other technical means that can achieve the purpose of regulating the expression of genes of the present invention are equally modified from the technical means of the present invention, so they are all within the scope of protection of the present invention.

The calvin cycle related gene of the present invention may be a gene derived from a heterotrophic microorganism. According to the functions, metabolic pathways and control similarities of the calvin cycle in the heterotrophic microorganism and the similarities of the heterotrophic microorganism to the metabolic pathways of the oil, the application of the invention in 1) -6) of improving the ability of the microorganism to utilize the oil to synthesize the metabolites by controlling the calvin cycle related genes can be applied to all the heterotrophic microorganisms. These heterotrophic microorganisms include, but are not limited to, eutrophic rogowski, escherichia coli, yeast, pseudomonas or halomonas.

In some embodiments of the invention, the calvin cycle related genes are cbbL and cbbS genes derived from eutrophic bacteria of the genus rochanteria.

For eutrophic rogowski, the calvin cycle related gene is a gene located in the genome of chromosome 2 or on plasmid pHG 1.

The cbbL, cbbS genes located in chromosome 2 genome have high similarity to the cbbL, cbbS genes located on plasmid pHG1, and their functions have high consistency. Therefore, the control of the cbbL, cbbS genes located in chromosome 2 genome can achieve comparable effects with the control of the cbbL, cbbS genes on plasmid pHG 1.

The improvement ratio of the expression quantity of the cbbL and the ratio of the expression quantity of the cbbL to the expression quantity of the cbbS are calculated based on the expression quantity of all the cbbL and the cbbS in the microbial cells, and the cbbL and the cbbS on the chromosome and the plasmid are not distinguished. The above-mentioned ratio of the expression level of cbbL to the expression level of cbbS may be achieved by controlling the chromosomal cbbL and cbbS genes alone, or by controlling the plasmid cbbL and cbbS genes alone, or by controlling the chromosomal and plasmid cbbL and cbbS genes in combination.

The sequences of the cbbL and cbbS genes are not particularly limited as long as the genes have the cbbL and cbbS gene functions (encoding the size subunits of Rubisco enzymes).

In some embodiments of the invention, the cbbL gene encodes a protein having a sequence as set forth in SEQ ID No.1, 2, or a sequence having at least 80% similarity to the sequence set forth in SEQ ID No.1, 2. The sequences of the coded proteins of the cbbS genes are shown as SEQ ID NO.3 and 4, or the sequences with at least 80 percent of similarity with the sequences shown as SEQ ID NO.3 and 4.

The amino acid sequence similarity may be at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.

In some embodiments of the invention, the amino acid sequence of the cbbL encoded protein is shown in SEQ ID No.1 and/or SEQ ID No.2, and the amino acid sequence of the cbbS encoded protein is shown in SEQ ID No.3 and/or SEQ ID No. 4.

Wherein SEQ ID NO.1 and SEQ ID NO.3 are sequences of the genes encoding the cbbL gene and the cbbS gene of the genome of chromosome 2, respectively, and SEQ ID NO.2 and SEQ ID NO.4 are sequences of the proteins encoding the cbbL gene and the cbbS gene on plasmid pHG1, respectively.

The microorganism of the present invention is a heterotrophic microorganism. According to the functions, metabolic pathways and control similarities of the calvin cycle in the heterotrophic microorganism and the similarities of the heterotrophic microorganism to the metabolic pathways of the oil, the application of the invention in 1) -6) of improving the ability of the microorganism to utilize the oil to synthesize the metabolites by controlling the calvin cycle related genes can be applied to all the heterotrophic microorganisms. These heterotrophic microorganisms include, but are not limited to, eutrophic rogowski, escherichia coli, yeast, pseudomonas or halomonas.

Preferably, the microorganism is a microorganism capable of synthesizing and accumulating the metabolite.

In some embodiments of the invention, the microorganism is eutrophic rochanterium.

The metabolites of the invention preferably use the metabolites of the beta-oxidation cycle as synthesis precursors. According to the mechanism of regulating and controlling the gene related to the Calvin cycle and further promoting the capability of microorganisms to utilize grease to produce metabolites, the mechanism of regulating and controlling the gene related to the Calvin cycle promotes the metabolism of the grease by the beta-oxidation cycle of the microorganisms, so that the synthesis flux of the metabolites in the beta-oxidation cycle can be improved, and more metabolites in the beta-oxidation cycle can be provided as precursors to synthesize downstream metabolites. Thus, the regulatory strategies and effects of the present invention are applicable to all metabolites with the β -oxidative cycle as synthesis precursors.

As an example, the metabolite takes acetyl-coa, acyl-coa, enoyl-coa, hydroxyacyl-coa and/or ketoacyl-coa as synthesis precursors.

Such metabolites include, but are not limited to, polyesters, organic acids, amino acids, alcohols, or hydrocarbons.

Among these, the polyester metabolites include PHA and the like. Organic acid metabolites include glycolic acid, 3-hydroxypropionic acid, fatty acids, and the like. Hydrocarbon metabolites include lycopene, beta-carotene, and the like.

In the specific embodiment of the present invention, PHA is taken as an example of the metabolites, and although the synthesis pathway of PHA, the precursor and the intermediate thereof are not related to the Calvin cycle of the microorganism, the capacity of the microorganism for synthesizing PHA and further the yield of PHA can be remarkably improved by regulating the expression of the Calvin cycle related genes cbBL and cbbS of the microorganism.

For PHA, the present invention provides the use of the calvin cycle related gene or its encoded protein or a biological material containing the calvin cycle related gene for increasing the ability of a microorganism to synthesize PHA, for increasing the PHA content of a microbial cell, for increasing the PHA yield of a microorganism, or for constructing an engineered microorganism for the production of PHA. The calvin cycle related genes are cbbL and cbbS.

The PHA-synthesizing ability of the microorganism, PHA content of the microorganism cells, PHA yield of the microorganism according to the present invention are preferably produced by fermentation of the microorganism under heterotrophic conditions.

The fermentation production of PHA preferably uses grease as a carbon source.

The grease comprises one or more of vegetable oil, animal oil and kitchen waste oil, wherein the vegetable oil can be one or more of palm oil, palm kernel oil, coconut oil, peanut oil, soybean oil, linseed oil, rapeseed oil, castor oil and corn oil.

It can be understood by those skilled in the art that the path of PHA biosynthesis using oil as a carbon source uses acyl-CoA obtained by beta-oxidation as a key raw material, and the metabolic pathway and the regulation mechanism are basically the same, so that the inventive concept of the invention is not limited to the specific selection of the carbon source, and all the oil carbon sources can be realized.

The present invention also provides a method for improving the yield of a metabolite produced by a microorganism using oil, the method comprising: modifying the microorganism to increase the expression level of the calvin cycle-related gene in the microorganism and/or to increase the enzyme activity of the encoded protein of the calvin cycle-related gene;

the calvin cycle related genes are cbbL and cbbS.

