WO2019185861A1

WO2019185861A1 - Modified microorganism with improved rubisco activity

Info

Publication number: WO2019185861A1
Application number: PCT/EP2019/057998
Authority: WO
Inventors: Cédric BOISART; Nicolas Chabot
Original assignee: Enobraq
Priority date: 2018-03-30
Filing date: 2019-03-29
Publication date: 2019-10-03
Also published as: FR3079525A1

Abstract

The invention concerns the improvement in the activity of ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO, E.C. 4.1.1.39) in a microorganism expressing a functional RuBisCO capable of using carbon dioxide as the only source of carbon or in addition to another source of organic carbon, by genetic modification at a transcription elongation factor responsible for modulating the processivity of RNA polymerase.

Description

MODIFIED MICROORGANISM WITH ENHANCED RUBISCO ACTIVITY

FIELD OF THE INVENTION

The present invention relates to the enhancement of the activity of ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCO, EC 4.1 .1 .39) in a microorganism expressing a functional RuBisCO capable of using carbon dioxide alone. source of carbon or in addition to another source of organic carbon.

STATE OF THE ART

RuBisCO is the carbon dioxide binding enzyme of the Calvin cycle. This protein, its different forms, their sequences, their structures and their activities have been widely studied and are well known to those skilled in the art.

Improving RuBisCO activity in microorganisms would improve the use of carbon dioxide by these organisms, in particular to improve their production yields (Singh et al., 2018).

Various microorganisms expressing a set of genes for the expression of a functional RuBisCO, whether it be a set of native or heterologous genes, are known (WO 2014/096391, WO 2014/129898, WO 2015/107496, WO 2015/177800).

These microorganisms are used in industrial processes using carbon dioxide as the sole source of carbon or in combination with a source of organic carbon. However, the RuBisCO activity is generally limiting and there is interest in improving this activity, in particular to promote the productivity of industrial processes.

The inventors have now identified new genetic modifications to be introduced into the microorganisms so as to improve the activity of the expressed functional RuBisCO.

While some have already described mutations in genes known to be associated with RuBisCO, such as rubisco activase (WO 2013/123244), the genetic modifications according to the invention are not associated with genes known to be associated with RuBisCO , its expression or activation.

SUMMARY OF THE INVENTION

The invention relates to a microorganism capable of expressing a functional RuBisCO, characterized in that it is genetically modified at a transcriptional elongation factor responsible for modulating the processivity of the RNA polymerase to improve the metabolism. activity of said functional RuBisCO.

The microorganisms modified according to the invention may be microorganisms expressing the genes necessary for the expression of a native functional RuBisCO. These microorganisms are in particular chosen from protists, in particular microalgae and bacteria. According to another aspect of the invention the modified organisms are microorganisms which do not express native functional RuBisCO and which are also modified to express a set of heterologous genes necessary for the expression of a functional RuBisCO.

The set of genes for the expression of a functional RuBisCO comprises the genes encoding the RuBisCO subunits and the genes encoding the chaperone proteins necessary for assembling the RuBisCO subunits. These different genes can be native or heterologous depending on the microorganisms considered.

Microorganisms that do not express native functional RuBisCO are in particular chosen from bacteria, yeasts, fungi and protists.

The invention also relates to a method for culturing a genetically modified microorganism according to the invention, whether or not it expresses a native functional RuBisCO, comprising culturing said microorganism on a culture medium comprising a carbon source for producing a biomass. and optionally a recovery step of metabolites of interest from the biomass and / or culture supernatant obtained. The carbon source may be carbon dioxide or a source of organic carbon combined with carbon dioxide for microorganisms capable of growing with a source of organic carbon as the only carbon source.

DESCRIPTION OF THE FIGURES

Figure 1 represents the consensus sequence identified in the sequences of the SPT5 and NusG proteins by alignment of the 3D representations of the proteins (the relative size of the letters representing an amino acid at a given position is associated with the number of occurrences where this is found. same amino acid at the same position in a gene SPT5 or nusG).

Figure 2 shows a 3D representation of the superposition of the S. cerevisiae SPT5 NGN domain and E. coli NusG. In black are represented the secondary structure elements of the S. cerevisiae SPT5 NGN domain. Alanine 339 is represented in black stick. The secondary structural elements of the NusG protein of E. coli have been superimposed on those of the NGN domain of SPT5, and are represented in light gray. The methionine side chain structurally equivalent to A339 is figured in a light gray colored stick. For the sake of clarity, the first six N-terminal residues of NusG have been omitted from the representation.

DEFINITIONS

The terms "recombinant microorganism", "modified microorganism", "genetically modified microorganism" and "recombinant host cell" are used interchangeably herein to mean microorganisms that have been genetically engineered to express or express endogenous nucleotide sequences, to express heterologous nucleotide sequences, or that have an alteration of the expression of an endogenous gene. "Alteration" means that the expression of the gene, or level of an RNA molecule or equivalent RNA molecules encoding one or more polypeptides or polypeptide subunits, or the activity of one or more polypeptides or polypeptide subunits is regulated, so that the expression, level or activity is greater or less than that observed in the absence of modification.

It is understood that the terms "recombinant microorganism", "modified microorganism", "genetically modified microorganism" and "recombinant host cell" refer not only to a particular genetically modified microorganism, but to the offspring or potential offspring of such an organism. As some changes may occur in later generations because of mutation or environmental influences, this offspring may not be identical to the parent microorganism, but is still within the term as used herein.

The term "exogenous" as used herein with reference to various molecules (nucleotide sequences, peptides, enzymes, etc.), refers to molecules that are not normally or naturally found in and / or produced by the microorganism of interest. Conversely, the term "endogenous" or "native" in reference to various molecules (nucleotide sequences, peptides, enzymes, etc.), refers to molecules that are normally or naturally found in and / or produced by the microorganism under consideration.

The invention provides genetically modified microorganisms, especially for the production of a molecule of interest, endogenous or exogenous.

By "genetically modified" microorganism is meant that the genome of the microorganism has been modified to integrate a nucleic sequence either to replace a native nucleic sequence, or to modify a native nucleic sequence, or to delete a native nucleic sequence, or to add a new nucleic sequence. Said nucleic sequence may have been introduced into the genome of said microorganism or one of its ascendants, by means of any suitable molecular cloning method. In the context of the invention, the genome of the microorganism refers to all the genetic material contained in said microorganism, including the extrachromosomal genetic material contained for example in plasmids, episomes, synthetic chromosomes, etc. The nucleic acid sequence introduced may be a heterologous sequence, that is to say one that does not exist in the natural state in said microorganism, or a homologous sequence. The nucleic sequence may be a gene fragment introduced to replace the native gene or a fragment thereof, in particular to replace a coding sequence, wholly or in part or to suppress the native coding sequence, in whole or in part. To introduce a new coding sequence, it is advantageous to introduce into the genome of the microorganism a transcriptional unit comprising the nucleic sequence of interest, placed under the control of one or more promoter (s). Such a transcriptional unit also advantageously comprises the usual sequences such as transcriptional terminators and, if appropriate, other transcriptional regulation elements. In particular, the term "microorganism capable of expressing a native functional RuBisCO" denotes a microorganism endogenously expressing genes encoding a functional RuBisCO.

In particular, the term "microorganism that does not express a native functional RuBisCO" denotes a microorganism that does not endogenously express genes encoding a functional RuBisCO and that expresses heterologous genes coding for a functional RuBisCO.

DETAILED DESCRIPTION OF THE INVENTION

The invention relates to a microorganism capable of expressing a functional RuBisCO, genetically modified to improve the activity of said functional RuBisCO.

The activity of RuBisCO can be measured by any means known to those skilled in the art, in particular the method described in Example 8 below.

According to a first embodiment of the invention, the genetically modified microorganisms express a native functional RuBisCO, in particular chosen from prokaryotic or eukaryotic microorganisms which express a native functional RuBisCO. It may be microorganisms such as protists, especially microalgae or cyanobacteria.

Among the bacteria which express a functional functional RuBisCO, mention will be made of Hydrogenovibrio marinus, Rhodobacter capsulatus, Rhodobacter sphaeroides, Cupriavidus necator, Cupriavidus metallidurans, Corynebacterium autotrophicum, Nocardia autotrophica, Nocardia opaca, Rhodospirillum rubrum, Rhizobium japonicum, Hydrogenomonas pantotropha, Hydrogenomonas eutropha, Hydrogenomonas Hydrogenophilus isleticus, Hydrogenophilus thermoluteolus, Xanthobacter autotrophicus, Xanthobacter flavus, Hydrogenophaga flava, Hydrogenophaga palleronii, Hydrogenophaga pseudoflava, Bradyrhizobium japonicum, Ralstonia eutropha, Alcaligenes eutrophus, Alcaligenes facilitis, Alcaligenes hydrogenophilus, Alcaligenes latus, Alkaligenes paradoxus, Alcaligenes ruhletii, Amycolata sp. , Aquaspirillum autotrophicum, Arthrobacter s train 1 1 / X, Azospirillum lipoferum, Variovouax paradoxus, Acidovouax facilis, Bacillus schlegelii, Bacillus tusciae, Calderobacterium hydrogenophilum, Derxia gummosa, Flavobacter ium autautresmophilum, Microcyclus aquaticus, Mycobacterium goudoniae, Paracoccus denitrificans, Persephonella marina, Persephonella guaymasensis, Renobacter vacuolatum, Thermocrinis ruber, Wautersia sp.

Among the cyanobacteria that express a native functional RuBisCO, mention may be made of Acaryochloris marina, Anabaena variabilis, Arthrospira platensis, Arthrospira maxima, Chlorobium tepidum, Chlorobaculum sp., Cyanothece sp., Gloeobacter violaceus, Microcystis aeruginosa, Nostoc punctiform, Prochlorococcus marinus, Synechococcus elongatus, Synechocystis sp., Thermosynechococcus elongatus, Trichodesmium erythraeum, and Rhodopseudomonas palustris.

Among the microalgae which express a native functional RuBisCO, mention will be made of all the eukaryotic-type microscopic algae, preferentially belonging to the classes or superclasses of Chlorophyceae, Chrysophyceae, Prymnesiophyceae, Diatomaceous or Bacillariophyta, Euglenophyceae, Rhodophyceae, or Trebouxiophyceae. Preferentially, the microalgae genetically modified according to the invention are chosen from Nannochloropsis sp. (e.g. Nannochloropsis oculata, Nannochloropsis gaditana, Nannochloropsis salina, Nannochloropsis oceanica), Tetraselmis sp. (e.g. Tetraselmis suecica, Tetraselmis chuii), Chlorella sp. (e.g. Chlorella salina, Chlorella protothecoides, Chlorella ellipsoidea, Chlorella emersonii, Chlorella minutissima, Chlorella pyrenoidosa, Chlorella sorokiniana, Chlorella vulgaris), Chlamydomonas sp. (e.g. Chlamydomonas reinhardtii) Dunaliella sp. (eg Dunaliella tertiolecta, Dunaliella salina), Phaeodactylum tricornutum, Botrycoccus braunii, Chroomonas salina, Cyclotella cryptica, Cyclotella sp., Ettlia texensis, Euglena gracilis, Gymnodinium nelsoni, Haematococcus pluvialis, Isochrysis galbana, Monoraphidium minutum, Monoraphidium sp., Neochloris oleoabundans, Nitzschia laevis, Onoraphidium sp., Pavlova lutheri, Phaeodactylum tricornutum, Porphyridium cruentum, Scenedesmus sp. (e.g. Scenedesmus obliquus, Scenedesmus quadricaula, Scenedesmus sp.), Stichococcus bacillaris, Spirulina platensis, Thalassiosira sp.

According to the invention, any microorganisms which do not express a native functional RuBisCO can be employed, these microorganisms being genetically modified to express a heterologous functional RuBisCO. In particular, these microorganisms are selected from bacteria, yeasts, fungi and protists.

In one embodiment, the microorganism that does not express a functional native RuBisCO genetically modified according to the invention is a yeast, preferably selected from ascomycete yeasts (Spermophthoraceae and Saccharomycetaceae), basidiomycetes yeasts (Leucosporidium, Rhodosporidium, Sporidiobolus, Filobasidium and Filobasidiella) and deuteromycete yeasts belonging to Fungi imperfecti (Sporobolomycetaceae, and Cryptococcaceae). Preferentially, the genetically modified yeast according to the invention belongs to the genus Pichia, Kluyveromyces, Saccharomyces, Schizosaccharomyces, Candida, Lipomyces, Rhodotorula, Rhodosporidium, Yarrowia, or Debaryomyces. More preferably, the genetically modified yeast according to the invention is chosen from Pichia pastoris, Kluyveromyces lactis, Kluyveromyces marxianus, Saccharomyces cerevisiae, Saccharomyces carlsbergensis, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri and Saccharomyces norbensis. Saccharomyces oviformis, Schizosaccharomyces pombe, Candida albicans, Candida tropicalis, Rhodotorula glutinis, Rhodosporidium toruloides, Yarrowia lipolytica, Debaryomyces hansenii and Lipomyces starkeyi.

In another embodiment, the microorganism that does not express functional native RuBisCO genetically modified according to the invention is a fungus, and more particularly a "filamentous" fungus. In the context of the invention, "filamentous fungi" refers to all filamentous forms of the Eumycotina subdivision. For example, the genetically modified fungus according to the invention belongs to the genus Aspergillus, Trichoderma, Neurospora, Podospora, Endothia, Mucor, Cochiobolus or Pyricularia. Preferably, the genetically modified fungus according to the invention is chosen from Aspergillus nidulans, Aspergillus niger, Aspergillus awomari, Aspergillus oryzae, Aspergillus terreus, Neurospora crassa, Trichoderma reesei, and Trichoderma viride.

In one embodiment, the microorganism that does not express functional native RuBisCO genetically modified according to the invention is a bacterium, preferably selected from phyla Acidobacteria, Actinobacteria, Aquificae, Bacterioidetes, Chlamydiae, Chlorobi, Chloroflexi, Chrysiogenetes, Cyanobacteria, Deferribacteria, Deinococcus-Thermus, Dictyoglomi, Fibrobacteria, Firmicutes, Fusobacteria, Gemmatimonadetes, Nitrospirae, Planctomycetes, Proteobacteria, Spirochaetes, Thermodesulfobacteria, Thermomicrobia, Thermotogae, or Verrucomicrobia. Preferably, the bacterium genetically modified according to the invention belongs to the genus Acaryochloris, Acetobacter, Actinobacillus, Agrobacterium, Alicyclobacillus, Anabaena, Anacystis, Anaerobiospirillum, Aquifex, Arthrobacter, Arthrospira, Azobacter, Bacillus, Brevibacterium, Burkholderia, Chlorobium, Chromatium, Chlorobaculum , Clostridium, Corynebacterium, Cupriavidus, Cyanothece, Enterobacter, Deinococcus, Erwinia, Escherichia, Geobacter, Gloeobacter, Gluconobacter, Hydrogenobacter, Klebsiella, Lactobacillus, Lactococcus, Mannheimia, Mesorhizobium, Methylobacterium, Microbacterium, Microcystis, Nitrobacter, Nitrosomonas, Nitrospina, Nitrospira, Nostoc , Phormidium, Prochlorococcus, Pseudomonas, Ralstonia, Rhizobium, Rhodobacter, Rhodococcus, Rhodopseudomonas, Rhodospirillum, Salmonella, Scenedesmun, Serratia, Shigella, Staphylococcus, Streptomyces, Synechoccus, Synechocystis, Thermosynechococcus, Trichodesmium, or Zymomonas. More preferably, the bacterium genetically modified according to the invention is selected from the species Agrobacterium tumefaciens, Anaerobiospirillum succiniciproducens, Actinobacillus succinogens, Aquifex aeolicus, Aquifex pyrophilus, Bacillus subtilis, Bacillus amyloliquefacines, Brevibacterium ammoniagenes, Brevibacterium immariophilum, Clostridium pasteurianum, Clostridium ljungdahlii , Clostridium acetobutylicum, Clostridium beigerinckii, Corynebacterium glutamicum, Cupriavidus necator, Cupriavidus metallidurans, Enterobacter sakazakii, Escherichia coli, Gluconobacter oxydans, Hydrogenobacter thermophilus, Klebsiella oxytoca, Lactococcus lactis, Lactobacillus plantarum, Mannheimia succiniciproducens, Mesorhizobium loti, Pseudomonas aeruginosa, Pseudomonas mevalonii, Pseudomonas pudica, Pseudomonas putida, Pseudomonas fluorescens, Rhizobium etli, Rhodobacter capsulatus, Rhodobacter sphaeroides , Rhodospirillum rubrum, Salmonella enterica, Salmonella typhi, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Streptomyces coelicolor and Zymomonas mobilis.

The invention thus relates to a microorganism capable of expressing a functional RuBisCO, characterized in that it is genetically modified at the level of a transcription elongation factor responsible for modulating the processivity of the RNA polymerase and of the stability of the RNA polymerase elongation machinery.

