EP3497206A1 - Infektiöse bronchitis (ib)-virus varianten und diesbezügliche zusammensetzungen, verwendungen und verfahren - Google Patents

Infektiöse bronchitis (ib)-virus varianten und diesbezügliche zusammensetzungen, verwendungen und verfahren

Info

Publication number
EP3497206A1
EP3497206A1 EP17755136.3A EP17755136A EP3497206A1 EP 3497206 A1 EP3497206 A1 EP 3497206A1 EP 17755136 A EP17755136 A EP 17755136A EP 3497206 A1 EP3497206 A1 EP 3497206A1
Authority
EP
European Patent Office
Prior art keywords
virus
nucleic acid
seq
amino acid
nos
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP17755136.3A
Other languages
English (en)
French (fr)
Inventor
Martin LIMAN
Theresa OLDOPP
Jennifer HANEKE
Wiebke BIELENBERG
Natalie VOGEL
Swaantje RÖNCHEN
Diana PETZOLDT
Klaus-Peter BEHR
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Anicon Labor GmbH
Original Assignee
Anicon Labor GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Anicon Labor GmbH filed Critical Anicon Labor GmbH
Publication of EP3497206A1 publication Critical patent/EP3497206A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1002—Coronaviridae
    • C07K16/1003—Severe acute respiratory syndrome coronavirus 2 [SARS‐CoV‐2 or Covid-19]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5254—Virus avirulent or attenuated
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • IB Infectious Bronchitis
  • the invention is directed to agents, compositions, uses and methods of a novel variant of the infectious bronchitis virus (IB virus).
  • IB virus infectious bronchitis virus
  • the new variant is also referred to here as "IB80”.
  • the invention provides the isolated infectious bronchitis virus variants, referred to as I B viruses, referred to in particular in the National Collection of Pathogenic Viruses (NCPV), Culture Collections, Public Health England, ( Porton Down, Salisbury, SP4 OJG, UK) on 16 June 2016 under accession number 16061601 and on 7 July 2016 under accession number 16070701 under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure.
  • NCPV National Collection of Pathogenic Viruses
  • IB Infectious bronchitis
  • IBV Infectious Bronchitis Virus
  • Viruses are infectious particles that spread as virions outside of cells (extracellularly) through transmission, but as viruses can only multiply within a suitable host cell (intracellularly). All viruses contain (propagate and propagate) genetic information, but lack the ability to replicate independently and have their own metabolism and therefore rely on the metabolism of a host cell, so virologists largely agree that viruses are not reckless with living things So far, about 3,000 types of viruses have been identified and viruses infect cells from eukaryotes (plants, fungi, animals, humans) and prokaryotes (bacteria and archaea).
  • the coronavirus is a member of the family Coronaviridae, which is a family within the order Nidovirales.
  • the Coronaviridae family is subdivided into two subfamilies based on phylogenetic characteristics and host range, and the genera alpha, beta and gamma (formerly groups 1, 2 and 3 of the ancient genus coronavirus) and deltacoronavirus, as well as torovirus and bafinovirus.
  • the coronavirus is the subfamily Coronavirinae, belonging to the genus gamma coronavirus assigned.
  • the species name according to ICTV is: Avian Coronavirus.
  • infectious bronchitis virus ie the causative agent of infectious bronchitis
  • this includes, for example, the former species turkey / turkey coronavirus (TCoV), pheasant coronavirus (PhCoV), duck coronavirus, geese coronavirus and Pigeon coronavirus.
  • ToV turkey / turkey coronavirus
  • PrCoV pheasant coronavirus
  • duck coronavirus geese coronavirus
  • geese coronavirus geese coronavirus
  • Pigeon coronavirus avirus with genome lengths.
  • RNA polymerase of other RNA viruses In contrast to the usually high error rate of the RNA polymerase of other RNA viruses, which leads to a restriction of the genome length to about 10,000 nucleotides, in coronaviruses a relatively high genetic stability, inter alia, by a 3'-5'-exoribonuclease function of the protein Nsp-14 reached.
  • the single-stranded RNA genome of the coronaviruses is about 27,600 to 31,000 nucleotides (nt) long, which coronaviruses have the longest genome of all known RNA viruses.
  • the 120 to 160 nm virions have a virus envelope in which 3 or 4 different membrane proteins are embedded:
  • the large, glycosylated S protein (180 to 220 kDa) forms as a trimer with its club-shaped, about 20 nm outwardly projecting spikes (Peplomere) the characteristic, coronal appearance of the coronaviruses (lat. Corona: wreath, crown).