Preferably, the improvement of the expression level of the calvin cycle related gene in the microorganism is to increase the expression level of cbbL to 2 to 141 times before modification, and the ratio of the expression level of cbbL to cbbS is (0.5 to 1.2): 1. the improvement of the expression level of cbbL and the ratio of the expression levels of cbbL and cbbS are controlled within the above-described range, and thus the PHA productivity of the microorganism can be remarkably improved, and both the PHA content and the PHA yield thereof can be remarkably improved.

further preferably, the increase in the expression level of the calvin cycle-related gene in the microorganism is 2 to 70-fold (more preferably 2 to 65-fold) increase in the expression level of cbbL before modification, and the ratio of the expression level of cbbL to cbbS is (0.5 to 1.1): 1 (more preferably 0.57-0.97:1, most preferably 0.57-0.91:1).

Under the conditions that the above-mentioned ratio of the expression level of cbbL to the expression level of cbbS is satisfied, the expression level of cbbS is preferably increased to 2 to 150 times, more preferably 2 to 70 times, the expression level before modification.

In the above method, the microorganism is a heterotrophic microorganism. According to the functions, metabolic pathways and control similarities of the calvin cycle in the heterotrophic microorganism and the similarities of the heterotrophic microorganism to the metabolic pathways of the oil, the application of the invention in 1) -6) of improving the ability of the microorganism to utilize the oil to synthesize the metabolites by controlling the calvin cycle related genes can be applied to all the heterotrophic microorganisms. These heterotrophic microorganisms include, but are not limited to, eutrophic rogowski, escherichia coli, yeast, pseudomonas or halomonas.

The above-mentioned metabolites are preferably synthesized precursors of metabolites of the beta-oxidation cycle. According to the mechanism of regulating and controlling the gene related to the Calvin cycle and further promoting the capability of microorganisms to utilize grease to produce metabolites, the mechanism of regulating and controlling the gene related to the Calvin cycle promotes the metabolism of the grease by the beta-oxidation cycle of the microorganisms, so that the synthesis flux of the metabolites in the beta-oxidation cycle can be improved, and more metabolites in the beta-oxidation cycle can be provided as precursors to synthesize downstream metabolites. Thus, the regulatory strategies and effects of the present invention are applicable to all metabolites with the β -oxidative cycle as synthesis precursors.

The present invention provides a method for increasing PHA production by a microorganism, the method comprising: modifying the microorganism to increase the expression level of the calvin cycle-related gene in the microorganism and/or to increase the enzyme activity of the encoded protein of the calvin cycle-related gene; the calvin cycle related genes are cbbL and cbbS.

The present invention provides an engineered microorganism modified such that the expression levels of cbbL and cbbS therein are increased;

wherein the expression level of cbbL is increased to 2-141 times before modification, and the ratio of cbbL to cbbS expression level in the engineered microorganism is (0.5-1.2): 1.

preferably, the expression level of cbbL is increased to 2 to 70 times (more preferably 2 to 65 times) before modification, and the ratio of cbbL to cbbS expression level is (0.5 to 1.1): 1 (more preferably 0.57-0.97:1, most preferably 0.57-0.91:1).

Preferably, the microorganism is a heterotrophic microorganism, more preferably a eutrophic bacterium, e.coli, yeast, pseudomonas or halomonas sp.

Preferably, the microorganism is a microorganism capable of synthesizing and accumulating PHA.

Further preferably, the microorganism is eutrophic rogowski. The present invention is not particularly limited as long as it is a strain capable of synthesizing and accumulating PHA, as long as it is a strain of the fungus used for constructing the engineered microorganism.

Further preferably, the engineered microorganism is an engineered eutrophic rogowski bacterium.

The modification of the engineered microorganism is selected from any one or more of the following 1) -4):

1) Modifying regulatory proteins of cbbL, cbbS;

3) Modifying sequences of cbbL, cbbS genes;

4) Increasing the copy number of cbbL, cbbS.

In some embodiments of the invention, an exogenous plasmid containing the cbbL and cbbS genes is introduced, wherein the cbbL gene initiates transcription with the p53 promoter and the cbbS gene initiates transcription with the p47 promoter.

The invention provides the application of the engineering microorganism in the production of metabolites by utilizing oil fermentation.

The oil comprises one or more of vegetable oil, animal oil and kitchen waste oil, wherein the vegetable oil can be selected from one or more of palm oil, palm kernel oil, coconut oil, peanut oil, soybean oil, linseed oil, rapeseed oil, castor oil and corn oil.

The present invention provides a method for producing a metabolite, the method comprising: culturing the engineered microorganism with oil as a carbon source to obtain a culture, and obtaining a metabolite from the culture.

In some embodiments of the invention, the method comprises inoculating the engineered microorganism into a primary seed culture medium for primary seed culture, inoculating a primary seed solution into a secondary seed culture medium for secondary seed culture to obtain a secondary seed solution, and inoculating the secondary seed solution into a fermentation culture medium for fermentation culture to obtain a culture.

The fermentation culture preferably uses grease as a carbon source. The oil comprises one or more of vegetable oil, animal oil and kitchen waste oil, wherein the vegetable oil can be selected from one or more of palm oil, palm kernel oil, coconut oil, peanut oil, soybean oil, linseed oil, rapeseed oil, castor oil and corn oil.

The invention has the beneficial effects that: according to the invention, the expression of the genes cbbL and cbbS related to the calvin cycle is regulated, the calvin cycle of the heterotrophic microorganism is rebuilt, the metabolism of the heterotrophic microorganism on the grease carbon source is effectively promoted, the operation of beta-oxidation cycle is promoted, the metabolic flux is promoted to enter the synthesis path of the metabolite, and the capability of the heterotrophic microorganism for synthesizing the target metabolite by using the grease carbon source is remarkably improved. The regulation strategy of the calvin cycle related gene can obviously improve the capability of microorganisms for synthesizing metabolic products such as PHA and the like, further effectively improve the content and the yield of the metabolic products such as PHA and the like produced by microbial fermentation, and provide a new transformation target and method for constructing engineering microorganisms of target metabolic products.

Drawings

In order to more clearly illustrate the invention or the technical solutions of the prior art, the following description will briefly explain the drawings used in the embodiments or the description of the prior art, and it is obvious that the drawings in the following description are some embodiments of the invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.

FIG. 1 shows the expression of cbBL and cbbS by recombinant bacteria relative to control bacteria in example 1 of the present invention.

FIG. 2 shows the expression of cbBL and cbbS by recombinant bacteria relative to control bacteria in example 2 of the present invention.

FIG. 3 shows the expression of cbBL and cbbS by recombinant bacteria relative to control bacteria in example 3 of the present invention.

FIG. 4 shows the expression of cbBL and cbbS by recombinant bacteria relative to control bacteria in example 4 of the present invention.

FIG. 5 shows the expression of cbBL and cbbS by recombinant bacteria relative to control bacteria in example 5 of the present invention.