Transcription elongation factors responsible for modulating the processivity of the RNA polymerase are known to those skilled in the art, in particular the nusG and SPT5 genes, transcription elongation factors which aid the synthesis of RNA on DNA template by cellular RNA polymerases (ARNP) (Yakhnin and Babitzke, 2015). SPT5, present in all eukaryotes and archaea, couples RNA treatment and chromatin modification to transcriptional elongation (Blythe et al., 2016). NusG is present in all bacteria and participates in a wide variety of processes, including the break in ARNP and the Rho-dependent termination. NusG / SPT5 regulates the processivity of RNA polymerase transcription and is important in the stability of the RNAP elongation machinery. The composition of the NusG / SPT5 modular domain and the way it binds to the ARNP are conserved in all three domains of life. NusG / SPT5 encloses the ARNP around a DNA binding channel, which allows to modulate the processivity of the transcription. Recruiting additional factors to the lengthening of the ARNP may be another conserved function of this ubiquitous protein.

Depending on the organism, the genes coding for NusG / SPT5 may be called nusG (eg Escherichia coli), SPT5 (eg Saccharomyces cerevisiae), elongation factor, chromatin elongation factor, termination / anti-termination protein. the transcription.

The table below lists, by way of example, the sequences coding for a NusG or SPT5 elongation factor.

Table 1: Examples of sequences coding for NusG / SPT5

According to a preferred embodiment of the invention, the genetic modification of the microorganism at the level of a transcription elongation factor responsible for modulating the processivity of the RNA polymerase and the stability of the elongation machinery RNA polymerase comprises the expression of a mutated transcription elongation factor, in particular the expression of a mutated NusG / SPT5 protein.

This expression of a mutated protein is achieved by the expression of a gene coding for the mutated protein in the genetically modified microorganism according to the invention.

This mutation is advantageously a transposition (substitution) of at least one amino acid by another amino acid in the NusG / SPT5 protein.

According to a particular embodiment of the invention, at least one mutation is localized in one of the secondary structure elements common to the NGN domain of SPT5 and NusG, that is to say, the three alpha helices (a1, a2 and a3) as well as the four beta strands (b1, b2, b3 and b4). More preferably, at least one mutation is introduced at the C-terminal end of the b3 sheet.

According to a preferred embodiment of the invention, the mutated NusG / SPT5 protein comprises a mutation in a 9 amino acid consensus sequence shown in FIG.

This sequence can be identified on the 3D structure of the proteins by superimposing the 3D representations as in FIG. 2. Those skilled in the art are familiar with 3D protein representation methods, in particular with the Pymol software.

This consensus sequence consists of a first amino acid which is either a glycine or an asparagine, a second amino acid having a sterically hindered side chain (Tyrosine, Histidine, Lysine, Arginine, etc.), a third acid apolar amine, a fourth amino acid which is either a tyrosine or a leucine, a fifth amino acid apolar, a sixth amino acid which may be either a Glutamic acid or a Glutamine is an Arginine, a seventh amino acid that will be either a Alanine is a Serine or a Methionine or an Isoleucine, the last two amino acids have polar side chains and / or bulky.

Table 2: Examples of consensus sequences of 9 amino acids in NusG / SPT5

According to a preferred embodiment, the NusG / SPT5 protein expressed in the genetically modified microorganism according to the invention comprises a mutation consisting of a transposition of the seventh amino acid (either an Alanine or a Serine or a Methionine or an Isoleucine) in any acid amine other than the amino acid present in the native sequence.

More preferably, the mutation consisting of a transposition of the seventh amino acid (an alanine or a serine or a methionine is an isoleucine) in Proline is introduced.

Those skilled in the art will be able to identify the structural equivalence of the position of the mutation.

For example, in Saccharomyces cerevisiae, the amino acid at position 7 of the consensus sequence corresponds to Alanine at position 339 in the SPT5 protein. The side chain of alanine 339 is oriented towards the hydrophobic core of this domain and points to residues 1322, 1337, V344 and 1345. Furthermore, it is vicinal of glutamic acid E338, well described in the literature to interact with by hydrogen bonding directly with the SPT4 protein of S. cerevisiae.

The mutation advantageously consists of a substitution of Alanine 339 by any amino acid other than Alanine. More preferably, the mutation consists of a substitution of Alanine 339 by a Proline. For example, in Escherichia coli, the amino acid at position 7 of the consensus sequence corresponds to a Methionine at position 73 in the NusG protein.

The mutation advantageously consists of a substitution of the methionine at position 73 for any amino acid other than a methionine. More preferably, the mutation consists of a substitution of the methionine at position 73 with a Proline.

For example, in Cupriavidus necator, the amino acid at position 7 of the consensus sequence corresponds to a Methionine at position 85 in the NusG protein.

The mutation advantageously consists of a substitution of the methionine at position 85 by any amino acid other than a methionine. More particularly, the mutation consists of a substitution of the methionine at position 85 with a Proline.

For example, in Synechococcus elongatus, the amino acid at position 7 of the consensus sequence corresponds to a methionine at position 92 in the NusG protein.

The mutation advantageously consists of a substitution of the methionine at position 92 with any amino acid other than a methionine. More preferably, the mutation consists of a substitution of methionine at position 92 with a Proline.

For example, in Nannochloropsis gaditana, the amino acid at position 7 of the consensus sequence corresponds to a methionine at position 50 in the SPT5 protein.

The mutation advantageously consists of a substitution of a methionine at position 50 for any amino acid other than a methionine. More preferably, the mutation consists of a substitution of the methionine at position 50 with a Proline.

For example, in Phaeodactylum tricornutum, the amino acid at position 7 of the consensus sequence corresponds to a Serine at position 260 in the SPT5 protein.

The mutation advantageously consists of a substitution of a serine at position 260 with any amino acid other than a serine. More preferably, the mutation consists of a substitution of Serine at position 260 by a Proline.

For example, in Synechocystis sp., The amino acid at position 7 of the consensus sequence corresponds to a methionine at position 88 in the NusG protein.

The mutation advantageously consists of a substitution of a methionine at position 88 with any amino acid other than a methionine. More preferably, the mutation consists of a substitution of methionine at position 88 with a Proline.

For example, in Rhodococcus opacus, the amino acid at position 7 of the consensus sequence corresponds to a methionine at position 139 in the NusG protein.

The mutation advantageously consists of a substitution of a methionine at position 139 with any other amino acid other than a methionine. More preferably, the mutation consists of a substitution of methionine at position 139 by a Proline.

For example, in Aspergillus niger, the amino acid at position 7 of the consensus sequence corresponds to a Methionine at position 274 in the SPT5 protein. The mutation advantageously consists of a substitution of a methionine at position 274 by any other amino acid other than a methionine. More preferably, the mutation consists of a substitution of the methionine at position 274 by a Proline.

The expression of a gene coding for a mutated NusG / SPT5 protein in the genetically modified microorganism according to the invention may be made by any means known to those skilled in the art.

According to a first embodiment of the invention, the microorganism is genetically modified by the introduction into its genome of a gene coding for a mutated protein as defined above. This heterologous gene comprises a sequence coding for the mutated protein and the regulatory elements necessary for its expression in the host organism, in particular promoters and termination sequences, which are well known to those skilled in the art.

When the genetically modified organism comprises a native sequence coding for a NusG / SPT5 protein, the mutated protein encoded by the heterologous gene may be identical to that of the host organism, with the exception of the mutation, or else be a protein another organism with the mutation as defined above.

Advantageously, the mutated NusG / SPT5 protein expressed in the host microorganism has the same sequence as the native NusG / SPT5 protein, with the exception of the mutation.

According to a second embodiment of the invention, the microorganism is genetically modified by site-directed mutagenesis in the native gene coding for the NusG / SPT5 protein, so as to replace the codons coding for the amino acid to be substituted by the codons coding for another amino acid, as defined above.

Site-directed mutagenesis techniques are well known to those skilled in the art, particularly homologous recombination techniques (Datsenko and Wanner, 2000, Lodish et al., 2000) for modifying the expression of a gene and / or the activity of the encoded protein (Thomas and Capecchi, 1987), the use of zinc finger nucleases (Kim et al., 1996), the use of transcriptional activator-like effector nucleases, called "TALEN" (Ousterout and al., 2016), the use of a system combining Cas9-type nucleases with short regular and regularly spaced palindromic repeats called 'CRISPR' (Cong et al., 2013, Mali Prashant, 2013), or the use of meganucleases (Daboussi et al., 2012).

Those skilled in the art will be able to determine the nucleic acid sequences necessary for modifying the coding sequence for the NusG / SPT5 protein so as to substitute an amino acid with another amino acid.

According to one embodiment of the invention, the genetically modified microorganism comprises a gene coding for an SPT5 protein or a homologue thereof. These microorganisms are in particular eukaryotic microorganisms, more particularly protists, mushrooms (fungi) and yeasts.

According to the invention, the term gene homologous to SPT5 is intended to mean a gene encoding a protein having an NGN domain comprising at least 40% identity with the NGN domain of the Saccharomyces cerevisiae SPT5 protein (EIW08248.1) and having a transcription elongation factor.

The mutation is advantageously introduced into the conserved zone defined by the following consensus sequence: GRIYIEAPK (SEQ ID NO 1)

This consensus sequence is located between amino acids 333 and 341 of the SPT5 sequence of Saccharomyces cerevisiae (EIW08248.1) and can be easily found by those skilled in the art by simple sequence alignment.

This mutation more advantageously consists in modifying the alanine at the 7-position of this consensus sequence with another amino acid, in particular with a proline residue, as defined above.

According to another embodiment of the invention, the genetically modified microorganism comprises a gene encoding a NusG protein or a homologue thereof. These organisms are in particular prokaryotic microorganisms.

By homologue of the nusG gene is meant according to the invention a gene coding for a protein comprising at least 50% identity with the NusG protein of Escherichia coli (NP_418409.1) and having a transcriptional elongation factor activity.

The mutation is advantageously introduced into the conserved zone defined by the following consensus sequence: GYVLVQMVM (SEQ ID No. 7)

This consensus sequence is located between amino acids 67 and 75 of the NusG sequence of Escherichia coli (NP_418409.1) and can be easily found by those skilled in the art by simple sequence alignment.

This mutation more advantageously consists in modifying the methionine residue at position 7 of this consensus sequence by another amino acid, in particular by a proline residue.

An improvement in the activity of RuBisCO is observed when the activity of the modified microorganism at the level of a transcription elongation factor responsible for modulating the processivity of the RNA polymerase according to the invention is greater than that of the same microorganism without this modification at a transcription elongation factor responsible for modulating the processivity of the RNA polymerase. Preferably, the activity is improved by at least a factor 2, more preferably by at least a factor of 5.

The modified microorganisms according to the invention may comprise the genes necessary for the expression of a native functional RuBisCO. Advantageously, the transcription elongation factor is the nusG / SPT5 gene, or a homologue thereof. last, in particular modified by the introduction of a mutation as defined above.

According to another aspect of the invention, the modified organisms are microorganisms that do not express native functional RuBisCO and are also modified with a set of heterologous genes necessary for the expression of a functional RuBisCO.

The gene set for the expression of a functional RuBisCO comprises the genes encoding the RuBisCO subunits and the genes encoding the chaperone proteins necessary for assembling the RuBisCO subunits.

These different genes may be native or heterologous and depending on the microorganisms considered, some of these genes may be native and others heterologous.

The genes coding for these proteins necessary for the expression of a functional RuBisCO and the modification of microorganisms for the expression of a functional RuBisCO are well known to those skilled in the art. There are several forms of RuBisCO in nature (Tabita et al., J Exp Bot 2008; 59 (7): 1515-24, doi: 10.1093 / jxb / erm361). Forms I, II and III catalyze the carboxylation and oxygenation reactions of ribulose 1,5-bisphosphate. Form I is present in eukaryotes and bacteria. It consists of two types of subunits: large subunits (RbcL) and small subunits (RbcS). The functional enzymatic complex is a hexadecamer consisting of eight L subunits and eight S subunits. The correct assembly of these subunits also requires the intervention of at least one specific chaperone: RbcX (Liu et al. , Nature, 2010 Jan 14, 463 (7278): 197-202, doi: 10.1038 / nature08651). Form II is found mainly in proteobacteria, archaea and dinoflagellate algae. Its structure is much simpler: it is a dimer formed of two identical RbcL subunits. Depending on the organism, the genes encoding type I RuBisCO may be called rbcL / rbcS (eg Synechococcus elongatus), or cbxLC / cbxSC, cfxLC / cfxSC, cbbL / cbbS (eg, Cupriavidus necator). Depending on the organism, the genes encoding type II RuBisCO are generally called cbbM (eg, Rhodospirillum rubrum). Form III is present in archaea. It is generally found in the form of RbcL subunit dimers, or pentamer dimers. Depending on the organism, the genes encoding type III RuBisCO may be called rbcL (for example, Thermococcus kodakarensis), cbbL (for example, Haloferax sp.).

In a particular embodiment, the NusG / SPT5 mutation described in this invention will be introduced into a microorganism that does not express a native functional RuBisCO and genetically modified to express a functional RuBisCO type I as described in WO 2014/096391 and WO 2015/107496.

In a particular embodiment, the NusG / SPT5 mutation described in this invention will be introduced into a microorganism that does not express a native functional RuBisCO and genetically engineered to express a functional RuBisCO of type II as described in WO 2014/129898 and WO 2015/177800.

The correct assembly of RuBisCO subunits also requires the intervention of at least one chaperone such as RbcX, GroEL, GroES as described in WO 2014/129898 and WO 2015/107496.

These organisms may be eukaryotic or prokaryotic as previously defined.

Advantageously, the genetically modified microorganism according to the invention expresses native proteins exhibiting phosphofructokinase activity, in particular PFK, and / or a transcriptional repressor involved in the glucose signaling pathway, in particular STD1. In particular, yeasts and bacteria are mentioned.

According to a particular embodiment of the invention, the microorganism is also modified with an alteration of the phosphofructokinase activity and / or the transcriptional repressor activity involved in the glucose signaling pathway when these activities are present in the modified microorganism. according to the invention. By alteration of activity is meant its diminution, attenuation or suppression.

The phosphofructokinase activity responsible for the conversion of fructose-6-phosphate to fructose-1,6-bisphosphate, using the ATP / ADP pair as a cofactor, is due to a phosphofructokinase enzyme (PFK, EC: 2.7.1.1 ). Depending on the organism, the enzymes may be called PFK, PFK1, PFK2, pfkA, pfkB, ATP-dependent 6-phosphofructokinase, ATP-PFK, Phosphofructokinase 2, Phosphohexokinase). This enzyme is well known in the way of glycolysis.

Table 3: Examples of sequences coding for an KFC

For example, in Saccharomyces cerevisiae, the PFK enzyme is an octamer composed of dimers of two different subunits: PFK1 and PFK2 (Arvanitidis and Heinisch, 1994). The two subunits share 55% identity and 71% homology. Each subunit has a catalytic site and a regulatory site. Mutations studies have shown that an activity of at least 50% can be conserved during the inactivation of one of the subunits by targeted mutations in the catalytic domain. No activity can be detected when one of the two genes is knocked out (Heinisch, 1986).

The reduction of KFC activity, its mitigation or suppression can be done by all the means known to those skilled in the art. The means used may consist in particular in removing all or part of the gene or genes coding for the PFK enzyme. The removal of part or all of a gene can be obtained by any method known per se by those skilled in the art. For example, the deletion of part or all of a gene can be achieved by introducing a stop codon into the coding sequence of the gene via genomic editing methods that allow direct genetic modifications to a gene. given genome, via the use of zinc finger nucleases (Kim et al., PNAS; 93: 1,156-1,160), transcriptional activator-like effector nucleases, called "TALEN" (Ousterout et al., Methods Mol Biol., 2016: 1338: 27-42, doi: 10.1007 / 978-1 -4939-2932-0_3), a system combining Cas9-type nucleases with short, regularly spaced, grouped palindromic repeats called CRISPR ( Mali et al., Nat Methods, 2013 Oct; 10 (10): 957-63, doi: 10.1038 / nmeth.2649), or even meganucleases (Daboussi et al., Nucleic Acids Res, 2012. 40: 6367-79. ). Other methods may include, in particular, modifying the regulatory elements of the gene, for example by replacing the native promoter with a weaker promoter in the host organism. The modification of the regulatory elements of a gene can be carried out by any method known per se by those skilled in the art. For example, the modification of the regulatory elements of a gene can be achieved by modifying a promoter sequence of the gene to alter its expression (Kaufmann et al., Methods Mol Biol 201 1, 765: 275-94. : 10.1007 / 978-1 -61779-197-0_16). For example, the modification of the regulatory elements of a gene can be obtained by extinction of the gene using interfering RNAs, ribozymes or antisense (Daneholt, 2006. Nobel Prize in Physiology or Medicine). In the context of the present invention, the term "interfering RNA" or "RNAi" refers to any RNAi molecule (e.g. single-stranded RNA or double-stranded RNA) that can block expression of a target gene and / or facilitate degradation. corresponding mRNA.

It may also consist of modifying the protein, for example by suppressing amino acids in its N- or C-terminal part. According to a particular embodiment of the invention, the reduction of the activity is obtained by the introduction of a mutation in the coding sequence of the gene coding for the PFK enzyme, in particular this mutation consisting of a stop codon. ". In particular, in Saccharomyces cerevisiae, this mutation consists of a "stop" codon introduced at its N- or C-terminal part. In particular, in Saccharomyces cerevisiae, this mutation consists of a "stop" codon introduced at the amino acid Tyrosine 61 1.

The mutation is found in the Fructose 2,6 diphosphate phosphofructokinase regulatory site. This mutation causes the deregulation of the enzyme thus decreasing its activity. The residual phosphofructokinase activity is between 10% and 40%.