  • a second membrane protein E (9 to 12 kDa) is present.
  • the human coronavirus OC43 and the coronaviruses of group 2 additionally contain the HE protein (hemagglutin esterase protein, 65 kDa).
  • the M-protein (23 to 35 kDa), which is also anchored in the sheath, faces inwards and covers the inside of the virus envelope (matrix protein). Inside is a helical nucleoprotein complex. This consists of the nucleoprotein N (50 to 60 kDa), which is complexed with a strand of single-stranded RNA of positive polarity. Certain outward-protruding amino acid residues of the N protein interact with the matrix protein M such that the capsid is associated with the membrane interior.
  • coronaviridae virus family cause very different diseases in various vertebrates such as mammals, rodents, fish and birds.
  • Coronaviruses are genetically highly variable and individual virus species can also infect several host species by overrunning the species barrier.
  • the entry portals of the virus are mainly the lid conjunctiva and mucous membranes of the upper digestive tract and the respiratory system.
  • the transmission is mainly as a droplet infection, with dust particles and droplets loaded with viruses can travel long distances.
  • the virus colonizes the ciliary epithelium of the respiratory tract, but also the reproductive tract and the kidneys can be affected.
  • IB Infectious bronchitis
  • False-tube infections later lead to laying disorders such as pale, thin-skinned or deformed eggs, diaper eggs, markedly reduced or completely missing laying activity ("false larks”) and reduced hatching rate.
  • the duration of the disease and the clinical symptoms can vary.Furthermore, the disease is complicated by secondary bacterial infections Some virus strains may be followed by a kidney infection, which can lead to high mortality from kidney failure or toxemia (toxinemia) .
  • toxemia toxinemia
  • the clinical manifestations allow a presumptive diagnosis and the diagnosis can be made by pathological examination of dead birds as well as by molecular biological, serological and virological detection methods In terms of genetic diagnosis, all respiratory diseases or pathogens which impair the genitourinary tract may be considered.
  • Viral infections such as infectious laryngotracheitis, Newcastle disease and egg drop syndrome, as well as bacterial infections such as mycoplasmosis or infectious chicken cold, as well as non-infectious diseases (eg feeding errors, management errors) should be differentiated.
  • Treatment of infectious bronchitis is possibly symptomatic possible. Therefore, the control is based primarily on the prophylactic vaccine, which can take place immediately after hatching of the broiler or during the first few weeks of life of the animals.
  • the vaccination in endangered areas should be repeated in the vaccination program at regular intervals in accordance with the instructions of the vaccine manufacturer, possibly also with the use of different vaccine variants.
  • Infectious bronchitis is an acute and highly contagious disease of the respiratory tract of chickens, as explained earlier.
  • the disease is caused by the infectious bronchitis virus (IBV), a coronavirus, and is characterized by respiratory and genitourinary symptoms including wheezing, sneezing, tracheal rattling and nasal discharge.
  • IBV infectious bronchitis virus
  • respiratory and genitourinary symptoms including wheezing, sneezing, tracheal rattling and nasal discharge.
  • severe respiratory distress and nephritis can occur.
  • In laying hens can. Shortness of breath, (significant) decline in egg production and loss of egg quality in the interior (watery egg white) and externalities (pale eggs (brownlegs), thin-shelled eggs, soft, deformed, rough shells, missing shells (wind eggs)).
  • IBV infectious bronchitis virus
  • Coronaviruses contain the largest known viral RNA genome by number of nucleotides, at approximately 30,000 bases. The RNA forms a single strand and a single segment.
  • IBV diversity is based on an error of transcription that is of high relevance when it occurs in genomic sequences that code for proteins involved in targeting or inducing immune responses. Due to transcriptional errors, variants may occur which have an evolutionary advantage in disease-susceptible chickens for this variant. Very large genomic changes can take place, e.g. with complete gene replacement, by reassortment in replication, generating multiple subgenomic mRNAs and allowing reassortment in coinfections, thus summarizing the current IBV problem as follows:
  • IBV Infectious Bronchitis Virus
  • IBV Infectious Bronchitis Virus
  • the virus has a broad spectrum of antigenically and genetically different types of virus, which means prevention and control of this disease. makes gers extremely complex.
  • the I B virus is mainly found in chicken.
  • the I B virus or IBV-like and other avian coronaviruses can be found in pets and wildlife, including domestic poultry. Partridges. Geese, pigeons, guinea fowls. Teals.