FIG. 6 shows the expression of cbBL and cbbS by recombinant bacteria relative to control bacteria in example 6 of the present invention.

FIG. 7 shows the expression of cbbL and cbbS by recombinant bacteria relative to control bacteria in example 7 of the present invention.

FIG. 8 shows the expression of cbBL and cbbS by recombinant bacteria relative to control bacteria in example 8 of the present invention.

FIG. 9 shows the expression of cbBL and cbbS by recombinant bacteria relative to control bacteria in example 9 of the present invention.

FIG. 10 shows the expression of cbBL and cbbS by recombinant bacteria relative to control bacteria in example 10 of the present invention.

FIG. 11 shows the expression of cbBL and cbbS by recombinant bacteria relative to control bacteria in example 11 of the present invention.

Detailed Description

For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings, and it is apparent that the described embodiments are some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. Wherein, the enzyme reagent is purchased from New England Biolabs (NEB), the kit for extracting plasmids is purchased from Tiangen Biochemical technology (Beijing) Co., ltd, the kit for recovering DNA fragments is purchased from American omega company, the corresponding operation steps are strictly carried out according to the product specification, and all culture media are prepared by deionized water unless specified.

The medium formulation used in the following examples was as follows:

seed culture medium i: 10g/L peptone,5g/L Yeast Extract,3g/L Fructose.

Seed medium II: 0.15% palm oil, 10g/L peptone,5g/L Yeast Extract.

Production medium: 1.0% palm oil, 9.85g/L Na ₂ HPO ₄ ·12H ₂ O，1.5g/L KH ₂ PO ₄ ，3.0g/L NH ₄ Cl,10mL/L trace element solution I and 1mL/L trace element solution II. Wherein the trace element solution I comprises the following components: 20g/L MgSO ₄ ，2g/L CaCl ₂ . The trace element solution II comprises the following components: 100mg/L ZnSO ₄ ·7H ₂ O，30mg/L MnCl ₂ ·4H ₂ O，300mg/L H ₃ BO ₃ ，200mg/L CoCl ₂ ·6H ₂ O，10mg/L CuSO ₄ ·5H ₂ O，20mg/L NiCl ₂ ·6H ₂ O，30mg/L NaMoO ₄ ·2H ₂ O. The above reagents were purchased from national drug group chemical reagent company.

The experimental data in the following examples were obtained from 3 or more parallel sets of experiments.

The PHA content described in the examples below is the mass percent of PHA based on the dry weight of the cells.

The calculation formula for PHA yields described in the examples below is as follows:

PHA yield = cdw×pha; wherein CDW is the dry weight of the cells, and PHA% is the percentage of PHA in the dry weight of the cells.

EXAMPLE 1 construction of cbbR mutant recombinant Strain and Performance test

In the embodiment, the eutrophic bacteria H16 (Re H16) is taken as an initial strain, the cbbR gene on the genome is knocked out, and stable plasmids containing double mutant cbbR (mutation sites are G205D and G118D; the amino acid sequence is shown as SEQ ID NO. 5) genes are transformed into the stable plasmids, and performance test is carried out on the stable plasmids.

Step one: knocking out proC gene on genome of eutrophic rogowski by homologous recombination method

(1) PCR amplification is carried out by taking a genome of the eutropha rogowski H16 as a template, proC-H1F, proC-H1R is used for obtaining proC-H1 of an upstream homology arm of proC, proC-H2F, proC-H2R is used for obtaining proC-H2 of a downstream homology arm of proC; the modified plasmid pK18mob (Orita I, iwazawa R, nakamura S, et al identification of mutation points in Cupriavidus necator NCIMB 11599and genetic reconstitution of glucose-utilization ability in wild strain H16 for polyhydroxyalkanoate production [ J ]. Journal of Bioscience & Bioengineering,2012,113 (1): 63-69) was used as a template, and pK-F, pK-R was used for amplification to obtain a vector fragment; the primer sequences used are shown in Table 1. The proC-H1 and proC-H2 are connected with the vector fragment by the Gibson Assembly method to obtain a basic plasmid pKO-delta proC, wherein the sequences of the homologous arms proC-H1 and proC-H2 are shown as SEQ ID NO. 6.

TABLE 1

(2) The recombinant plasmid pKO-delta proC is transformed into escherichia coli S17-1, and then transferred into the eutrophic rochanterium H16 by a conjugal transformation method, and positive clones are screened by using LB plates simultaneously containing 250 mug/mL kanamycin and 100 mug/mL apramycin by utilizing the characteristic that suicide plasmids cannot replicate in host bacteria. The recombinant plasmid carrying the homologous fragment in the positive clone is integrated into the genome at the specific position of proC-H1 and proC-H2, thereby obtaining the first homologous recombinant bacterium. The first homologous recombinant bacteria are subjected to monoclonal culture on LB plates containing 100mg/mL sucrose and 0.2% proline, clones without kanamycin resistance are screened from the monoclonal bacteria, PCR is carried out by using primers proC-F: ctggcggtttccaagaccg and proC-R: gtgttgccgctcaatgcgc, and the recombinant bacteria inserted with the target genes are identified by sequencing, so that the obtained recombinant bacteria are the eutrophic bacteria Re delta proC of Roche.

Step two: knockout of the cbbR gene on the genome by homologous recombination

(1) PCR amplification is carried out by taking a genome of the eutrophic bacteria H16 of Roche as a template, a cbbR-H1F, cbbR-H1R is used for obtaining a cbbR upstream homology arm cbbR-H1, a cbbR-H2F, cbbR-H2R is used for obtaining a cbbR downstream homology arm cbbR-H2; vector fragments were amplified using pK-F, pK-R using modified plasmid pK18mob (Orita, I., iwazawa, et al J. Biosci. Bioeng.113, 63-69) as template; the primer sequences used are shown in Table 2. The cbbR-H1 and the cbbR-H2 are connected with the vector fragment by the Gibson Assembly method to obtain a basic plasmid pKO-delta cbbR, wherein the sequences of the homologous arms cbbR-H1 and cbbR-H2 are shown as SEQ ID NO. 7.