STD1 is a non-essential gene encoding a transcriptional repressor involved in the glucose signaling pathway (Schmidt et al., 1999).

According to a particular embodiment of the invention, a mutation is introduced into the coding sequence of the gene coding for the STD1 protein, this mutation consisting in a transposition of Tyrosine 85 to Asparagine, or in a transposition of all other conserved amino acids. at the equivalent position.

Depending on the organism genes encoding STD1 may be called MSN3, SFS3.

Table 4: Examples of sequences coding for STD1

Even more advantageously, the microorganism is genetically modified according to the invention at the level of a transcription elongation factor (NusG / SPT5), a phosphofructokinase (PFK) and a transcriptional repressor involved in the signaling pathway. glucose (STD1) in combination, either by combining NusG / SPT5 and PFK mutations, or by combining NusG / SPT5 and STD1 mutations, or by combining STD1 and PFK mutations, or by combining NusG / SPT5 mutations , PFK and STD1.

According to a particular embodiment of the invention, the three mutations as described above and in the examples may be introduced alone or in combination into a microorganism, expressing a functional RuBisCO, modified or not at the level of glycolysis and / or or at the level of the pentose phosphate pathway in order to improve the production yield of molecules of interest from sugars and carbon dioxide as described, for example, in applications WO 2014/129898, PCT / EP2018 / 052005 filed on January 26, 2018 and PCT / EP2018 / 052004 filed January 26, 2018.

The invention also relates to a genetically modified microorganism, as described above, which is further modified to produce molecules of interest. These molecules of interest may be a mono- or polyhydric alcohol, an ester, an ether, an acid, an aldehyde, a ketone or a hydrocarbon such as an alkane, an alkene or an alkyne. The molecule of interest can be linear or cyclic and can be saturated or unsaturated.

In a particular example, the microorganism is genetically modified to produce or overproduce alcohols such as ethanol, 1,3 propanediol, 1,2 propanediol, 1,4 butanediol, 2,3 butanediol, 1,3 Butanediol, etc.

In a particular example, the microorganism is genetically modified to produce or overproduce at least one amino acid, such as arginine, lysine, methionine, threonine, proline, glutamate, homoserine, isoleucine and valine. In one particular example, the microorganism is genetically engineered to produce or overproduce isoprenoid pathway molecules, such as farnesene, the terpenes pathway and the carotenoid pathway.

In a particular example, the microorganism is genetically modified to produce or overproduce a vitamin or a precursor, such as pantoate, pantothenate, transneurosporene, phylloquinone, vitamin B12, vitamin B2, precursors of vitamin C and tocopherols .

In a particular example, the microorganism is genetically modified to produce or overproduce a sterol, such as squalene, cholesterol, testosterone, progesterone and cortisone.

In a particular example, the microorganism is genetically modified to produce or overproduce a flavonoid, such as rambinone and vestinone.

In a particular example, the microorganism is genetically modified to produce or overproduce an organic acid, such as citric acid, coumaric acid, 3-hydroxypropionic acid, acetic acid, lactic acid, acid and the like. itaconic, gluconic acid, etc.

In a particular example, the microorganism is genetically modified to produce or overproduce a polyol, preferably selected from sorbitol, xylitol and glycerol.

In a particular example, the microorganism is genetically modified to produce or overproduce a polyamine, preferentially spermidine.

In a particular example, the microorganism is genetically modified to produce or overproduce an aromatic molecule from a stereospecific hydroxylation, via a NADP-dependent cytochrome p450, preferentially chosen from phenylpropanoids, terpenes, lipids, tannins, flavors, hormones.

In a particular example, the microorganism is genetically modified to produce or overproduce fatty acids and lipids.

The invention also relates to a method for culturing a genetically modified microorganism according to the invention, comprising culturing said microorganism in a suitable culture medium in the presence of a carbon source comprising carbon dioxide.

The growth of microorganisms produces a biomass, followed by a step of recovering the metabolites of interest from the biomass and / or culture supernatant obtained. Biomass and the metabolites of interest present in the biomass and / or in the culture supernatant can be harvested, separated, and then treated by any known method (purification, drying, grinding, extraction of metabolites, etc.).

The term "appropriate culture medium" generally refers to a medium of sterile culture providing nutrients essential or beneficial for the maintenance and / or growth of said microorganism, such as nitrogen sources such as ammonium sulfate; sources of phosphorus, for example, potassium phosphate monobasic; trace elements, for example, salts of copper, iodide, iron, magnesium, zinc or molybdate; vitamins and other growth factors such as amino acids or other growth promoters. Antifoam can be added as needed. According to the invention, this appropriate culture medium can be chemically defined or complex. The culture medium can thus be of identical or similar composition to a synthetic medium, as defined by Verduyn et al., (Yeast 1992, 8: 501-17), adapted by Visser et al., (Biotechnology and Bioengineering. 2002. 79: 674-81), or commercially available such as YNB medium (Yeast Nitrogen Base, MP Biomedicals or Sigma-Aldrich).

The carbon source comprises carbon dioxide. The contribution of carbon dioxide is made by adding gaseous carbon dioxide or in the form of carbonate in the solid state for a culture in a controlled atmosphere, for example by controlling the atmosphere in contact with the culture medium, or in bubbling the gas alone or in mixture with other gaseous elements in the culture medium.

In a first embodiment of the invention, the culture method is implemented with carbon dioxide as sole source of carbon and a supply of energy. There are different types of "energy" sources that can be used by living things. For example, reduced organic compounds (carbohydrates, organic acids), but also reduced mineral compounds (hh, NH ₃ , CHU, sulphites and thiosulphates) or even light and electrons.

In a particular embodiment, the cultivation process is carried out with photosynthetic microorganisms in autotrophic mode, with carbon dioxide as sole source of carbon and a light input. The photosynthetic microorganisms that can be grown in the autotrophic mode are well known, in particular chosen from protists, in particular microalgae and cyanobacteria.

In a particular embodiment of the invention, the carbon source is carbon dioxide and the process is carried out in the presence of hydrogen. This process is implemented in particular for microorganisms capable of growing under chemolithoautotrophic conditions. In particular, they are microorganisms that have endogenous or heterologous hydrogenase activity, such as microorganisms of the genus Cupriavidus or Rhodococcus, Escherichia or genetically modified Saccharomyces.

Hydrogen gas is added for controlled atmosphere cultivation, for example by controlling the atmosphere in contact with the culture medium, or by bubbling the gas alone or in admixture with carbon dioxide and other gaseous elements in the atmosphere. the culture medium. For microorganisms capable of growing on a source of organic carbon as the sole source of carbon, such as bacteria, yeasts, fungi and some protists, the culture medium may also contain a source of organic carbon and carbon dioxide.

The source of organic carbon is usually dissolved in the culture medium. In particular, the culture medium may comprise a source of simple organic carbon as a source of organic carbon, such as glucose, galactose, sucrose, molasses, or the by-products of these sugars. According to the present invention, the single carbon source must allow normal growth of the microorganism of interest. It is also possible in some cases to use a complex carbon source, such as lignocellulosic biomass, rice straw, or starch. The use of a complex carbon source generally requires pretreatment before use.

In a particular embodiment, the culture medium contains at least one carbon source among monosaccharides such as glucose, xylose or arabinose, disaccharides such as sucrose, glycerol.

The source of organic carbon may be the main source of carbon in the culture medium, the skilled person can determine the organic carbon / carbon dioxide ratio appropriate to its objectives of growth and production of metabolites of interest.

Some microorganisms capable of growing on an organic carbon source as the only source of carbon can also react to light, as some photosynthetic organisms that are also able to grow on a carbon source, without light, in heterotrophic mode.

For these microorganisms, it may be advantageous to cultivate them in mixotrophic mode, that is to say with carbon dioxide and a source of organic carbon, with a contribution of light.

Whether in autotrophic mode or in mixotrophic mode, the lighting (light input) is done in continuous or discontinuous form, in particular with alternating periods of lighting and periods of darkness, the alternation being able to simulate an alternation day / night according to natural cycles or in a more controlled manner with periods of illumination and dark periods of equal or variable controlled durations.

The light can be natural or artificial light, in a wide or narrow spectrum in the visible range, which can go to near IR and near UV.

The conditions for providing light in autotrophic and mixotrophic modes are well known to those skilled in the art who will be able to adapt them to the genetically modified microorganisms according to the invention.

The conditions of culture in autotrophic, chemolithoautotrophic, heterotrophic and mixotrophic modes, in particular the temperature conditions, the appropriate culture media, the Nutrient contributions, are well known to those skilled in the art that will adapt to genetically modified microorganisms according to the invention.

According to the invention, any culture method allowing the production on an industrial scale of molecules of interest can be envisaged. Advantageously, the culture is done in bioreactors, especially in batch mode, fed-batch and / or continuous culture. Preferably, the culture line associated with the production of the molecule of interest is fed-batch mode corresponding to a controlled feed into one or more substrates, for example via the addition of a concentrated solution of glucose, the concentration of which can be between 200 gL-1 and 700 gL-1 for a heterotrophic or mixotrophic culture. Controlled vitamin feeding during the process may also be beneficial to productivity (Alfenore et al., Appl Microbiol Biotechnol, 2002. 60: 67-72). It is also possible to add a solution of ammonium salts to limit nitrogen intake.

Fermentation is generally conducted in bioreactors, with possible solid and / or liquid precultures in Erlenmeyer flasks, with a suitable culture medium containing at least one single carbon source.

In general, the culture conditions of the microorganisms according to the invention are easily adaptable by those skilled in the art, depending on the microorganism.

The invention also relates to the biomass obtained by the culture method according to the invention. The biomass according to the invention consists of microorganisms grown with or without all or part of the culture medium, in particular constituted by the fermentation juice at the end of culture. The microorganisms that constitute it can be partially or totally lysed.

The invention also relates to the molecule of interest produced by the microorganism according to the invention. Said microorganism can produce this molecule intracellularly, or extracellularly, in a fermentation process as described above. At the end of this fermentation step, a centrifugation step is generally necessary in order to separate the biomass from the culture supernatant. When the molecule of interest is produced intracellularly, a step of extracting said molecule of interest from the cellular biomass produced is necessary. The molecule of interest thus extracted can also be purified. When the molecule of interest is produced extracellularly, a step of separating said molecule of interest from the culture supernatant is necessary. The molecule of interest thus separated can also be purified.

Those skilled in the art are familiar with the extraction and purification methods of the molecules of interest produced by fermentation and will be able to adapt them according to the microorganism according to the invention and the molecule of interest produced.

EXAMPLES

Example 1 Construction of a yeast strain expressing PRK, RuBisCO and mutated on the SPT5 gene (A339P).

Strain and genetic constructions.

A yeast strain Saccharomyces cerevisiae, CEN.PK 1605 (Mat has HIS3 leu2-3,1312 trp1-289 ura3-52 MAL.286) derived from the commercial strain CEN.PK 1 13-7D (GenBank: JRIV00000000) was engineered to express the endogenous SPT5 gene mutated at position 339 of its protein sequence, and characterize the effect of this mutation on the activity of RuBisCO of Synechococcus elongatus expressed in the strain.

The construction of strain SC0002 was carried out by homologous recombination according to the following protocol:

A linear genomic insertion cassette was constructed from PCR products assembled via the NEBuilder® protocol (New England Biolabs, Evry, France), and then amplified by a final nested PCR step:

A first PCR product was produced on the genomic DNA of strain CEN.PK 1605 from a sense oligonucleotide 1 (SEQ ID NO: 12 'GCGTCGTCAG GAGAGGAACA GATTC 3') located 499 base pairs upstream of the site. mutation (position 1015 of the open reading phase) and of an antisense oligonucleotide 2 (SEQ ID NO: 13: 5 'GCTTAGGGGG TTC AT AT AG ATTCTTCCTG TGTAATTATC 3') localized at position 1015, introducing the point mutation g1015c leading to the missense mutation A339P on the protein sequence.

A second PCR product made on the genomic DNA of the CEN.PK 1605 strain using the sense oligonucleotide 3 (SEQ ID NO: 14: 5 'GAATCTATAT CGAACCCCCT AAGCAATCCG TTATTGAAAA ATTTTG 3') having at 5 'a zone of 24 base pair recovery with the 3 'end of the first PCR, and the antisense oligonucleotide 4 (SEQ ID NO: 15' CACATATGCA TACATACATA CATACGTATA TG 3 ') located 213 base pairs downstream of the STOP codon of the open reading phase of the SPT5 gene.

A third PCR product, having at 5 'a 32 base pair overlap zone with the 3' end of the second PCR allowing the amplification of the BleMX resistance cassette, surrounded by LoxP sites, on the plasmid pUG66 (Gueldener 2002) using the sense oligonucleotides 5 (SEQ ID NO: 16: 5 'CATATACGTA TGTATGTATG TATGCATATG TGCGTACGCT GCAGGTCGAC AACC 3') and antisense 6 (SEQ ID NO: 17: 5 'CATAGGCCAC TAGTGGATCT G AT AT CAC 3').

A fourth PCR product having in 5 'a 26 base pair overlap zone with the 3' end of the third PCR, made on the genomic DNA of the CEN.PK 1605 strain from a sense oligonucleotide 7 ( SEQ ID NO 18: 5 'GATATCAGAT CCACTAGTGG CCTATGGCAT ATCTAAATGA AATATCAACT TTATTATGAG G GAG

3 ') located 222 base pairs downstream of the STOP codon of the open reading phase of the SPT5 gene and an antisense oligonucleotide 8 (SEQ ID NO: 19: 5 'GATACGATCC TGTGGTGAAA CGGC 3') located 560 base pairs downstream of the STOP codon of the open reading phase of the SPT5 gene.

After assembly via the NEBuilder® protocol (New England Biolabs, Evry, France), the final product was amplified by PCR nested using the sense oligonucleotides 9 (SEQ ID NO: 20 'CTTGGATATT GAAGCTGAGG TTAGTGATGA TG 3') and antisense 10 (SEQ ID NO: 21: 5 'CGATCCTGTG GTGAAACGGC ATGTGCTTTT C 3').

This PCR product was checked by agarose gel electrophoresis and cleaned using the NucleoSpin ^® Gel Extraction Kit and PCR Clean-up (MACHEREY-NAGEL GmbH, Hoerdt, France).

The strain CEN.PK 1605 was then transformed with this linear DNA according to the following protocol:

The strain was cultured in a volume of 50 ml YPD complex (Yeast extract, Peptone, Dextrose) at 30 ° C. until the exponential growth phase. The cells were centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant was removed and the cells resuspended in 25 ml sterile water and then centrifuged again for 5 minutes at 2500 rpm at room temperature. After removal of the supernatant, the cells were resuspended in 500 μl of PLTE solution (400 μl 50% Polyethylene glycol, 50 μl 1 M lithium acetate, 2.5 ml 200mM Ethylene Diamine Tetraacetic). 5 ml of 1 M Tris pH 7.5, 42.5 ml of water). 10 μl of "carrier" DNA (denatured salmon sperm DNA) at 5 mg / ml, 56 ml of dimethyl sulfoxide and 500 μg of the genomic insertion cassette were added to the reaction mixture. The cells were then incubated for 15 min at 30 ° C and 15 min at 42 ° C. The cells were centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed and the cells resuspended in 1 ml of YPD and incubated overnight at 30 ° C with shaking (180 rpm). The cells were centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed, the cells resuspended in 100 ml sterile physiological saline and then plated on YPD selection medium supplemented with 80 μg / ml phleomycin and incubated for 72 h at 30 ° C.

The clones obtained were validated by genotyping on genomic DNA and sequencing after amplification of the area of interest by PCR. One of these clones was referenced as SC0002 (Mat to HIS3 Ieu2-3.112 trp1-289 ura3-52 MAL.28c spt5A339P: BleMX)

The yeast strain SC0002 was then transformed to express the PRK, RuBisCO (RbcL RbcS) and RbcX genes of Synechococcus elongatus PCC6301 and the GroES and GroEL genes of E. coli.

The strain was cultured in a volume of 50 ml YPD complex (Yeast extract, Peptone, Dextrose) at 30 ° C. until the exponential growth phase. Cells were centrifuged for 5 minutes at 2500rpm at room temperature. The supernatant was removed, the cells resuspended in 25 ml of sterile water and then centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells were resuspended in 500mI of PLTE solution. 10 μl of "carrier" DNA at 5 mg / ml, 56 ml of dimethyl sulfoxide and 300 μg of each of the following shuttle plasmids were added to the reaction mixture:

P1: pFL36_P _TEFi -RbcX-Tp _GKi _Pp _Gii -GroES-Tc _Y ci_P _TDH3 -GroEL-T _AD m, LEU2

P2: V51_V51 -PdH3-RbcL-TADHi-PTEFi-RbcS-TpGKi, URA3

- P3: pCM185_pCM185-Tet :: Pc _Y following PRK-Tc _Y one, TRP1

The cells were then incubated for 15 min at 30 ° C and 15 min at 42 ° C. The cells were centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed, the cells resuspended in 1 ml of YPD and incubated for 1 hour at 30 ° C. The cells were then centrifuged (5000rpm, 1 min) and the supernatant removed. They were then washed in 1 ml of sterile physiological saline, centrifuged again (5000 rpm, 1 min), taken up in 100 ml of sterile physiological saline and then spread on a selection medium YNB.D (Yeast Nitrogen base, Dextrose) and incubated 72h at 30 ° C.