TABLE 2

Primer name	Primer sequence (5 '-3')
		cbbR-H1F	cacacaggaaacagctatgacggagcctgacgtccgaacgg
cbbR-H1R	cgcccccaaccgcccggttccaggagggttggctggg
		cbbR-H2F	gggcggttgggggcggctttggatggtcccgtgatgtgcag
cbbR-H2R	gttgtaaaacgacggccagtccacgtagcagaagaactgc
		pK-F	actggccgtcgttttacaac
pK-R	gtcatagctgtttcctgtgtg

(2) The recombinant plasmid pKO-Deltacbbr is transformed into escherichia coli S17-1, and then transferred into Re delta proC by a conjugation transformation method, and positive clones are screened out by using LB plates simultaneously containing 250 mug/mL kanamycin, 100 mug/mL apramycin and 0.2% proline by utilizing the characteristic that suicide plasmids cannot replicate in host bacteria. The recombinant plasmid carrying the homologous fragment in the positive clone is integrated into the specific position of the cbbR-H1 and the cbbR-H2 of the genome, thereby obtaining the first homologous recombinant bacterium. The first homologous recombinant bacteria were subjected to monoclonal culture on LB plates containing 100mg/mL sucrose and 0.2% proline, clones without kanamycin resistance were selected from the monoclonal bacteria, PCR was performed using cbbR-F: agtattcacgtccgaccatcgcg and cbbR-R: ggaagcgcatgtcttccaggc, and recombinant bacteria inserted with the target gene were identified by sequencing, and the obtained recombinant bacteria were Ralstonia rosenbergii Re.DELTA.proc.cbbr.

Step three: construction of a stable plasmid version Strain containing the cbbR (G205D, G118D) double mutant Gene

(1) A plasmid which can be stably inherited in the eutrophic Ralstonia was constructed and the proC gene and the cbbR (G205D, G118D) double mutant gene were loaded thereon. The gene synthesizes a proC gene with BsaI interface sequence, and the specific synthetic sequence is shown in SEQ ID NO. 8; the pSP plasmid with BsaI interface sequence is synthesized by the gene, and the specific synthetic sequence is shown in SEQ ID NO. 9; the gene synthesis of cbbR (G205D, G118D) gene with BsaI linker sequence has specific synthetic sequence shown in SEQ ID NO. 10. The three plasmids were assembled by Goldengate to obtain recombinant plasmids pSP-proC-cbbR (G205D, G118D).

(2) The recombinant plasmid pSP-proC-cbbR (G205D, G118D) was transformed into E.coli S17-1, and transferred into Re.DELTA.proC.DELTA.cbbr by the conjugal transformation method, and positive clones were selected on LB plates containing 250. Mu.g/l kanamycin. The obtained recombinant strain is Roche true culture Re 01.

Step four: recombinant strain Performance test

The fermentation performance of recombinant strain Re 01 was tested using Eutrophic Roche H16 as a control strain.

(1) Each strain (1000 μl) constructed in example 1 stored in glycerol tube was inoculated into seed medium i (20 mL) and seed first-stage culture was performed for 12 hours; then, inoculating 1v/v% of seed culture solution I into a seed culture medium II, and carrying out secondary seed culture for 13h; then 10v/v% of seed culture II was inoculated into a 2L mini-fermenter (Dibicer Co.) containing 1.1L of production medium. The operating conditions were a culture temperature of 30℃and a stirring speed of 800rpm, an aeration rate of 1L/min, and the pH was controlled to be between 6.7 and 6.8. 28% aqueous ammonia was used for pH control. During the cultivation, palm oil was continuously used as a carbon source for 54 hours.

(2) And centrifuging the fermentation liquor to obtain thalli. And drying the thalli to constant weight. The weight of the dried cells was measured and recorded as dry weight. To the dried cells obtained, 100mL of chloroform was added, and the mixture was stirred at room temperature for one day and night to extract the polyester in the cells. After the cell residue was filtered off, the mixture was concentrated to a total volume of about 30mL by an evaporator, and then about 90mL of hexane was slowly added thereto, followed by standing under slow stirring for 1 hour. The precipitated polyester was filtered off and dried in vacuo at 5CTC for 3 hours. The mass of the dried polyester was measured, and the polyester content in the cells was calculated.

(3) The results are shown in Table 3, with respect to the starting strain ReH16, the dry weight of Re01 was increased by 7.2%, the PHA% was increased by 7.2%, and the yield (titer) was increased by 15.0%.

TABLE 3 Table 3

Strain	Dry weight (g/L)	PHA(％)	titer(g/L)
				Re H16	207.4±2.8	74.0±1.0	153.5±2.6
Re 01	222.4±0.5	79.3±1.5	176.4±3.2

Step five: determination of the expression of cbbL and cbbS in the fermentation of recombinant strains

Taking the bacterial liquid fermented for 10 hours in the step four, and measuring transcriptome data by commercial companies. The expression conditions of the recombinant strain Re01 relative to the control strain ReH16 are shown in FIG. 1, the wild type cbbR gene is replaced by double mutant cbbR (G205D, G118D), the expression quantity of the cbbL is up-regulated to 64 times of the control strain, the expression quantity of the cbbS is up-regulated to 58 times of the control strain, and the expression quantity ratio of the cbbL and the cbbS of the strain Re01 is 1.02.

EXAMPLE 2 construction and Performance test of recombinant strains with Low-Strength promoters inserted before cbbL

The performance of the strain was tested by silencing the cbbR gene using H16, a true eutrophic strain of rochnder, and replacing the wild-type promoter before cbbL with a low-strength constitutive promoter (SEQ ID NO:53, hereinafter referred to as p53, of patent CN 108977890B).

Step one: recombinant bacterium for constructing replacement promoter by homologous recombination method

(1) PCR amplification is carried out by taking a genome of the eutropha rogowski H16 as a template, pcbbL-H1F, pcbbL-H1R is used for obtaining a homologous arm pcbbL-H1 at the upstream of a promoter insertion site, and pcbbL-H2F, pcbbL-H2R is used for obtaining a homologous arm pcbbL-H2 at the downstream of the promoter; amplifying the modified plasmid pK18mob serving as a template by using pK-F and pK-R to obtain a vector fragment; the primer sequences used are shown in Table 4. The pcbbL-H1 and pcbbL-H2 are connected with the vector fragment by the Gibson Assembly method to obtain a basic plasmid pKO-L, wherein the sequences of the homologous arms pcbbL-H1 and pcbbL-H2 are shown as SEQ ID NO. 11.

TABLE 4 Table 4

(2) The constitutive promoter p53 (SEQ ID NO. 15) was synthesized by adding GGTCTCATCGT upstream and ACGCAGAGACC downstream of the synthesized DNA sequence for subsequent manipulation.

(3) The basic plasmid pKO-L and the constitutive promoter p53 synthesized by the gene are assembled by the Goldengate method to obtain the recombinant plasmid pKO-L-p53. The recombinant plasmid is transformed into escherichia coli S17-1, then transferred into the eutrophic rochanterium H16 by a joint transformation method, and positive clones are screened by using an LB plate simultaneously containing 250 mug/mL kanamycin and 100 mug/mL apramycin by utilizing the characteristic that the suicide plasmid cannot replicate in host bacteria. The recombinant plasmid carrying the homologous fragment in the positive clone is integrated into the specific position of the pcbbL-H1 and the pcbbL-H2 of the genome, thereby obtaining the first homologous recombinant bacterium. The first homologous recombinant bacteria are subjected to monoclonal culture on an LB plate containing 100mg/mL sucrose, clones without kanamycin resistance are selected from the monoclonal bacteria, PCR is carried out by using a primer pcbbL-F: gacatatgcgcaacatgccaga, pcbbL-R: ggacggccgaacttgtccag, and recombinant bacteria inserted with a target gene are identified by sequencing, wherein the obtained recombinant bacteria are eutrophic rochanter Re 02.

Step two: performance test of recombinant strains

And (3) taking the eutrophic bacteria H16 of the Roche as a control strain, and testing the fermentation performance of the eutrophic bacteria Re 02 of the Roche. The specific operation procedure is the same as in step four of example 1. The results are shown in Table 5, where Re 02 is 16.7% higher in dry weight, 15.8% higher in PHA% and 35.1% higher in yield (titer) than Re H16, the starting strain.

TABLE 5

Strain	Dry weight (g/L)	PHA(％)	titer(g/L)
				Re H16	207.4±2.8	74.0±1.0	153.5±2.6
Re 02	242.1±3.5	85.7±0.6	207.4±4.2

Step three: determination of the expression of cbbL and cbbS in the fermentation of recombinant strains

Taking the bacterial liquid fermented for 10 hours in the second step, and measuring transcriptome data by commercial companies. As shown in FIG. 2, compared with the control strain Re H16, the expression of the recombinant strain Re 02 in the cbbL and the cbbS is up-regulated to 2.4 times of the original strain, the expression of the recombinant strain Re 02 in the cbbL and the cbbS is up-regulated to 2.9 times of the original strain, and the ratio of the expression of the cbbL and the cbbS of the recombinant strain Re 02 is 0.77.

EXAMPLE 3 construction and Performance test of recombinant strains with mid-strength promoters inserted before cbbL

The Brucella H16 was used as an initial strain, the cbbR gene was silenced, and the wild-type promoter before cbbL was replaced with a medium-strength constitutive promoter, (SEQ ID NO:52, hereinafter referred to as p52, from patent CN 108977890B), and the performance thereof was tested.

Step one: construction of recombinant bacterium substituting for promoter by homologous recombination (Green color note content same as in example 2)

(1) The constitutive promoter p52 (SEQ ID No. 16) was synthesized by adding GGTCTCATCGT upstream and ACGCAGAGACC downstream of the synthesized DNA sequence for subsequent manipulation.

(2) The pKO-L obtained in the step one of example 2 was assembled with the constitutive promoter p52 synthesized by the gene using the Goldengate method to obtain a recombinant plasmid pKO-L-p52. The recombinant plasmid is transformed into escherichia coli S17-1, then transferred into the eutrophic rochanterium H16 by a joint transformation method, and positive clones are screened by using an LB plate simultaneously containing 250 mug/mL kanamycin and 100 mug/mL apramycin by utilizing the characteristic that the suicide plasmid cannot replicate in host bacteria. The recombinant plasmid carrying the homologous fragment in the positive clone is integrated into the specific position of the pcbbL-H1 and the pcbbL-H2 of the genome, thereby obtaining the first homologous recombinant bacterium. The first homologous recombinant bacteria are subjected to monoclonal culture on an LB plate containing 100mg/mL sucrose, clones without kanamycin resistance are selected from the monoclonal bacteria, PCR is carried out by using a primer pcbbL-F: gacatatgcgcaacatgccaga, pcbbL-R: ggacggccgaacttgtccag, and recombinant bacteria inserted with a target gene are identified by sequencing, wherein the obtained recombinant bacteria are eutrophic bacteria Re 03.

Step two: performance test of recombinant strains

The fermentation performance test is carried out on the eutrophic rochanterium Re 03 by taking the eutrophic rochanterium H16 as a control strain. The specific operation procedure is the same as in step four of example 1. The results are shown in Table 6, and the recombinant strain Re 03 has a dry weight increase of 19.3%, a PHA% increase of 14.9% and a yield (titer) increase of 37.1% relative to the starting strain Re H16.

TABLE 6

Strain	Dry weight (g/L)	PHA(％)	titer(g/L)
				Re H16	207.4±2.8	74.0±1.0	153.5±2.6
Re 03	247.5±1.9	85.0±1.0	210.4±3.7

Taking the bacterial liquid fermented for 10 hours in the second step, and measuring transcriptome data by commercial companies. As shown in FIG. 3, compared with the control strain Re H16, the expression of the recombinant strain Re 03 in the cbbL and the cbbS is up-regulated to 18.6 times of the original strain, the expression of the recombinant strain Re 03 in the cbbS is up-regulated to 23.1 times of the original strain, and the ratio of the expression of the cbbL and the cbbS of the recombinant strain Re 03 is 0.75.

EXAMPLE 4 construction and Performance test of recombinant strains with high-strength promoters inserted before cbbL

The Brucella H16 was used as an initial strain, the cbbR gene was silenced, and the wild-type promoter before cbbL was replaced with a medium-strength constitutive promoter, (SEQ ID NO:68, hereinafter referred to as p68, from patent CN 108977890B), and the performance thereof was tested.

(1) The constitutive promoter p68 (SEQ ID NO. 17) was synthesized by adding GGTCTCATCGT upstream and ACGCAGAGACC downstream of the synthesized DNA sequence for subsequent manipulation.

(2) The basic plasmid pKO-L obtained in the step one of example 2 above was assembled with the constitutive promoter p68 synthesized by the gene synthesis method using the Goldengate method to obtain the recombinant plasmid pKO-L-p68. The recombinant plasmid is transformed into escherichia coli S17-1, then transferred into the eutrophic rochanterium H16 by a joint transformation method, and positive clones are screened by using an LB plate simultaneously containing 250 mug/mL kanamycin and 100 mug/mL apramycin by utilizing the characteristic that the suicide plasmid cannot replicate in host bacteria. The recombinant plasmid carrying the homologous fragment in the positive clone is integrated into the specific position of the pcbbL-H1 and the pcbbL-H2 of the genome, thereby obtaining the first homologous recombinant bacterium. The first homologous recombinant bacteria are subjected to monoclonal culture on an LB plate containing 100mg/mL sucrose, clones without kanamycin resistance are selected from the monoclonal bacteria, PCR is carried out by using a primer pcbbL-F: gacatatgcgcaacatgccaga, pcbbL-R: ggacggccgaacttgtccag, and recombinant bacteria inserted with a target gene are identified by sequencing, wherein the obtained recombinant bacteria are eutrophic rochanterium Re 04.

Step two: performance test of recombinant strains

The fermentation performance test is carried out on the eutrophic rochanterium Re 04 by taking the eutrophic rochanterium H16 as a control strain. The specific operation procedure is the same as in step four of example 1. The results are shown in Table 7 below, and the dry weight of recombinant Re 04 was increased by 13.7%, PHA% was increased by 10.4% and yield (titer) was increased by 25.6% relative to the starting strain Re H16.