The clones obtained were validated by colony genotyping and one of them was referenced SC0003.

In order to construct a control strain for RuBisCO activity A yeast strain Saccharomyces cerevisiae, CEN.PK 1605 (Mat has HIS3 leu2-3.112 trp1-289 ura3-52 MAL.286) resulting from the commercial strain CEN.PK 1 13- 7D (GenBank: JRIV00000000) is engineered to express the PRK, RuBisCO (RbcL RbcS) and RbcX genes of Synechococcus elongatus PCC6301 and the GroES and GroEL genes of E. coli.

The construction of strain SC0001 is carried out according to the following protocol:

The strain was cultured in a volume of 50 ml YPD complex (Yeast extract, Peptone, Dextrose) at 30 ° C. until the exponential growth phase. The cells were centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant was removed and the cells resuspended in 25 ml sterile water and then centrifuged again for 5 minutes at 2500 rpm at room temperature. After removal of the supernatant, the cells were resuspended in 500mI of PLTE solution (400mI of 50% Polyethylene glycol, 50mL of 1M lithium acetate, 2.5mL of ethylene diamine tetraacetic acid). mM, 5 ml of 1 M Tris pH 7.5, 42.5 ml of water). 10μl of "carrier" DNA (denatured salmon sperm DNA) at 5mg / ml, 56mL of dimethylsulfoxide and 300ng of each of the following shuttle plasmids were added to the reaction mixture:

P2: V51_V51 -PiDH3-RbcL-TADHi-PTEFi-RbcS-TpGKi, URA3

- P3: pCM185_pCM185-Tet :: PcYci-PRK-T _CY ci, TRP1 The cells were then incubated for 15 min at 30 ° C and 15 min at 42 ° C. The cells were centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed, the cells resuspended in 1 ml of YPD and incubated for 1 hour at 30 ° C. The cells were then centrifuged (5000 rpm, 1 min) and the supernatant removed. They were then washed in 1 ml of sterile physiological saline, centrifuged again (500 Orpm, 1 min), taken up in 100 μl of sterile physiological saline and then plated on selection medium YNB.D.CSM-LUW (Yeast Nitrogen Base, Dextrose, Complete Mixture Supplement without Leucine, Uracil and Tryptophan - MP BIOMEDICALS, Santa Ana, United States) and incubated 72h at 30 ° C.

The clones obtained were validated by colony genotyping and one of them was referenced SC0001.

Example 2 Construction of a yeast strain expressing PRK RuBisCO and mutated on the STD1 gene (Y86N).

Strain and genetic constructions.

Two yeast strains Saccharomyces cerevisiae, CEN.PK 1605 (Mat has HIS3 leu2-3,1312 trp1-289 ura3-52 MAL.28c) and CEN.PK 1606 {Matte alpha HIS3 leu2-3.112 trp1-289 ura3- 52 MAL.28c) from the commercial strain CEN.PK 1 13-7D (GenBank: JRIV00000000) were engineered to express the mutated endogenous STD1 gene at position 86 of its protein sequence, and characterize the effect of this mutation on the activity of the RuBisCO of Synechococcus elongatus expressed in the strain.

The SC0004 and SC0005 strains were constructed by homologous recombination according to the following protocol:

A linear genomic insertion cassette was constructed from PCR products assembled via the NEBuilder® protocol (New England Biolabs, Evry, France), then amplified by a last step of nested PCR:

A first PCR product made on the genomic DNA of strain CEN.PK 1605 from a sense oligonucleotide 11 (SEQ ID NO: 22: 5 'CGTTACCATC GCGATTGTAG GAG 3') located 328 base pairs upstream of the site of mutation (position 256 of the open reading phase) and an antisense oligonucleotide 12 (SEQ ID NO: 23: CTGCATTTTC TGGTGGTGTA GTAACAAAAT TGTTGTTG) located at position 256, introducing the point mutation t256a leading to the missense mutation Y86N on the protein sequence.

A second PCR product carried out on the genomic DNA of the CEN.PK 1605 strain using the sense oligonucleotide 13 (SEQ ID NO: 24 'CTACACCACC AGAAAATGCA GACAGGGCAA GAATAGAAAT CATAAAAAGG TTATTG 3') having at 5 'a zone 25 base pair recovery with the 3 'end of the first PCR and antisense oligonucleotide 14 (SEQ ID NO: 25' GTAAGCGTGA CATAACTAAT TACATGATGA ATTCCTAGGA CATTCCATCA GGCTTCCAAT C 3 ') localized at the end of the open reading phase of the STD1 gene (including the STOP codon) and having a 34 base pair overlap zone with the 3' end of the third PCR.

A third PCR product allowing the amplification of the PCYCI promoter derived from the Saccharomyces cerevisiae CYC1 gene (YJR048W, Cytochrome c, isoform 1), obtained by gene synthesis (Eurofins Genomics, Nantes, France) and cloned into the plasmid P4 (PCM 1 85_TCYCI, TRP1) using sense oligonucleotides 15 (SEQ ID NO: 26: 5 'GAATTCATCA TGTAATTAGT TATGTCAC 3') and antisense 16 (SEQ ID NO: 27: 5 'GCATTAAAGC CTTCGAGCGT CC 3').

A fourth PCR product having 5 'a 22 base pair recovery zone with the 3' end of the third PCR and allowing the amplification of the HphMX resistance cassette, surrounded by LoxP sites, on the plasmid pUG75 (Hegemann and Heick, 201 1) using the sense oligonucleotides 17 (SEQ ID NO: 28: 5 'GGACGCTCGA AGGCTTTAAT GCCGTACGCT GCAGGTCGAC AACC 3') and antisense 18 (SEQ ID NO: 29 'CATAGGCCAC TAGTGGATCT G AT AT CAC 3') .

A fifth PCR product having at 5 'a 26 base pair overlap zone with the 3' end of the fourth PCR, carried out on the genomic DNA of the strain CEN.PK 1605 from a sense oligonucleotide 19 ( SEQ ID NO: 30: 5 'GATATCAGAT CCACTAGTGG CCTATGTAAA TTTTTACAAC AACGCAAAAA CGAAATACCC CAC 3') located downstream of the STOP codon of the open reading phase of the STD1 gene and an antisense oligonucleotide (SEQ ID NO: 31 'ATGGATAT GGGTAATACC GCGTTG 3 ') located 314 base pairs downstream of the STOP codon of the open reading phase of the STD1 gene

After assembly using the NEBuilder® protocol (New England Biolabs, Evry, France), the final product was amplified by PCR nested using the sense oligonucleotides 21 (SEQ ID No. 32: 5 'CGATTGTAGG AGGTTTTGCA CTACTTAACA G 3') and antisense 22 (SEQ ID NO: 33 'GGTAATACCG CGTTGATAAT AATGTAACAA TC 3').

Strains CEN.PK 1605 and CEN.PK1606 were then transformed with these linear DNAs according to the following protocol:

Each strain was cultured in a volume of 50 ml YPD complex (Yeast extract, Peptone, Dextrose) at 30 ° C until the exponential growth phase. The cells were centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant was removed and the cells were resuspended in 25 ml of sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removal of the supernatant, the cells were resuspended in 500 μl of PLTE solution (400 μl 50% Polyethylene glycol, 50 μl 1 M lithium acetate, 2.5 ml Ethylene Diamine Tetraacetic 200 mM, 5 mI Tris 1 M pH 7.5, 42.5 ml water). 10 μl of "carrier" DNA (denatured salmon sperm DNA) at 5 mg / ml, 56 ml of dimethyl sulfoxide and 500 μg of the genomic insertion cassette were added to the reaction mixture. The cells were then incubated for 15 min at 30 ° C and 15 min at 42 ° C. The cells were centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed and the cells resuspended in 1 ml of YPD and incubated overnight at 30 ° C with shaking (180 rpm). The cells were centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed and the cells were resuspended in 100 ml sterile saline and then plated on YPD selection medium supplemented with 200 μg / ml hygromycin B and incubated for 72 h at 30 ° C.

The clones obtained were validated by genotyping on genomic DNA and sequencing after amplification of the area of interest by PCR. One of these clones was referenced SC0004 for the strain resulting from the transformation of CEN.PK1605 (Mat to HIS3 Ieu2-3.112 trp1-289 ura3-52 MAL.28c std1Y86N: HphM) or SC0005, for the strain resulting from the transformation of CEN.PK1606 {Alpha mat HIS3 \ eu2-3.112 trp1-289 ura3-52 MAL.28c std 1 Y86N: HphM).

The yeast strain SC0005 was then transformed to express the PRK, RuBisCO (RbcL RbcS) and RbcX genes of Synechococcus elongatus PCC6301 and the GroES and GroEL genes of E. coli.

The strain was cultured in a volume of 50 ml YPD complex (Yeast extract, Peptone, Dextrose) at 30 ° C. until the exponential growth phase. The cells were centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant was removed, cells resuspended in 25 ml sterile water and then centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells were resuspended in 500 ml of solution. 10 μl of "carrier" DNA at 5 mg / ml, 56 ml of dimethyl sulfoxide and 300 μg of each of the following shuttle plasmids were added to the reaction mixture:

P1: pFL36_Pi _EFi -RbcX-Tp _GKi _Pp _Gii -GroES-Tc _Y ci_P _TDH3 -GroEL-T _ADHi , LEU2

P2: V51_V51 -PdH3-RbcL-TADHi-PTEFi-RbcS-TpGKi, URA3

- P3: pCM185_pCM185-Tet :: PcYci-PRK-T _CY ci, TRP1

The cells were then incubated for 15 min at 30 ° C and 15 min at 42 ° C. The cells were centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed, the cells resuspended in 1 ml of YPD and incubated for 1 hour at 30 ° C. The cells were then centrifuged (5000 rpm, 1 min) and the supernatant removed. They were then washed in 1 ml of sterile saline, centrifuged again (5000 rpm, 1 min), taken up in 100 ml of sterile physiological saline and then spread on YNB.D selection medium (Yeast Nitrogen base, Dextrose) and incubated for 72 h at 30 ° C.

The clones obtained were validated by colony genotyping and one of them was referenced SC0006.

Example 3 Construction of a yeast strain expressing PRK RuBisCO and mutated on the PFK2 gene (Y611 *).

Strain and genetic constructions.

A strain of yeast Saccharomyces cerevisiae, CEN.PK 1606 (Matte HIS3 Heu3- 3.112 trp1-289 ura3-52 MAL.286) from the commercial strain CEN.PK 1 13-7D (GenBank: JRIV00000000) was engineered to express the endogenous PFK2 gene truncated in its protein sequence at position 61 1 and characterize the effect of this mutation on the activity of RuBisCO of Synechococcus elongatus expressed in the strain.

The construction of strain SC0007 was carried out by homologous recombination according to the following protocol:

A first PCR product made on the genomic DNA of strain CEN.PK 1605 from a sense oligonucleotide 23 (SEQ ID NO: 34: CTTGGCTACT TTACAAGGTC TTGAG 3 ') located 351 base pairs upstream of the mutation site (position 1833 of the open reading phase) and an antisense oligonucleotide 24 (SEQ ID NO: 35 'ACATTAAGTA GCCATCGAGT AGACGGCAGA G 3') located at position 1833, introducing the c1833a point mutation leading to the non-mutant mutation. -sens Y61 1 ^* on the protein sequence.

A second PCR product made on the genomic DNA of the CEN.PK 1605 strain using the sense oligonucleotide (SEQ ID NO: 36: GTCTACTCGATGGCTACTTAATGTATGTCCCAAG) having at 5 'a cover area of 24 base pairs with 1 3 'end of the first PCR, and antisense oligonucleotide 26 (SEQ ID NO: 37: 5'

G GT AGT ACTT GT ATT ATT AAAAG AAAG AACAAAAAATT CATT G 3 ') located 151 base pairs downstream of the STOP codon of the open reading phase of the PFK2 gene. A third PCR product, having in 5 'a recovery zone of 44 base pairs with the 3' end of the second PCR allowing the amplification of the NatMX resistance cassette, surrounded by LoxP sites, on the plasmid pUG74 (Hegemann and Heick, 201 1) using the sense oligonucleotides 27 (SEQ ID NO 38: 5 'CAATGAATTT TTTGTTCCTT TCTTTTAATA ATACAAGTAC TACCCGTACG CTGCAGGTCG ACAACC 3') and antisense 28 (SEQ ID NO: 39: 5 'CATAGGCCAC TAGTGGATCT GATATCAC 3 ').

A fourth PCR product having at 5 'a 28 base pair recovery zone with the 3' end of the third PCR, carried out on the genomic DNA of strain CEN.PK 1606 from a sense oligonucleotide 29 ( SEQ ID NO: 40 'GTGATATCAG ATCCACTAGT GGCCTATGCC ATGAAACCAA TATTATCATG CATTTTTATG AATGTC

3 ') located 152 base pairs downstream of the STOP codon of the open reading phase of the PFK2 gene and an antisense oligonucleotide (SEQ ID NO: 41: CATTCACTCT TTTTGTTTAC ATCTCCGTTC TTCG) located 451 base pairs downstream of the STOP codon of the open reading phase of the PFK2 gene.

After assembly via the NEBuilder® protocol (New England Biolabs, Evry, France), the final product was amplified by PCR nested using the sense oligonucleotides 31 (SEQ ID NO: 42 'GTCTTGAGGC CGTTAATGCC GTTTTGG 3') and antisense 32 (SEQ ID NO. 43: 5 'GTTTACATCT CCGTTCTTCG TGATAAGTTC ATAG 3').

The strain CEN.PK 1606 was then transformed with this linear DNA according to the following protocol:

The strain was cultured in a volume of 50 ml YPGE complex (Yeast extract, Peptone, Glycerol, Ethanol) complex at 30 ° C until the exponential growth phase. The cells were centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant was removed and the cells resuspended in 25 ml sterile water and then centrifuged again for 5 minutes at 2500 rpm at room temperature. After removal of the supernatant, the cells were resuspended in 500 μl of PLTE solution (400 μl 50% Polyethylene glycol, 50 μl 1 M lithium acetate, 2.5 ml 200mM Ethylene Diamine Tetraacetic). , 5mI of Tris 1M pH 7.5, 42.5mI of water). 10μl of "carrier" DNA (denatured salmon sperm DNA) at 5mg / ml, 56mL of dimethylsulfoxide and 500ng of the genomic insertion cassette were added to the reaction mixture. The cells were then incubated for 15 min at 30 ° C and 15 min at 42 ° C. The cells were centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed and the cells resuspended in 1 ml YPGE and incubated overnight at 30 ° C with shaking (180 rpm). The cells were centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed and the cells were resuspended in 100 ml of sterile physiological saline and then plated on YPGE selection medium supplemented with 50 μg / ml of nourseothricin and incubated for 72 h at 30 ° C.

The clones obtained were validated by genotyping on genomic DNA and sequencing after amplification of the area of interest by PCR. One of these clones has been referenced SC0007 {Alpha mat HIS3 leu2-3.112 trp1-289 ura3-52 MAL.28c pfk2Y611 ^* : NatMX)

The yeast strain SC0007 was then transformed to express the PRK, RuBisCO (RbcL RbcS) and RbcX genes of Synechococcus elongatus PCC6301 and the GroES and GroEL genes of E. coli.

The strain was cultured in a 50 ml volume of YPGE complex rich medium at 30 ° C until the exponential growth phase. The cells were centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant was removed and the cells resuspended in 25 ml sterile water and then centrifuged again for 5 minutes at 2500 rpm min at room temperature. After removing the supernatant, the cells were resuspended in 500 μl of PLTE solution. 10 μl of "carrier" DNA at 5 mg / ml, 56 μl of dimethylsulfoxide and 300 μg of each of the following shuttle plasmids were added to the reaction mixture:

P2: V51 -V51 -PiDH3-RbcL-TADHi-PTEFi-RbcS-TpGK1, URA3

- P3: pCM185_pCM185-Tet :: PC _Y ci-PRK-T _CY ci, TRP1

The cells were then incubated for 15 min at 30 ° C and 15 min at 42 ° C. The cells were centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed, the cells resuspended in 1 ml of YPD and incubated for 1 hour at 30 ° C. The cells were then centrifuged (5000 rpm, 1 min) and the supernatant removed. They were then washed in 1 ml of sterile physiological saline, centrifuged again (5000 rpm, 1 min), taken up in 100 ml of sterile physiological saline and then spread on YNB.E.AAM-LUW (Yeast) selection medium. Nitrogen base, Ethanol, Amino-Acid Mix without Leucine, Uracil and tryptophan: adenine 10 mg / l, alanine 76 mg / l, arginine 50 mg / l, asparagine 76 mg / l, aspartic acid 80 mg / l, cysteine 76 mg glutamic acid 76 mg / l, glutamine 76 mg / l, glycine 76 mg / l, histidine 20 mg / l, isoleucine 50 mg / l, lysine 50 mg / l, methionine 20 mg / l, phenylalanine 50 mg / l proline 76 mg / l, serine 76 mg / l, threonine 100 mg / l, tyrosine 50 mg / l, valine 140 mg / l) and incubated 72 h at 30 ° C.

The clones obtained were validated by colony genotyping and one of them was referenced SC0008.

Example 4 Construction of a yeast strain expressing PRK RuBisCO and mutated on the SPT5 (A339P) and STD1 (Y86N) genes.