TABLE 7

Strain	Dry weight (g/L)	PHA(％)	titer(g/L)
				Re H16	207.4±2.78	74.0±1.0	153.5±2.6
Re 04	235.9±3.2	81.7±1.0	192.7±4.9

Taking the bacterial liquid fermented for 10 hours in the second step, and measuring transcriptome data by commercial companies. As shown in fig. 4, compared with the control strain Re H16, the expression of cbbL and cbbS of the recombinant strain Re 04 was up-regulated to 64.9 times of the original strain, the expression of cbbS was up-regulated to 66.5 times of the original strain, and the ratio of cbbL to cbbS of the recombinant strain Re 04 was 0.91.

EXAMPLE 5 construction and Performance test of recombinant Strain with ultra high strength promoter inserted before cbbL

The Brucella H16 is taken as an original strain, a cbbR gene is silenced, a wild type promoter before the cbbL is replaced by an ultra-high strength constitutive promoter, which is derived from SEQ ID NO. 81 of patent CN 108977890B, hereinafter referred to as p 81), and the performance of the recombinant strain is tested.

(1) The constitutive promoter p81 (SEQ ID NO. 18) was synthesized by adding GGTCTCATCGT upstream and ACGCAGAGACC downstream of the synthesized DNA sequence for subsequent manipulation.

(2) The basic plasmid pKO-L obtained in the step one of example 2 above was assembled with the constitutive promoter p81 synthesized by the gene synthesis method using the Goldengate method to obtain the recombinant plasmid pKO-L-p81. The recombinant plasmid is transformed into escherichia coli S17-1, then transferred into the eutrophic rochanterium H16 by a joint transformation method, and positive clones are screened by using an LB plate simultaneously containing 250 mug/mL kanamycin and 100 mug/mL apramycin by utilizing the characteristic that the suicide plasmid cannot replicate in host bacteria. The recombinant plasmid carrying the homologous fragment in the positive clone is integrated into the specific position of the pcbbL-H1 and the pcbbL-H2 of the genome, thereby obtaining the first homologous recombinant bacterium. The first homologous recombinant bacteria are subjected to monoclonal culture on an LB plate containing 100mg/mL sucrose, clones without kanamycin resistance are selected from the monoclonal bacteria, PCR is carried out by using a primer pcbbL-F: gacatatgcgcaacatgccaga, pcbbL-R: ggacggccgaacttgtccag, and recombinant bacteria inserted with a target gene are identified by sequencing, wherein the obtained recombinant bacteria are eutrophic rochanterium Re 05.

Step two: performance test of recombinant strains

And (3) taking the eutrophic bacteria H16 of the Roche as a control strain, and testing the fermentation performance of the eutrophic bacteria Re 05 of the Roche. The specific operation procedure is the same as in step four of example 1. The results are shown in Table 8, which show that the recombinant strain Re 05 has no significant improvement in dry weight, PHA% and yield compared with the original strain Re H16.

TABLE 8

Strain	Dry weight (g/L)	PHA(％)	titer(g/L)
				Re H16	207.4±2.8	74.0±1.0	153.5±2.6
Re 05	203.5±3.3	76.3±0.6	155.4±2.0

Taking the bacterial liquid fermented for 10 hours in the second step, and measuring transcriptome data by commercial companies. As shown in FIG. 5, compared with the control strain Re H16, the expression level of the cbbL of the recombinant strain Re 05 is up-regulated to 141.5 times of the original strain, the expression level of the cbbS is up-regulated to 152.4 times of the original strain, and the expression level ratio of the cbbL to the cbbS of the recombinant strain Re 05 is 0.86.

EXAMPLE 6 construction and Performance test of cbbR mutant Strain with terminator knock-out between cbbS and cbbX genes

A strain which knocks out a terminator between the cbbS and cbbX genes and contains a stable plasmid pSP-proC-cbbR (G205D, G118D) was constructed using the recombinant strain of the eutrophic bacterium of Roche as obtained in example 1 above as an initial strain, and its performance was tested.

Step one: knocking out terminator between cbbS and cbbX by homologous recombination

(1) PCR amplification is carried out by taking a genome of the eutrophic Roche as a template, a cbbS-X-H1F, cbbS-X-H1R is used for obtaining a homologous arm cbbS-X-H1 on the upstream side of the terminator, and a cbbS-X-H2F, cbbS-X-H2R is used for obtaining a homologous arm cbbS-X-H2 on the downstream side of the terminator; amplifying the modified plasmid pK18mob serving as a template by using pK-F, pK-R to obtain a vector fragment; the primer sequences used are shown in Table 9. The cbbS-X-H1 and the cbbS-X-H2 are connected with the carrier fragment by the Gibson Assembly method to obtain a basic plasmid pKO-delta S-X, wherein the sequences of the homologous arms cbbS-X-H1 and cbbS-X-H2 are shown as SEQ ID NO. 12.

TABLE 9

(2) The recombinant plasmid pKO-delta S-X is transformed into escherichia coli S17-1, and then transferred into the eutrophic rocarpium Rdelta proC delta cbbR by a joint transformation method, and the construction method of the recombinant strain is the same as the step II of the example 1, and correspondingly, the primer proC-F, proC-R is replaced by the primer cbbS-X-F: tggggcgacatcagcttcaacta and cbbS-X-R: gttggactcgaagaaacggtcca, the recombinant bacteria obtained are Eutrophic bacteria Re delta proC delta cbbR delta S-X.

Step two: construction of a stable plasmid version Strain containing the cbbR (G205D, G118D) double mutant Gene

The plasmid pSP-proC-cbbR (G205D, G118D) constructed in step three of example 1 above was transformed into E.coli S17-1, and then transferred into Re.DELTA.proC.DELTA.cbbRDELTA.S-X by the conjugal transformation method, and positive clones were selected on LB plates containing 250. Mu.g/l kanamycin. The obtained recombinant strain is Rogowski true culture Re 06.

Step three: recombinant strain Performance test

Fermentation performance of recombinant strains was tested according to step four of example 1, using eutrophic rochanterium H16 as a control. The results are shown in Table 10, and the dry weight of recombinant strain Re 06 was increased by 6.8%, PHA% was increased by 6.8% and yield (titer) was increased by 14.1% relative to the starting strain Re H16.

Table 10

Strain	Dry weight (g/L)	PHA(％)	titer(g/L)
				Re H16	207.4±2.8	74.0±1.0	153.5±2.6
Re 06	221.6±6.2	79.0±2.0	175.1±8.5

Step four: determination of the expression of cbbL and cbbS in the fermentation of recombinant strains

Taking the bacterial liquid fermented for 10 hours in the third step, and measuring transcriptome data by commercial companies. As shown in fig. 6, compared with the expression conditions of cbbL and cbbS of the control strain Re H16, compared with the expression quantity of cbbL of the original strain Re 16, the expression quantity of cbbS of the recombinant strain Re 06 is up-regulated to 30.3 times of the original strain, the expression quantity of cbbS is up-regulated to 29.1 times of the original strain, and the expression quantity ratio of cbbL and cbbS of the recombinant strain Re 06 is 0.97.