Strain and genetic constructions.

A yeast strain Saccharomyces cerevisiae, CEN.PK 1605 (Mat has HIS3 leu2-3,1312 trp1-289 ura3-52 MAL.286) derived from the commercial strain CEN.PK 1 13-7D (GenBank: JRIV00000000) was engineered to express the endogenous SPT5 gene mutated at position 339 of its protein sequence and STD1 gene mutated at position 86 of its protein sequence, and characterize the effect of these mutations on the RuBisCO activity of Synechococcus elongatus expressed in the strain.

The construction of strain SC0009 was carried out by homologous recombination according to the following protocol:

Two linear genomic insertion cassettes were constructed from PCR products assembled via the NEBuilder® protocol (New England Biolabs, Evry, France), and then amplified by a final nested PCR step.

Spt5A339P cassette:

A first PCR product made on the genomic DNA of strain CEN.PK 1605 from a sense oligonucleotide 1 (SEQ ID NO 12) located 499 base pairs upstream of the mutation site (position 1015 of the open phase of reading) and an antisense oligonucleotide 2 (SEQ ID NO: 13 ') located at position 1015, introducing the point mutation g1015c leading to the missense mutation A339P on the protein sequence. A second PCR product carried out on the genomic DNA of the CEN.PK 1605 strain using the sense oligonucleotide 3 (SEQ ID No. 14) having at 5 'a cover area of 24 base pairs with the end 3 'of the first PCR, and antisense oligonucleotide 4 (SEQ ID NO 15) located 213 base pairs downstream of the STOP codon of the open reading phase of the SPT5 gene.

A third PCR product, having at 5 'a 32 base pair overlap zone with the 3' end of the second PCR allowing amplification of the BleMX resistance cassette, surrounded by LoxP sites on the plasmid pUG66 (Gueldener, 2002) using the sense oligonucleotides 5 (SEQ ID NO 16).

A fourth PCR product having at 5 'a 26 base pair overlap zone with the 3' end of the third PCR, carried out on the genomic DNA of strain CEN.PK 1605 from a sense oligonucleotide 7 ( SEQ ID No. 18) located 222 base pairs downstream of the STOP codon of the open reading phase of the SPT5 gene and of an antisense oligonucleotide 8 (SEQ ID NO 19) located 560 base pairs downstream of the STOP codon of the phase open reading of the SPT5 gene.

After assembly via the NEBuilder® protocol (New England Biolabs, Evry, France), the final product was amplified by PCR nested using the oligonucleotides sense 9 (SEQ ID NO 20) and antisense 10 (SEQ ID NO 21).

Cassette std1 Y86N:

A first PCR product made on the genomic DNA of strain CEN.PK 1605 from a sense oligonucleotide 1 (SEQ ID NO 22) located 328 base pairs upstream of the mutation site (position 256 of the open phase reading) and an oligonucleotide antisense 12 (SEQ ID No. 23) located at position 256, introducing the t256a point mutation leading to the Y86N missense mutation on the protein sequence.

A second PCR product made on the genomic DNA of the CEN.PK 1605 strain using the sense oligonucleotide 13 (SEQ ID NO 24) having at 5 'a 25 base pair overlap zone with the end 3 'of the first PCR, and the antisense oligonucleotide 14 (SEQ ID NO 25) located at the end of the open reading phase of the STD1 gene (including the STOP codon) and having a recovery zone of 34. base pairs with the 3 'end of the third PCR.

A third PCR product allowing the amplification of the PCYCI promoter derived from the Saccharomyces cerevisiae CYC1 gene (YJR048W, Cytochrome c, isoform 1), obtained by gene synthesis (Eurofins Genomics, Nantes, France) and cloned into the plasmid P4 (PCM 1 85_TCYCI, TRP1) using oligonucleotides sense 15 (SEQ ID NO 26) and antisense 16 (SEQ ID NO 27).

A fourth PCR product exhibiting at 5 'a 22 base pair overlap zone with the 3' end of the third PCR and allowing the amplification of the HphMX resistance cassette, surrounded by LoxP sites, on the plasmid pUG75 (Hegemann and Heick, 201 1) using oligonucleotides sense 17 (SEQ ID NO 28) and antisense 18 (SEQ ID NO 29).

A fifth PCR product having at 5 'a 26 base pair overlap zone with the 3' end of the fourth PCR, carried out on the genomic DNA of the strain CEN.PK 1605 from a sense oligonucleotide 19 ( SEQ ID No. 30) located downstream of the STOP codon of the open reading phase of the STD1 gene and of an antisense oligonucleotide (SEQ ID NO 31) located 314 base pairs downstream of the STOP codon of the open reading phase of the STD1 gene

After assembly via the NEBuilder® protocol (New England Biolabs, Evry, France), the final product was amplified by PCR nested using the oligonucleotides sense 21 (SEQ ID NO 32) and antisense 22 (SEQ ID NO 33).

The strain CEN.PK 1605 was then transformed with these linear DNAs according to the following protocol:

The strain was cultured in a volume of 50 ml YPD complex (Yeast extract, Peptone, Dextrose) at 30 ° C. until the exponential growth phase. The cells were centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant was removed and the cells resuspended in 25 ml sterile water and then centrifuged again for 5 minutes at 2500 rpm at room temperature. After having removed the supernatant, the cells were resuspended in 500mI of PLTE solution (400mI 50% Polyethylene glycol, 50mL 1M lithium acetate, 2.5mM 200mM Ethylene Diamine Tetraacetic, 1 M Tris 1 M pH 7.5, 42.5 mI water). 10 μl of "carrier" DNA (denatured salmon sperm DNA) at 5 mg / ml, 56 ml of dimethyl sulfoxide and 500 ng of each of the 2 genomic insertion cassettes were added to the reaction mixture. The cells were then incubated for 15 min at 30 ° C and 15 min at 42 ° C. The cells were centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed and the cells resuspended in 1 ml of YPD and incubated overnight at 30 ° C with shaking (180 rpm). The cells were centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed and the cells were resuspended in 100 ml sterile saline and then plated on YPD selection medium supplemented with 80 μg / ml phleomycin and 200 μg / ml hygromycin B and incubated. 72 h at 30 ° C.

The clones obtained were validated by genotyping on genomic DNA and sequencing after amplification of the area of interest by PCR. One of these clones was referenced as SC0009 (Mat at HIS3 Ieu2-3.112 trp1-289 ura3-52 MAL.28c spt5A339P: BleMX std1 Y86N: HphMX)

The yeast strain SC0009 was then transformed to express the PRK, RuBisCO (RbcL RbcS) and RbcX genes of Synechococcus elongatus PCC6301 and the GroES and GroEL genes of E. coli.

The strain was cultured in a volume of 50 ml YPD complex (Yeast extract, Peptone, Dextrose) at 30 ° C. until the exponential growth phase. The cells were centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant was removed, the cells resuspended in 25 ml of sterile water, and then centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells were resuspended in 500mI of PLTE solution. 10 μl of "carrier" DNA at 5 mg / ml, 56 ml of dimethyl sulfoxide and 300 μg of each of the following shuttle plasmids were added to the reaction mixture:

P2: V51_V51 -PdH3-RbcL-TADHi-PTEFi-RbcS-TpGKi, URA3

- P3: pCM185_pCM185-Tet :: PcYci-PRK-T _CY ci, TRP1

The cells were then incubated for 15 min at 30 ° C and 15 min at 42 ° C. The cells were centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed, the cells resuspended in 1 ml of YPD and incubated for 1 hour at 30 ° C. The cells were then centrifuged (5000 rpm, 1 min) and the supernatant removed. They were washed in 1 ml of sterile physiological saline, centrifuged again (5000 rpm, 1 min), taken up in 100 ml of sterile physiological saline and then spread on a selection medium YNB.D (Yeast Nitrogen Base, Dextrose). and incubated 72 h at 30 ° C.

The clones obtained were validated by colony genotyping and one of them was referenced SC0010.

Example 5 Construction of a yeast strain expressing PRK RuBisCO and mutated on the genes SPT5 (A339P) and PFK2.

Strain and genetic constructions.

Strains of Saccharomyces cerevisiae, SC0002 (Mat has HIS3 leu2-3.112 trp1-289 ura3-52 MAL.28c spt5A339P: BleMX) and SC0007 (Matte alpha HIS3 leu2-3.112 trp1-289 ura3- 52 MAL.28c pfk2Y611 ^* : NatMX) were crossed to construct a strain coexpressing the endogenous SPT5 gene, mutated at position 339 of its protein sequence and the endogenous PFK2 gene, truncated in its protein sequence at position 61 1, and characterize the effect of these mutations on the RuBisCO activity of Synechococcus elongatus expressed in the strain.

The crossing was made as follows:

Crossing:

The two haploid strains SC0002 and SC0007 of opposite sex signs were plated on rich medium: YPD agar (Yeast extract Petone Dextrose) and YPGE agar (Yeast extract Peptone Glycerol Ethanol) respectively, and incubated overnight at 30 ° C. The strains were then placed in contact on a box of selective YPGE agar medium supplemented with 80 μg / ml of phleomycin and 50 μg / ml of nourseothricin, and incubated for two days at 30 ° C. An isolated diploid isolate from this cross was then plated on the same selection medium and incubated overnight at 30 ° C. The cells were then plated again on non-selective YPGE agar medium and incubated overnight at 30 ° C.

Sporulation:

The cells were recovered on the plate and suspended in 5 ml of SM medium (Sporulation Medium: 1% of potassium acetate, 0.1% of yeast extract) supplemented with leucine: 100 mg / ml, tryptophan: 50 mg / ml and uracil 20 mg / ml. Cells were placed at 30 ° C for 5 days to allow sporulation of each diploid cell into 4 haploid daughter cells (spores), pooled as tetrads.

Spore analysis in yrac:

The cell suspension was centrifuged for 5 min at 2500 rpm at room temperature. The supernatant was removed and the cells washed with 5 ml of sterile water. The suspension was centrifuged (5 min, 2500 rpm, room temperature), the supernatant removed and the cells taken up in 500 μl of sterile water. The wall surrounding the 4 spores was degraded by enzymatic digestion overnight (30 ° C., with stirring 180 rpm) in the following reaction mixture: 250 ml of cell suspension, 2.4 ml of sterile water, 125 ml of Lyticase (Arthrobacter luteus, SIGMA-Aldrich, St. Louis, USA) at 10 mg / ml, 5 ml b-mercaptoethanol. The suspension was centrifuged (5 min, 2500 rpm, room temperature), the supernatant removed and the cells taken up in 5 ml of sterile water. The suspension was diluted (in order to obtain isolated clones) and plated on YPGE selective medium supplemented with 80 μg / ml of phleomycin and 50 μg / ml of nourseothricin, then incubated for 48 h at 30 ° C.

The clones obtained were validated by genotyping on genomic DNA and sequencing after amplification of the areas of interest by PCR. The sexual sign of the clones was also tested by cross-breeding with protective strains of matte or alpha matte sexual signs. One of these clones was referenced SC001 1 (Mat has HIS3 leu2-3.112 trp1-289 ura3-52 MAL.28c spt5A339P: BleMX pfk2Y611 ^* : NatMX).

The yeast strain SC001 1 was then transformed to express the PRK, RuBisCO (RbcL RbcS) and RbcX genes of Synechococcus elongatus PCC6301 and the GroES and GroEL genes of E. coli.

The strain was cultured in a volume of 50 ml of rich YPGE medium at 30 ° C until the exponential growth phase. The cells were centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant was removed, the cells resuspended in 25 ml of sterile water and then centrifuged again for 5 minutes at 2500 rpm at room temperature. After removal of the supernatant, the cells were resuspended in 500mI of PLTE solution (400mI 50% Polyethylene glycol, 50mL 1M lithium acetate, 2.5mM 200mM Ethylene Diamine Tetraacetic). 5 ml of 1 M Tris pH 7.5, 42.5 ml of water). 10μl of "carrier" DNA (denatured salmon sperm DNA) at 5mg / ml, 56mL of dimethylsulfoxide and 300ng of each of the following shuttle plasmids were added to the reaction mixture:

P2: V51 -V51 -PdH3-RbcL-TADHi-PTEFi-RbcS-TpGK1, URA3

- P3: pCM185_pCM185-Tet :: PC _Y ci-PRK-T _CY ci, TRP1

The cells were then incubated for 15 min at 30 ° C and 15 min at 42 ° C. The cells were centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed, the cells resuspended in 1 ml of YPD and incubated for 1 hour at 30 ° C. The cells were then centrifuged (5000 rpm, 1 min) and the supernatant removed. They were then washed in 1 ml of sterile physiological saline, centrifuged again (5000 rpm, 1 min), taken up in 100 ml of sterile physiological saline and then spread on YNB.GE.AAM-LUW (Yeast Nitrogen) selection medium. base, Glycerol, Ethanol, Amino-Acid Mix without Leucine, Uracil and tryptophan: adenine 10 mg / l, alanine 76 mg / l, arginine 50 mg / l, asparagine 76 mg / l, aspartic acid 80 mg / l, cysteine 76 mg / l, glutamic acid 76 mg / l, glutamine 76 mg / l, glycine 76 mg / l, histidine 20 mg / l, isoleucine 50 mg / l, lysine 50 mg / l, methionine 20 mg / l, phenylalanine 50 mg Proline 76 mg / l, serine 76 mg / l, threonine 100 mg / l, tyrosine 50 mg / l, valine 140 mg / l) and incubated 72 h at 30 ° C.

The clones obtained were validated by colony genotyping and one of them was referenced SC0012. Example 6 Construction of a yeast strain expressing PRK RuBisCO and mutated on the STD1 (Y86N) and PFK2 genes.

Strain and genetic constructions.

Strains of Saccharomyces cerevisiae, SC0004 (Mat has HIS3 leu2-3.112 trp1-289 ura3-52 MAL.28c std1 Y86N: HphMX) and SC0007 (Matte alpha HIS3 leu2-3.112 trp1-289 ura3- 52 MAL.28c pfk2Y611 ^* : NatMX ) were crossed to construct a strain co-expressing the endogenous STD1 gene, mutated at position 86 of its protein sequence, and the endogenous PFK2 gene, truncated in its protein sequence at position 61 1, and characterize the effect of these mutations on the activity of RuBisCO of Synechococcus elongatus expressed in the strain.

The crossing was made as follows:

Crossing:

The two opposite SC0004 and SC0007 haploid strains were plated on rich medium: YPD agar (Yeast extract Petone Dextrose) and YPGE agar (Yeast extract Peptone Glycerol Ethanol) respectively, and incubated overnight at 30 ° C. The strains were then contacted on a box of selective YPGE agar medium supplemented with 200 μg / ml of hygromycin B and 50 μg / ml of nourseothricin, and incubated for two days at 30 ° C. An isolated diploid isolate from this cross was then plated on the same selection medium and incubated overnight at 30 ° C. The cells were then plated again on non-selective YPGE agar medium and incubated overnight at 30 ° C.

Sporulation:

Spore analysis in yrac:

The cell suspension was centrifuged for 5min at 2500 rpm at room temperature. The supernatant was removed and the cells washed with 5 ml of sterile water. The suspension was centrifuged (5 min, 2500 rpm, room temperature), the supernatant removed and the cells taken up in 500 μl of sterile water. The wall surrounding the 4 spores was degraded by enzymatic digestion overnight (30 ° C., with stirring 180 rpm) in the following reaction mixture: 250 ml of cell suspension, 2.4 ml of sterile water, 125 ml of Lyticase (Arthrobacter luteus, SIGMA-Aldrich, St. Louis, USA) at 10 mg / ml, 5 ml b-mercaptoethanol. The suspension was centrifuged (5 min, 2500 rpm, room temperature), the supernatant discarded and the cells reprocessed in 5 ml of sterile water. The suspension was diluted (to obtain isolated clones) and plated on selective YPGE medium supplemented with 200 μg / ml hygromycin B and 50 μg / ml of nourseothricin, then incubated for 48 h at 30 ° C.

The clones obtained were validated by genotyping on genomic DNA and sequencing after amplification of the areas of interest by PCR. The sexual sign of the clones was also tested by cross-breeding with protective strains of matte or alpha matte sexual signs. One of these clones was referenced SC0013 (MAT HIS3 Ieu2-3.112 trp1-289 ura3-52 MAL.28c std1 Y86N: HphMX pfk2Y611 ^* : NatMX).

The yeast strain SC0013 was then transformed to express the PRK, RuBisCO (RbcL RbcS) and RbcX genes of Synechococcus elongatus PCC6301 and the GroES and GroEL genes of E. coli.

The strain was cultured in a volume of 50 ml of rich YPGE medium at 30 ° C until the exponential growth phase. The cells were centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant was removed and the cells resuspended in 25 ml sterile water and then centrifuged again for 5 minutes at 2500 rpm at room temperature. After removal of the supernatant, the cells were resuspended in 500mI of PLTE solution (400mI 50% Polyethylene glycol, 50mL 1M lithium acetate, 2.5mM 200mM Ethylene Diamine Tetraacetic). 5 ml of 1 M Tris pH 7.5, 42.5 ml of water). 10μl of "carrier" DNA (denatured salmon sperm DNA) at 5mg / ml, 56mL of dimethylsulfoxide and 300ng of each of the following shuttle plasmids were added to the reaction mixture:

P2: V51 -V51 -PdH3-RbcL-TADHi-PTEFi-RbcS-TpGK1, URA3

- P3: pCM185_pCM185-Tet :: Pc _Y following PRK-Tc _Y one, TRP1

The cells were then incubated for 15 min at 30 ° C and 15 min at 42 ° C. The cells were centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed, the cells resuspended in 1 ml of YPD and incubated for 1 hour at 30 ° C. The cells were then centrifuged (5000 rpm, 1 min) and the supernatant removed. They were then washed in 1 ml of sterile physiological saline, centrifuged again (5000 rpm, 1 min), taken up in 100 ml of sterile physiological saline and then spread on YNB.GE.AAM-LUW (Yeast) selection medium. Nitrogen base, Glycerol, Ethanol, Amino-Acid Mix without leucine, uracil and tryptophan: adenine 10 mg / l, alanine 76 mg / l, arginine 50 mg / l, asparagine 76 mg / l, aspartic acid 80 mg / l, cysteine 76 mg / l, glutamic acid 76 mg / l, glutamine 76 mg / l, glycine 76 mg / l, histidine 20 mg / l, isoleucine 50 mg / l, lysine 50 mg / l, methionine 20 mg / l, phenylalanine 50 mg / l, proline 76 mg / l, serine 76 mg / l, threonine 100 mg / l, tyrosine 50 mg / l, valine 140 mg / l) and incubated 72 h at 30 ° C.

The clones obtained were validated by colony genotyping and one of them was referenced SC0014.

Example 7 Construction of a yeast strain expressing PRK RuBisCO and mutated on SPT5 genes (A339P). STD1 (Y86N) and PFK2.

Strain and genetic constructions.

Strains of Saccharomyces cerevisiae, SC0009 (Mat has HIS3 leu2-3.112 trp1-289 ura3-52 MAL.28c std1 Y86N: HphMX spt5A339P: BleMX) and SC0007 (Matte alpha HIS3 leu2-3,1312 trp1-289 ura3-52 MAL.28c pfk2Y611 ^* : NatMX) were crossed to construct a strain coexpressing the genes: endogenous STD1, mutated at position 86 of its protein sequence, endogenous SPT5, mutated at position 339 of its protein sequence and endogenous PFK2, truncated in its sequence Protein in position 61 1, and characterize the effect of these mutations on the activity of RuBisCO of Synechococcus elongatus expressed in the strain.

The crossing was made as follows:

Crossing:

The two opposite sex sign haploid strains SC0009 and SC0007 were plated on rich medium: YPD agar (Yeast extract Petone Dextrose) and YPGE agar (Yeast extract Peptone Glycerol Ethanol) respectively, and incubated overnight at 30 ° C. The strains were then placed in contact on a box of selective YPGE agar medium supplemented with 200 μg / ml of hygromycin B and 50 μg / ml of nourseothricin, and incubated for two days at 30 ° C. An isolated diploid isolate from this cross was then plated on the same selection medium and incubated overnight at 30 ° C. The cells were then plated again on non-selective YPGE agar medium and incubated overnight at 30 ° C.

Sporulation:

The cells were recovered on the plate and suspended in 5 ml of SM medium (Sporulation Medium: 1% of potassium acetate, 0.1% of yeast extract) supplemented with leucine: 100 mg / ml, tryptophan: 50 mg / ml and uracil 20 mg / ml. Cells were put at 30 ° C for 5 days to allow sporulation of each diploid cell into 4 haploid daughter cells (spores), pooled as tetrads.

Spore analysis in yrac:

The cell suspension was centrifuged for 5min at 2500 rpm at room temperature. The supernatant was removed and the cells washed with 5 ml of sterile water. The suspension was centrifuged (5 min, 2500 rpm, room temperature), the supernatant removed and the cells taken up in 500 ml of sterile water. The wall surrounding the 4 spores was degraded by enzymatic digestion overnight (30 ° C., with 180 rpm stirring) in the following reaction mixture: 250 ml of cell suspension, 2.4 ml of sterile water, 125 ml of Lyticase ( Arthrobacter luteus, SIGMA-Aldrich, St. Louis, USA) at 10 mg / ml, 5 mI of b-mercaptoethanol. The suspension was centrifuged (5 min, 2500 rpm, room temperature), the supernatant discarded and the cells reprocessed in 5 ml of sterile water. The suspension was diluted (to obtain isolated clones) and spread on YPGE selective medium supplemented with 200 μg / ml of hygromycin B, 50 μg / ml of nourseothricin and 80 μg / ml of phleomycin, then incubated 48h at 30 ° C.

The clones obtained were validated by genotyping on genomic DNA and sequencing after amplification of the areas of interest by PCR. The sexual sign of the clones was also tested by cross-breeding with protective strains of matte or alpha matte sexual signs. One of these clones was referenced SC0015 (MAT HIS3 Ieu2-3.112 trp1-289 ura3-52 MAL.28c std1 Y86N: HphMX spt5A339P: BleMX pfk2Y611 ^* : NatMX).

The strain was cultured in a volume of 50 ml of rich YPGE medium at 30 ° C until the exponential growth phase. The cells were centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant was removed and the cells resuspended in 25 ml sterile water and then centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells were resuspended in 500mI of PLTE solution (400mI of 50% Polyethylene glycol, 50mL of 1M lithium acetate, 2.5mL of 200mM Ethylene Diamine Tetraacetic). 5 ml of 1 M Tris pH 7.5, 42.5 ml of water). 10 μl of "carrier" DNA at 5 mg / ml, 56 ml of dimethyl sulfoxide and 300 μg of each of the following shuttle plasmids were added to the reaction mixture:

P2: V51 -V51 -PdH3-RbcL-TADHi-PTEFi-RbcS-TpGK1, URA3

- P3: pCM185_pCM185-Tet :: Pc _Y following PRK-Tc _Y one, TRP1

The clones obtained were validated by colony genotyping and one of them was referenced SC0016.

Example 8 Characterization of Yeast Strains (SC0003, SC0006, SC0008,

SC0010, SC0012, SC00014, SC00016) expressing PRK RuBisCO and mutated at gene level SPT5 (A339P). STD1 (Y86N) and PFK2. so

individually or in combination.

The 8 strains prepared in the preceding examples were cultured in order to characterize the effect of SPT5 mutations A339P, STD1 Y86N and PFK2 Y61 1 ^* , individually or in combination, on the activity of RuBisCO of Synechococcus elongatus expressed in strain.

Environments

For precultures and cultures, medium A used contained 6.7 g / L Yeast Nitrogen Base with ammonium sulfate (YNB w / SA, MP biomedicals, 4027-532) and 20 g / L glucose (Sigma, G7021). ), adjusted to pH 5.5 with sodium hydroxide solution (1M).

precultures

1 mL of each SC0001, SC0003, SC0006, SC0008, SC0010, SC0012, SC0014 and SC0016 strains stored in cryotubes at -80 ° C (20% glycerol) was inoculated with 19 mL of medium A in 250 bafled Erlenmeyer flask. mL. These precultures were cultured at 30 ° C and 120 rpm under 10% CO2 to an optical density (DC> 6oonm) target of 0.6 AU (Absorbance Unit).

A second preculture stage was conducted by inoculating 50 ml of medium A into a 250 ml 0.05 AU baffle Erlenmeyer flask from the first preculture. This second preculture was grown at 30 ° C and 120 rpm at 10% CO2 (up to a target OD of 0.7 AU) This second preculture was used to inoculate the next culture step.

Culture in Erlens

The cultures of strains SC0001, SC0003, SC0006, SC0008, SC0010, SC0012, SC0014 and SC0016 were each carried out in 100 ml of medium A, in 500 ml baffled Erlenmeyer flask by inoculating at 0.05 AU from the second precultures. The culture conditions used were the same as for the precultures (30 ° C, 120 rpm, 10% CO2) with the exception of the DC> ₆ oo _nm target end of culture of 0.5 AU.

Enzymatic test

In order to assay RuBisCO enzymatic activities, the fermentation broth was first centrifuged for 10 minutes at 3000 g and at 4 ° C. The supernatant was then removed and the cell pellets were taken up in 500 μl of Tris-HCl buffer at pH 7.9. The cell suspension was then transferred to a 2 ml FastPrep tube (MP biomedicals, Lysing matrix Y, 6960-100) and then the cells were lysed at FastPrep 96 (MP biomedicals, 16010500) by two cycles of 30 seconds at 1800 rpm. minute. The tubes were then centrifuged at 4 ° C. for 5 minutes at 13,000 rpm and 10 μg of total cell lysate proteins (supernatant) were used for the assay of enzymatic activity in technical triplicate. The total protein concentration of the cell lysate was determined with the kit QuantiPro ™ BCA (Sigma, QPBCA-1 KT).

RuBisCO activity was determined using CO2 as carbonate (NaHCO3, 50 mM) and Ribulose-1,5-bisphosphate (RuBP, 5 mM) as substrates in 50 mM Tris-HCl buffer pH 7, 9 in the presence of DTT (2 mM), KCl (30 mM) and MgCh (10 mM). The reaction was stopped after 80 minutes by boiling (7 min at 95 ° C). The products of the enzymatic reaction and more particularly 3-phosphoglycerate (3-PG), 2-phosphoglycerate (2-PG) and phosphoenolpyruvate (PEP) were quantified by liquid chromatography coupled to a UHPLC ultimate 3000 RS mass spectrometer. MSQ plus (LC-MS) using a Spheri-5 RP-18 100x2.1mm, 5μm column (PerkinElmer, 071-10016) with a Newguard RP-18 precolumn, 15x3.2mm, 7μm (PerkinElmer) , 071 1-0092). The temperature of the column was 35 ° C and the flow rate was set at 1 mL / min. The run was carried out with two mobile phases (10 mM of tributylamine in the D route and 100% of acetonitrile in the B route) according to the following gradient: 3 min 100% D route then 15 min 95% D route and 5% B route 2 min 65% D-way and 35% B-way, 4 min 100% B-way and finally 2 min 100% D-way. A volume of 30 μL was injected for each sample. The identification of the compounds was based on their molecular weight and comparison of retention times with standards. Quantification is performed using calibration curves of the appropriate standards. The activity of RuBisCO will therefore be expressed in nmol of products. min ¹ mg ¹ of total protein. The products being the sum of 3-phosphoglycerate (3-PG), 2-phosphoglycerate (2-PG) and phosphoenolpyruvate (PEP)

Result

The activities of RuBisCO expressed in the modified strains are summarized in the table below in products. min ¹ mg ^-1 of total protein. These activities were compared with RuBisCO activity expressed in strain SC0001. The strain SC0001 represents the reference RuBisCO activity without any other mutation in the genome. In strain SC0001, RuBisCO has an activity of 10 ± 7 nmol of products. min ¹ ¹ .mg of total protein.

Table 5: Summary of RuBisCO Activities Expressed in Modified Yeast Strains

The results presented in the table above show that:

Mutation of the endogenous SPT5 gene at position 339 of its protein sequence makes it possible to improve the activity of RuBisCO by a factor of 7 relative to an RuBisCO expressed in a yeast strain without a mutated SPT5 gene.

Mutation of the endogenous STD1 gene at position 86 of its protein sequence makes it possible to improve the activity of RuBisCO by a factor of 2 relative to an RuBisCO expressed in a yeast strain without a mutated STD1 gene.

Truncating the endogenous PFK2 gene at position 61 1 of its protein sequence makes it possible to improve the activity of RuBisCO by a factor of 5 relative to an RuBisCO expressed in a yeast strain without a mutated PFK2 gene.

These results also show that some mutations can have a cumulative effect when they are combined with each other, two by two, or when the three mutations are introduced. Indeed, we can note that:

Mutation of the endogenous SPT5 gene at position 339 of its protein sequence and truncating the endogenous PFK2 gene at position 611 of its protein sequence makes it possible to improve the RuBisCO activity by a factor of 13 relative to an RuBisCO expressed in a yeast strain without mutated gene. The combination of these mutations makes it possible to improve the RuBisCO activity by a factor greater than that obtained with the SPT5 A339P or PFK2 Y611 ^* mutation alone.

Truncating the endogenous PFK2 gene at position 611 of its protein sequence and mutating the endogenous STD1 gene at position 86 of its protein sequence makes it possible to improve the activity of RuBisCO by a factor of 9 relative to an RuBisCO expressed in a protein. yeast strain without mutated gene. The combination of these mutations makes it possible to improve the RuBisCO activity by a factor greater than that obtained with the PFK2 Y61 1 ^* or STD1 Y86N mutation alone.

Mutate the endogenous SPT5 gene at position 339 of its protein sequence, mutate the gene STD1 endogenous at position 86 of its protein sequence and truncating the endogenous PFK2 gene at position 61 1 of its protein sequence makes it possible to improve the activity of RuBisCO by a factor 21 relative to an RuBisCO expressed in a yeast strain. without mutated gene. The combination of these three mutations makes it possible to improve the RuBisCO activity by a factor greater than that obtained with the SPT5 mutation A339P, STD1 Y86N or PFK2 Y61 1 ^* alone.

Example 9 Construction and characterization of a Cupriavidus necator strain mutated at the NusG gene.

Strain and genetic constructions

A strain of commercial bacterium CN0001 Cupriavidus necator H16 (DSMZ: 428) has been modified to express the mutated endogenous NusG (H16-A3502) gene at position 85 of its protein sequence, and to characterize the effect of this mutation on the activity. of RuBisCO.

The construction of the strain was carried out according to the following protocol:

A plasmid allowing the introduction of the mutation into the genome of Cupriavidus necator was cloned in one step in vitro via the NEBuilder® HiFi DNA Assembly Cloning (New England Biolabs, Evry, France) assembly protocol using fragments following:

A first PCR product allowing the amplification of an upstream homology zone at the codon coding for the methionine 85 of the NusG gene was carried out on the genomic DNA of the wild-type CN0001 strain using the sense oligonucleotides (SEQ ID NO 44: 5 'AGATCCTTTA ATTCGAGCTC GGTACGTGGC AAAGATCCTC GACTAAGTTG 3'), located 631 base pairs upstream of the open reading phase of the NusG gene and having at 5 'a 25 nucleotide recovery zone with the 3' end of plasmid pL03 and antisense (SEQ ID NO: 45: 5 'AGCCGGGGAA GAAACGACGC TCGGTGACCG ACTTGT 3'), located 29 base pairs upstream of the mutation (position 223 of the open reading phase) and having at 5 'a recovery zone of 25 nucleotides with the 5 'end of the second PCR product.

A second PCR product allowing the amplification of the end of the coding sequence of the NusG gene (from position 224 of the open reading phase), modified to contain the a253c and t254c point mutations leading to the M85P missense mutation on the protein sequence was performed on a synthetic DNA fragment (Genscript) using the sense oligonucleotides (SEQ ID NO: 46 'CGGTCACCGA GCGTCGTTTC TTCCCCGGCT ACG 3'), located 29 base pairs upstream of the mutation and having at 5 'an overlap region of 25 nucleotides with the 3' end of the first PCR product, and antisense (SEQ ID NO: 47 'CTTACGTGCC GATCACGCTG TCGCCGCACC TTCGGCACGG CCTCACGCTC CTCTTGGCGC CGCCACCGGG GCGGCGCCGT TGCCCGTTGC CGCCCTTTCA GGCCGCAACC GGCAAATTCC TTAAACCTTC TCGACCTGGC 3') , located at the end of the open reading phase of the gene NusG (last 20 base pairs including the final STOP codon), having 105 nucleotides corresponding to the terminator sequence of the SecE (H16-A3503) -NusG operon and a 30 nucleotide overlap with the 5 'end of the third PCR product.

A third PCR product for the amplification of a chloramphenicol resistance cassette was made on the plasmid pKTrfp (Addgene plasmid # 59772, http://n2t.net/addgene:59772, RRID: Addgene_59772 (Bi et al. 2013)) using the sense oligonucleotides (SEQ ID NO: 48: 5 'GGTGCGGCGA CAGCGTGATC

GGCACGTAAG AGGTTC 3 '), having at 5' an overlap region of 30 nucleotides with the 3 'end of the second PCR product, and antisense (SEQ ID NO 49: 5' GTTGCCGCCC TTTCATGCAT ACTAGTGCTT GGATTCTC 3 '), having 5' a 30 nucleotide overlap area with the fourth PCR product.

A fourth PCR product allowing the amplification of a zone of homology downstream of the NusG gene was carried out on the genomic DNA of the wild-type CN0001 strain using the sense oligonucleotides (SEQ ID NO: 50 'AAGCACTAGT ATGCATGAAA

GGGCGGCAAC GGGCAAC 3 ') having at 5' an overlap zone of 30 nucleotides with the 3 'end third PCR product, and antisense (SEQ ID NO 51: 5' ACTTAATTAA GGATCCGGCG CGCCCACCCG GGGTCTTCCA TGCCGACGAT GTCAG 3 ') having in 5' a 25 nucleotide overlap area with the 5 'end of plasmid pL03 (Lenz and Friedrich., 1998).

The oligonucleotides were synthesized and purified by Eurofins Genomics (less than 30 nucleotides: desalted, more than 30 nucleotides: HPSF or Xtrem free for the oligonucleotide SEQ ID NO 47). The PCR products were amplified with KOD Hot Start DNA Polymerase enzyme (Novagen) with 5% DMSO and purified on gel with the Nucleospin gel kit and PCR clean-up (Macherey-Nagel).