EXAMPLE 7 construction and Performance test of recombinant Strain with terminator knockout between cbbS and cbbX genes, insertion of Low-Strength promoter before cbbL

Recombinant strain of the recombinant strain robusta Re 02 obtained in the above example 2 was used as an initial strain, and a terminator-knocked-out recombinant strain between the cbbS and cbbX genes was constructed and tested for performance.

The recombinant plasmid pKO-DeltaS-X constructed in the step I of the example 6 is transformed into the escherichia coli S17-1, and then is transferred into the recombinant strain Re 02 obtained in the example 2 by a joint transformation method, and the specific steps are the same as those of the step I of the example 6, so that the recombinant strain with the knocked-out terminator is the eutrophic roller Re 07.

Step two: recombinant strain Performance test

Fermentation performance of recombinant strains was tested according to step four of example 1, using eutrophic rochanterium H16 as a control. The results are shown in Table 11, and the recombinant strain Re 07 has no significant improvement in dry weight, PHA and yield (titer) relative to the starting strain Re H16.

TABLE 11

Strain	Dry weight (g/L)	PHA(％)	titer(g/L)
				Re H16	207.4±2.8	74.0±1.0	153.5±2.6
Re 07	201.9±6.3	75.1±0.4	151.3±0.4

Taking the bacterial liquid fermented for 10 hours in the second step, and measuring transcriptome data by commercial companies. As shown in fig. 7, compared with the expression of cbbL and cbbS of the control strain Re H16, the expression level of cbbL of the recombinant strain Re 07 was up-regulated to 3.4 times that of the original strain, the expression level of cbbS was up-regulated to 2.5 times that of the original strain, and the expression level ratio of cbbL to cbbS of the recombinant strain Re 07 was 1.25.

EXAMPLE 8 construction and Performance test of recombinant Strain with middlestrength promoter for terminator knockout between cbbS and cbbX genes, pre-insertion of cbbL

Recombinant strain of the recombinant strain robusta Re 03 obtained in the above example 3 was used as an initial strain, and a terminator-knocked-out recombinant strain between the cbbS and cbbX genes was constructed and tested for performance.

The recombinant plasmid pKO-DeltaS-X constructed in the first step of the example 6 is transformed into the escherichia coli S17-1, and then is transformed into the recombinant strain Re 03 of the example 3 by a joint transformation method, and the specific steps are the same as those of the first step of the example 6, so that the recombinant strain with the knocked-out terminator is the eutrophic roller Re 08.

Step two: recombinant strain Performance test

Fermentation performance of recombinant strains was tested according to step four of example 1, using eutrophic rochanterium H16 as a control. The results are shown in Table 12, and there was no significant difference in the dry weight, PHA% and yield (titer) of recombinant Re 08 relative to the starting strain Re H16.

Table 12

Strain	Dry weight (g/L)	PHA(％)	titer(g/L)
				Re H16	207.4±2.8	74.0±1.0	153.5±2.6
Re 08	203.0±7.7	76.0±1.0	153.9±7.0

Taking the bacterial liquid fermented for 10 hours in the second step, and measuring transcriptome data by commercial companies. As shown in fig. 8, compared with the expression of cbbL and cbbS of the control strain Re H16, the expression level of cbbL of the recombinant strain Re 08 was up-regulated to 21.2 times that of the original strain, the expression level of cbbS was up-regulated to 7.6 times that of the original strain, and the expression level ratio of cbbL to cbbS of the recombinant strain Re 08 was 2.60.

EXAMPLE 9 construction and Performance test of recombinant Strain with terminator knockout between cbbS and cbbX genes, insertion of high-Strength promoter before cbbL

The terminator recombinant strain between the cbbS and cbbX genes was constructed using the recombinant strain eutrophic rochanteria Re 04 obtained in example 4 as an initial strain, and the performance thereof was tested.

The recombinant plasmid pKO-DeltaS-X constructed in the first step of the example 6 is transformed into the escherichia coli S17-1, and then is transformed into the recombinant bacterium Re 04 of the example 3 by a joint transformation method, and the specific steps are the same as the first step of the example 6, so that the recombinant bacterium with the knocked-out terminator is the eutrophic bacterium Re 09.

Step two: recombinant strain Performance test

Fermentation performance of recombinant strains was tested according to step four of example 1, using eutrophic rochanterium H16 as a control. As shown in Table 13, the recombinant strain Re 09 was not significantly improved in dry weight, PHA and yield (titer) relative to the starting strain Re H16.

TABLE 13

Strain	Dry weight (g/L)	PHA(％)	titer(g/L)
				Re H16	207.4±2.8	74.0±1.0	153.5±2.6
Re 09	188.5±2.5	74.1±0.5	138.3±1.8

Taking the bacterial liquid fermented for 10 hours in the second step, and measuring transcriptome data by commercial companies. As shown in fig. 9, compared with the expression of cbbL and cbbS of the control strain Re H16, the expression level of cbbL of the recombinant strain Re 09 was up-regulated to 79.7 times that of the original strain, the expression level of cbbS was up-regulated to 40.6 times that of the original strain, and the expression level ratio of cbbL to cbbS of the recombinant strain Re 09 was 1.83.

EXAMPLE 10 stable plasmid over-expression of cbbL and cbbS

This example uses the eutrophic roller re.DELTA.proc of example 1 above as a starting strain, into which a stable plasmid comprising expression of cbbL using the p47 promoter (SEQ ID NO:47, hereinafter referred to as p47, from patent CN 108977890B) and expression of cbbS using the p53 promoter was transformed, and performance test was performed.

Step one: construction of recombinant strains containing stable plasmids expressing cbbL using the p47 promoter and cbbS using the p53 promoter

(1) A plasmid which can be stably inherited in the eutrophic bacterium of Roche was constructed, and the proC gene and the cbbS and cbbL genes were loaded thereon. The gene synthesizes a proC gene with BsaI interface sequence, and the specific synthetic sequence is shown as SEQ ID NO.8; the pSP plasmid with BsaI interface sequence is synthesized by the gene, and the specific synthetic sequence is shown as SEQ ID NO.9; the gene synthesis has the p53-cbbS-p47-cbbL gene with BsaI interface sequence, and the specific synthesis sequence is shown in SEQ ID NO.13. The three plasmids were assembled by Goldengate to obtain a recombinant plasmid pSP-proC-p53-cbbS-p47-cbbL.

(2) The recombinant plasmid pSP-proC-p53-cbbS-p47-cbbL was transformed into E.coli S17-1 and transferred into Re.DELTA.proC by the conjugal transformation method, and positive clones were selected on LB plates containing 250. Mu.g/l kanamycin. The obtained recombinant bacteria are the eutrophic bacteria Re 10 of Roche.