The skeletal plasmid pL03 (Lenz and Friedrich, 1998) was linearized with the restriction enzyme XmaI (New England Biolabs, Evry, France). The digestion product was gel purified with the Nucleospin gel kit and PCR clean-up (Macherey-Nagel).

2 μl of the NEB Builder construct were transformed into chemically competent Escherichia coli NEB 5-alpha cells (New England Biolabs, Evry, France). The transformants were selected on LB / Agar medium (Tryptone 10 g / L, yeast extract 5 g / L, NaCl 5 g / L, Sigma-Aldrich, agar 20 g / L) containing 15 μg / mL of tetracycline. The selection of the positive clones was carried out by colony PCR using the enzyme DreamTaq Green PCR Master Mix (Thermo Scientific ™) and sense oligonucleotides (SEQ ID No. 52: 5 'AAGAGCTTCA CCTTCGTGAT GAAG 3') and antisense (SEQ ID NO. 53: 3 'TAGCAGCACG CCATAGTGAC TG 3'). After extraction of the plasmids with the NucleoSpin® Plasmid kit (Macherey-Nagel), the plasmid was validated by sequencing (Eurofins Genomics) with oligonucleotides: (SEQ ID NO: 54: 5 'GGTCTGACGC TCAGTGGAAC 3'), (SEQ ID NO: 55: 5 'TCTGGGTCAT GATCTTGTCG ACTTC 3'), (SEQ ID NO: 56: 5 'TGGTGCCGTC CGAAGAAGTC 3'), ( SEQ ID NO. 57: 5 'ACCGTTCAGC TGGATATTAC G 3'), (SEQ ID NO: 58: 5 'AAGAGCTTCA CCTTCGTGAT GAAG 3'), (SEQ ID NO: 59: 5 'GATTTGTTCA GAACGCTCGG 3').

Plasmid pL03-NusG (M85P) -CmR is inserted into an electrocompetent strain Escherichia coli S17-1 by electroporation using a Gene Pulser electroporator, BioRad (Datsenko and Wanner, 2000).

The selection of the positive clones was carried out by colony PCR using the DreamTaq Green PCR Master Mix enzyme (Thermo Scientific ™) and sense oligonucleotides (SEQ ID NO. 52) and antisense oligonucleotides (SEQ ID NO. 53). A clone of interest was isolated on LB / agar medium (Tryptone 10 g / L, yeast extract 5 g / L, NaCI 5 g / L, Sigma-Aldrich, agar 20 g / L) containing 15 μg / mL of tetracycline and incubated overnight at 37 ° C.

The conjugation between Escherichia coli S17-1 cells and those of the wild strain CN0001 was adapted from the Lenz et al. 1994 protocol. The sucrose selection method (15% sucrose used), combined with constant selection with 10 μg / ml of chloramphenicol (C0378, Sigma-Aldrich) allowed the insertion of the NusG cassette (M85P) -Terminator-CmR at the NusG locus. After the first homologous recombination, the clones were validated by colony PCR using the DreamTaq Green PCR Master Mix enzyme (Thermo Scientific ™) and sense oligonucleotides (SEQ ID No. 52) and antisense oligonucleotides (SEQ ID NO 53). After the second homologous recombination, the selection of positive clones among chloramphenicol-resistant and tetracycline-sensitive clones was performed by colony PCR using the Kod Xtreme Hot Start DNA Polymerase enzyme (Novagen) and oligonucleotides. sense (SEQ ID NO: 60: 5 'CTTGGACTCC TGTTGATAGA TCC 3') and antisense (SEQ ID NO: 61: 5 'CCGACGATAC GCATCGTGTC 3'). Extraction of the genomic DNA was performed on the positive clones from 5 ml of culture incubated overnight in a rich medium (27.5% (w / v) of trypticase soy broth, TSB, Becton Dickinson, France) at 30 ° C, using the DNeasy UltraClean Microbial Kit Extraction Kit (Qiagen, Cat No./ID: 12224). A PCR product covering the mutated zone was made using the enzyme Q5 High-Fidelity DNA Polymerase (New England Biolabs Inc.) and sense oligonucleotides (SEQ ID NO: 62: 5 'GGCTGACAAGCTCATCGAGTG 3') and antisense (SEQ ID NO. 63: 5 'AACCTCTTAC GTGCCGATCA C 3'). It was then cleaned on a column using the Nucleospin gel and PCR clean-up kit (Macherey-Nagel) and sent to sequence (Eurofins Genomics) with the oligonucleotides SEQ ID No. 62 and SEQ ID NO 63 to validate the presence of a253c and t254c mutations leading to the M85P missense mutation on the NusG protein sequence.

The Cupriavidus necator strain H16 NusG (M85P) -CmR was recovered and named CN0002.

Environments

The rich medium consisted of 27.5% (w / v) tryptic soy broth (TSB, Becton Dickinson, France).

The minimum medium used for Erlenmeyer cultures contained: 4.0 g / L NaH ₂ PO ₄ 2H ₂ O; 4.6 g / L of Na ₂ HPO ₄ 12H ₂ O; 0.45 g / LK ₂ SO ₄ ; 0.39 g / L MgSO ₄ H ₂ O; 0.062 g / L of CaCl ₂ 2H ₂ O and 1 ml / L of trace element solution. The element trace solution contained: 15 g / L FeSO ₄ H ₂ O; 2.4 g / L MnSO ₄ H ₂ O; 2.4 g / L of ZnSO ₄ 7H ₂ 0 and 0.48 g / L of CuSO ₄ 5H ₂ O in 0.1 M of HCl. Fructose (20 g / L) was used in heterotrophic culture as a carbon source. NH ₄ CI (1 g / L) was used as a nitrogen source to achieve a biomass concentration of about 6 g / L. 0.04 g / L of NaOH was added.

precultures

One colony isolated from each of CN0001 and CN0002 was first cultured for 8 h in 5 mL of medium rich with gentamycin (10 mg / L) and chloramphenicol (10 mg / L) (depending on strain) in culture tubes at 30 ° C with shaking (200 rpm). This first preculture was used to inoculate the second preculture to an initial 0.05 μg in 25 ml of minimal medium in 250 ml baffled Erlenmeyer flasks which were incubated for 20 h at 30 ° C, 200 rpm. This second preculture was used to inoculate the heterotrophic culture in Erlenmeyer flasks in 50 ml of minimum medium in the presence of fructose (20 g / l), gentamycin (10 mg / l) and chloramphenicol (10 mg / l). The initial ϋqboo target was 0.05.

Erlenmeyer culture

The heterotrophic culture was carried out in a minimum medium volume of 50 ml in 500 ml baffled Erlenmeyer flasks at a temperature of 30 ° C. and a stirring of 200 rpm. An exponential phase of growth lasting 18-20 hours was carried out without air restriction, until a biomass of 3 g / L was obtained. The cells were then washed twice with minimal medium without carbon source, taken up in 50 mL of the same medium and put into autotrophic culture using a commercial gas mixture of H _2/0 ₂ / C0 ₂ / N ₂ (mol%: 60: 2: 10: 28, Air Liquide, Paris, France) for 48 hours.

Enzymatic test

In order to assay RuBisCO enzymatic activities, the fermentation must was first centrifuged for 10 minutes at 4000 g and at 4 ° C. The supernatant was then removed and the cell pellets were taken up in 500 μl of Tris-HCl buffer at pH 7.9. The cell suspension was then transferred to a 2 ml FastPrep tube (MP biomedicals, Lysing matrix Y, 6960-100) and then the cells were lysed at FastPrep 96 (MP biomedicals, 16010500) by two cycles of 30 seconds at 1800 rpm. minute. The tubes were then centrifuged at 4 ° C. for 5 minutes at 13,000 rpm and 10 μg of total protein of the cell lysate (supernatant) were used for the determination of the enzymatic activity, in technical triplicate. The total protein concentration of the cell lysate was determined with the QuantiPro ™ BCA Kit (Sigma, QPBCA-1 KT).

RuBisCO activity was determined using CO2 as carbonate (NaHCC> 3.50 mM) and Ribulose-1, 5-bisphosphate (RuBP, 5 mM) as substrates in 50 mM Tris-HCl pH buffer. 7.9 in the presence of DTT (2 mM), KCl (30 mM) and MgCl (10 mM). The reaction was stopped after 80 minutes by boiling (7 min at 95 ° C). The products of the enzymatic reaction and more particularly 3-phosphoglycerate (3-PG), 2-phosphoglycerate (2-PG) and phosphoenolpyruvate (PEP) were quantified by liquid chromatography coupled to a UHPLC ultimate 3000 RS mass spectrometer. MSQ plus (LC-MS) using a Spheri-5 RP-18 100x2.1mm, 5μm column (PerkinElmer, 071-10016) with a Newguard RP-18 precolumn, 15x3.2mm, 7μm (PerkinElmer) , 071 1-0092). The temperature of the column was 35 ° C and the flow rate was set at 1 mL / min. The run was carried out with two mobile phases (10 mM of tributylamine in the D route and 100% of acetonitrile in the B route) according to the following gradient: 3 min 100% D route then 15 min 95% D route and 5% B route 2 min 65% D-way and 35% B-way, 4 min 100% B-way and finally 2 min 100% D-way. A volume of 30 μL was injected for each sample. The identification of the compounds was based on their molecular weight and comparison of retention times with standards. Quantification is performed using calibration curves of the appropriate standards. The activity of RuBisCO will therefore be expressed in nmol of products. min ¹ mg ¹ of total protein. The products are the sum of 3-phosphoglycerate (3-PG), 2-phosphoglycerate (2-PG) and phosphoenolpyruvate (PEP).

Result

The results of RuBisCO activities carried out on strains CN0001 and CN0002 are presented in the table below:

Table 6: Summary of RuBisCO activities expressed in strains of

Cupriavidus necator

The activity of RuBisCO expressed in modified strain CN0002 is 130.7 ± 1.1.8 products. min- ¹ . mg ^-1 of total protein. This activity was compared to RuBisCO activity expressed in strain CN0001. The latter represents the reference RuBisCO activity without any other mutation in the genome. In strain CN0001, RuBisCO has an activity of 85.3 ± 9.9 nmol of products. min ¹ mg 1 of total protein. At Cupriavidus necator, the M85P mutation of the NusG gene improves RuBisCO activity by 53%.

Example 10 Construction and Characterization of a Nannochloroosis Oceanica Strain Mutated at the SPT5 Gene (A294P)

Strain and genetic constructions.

The commercial strain of unicellular and haploid microalgae Nannocholoropsis oceanica CCMP1779 (National Center for Marine Algae and Microbiota, USA), named NG0001, is modified to express the endogenous SPT5 gene (gm1 .4073_g, scaffold_12: 256855-259739 (+)), mutated at position 294 of its protein sequence, and characterize the effect of this mutation on the activity of RuBisCO.

The construction of strain NG0002 SPT5A294P is carried out by homologous recombination, as described by Kilian et al., 201 1, according to the following protocol:

A linear genomic insertion cassette is constructed from PCR products assembled via the NEBuilder® protocol (New England Biolabs, Evry, France), then amplified by a last PCR step:

A first PCR product allowing the amplification of a 1 kb recombination zone upstream of the putative SPT5 gene promoter is amplified on the genomic DNA of the NG0001 wild-type strain from a sense oligonucleotide (SEQ ID NO 64: 5 'ATGATGTGTG TCTTTCCACA TTGATC 3'), located 1440 base pair upstream of the translation initiation codon of the SPT5 gene, and antisense (SEQ ID NO 65: 5 'ATTTTGTATA CTTTACGCTTA TGTCTTTATG GACATTAGAC CATCGTACAC 3') located 441 pairs of bases upstream of the initiation codon and having at 5 'a 25 base pair overlap area with the 5' end of the second PCR.

A second PCR product 5 'having a 25 base pair overlap area with the 3' end of the second PCR and allowing amplification of the zeocin resistance gene Shble (Streptoalloteichus hindustanus), preceded by the promoter EF ( elongation factor) and monitoring of the terminator LDSP (lipid droplet surface protein), is amplified on the plasmid pNOC41 1 (Poliner et al., 2018), using the sense oligonucleotides (SEQ ID NO: 66 'AGACATAGCG TAAAGTATAC AAAATGAC 3 ') and antisense (SEQ ID NO 67: 5' TGTTTCCACG ATAAAAATAG ACTGC 3 ').

A third PCR product is carried out on the genomic DNA of strain NG0001 using the sense oligonucleotide (SEQ ID NO 68: 5 'GCAGTCTATT TTTATCGTGG AAACAATCCA CATTGCATGG ATTCCTTTG 3'), located 440 base pairs upstream of the codon initiation of the SPT5 gene and having a 25-nucleotide overlap region with the 3 'end of the second PCR product, and antisense (SEQ ID NO: 69: 5' CGCTTCATTC CTGGGTTCA ACCAAGACAT GCCCTTTCG 3 ') localized within the SPT5 gene and allowing the introduction of the point mutation g880c leading to the missense mutation A294P on the protein sequence.

A fourth PCR product allowing the amplification of a 1 kb recombination zone downstream of the g880c mutation and having at 5 'a 25 base pair overlap zone with the 3' end of the third PCR is performed on the genomic DNA of the NG0001 strain using the sense oligonucleotides (SEQ ID NO: 70: 5 'CTTGGTTGAA CCCAGGAATG AAGCGGATGC ATCGG 3'), localized at the level of the g880c mutation, and antisense (SEQ ID NO 71: 5 'TGCTCAGGCC GGTTGCCACC TC 3 ') located in position 1882 of the nucleotide sequence of the SPT5 gene.

After assembly via the NEBuilder® protocol (New England Biolabs, Evry, France), the final product is amplified by PCR using the oligonucleotides sense (SEQ ID NO 64) and antisense (SEQ ID NO 71). This PCR product is verified by agarose gel electrophoresis and cleaned using the NucleoSpin ^® Gel Extraction Kit and PCR Clean-up (MACHEREY NAGEL GmbH, Hoerdt, France).

The NG0001 strain is transformed with this linear DNA according to the following protocol:

The strain is cultured in F2N medium (Kilian et al., 201 1) (5 mM NFUCI, 880 mM NaNOs, 36 mM NaH ₂ PO ₄ .H ₂ 0, 106mM Na ₂ SiO ₃ .9H ₂ O, FeCl ₃ . 6H ₂ 0 25.75 mM Na ₂ EDTA.2H ₂ 0 .8 21 mM CUS0 ₄ .5H ₂ 0 0.2 mM, Na ₂ Mo0 ₄ .2H ₂ 0 0.15 mM ZnS0 ₄ .7H ₂ 0 0.4 mM, COCl ₂ 6H ₂ 0 0.25 mM, MnCl ₂ .4H ₂ 0 4.5 mM thiamine HCl (Vit. B1) 148 mM biotin (vit. H) 10.25 nM, cyanocobalamin (vit B12) 1, 845 nM, HCl or NaOH and TrisHCl pH7.6 (10mM) up to the exponential phase of growth (approximately 2.10 ⁶ cells / ml) then washed four times in a solution of D-sorbitol (384 mM). The cell concentration is adjusted than 10 ¹⁰ cells / ml in D-sorbitol solution. 100 μl of the cell suspension is transformed in the hour by electroporation (Gene Pulser Bio-Rad, 2200 V, 50 μF and 500 Ohm, 2 mm cuvettes) with 0.1 to 1 μg of linear DNA. The cells are then immediately resuspended in 10 ml of F / 2 medium (Guillard and Ryther, 1962), NaN0 ₃ 880 μM, NaH ₂ PO ₄ .H ₂ 0 36 mM, Na ₂ SiO ₃ .9H ₂ 0 106mM, FeCl ₃ .6H ₂ O 5.15 μM, Na ₂ EDTA 2H ₂ 4.36 mM, CuSO ₄ .5H ₂ O 0.04 μM, Na ₂ MoO ₄ .2H ₂ O 0.03 mM, ZnSO ₄ . 7H ₂ 0 0.08 mM, COCl ₂ 6H ₂ 0 0.05 mM, MnCl ₂ .4H ₂ 0 0.9 mM thiamine HCl (Vit. B1) 29.6 mM biotin (vit. H) 2.05 nM, cyanocobalamin (vit B12) 0.369 nM, pH adjusted 8 with NaOH or HCl) and incubated in low light overnight. The next day, 5.10 ⁸ cells are spread on square petri dishes (500 cm ² ) on F / 2 agar medium containing 2 μg / ml of Zeocin (ant-zn, Invivogen).

The zeocin resistant colonies are then validated by genotyping on genomic DNA and sequencing after amplification of the SPT5 gene by PCR using the following oligonucleotides: SEQ ID NO. 72 (5 'CTTGCGAAGC AGAACTTCTG CTC 3'), SEQ ID NO. 73 ( 5 'CTTGTCGTAG CTGCCGACCT G 3'). Amplified PCR on genomic DNA a wild strain NG0001 is used as a control. One of these strains, having the point mutation g880c on the SPT5 gene, is conserved and referenced NG0002.

The oligonucleotides are synthesized and purified by Eurofins Genomics (HPSF or desalted in case of length less than 30 nucleotides). The PCR products are amplified with the enzyme Taq DNA Polymerase (RR002A, Takara).