Step two: recombinant strain Performance test

The fermentation performance test is carried out on the eutrophic rochanterium Re 10 by taking the eutrophic rochanterium H16 as a control strain. The specific operation procedure is the same as in step four of example 1. The results are shown in Table 14, and the recombinant strain Re 10 has no significant improvement in dry weight, PHA and yield (titer) relative to the starting strain Re H16.

TABLE 14

Strain	Dry weight (g/L)	PHA(％)	titer(g/L)
				Re H16	207.4±2.8	74.0±1.0	153.5±2.6
Re 10	208.7±1.3	74.3±0.6	155.2±1.1

Taking the bacterial liquid fermented for 10 hours in the second step, and measuring transcriptome data by commercial companies. As shown in fig. 10, compared with the expression of cbbL and cbbS of the control strain, the expression level of cbbL of the recombinant strain Re 10 was up-regulated to 5.7 times that of the original strain, and the expression level of cbbS was up-regulated to 3.9 times that of the original strain, compared with the expression level of the original strain Re H16, and the ratio of cbbL to cbbS of the recombinant strain Re 10 was 1.41.

EXAMPLE 11 stable plasmid over-expression of cbbL and cbbS

In this example, a stable plasmid containing cbbL expressed using the p53 promoter and cbbS expressed using the p47 promoter was transformed with Re Δproc as the starting strain and subjected to performance test.

Step one: construction of recombinant strains containing stable plasmids expressing cbbL using low-strength promoters and cbbS using high-strength promoters

(1) A plasmid which can be stably inherited in the eutrophic bacterium of Roche was constructed, and the proC gene and the cbbS and cbbL genes were loaded thereon. The gene synthesizes a proC gene with BsaI interface sequence, and the specific synthetic sequence is shown as SEQ ID NO.8; the pSP plasmid with BsaI interface sequence is synthesized by the gene, and the specific synthetic sequence is shown as SEQ ID NO.9; the gene synthesis has the p47-cbbS-p53-cbbL gene with BsaI interface sequence, and the specific synthesis sequence is shown in SEQ ID NO.14. The three plasmids were assembled by Goldengate to obtain a recombinant plasmid pSP-proC-p47-cbbS-p53-cbbL.

(2) The recombinant plasmid pSP-proC-p47-cbbS-p53-cbbL was transformed into E.coli S17-1 and transferred into Re.DELTA.proC by the conjugal transformation method, and positive clones were selected on LB plates containing 250. Mu.g/l kanamycin. The obtained recombinant bacteria are eutrophic bacteria Re 11 of Roche.

Step two: recombinant strain Performance test

The fermentation performance test is carried out on the eutrophic rochanterium Re 11 by taking the eutrophic rochanterium H16 as a control strain. The specific operation procedure is the same as in step four of example 1. The results are shown in Table 15, and the recombinant strain Re 11 has 12.5% dry weight, 9.5% PHA% and 25.7% yield (titer) relative to the starting strain Re H16.

TABLE 15

Strain	Dry weight (g/L)	PHA(％)	titer(g/L)
				Re H16	207.4±2.8	74.0±1.0	153.5±2.6
Re 11	233.3±2.5	81.0±0.6	192.8±1.2

Taking the bacterial liquid fermented for 10 hours in the second step, and measuring transcriptome data by commercial companies. As shown in fig. 11, compared with the expression of cbbL and cbbS of the control strain Re H16, the expression level of cbbL of the recombinant strain Re 11 was up-regulated to 3.4 times that of the original strain, the expression level of cbbS was up-regulated to 5.5 times that of the original strain, and the expression level ratio of cbbL to cbbS of the recombinant strain Re 11 was 0.57.

It should be noted that the above examples only show a way of partially controlling the expression levels of cbbL and cbbS, and it is understood from the experimental results of the present invention that no matter what gene expression control method is used, the improvement of PHA yield can be achieved by increasing the expression levels of cbbL and cbbS within the range described in the present invention, and therefore, the way of controlling the expression levels of cbbL and cbbS is not limited to the examples in the above examples. In addition, the above examples only show experimental results of fermentation verification using palm oil as a carbon source, but according to the general technical knowledge in the art, routes of PHA biosynthesis using different oils and fats as carbon sources all use acyl-coa obtained by β -oxidation as key raw materials, and their metabolic pathways and regulation modes are basically the same, so the essential inventive concept of the present invention is not limited to specific selection of carbon sources, and other oil and fat carbon sources (such as vegetable oil, animal oil, kitchen waste oil, etc.) can achieve technical effects of the present invention.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a calvin cycle related gene or a protein encoded by the same or a biological material comprising the calvin cycle related gene for any of the following:

6) Use in promoting the beta-oxidation cycle of a microorganism;

The calvin cycle related genes are cbbL and cbbS.

2. The application according to claim 1, characterized in that it comprises: increasing the expression level of the calvin cycle related gene in a microorganism and/or increasing the enzyme activity of the encoded protein of the calvin cycle related gene;

preferably, the expression level of the calvin cycle related gene in the microorganism is increased to 2 to 141 times the expression level of cbbL before regulation, and the ratio of cbbL to cbbS expression level is (0.5 to 1.2): 1.

3. the use according to claim 1 or 2, wherein the calvin cycle related gene is derived from a heterotrophic microorganism; preferably from Eutrophic bacteria, E.coli, yeasts, pseudomonas or Salmonella;

and/or the microorganism is a heterotrophic microorganism, preferably a eutrophic bacterium, e.coli, yeast, pseudomonas or halomonas sp.

4. Use according to any one of claims 1 to 3, characterized in that the metabolite takes the metabolite of the β -oxidation cycle as synthesis precursor.

5. The use according to claim 4, wherein the metabolite uses acetyl-coa, acyl-coa, enoyl-coa, hydroxyacyl-coa and/or ketoacyl-coa as synthesis precursors;

Preferably, the metabolite is a polyester, an organic acid, an amino acid, an alcohol or a hydrocarbon compound.

6. A method for increasing the yield of a metabolite produced by a microorganism using oil or fat, the method comprising: modifying the microorganism to increase the expression level of the calvin cycle-related gene in the microorganism and/or to increase the enzyme activity of the encoded protein of the calvin cycle-related gene;

the calvin cycle related genes are cbbL and cbbS.

7. The method according to claim 6, wherein the increase in the expression level of the calvin cycle-related gene in the microorganism is 2 to 141-fold higher than the expression level of cbbL before modification, and the ratio of the expression level of cbbL to cbbS is (0.5 to 1.2): 1.

8. the method according to claim 6 or 7, wherein the microorganism is a heterotrophic microorganism, preferably a eutrophic bacterium of the genus rochanteria, escherichia coli, yeast, pseudomonas or halomonas.

9. The method according to any one of claims 6 to 8, wherein the metabolite is a metabolite of the β -oxidation cycle as a synthetic precursor.

10. The method according to claim 9, wherein the metabolite uses acetyl-coa, acyl-coa, enoyl-coa, hydroxyacyl-coa and/or ketoacyl-coa as synthesis precursors;