Environments

The standard medium consisted of 35 g / L sea salt, trace metal mixture (0.0196 mg.L ¹ CuS0 ₄ ^* 5H ₂ 0, 0.0126 mg L ¹ NaMo0 ₄ ^* 2H ₂ 0, 0.044 mg.L ¹ ZnSO ₄ ^* 7H ₂ O, 0.01 mg.L ¹ CoCl ₂ and 0.36 mg.L ¹ MnCl ₂ ^* 4H ₂ O), vitamin mixture (2.5 μg L ¹ VB 12, 2 , 5 μg L ¹ biotin, and 0.5 μg L ¹ thiamine HCl) and 0.361 mM NaH ₂ PO ₄ . The nitrogen source consists of 15 mM NaNO ₃ for the growth phase (culture 1) and 8.8 mM for the culture phase under CO ₂ (culture 2). The medium is buffered at pH 7.8.

Culture in rectangular flasks

175 ml of standard medium with 15 mM NaNO 3 are inoculated with each of the strains at an OD730 _nm of 0.5 in rectangular flasks having 75 cm ² of cell culture surface. Culture 1 is maintained at 25 ° C. under LED light (ramps rising from 0 to a maximum intensity of 1200 pE and then decreasing from 1200 to 0 pE) for 14 hours and then 10 hours in the dark until a biomass is obtained. about 2 g / L.

550 ml of culture medium 2 is then inoculated with culture 1 to an OD730 _nm of 0.9 in rectangular flasks having 225 cm ² of cell culture surface. The flasks are subjected to a LED type of light (maximum intensity of 2000 pE) with a cycle mimicking that of a summer day in southern California (14 hours of light and 10 hours of night), with agitation (575 rpm) at 25 ° C. Cultures 2, lasting 10 days, are carried out under C0 ₂ enriched air (1% C0 ₂ ) at a flow rate of 300 ml / min. Each day, 30% of the culture volume (ie 165 mL) is removed and replaced by the same volume of fresh medium supplemented with 10 mL of distilled water (to compensate for evaporation).

Enzymatic test

In order to assay RuBisCO enzymatic activities, the microalgae culture 2 is first centrifuged for 10 minutes at 3000 g and at 4 ° C. The supernatant is then removed and the cell pellets are taken up in 500 μl of Tris-HCl buffer at pH 7.9. The cell suspension is then transferred to a 2 ml FastPrep tube (MP biomedicals, Lysing matrix Y, 6960-100) and the cells are then lysed at FastPrep 96 (MP biomedicals, 16010500) by two cycles of 30 seconds at 1800 revolutions per minute. The tubes are then centrifuged at 4 ° C. for 5 minutes at 13,000 rpm and 10 μg of total cellular lysate proteins (supernatant) are used for the determination of the enzymatic activity, in technical triplicate. The total protein concentration of the cell lysate is determined with the QuantiPro ™ BCA kit (Sigma, QPBCA-1 KT).

RuBisCO activity is determined using CO2 as carbonate (NaHCC> 3.50 mM) and Ribulose-1,5-bisphosphate (RuBP, 5 mM) as substrates in 50 mM Tris-HCl buffer pH 7. , 9 in the presence of DTT (2 mM), KCl (30 mM) and MgCh (10 mM). The reaction is stopped after 80 min by boiling (7 min at 95 ° C). The products of the enzymatic reaction and more particularly 3-phosphoglycerate (3-PG), 2-phosphoglycerate (2-PG) and phosphoenolpyruvate (PEP) are quantified by liquid chromatography coupled to a UHPLC ultimate 3000 RS mass spectrometer. MSQ plus (LC-MS) using a Spheri-5 RP-18 100x2.1mm, 5μm column (PerkinElmer, 071-10016) with a Newguard RP-18 precolumn, 15x3.2mm, 7μm (PerkinElmer, 071 1 - 0092). The temperature of the column is 35 ° C and the flow rate is set at 1 mL / min. The run is carried out with two mobile phases (10 mM of tributylamine in the D route and 100% of acetonitrile in the B route) according to the following gradient: 3 min 100% D route then 15 min 95% D route and 5% B route, 2 min 65% D-way and 35% B-way, 4 min 100% B-way and finally 2 min 100% D-way. A volume of 30 μL is injected for each sample. The identification of the compounds is based on their molecular weight and by comparison of retention times with standards. Quantification is performed using calibration curves of the appropriate standards. The activity of RuBisCO will therefore be expressed in nmol of products. min ¹ mg ¹ of total protein. The products are the sum of 3-phosphoglycerate (3-PG), 2-phosphoglycerate (2-PG) and phosphoenolpyruvate (PEP).

Result

The activity of RuBisCO expressed in the modified strain NG0002 is compared with the activity of RuBisCO expressed in strain NG0001. Strain NG0001 represents the reference RuBisCO activity without any other mutation in the genome.

Mutation of the endogenous SPT5 gene at position 294 of its protein sequence makes it possible to improve the activity of RuBisCO relative to a RuBisCO expressed in a microalgae strain without mutated SPT5 gene.

REFERENCES

WO 2013/123244, WO 2014/096391, WO 2014/129898, WO 2015/107496 and WO

2015/177800

Arvanitidis, A., Heinisch, J.J., 1994. Studies in the function of yeast phosphofructokinase subunits by in vitro mutagenesis. J. Biol. Chem. 269, 8911-8918.

Bi, C. et al. (2013) 'Development of a broad-host synthetic biology toolbox for ralstonia

eutropha and its application to hydrocarbon biofuel production ', Microbial Cell Factories, 12, pp. 1-10.

Blythe, AJ, Yazar-Klosinski, B., Webster, MW, Chen, E., Vandevenne, M., Bendak, K., Mackay, JP, Hartzog, GA, Vrielink, A., 2016. The Yeast Transcription Elongation Factor Spt4 / 5 is a sequence-specific RNA binding protein. Protein Sci. 25, 1710-1721. https://doi.Org/10.1002/pro.2976

Cong, L, Ran, FA, Cox, D., Lin, S., Barretto, R., Hsu, PD, Wu, X., Jiang, W., Marraffini, LA, 2013. Multiplex Genome Engineering Using CRISPR / VCas Systems. Science (80-.). 339, 819-823. https://doi.org/10.1 126 / science.1231 143.Multiplex

Daboussi, F., Zaslavskiy, M., Poirot, L., Loperfido, M., Gouble, A., Guyot, V., Leduc, S., Galetto, R., Grizot, S., Oficjalska, D., Perez, C., Delacote, F., Dupuy, A., Chion-Sotinel, I., Clerre, D., Lebuhotel, C., Danos, O., Lemaire, F., Oussedik, K., Cedrone, F., Epinat, JC, Smith, J., Yandez-Munoz, RJ, Dickson, G., Popplewell, L., Koo, T., Vandendriessche, T., Chuah, MK, Duclert, A., Duchateau, P. ., Easter, F., 2012.

Chromosomal context and epigenetic mechanisms control the efficacy of genome editing by rare-cutting designer endonucleases. Nucleic Acids Res. 40, 6367-6379. https://doi.Org/10.1093/nar/gks268

Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in

Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97, 6640-5. https://doi.Org/10.1073/pnas.120163297

Gueldener, U., 2002. A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in yeast budding. Nucleic Acids Res. 30, 23e-23.

https://doi.Org/10.1093/nar/30.6.e23

Guillard, R.R. and Ryther, J.H. (1962) 'Studies of marine planktonic diatoms. I. Cyclotella nana Hustedt, and Detonula confervacea (cleve) Gran., Canadian Journal of Microbiology, 8, pp. 229-39. Available at:

http://www.ncbi.nlm.nih.gov/pubmed/13902807 (Accessed: March 13, 2019).

Hegemann, J.H., Heick, S.B., 201 1. Delete and Repeat: A Comprehensive Toolkit for

Sequential Gene Knockout in the Budding Yeast Saccharomyces cerevisiae. Humana Press, pp. 189-206. https://doi.org/10.1007/978-1-61779-197-0_12

Heinisch, J., 1986. Isolation and characterization of the two structural genes coding for phosphofructokinase in yeast. Mol. Gen. Broom. 202, 75-82.

Kilian, O. et al. (2011) High-efficiency homologous recombination in the oil-producing alga Nannochloropsis sp., Proceedings of the National Academy of Sciences, 108 (52), pp. 21265-21269. doi: 10.1073 / pnas.1105861108.

Kim, Y.G., Cha, J., Chandrasegaran, S., 1996. Hybrid restriction enzymes: zinc finger

fusions to Fok I cleavage domain. Proc. Natl. Acad. Sci. 93, 1156-1 160.

https://doi.org/10.1073/pnas.93.3-1156

Lenz, O. et al. (1994) 'The Alcaligenes eutrophus H16 hoxX gene participates in

Hydrogenase regulation, Journal of Bacteriology. American Society for Microbiology Journals, 176 (14), pp. 4385-93. doi: 10.1128 / JB.176.14.4385-4393.1994.

Lenz, O. and Friedrich, B. (1998) 'A Novel Multicomponent Regulatory System H2 Media Sensing in Alcaligenes Eutrophus', Proceedings of the National Academy of Sciences, 95 (21), pp. 12474-12479. doi: 10.1073 / pnas.95.21.12474.

Lodish, H., Berk, A., Zipursky, S.L., Matsudaira, P., Baltimore, D., Darnell, J., 2000.

Recombination between Homologous DNA Sites.

Mali Prashant, E.K. and C.G., 2013. Cas9 as a versatile tool for engeneering biology. Nat Methods 10, 957-963. https://doi.org/10.1038/nmeth.2649.Cas9

Ousterout, D.G., Gersbach, C.A., Carolina, N., U., States, Biology, C., Carolina, N.,

Carolina, N., 2016. The Development of Tale Nucleases for Biotechnology, Methods in Molecular Biology. Springer New York, New York, NY. https://doi.org/10.1007/978-1- 4939-2932-0

Poliner, E. et al. (2018) 'A toolkit for Nannochloropsis oceanica CCMP1779 enables gene stacking and genetic engineering of the eicosapentaenoic acid pathway for enhanced long-chain polyunsaturated fatty acid production', Plant Biotechnology Journal, 16 (1), pp. 298-309. doi: 10.1 11 1 / pbi.12772.

Schmidt, MC, McCartney, RR, Zhang, X., Tillman, TS, Solimeo, H., Wolfl, S., Almonte, C., Watkins, SC, 1999. Std 1 and Mth1 Interact Proteins with Glucose Sensors to Control Glucose-Regulated Gene Expression in Saccharomyces cerevisiae. Mol. Cell. Biol. 19, 4561-4571. https://doi.org/10.1 128 / MCB.19-7.4561

Singh, A.K. et al. (2018) "Emerging Platforms for co-utilization of one-carbon substrates by photosynthetic organism" Current Opinion in Biotechnology, 53: 201-208

Thomas, K.R., Capecchi, M.R., 1987. Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells. Cell 51, 503-512. https://doi.org/10.1016/0092- 8674 (87) 90646-5

Yakhnin, A.V., Babitzke, P., 2015. NusG / Spt5: Are there Common Functions of this

Ubiquitous 68-71. https://doi.Org/10.1016/j.mib.2014.02.005.NusG/Spt5

Claims

1. Microorganism capable of expressing a functional RuBisCO selected from bacteria, yeasts, fungi and protists, characterized in that it is genetically modified to express a transcription elongation factor responsible for regulating the processivity of the organism. Mutated RNA polymerase to enhance the activity of said functional RuBisCO.

2. Microorganism according to claim 1, characterized in that the elongation factor of the mutated transcription is a mutated NusG / SPT5 protein.

3. Microorganism according to claim 2, characterized in that the mutation comprises the transposition (substitution) of at least one amino acid by another amino acid in the protein NusG / SPT5.

4. Microorganism according to claim 3, characterized in that the mutation is at the C-terminal end of the sheet b3 in the secondary structure elements common to NusG and the NGN domain of SPT5.

5. Microorganism according to claim 4, characterized in that the protein NusG / SPT5 comprises a mutation in a sequence corresponding to the consensus sequence of 9 amino acids shown in Figure 1.

6. Microorganism according to claim 5, characterized in that the mutation consists of a transposition of the seventh amino acid (either an Alanine or a Serine or a Methionine or an Isoleucine) of the consensus sequence into any other amino acid.

7. Microorganism according to claim 6, characterized in that the mutation consists of a transposition of the seventh amino acid of the consensus sequence (an Alanine or a Serine or a Methionine or an Isoleucine) in Proline.

8. Microorganism according to one of claims 5 to 7, characterized in that it comprises a gene encoding the protein SPT5 and the consensus sequence of 9 amino acids is defined by the consensus sequence: GRIYIEAPK (SEQ ID NO 1).

9. Microorganism according to one of claims 5 to 7, characterized in that it comprises a gene encoding the NusG protein and the consensus sequence of 9 amino acids is defined by the consensus sequence: GYVLVQMVM (SEQ ID NO 7).

10. Microorganism according to one of claims 1 to 9, characterized in that it expresses a native functional RuBisCO.

1 1. Microorganism according to one of Claims 1 to 9, characterized in that it does not express native functional RuBisCO and is also modified to express a set of heterologous genes necessary for the expression of a functional RuBisCO.

Microorganism capable of expressing a functional RuBisCO selected from bacteria, yeasts, fungi and protists, characterized in that it is genetically modified to express a mutated NusG / SPT5 protein by transposition (substitution) of at least one amino acid with another amino acid to enhance the activity of said functional RuBisCO, the mutation consisting of a transposition of the seventh amino acid of the 9 amino acid consensus sequence shown in Figure 1 in Proline.

13. Microorganism according to one of claims 1 to 7 or 12, characterized in that the mutation is a transposition of the seventh amino acid of the GRIYIEAPK consensus sequence (SEQ ID NO 1) of SPT5.

14. Microorganism according to claim 13, characterized in that it is selected from among yeasts, fungi and protists.

15. Microorganism according to claim 14, characterized in that it is selected from the yeasts of the genera Pichia, Kluyveromyces, Saccharomyces, Schizosaccharomyces, Candida, Lipomyces, Rhodotorula, Rhodosporidium, Yarrowia, and Debaryomyces.

16. Microorganism according to claim 14, characterized in that it is selected from Saccharomyces cerevisiae and Yarrowia lipolytica.

17. Microorganism according to claim 14, characterized in that it is selected from the fungi of the genera Aspergillus, Trichoderma, Neurospora, Podospora, Endothia, Mucor, Cochiobolus and Pyricularia.

18. Microorganism according to claim 17, characterized in that the fungus is Aspergillus niger.

19. Microorganism according to claim 14, characterized in that the protists are chosen from microalgae of the classes or superclasses of Chlorophyceae, Chrysophyceae, Prymnesiophyceae, Diatomaceous or Bacillariophyta, Euglenophyceae, Rhodophyceae, or Trebouxiophyceae.

20. Microorganism according to claim 19, characterized in that the microalgae is chosen from Nannochloropsis sp. and Phaeodactylum.

21. Microorganism according to Claim 20, characterized in that it is chosen from Nannochloropsis gaditana, Nannochloropsis oceanica and Phaeodactylum tricornutum.

22. Microorganism according to one of claims 1 to 7 or 12, characterized in that the mutation is a transposition of the seventh amino acid of the consensus sequence GYVLVQMVM (SEQ ID NO 7) of NusG.

23. Microorganism according to claim 22, characterized in that it is selected from bacteria.

24. Microorganism according to claim 23, characterized in that it is selected from the genera genus Acaryochloris, Acetobacter, Actinobacillus, Agrobacterium, Alicyclobacillus, Anabaena, Anacystis, Anaerobiospirillum, Aquifex, Arthrobacter, Arthrospira, Azobacter, Bacillus, Brevibacterium, Burkholderia, Chlorobium, Chromatium, Chlorobaculum, Clostridium, Corynebacterium, Cupriavidus, Cyanothece, Enterobacter, Deinococcus, Erwinia, Escherichia, Geobacter, Gloeobacter, Gluconobacter, Hydrogenobacter, Klebsiella, Lactobacillus, Lactococcus, Mannheimia, Mesorhizobium, Methylobacterium, Microbacterium, Microcystis, Nitrobacter, Nitrosomonas, Nitrospina, Nitrospira, Nostoc, Phormidium, Prochlorococcus, Pseudomonas, Ralstonia, Rhizobium, Rhodobacter, Rhodococcus, Rhodopseudomonas, Rhodospirillum, Salmonella, Scenedesmun, Serratia, Shigella, Staphylococcus, Streptomyces, Synechoccus, Synechocystis, Thermosynechococcus, Trichodesmium, or Zymomonas.

25. Microorganism according to claim 24, characterized in that it is selected from Escherichia coli, Bacillus subtilis, Corynebacterium glutamicum, Cupriavidus necator, Deinococcus radiodurans, Rhodococcus opacus, Synechocystis sp. PCC 6803 and Synechococcus elongatus.

26. A method of culturing a defined microorganism according to one of claims 1 to 25, characterized in that it comprises culturing the microorganism on a suitable culture medium in the presence of carbon dioxide as a carbon source.

27. The method of claim 26, characterized in that the culture medium also comprises a source of organic carbon.

28. Method according to one of claims 26 or 27, characterized in that it comprises a supply of energy.

29. Method according to one of claims 26 to 28, characterized in that it comprises a step of recovering the biomass from the fermentation medium.

30. Biomass obtained by the method according to one of claims 26 to 29.

31. Method according to one of claims 26 to 29, characterized in that it comprises a step of recovering metabolites of interest from the biomass and / or culture supernatant obtained.