  • the IBV is a single-stranded, positive-oriented RNA virus of the family Coronaviridae, genus Gammacoronavirus (Cavanagh and Naqi, 2003, International Committee on Taxonomy of Viruses, http://www.ictvonline.org/virustaxonomy.asp).
  • the viral genome contains two untranslated regions (UTRs) at the 5 'and 3' ends (Boursnell et al., 1987; Ziebuhr et al., 2000). two overlapping open reading frames (ORFs).
  • the S protein (-3462 nt) located in the surface of the viral membrane is the most important trigger for neutralizing antibodies (Cavanagh and Naqi, 1997, Winter et al., 2008) and is useful for viral binding and invasion into the virus Host cells (Cavanagh et al, 1986a, Koch et al, 1990, Niesters et al, 1987). It is cleaved post-translationally at a cleavage site with multiple basic amino acids (Cavanagh et al., 1986b) into the amino-terminal S1 (-535 amino acids) and the carboxyl-terminal S2 subunit (-627 amino acids).
  • IB serotypes can differ by 20% to 25% at the genomic level and in up to 50% of the amino acids of the S1 protein (Cavanagh et al., 2005) has received considerable attention (Cavanagh and Gelb 2008). guided. Such variability can lead to important biological differences between strains, and as a result of a limited number of amino acid changes in the spike protein, novel serotype variants can arise. Nucleotide heterogeneity is widespread in the S1 part of the S gene and is largely within three different hypervariable regions (HVRS) of the S1 gene (aa 38-67, 91-141 and 274-387) (Cavanagh et al., 1988; most commonly Moore et al., 1997).
  • HVRS hypervariable regions
  • genotype, serotype or protector type-based approaches do not always classify IB viruses in the same way.
  • analyzes of S1 sequence data are the most commonly used methods for assigning IBV strains to groups that appear to have been arbitrarily subdivided into genetic types, genotypes, cladding, or clusters.
  • the infectious bronchitis virus is the cause of a highly contagious disease in the global poultry industry, causing serious economic losses.
  • the virus exists in a variety of genetically different virus types. Both phylogenetic analysis and pairwise similarity measurements between nucleotide or amino acid sequences were used to classify IBV strains. Until recently, however, there was no consensus about the method by which to compare IBV sequences. Heterogeneous designations of genetic groups that are incompatible with phylogenetic history have been adopted, leading to confusing coexistence of several systems of genotyping. However, the acceptance of an internationally recognized viral nomenclature is crucial to conducting well-founded studies and to gaining and evaluating new insights into the epidemiology and evolution of IBV.
  • Valastro et al. a published in 2016 (Valastro V., Holmes EC, Britton P., Fusaro A., Jackwood MW, Cattoli G., Monne I., S1 gene-based phylogeny of infectious bronchitis virus: An attampt to harmonize virus classification , Infection, Genetics and Evolution, 39 (2016), 349-364), a new classification scheme based on phylogenetic relationships (based on the S1 gene) that can be updated and revised as new S1 sequences become available. Valastro et al.
  • UV Unique Variant
  • the object of the invention is to provide Bases for the detection, control or prophylactic strategy provide, in particular, the here disclosed new IBV variant (IB80) should be affected as a pathogen.
  • the present invention thus aims at a significant advance in solving the particular problems posed by the IB80 virus in poultry keeping, with the aim of providing faster, more reliable and effective means of controlling, particularly the diagnosis, prevention and / or treatment of infectious agents To provide bronchitis in birds.
  • the object on which the invention is based is achieved by providing the agent specified in the claims, such as the IB virus according to the invention (IB80), the nucleic acid according to the invention, the protein according to the invention, the novel protein Vector, antibody, vaccine, the use specified in the claims of the invention IB virus and the pharmaceutical mixture according to the invention.
  • the agent specified in the claims such as the IB virus according to the invention (IB80), the nucleic acid according to the invention, the protein according to the invention, the novel protein Vector, antibody, vaccine, the use specified in the claims of the invention IB virus and the pharmaceutical mixture according to the invention.
  • novel agents, uses, mixtures and methods of the invention described herein are directed to a novel variant IB80 and its closest relative, the agents, uses, mixtures and methods of the invention being useful for the diagnosis and prevention of IB80 virus infections ; including the associated development of in vitro diagnostics, vaccines and the prevention of infectious bronchitis, and associated symptoms or clinical pictures, as further explained below.
  • the present invention is based on the isolation and identification of a novel IB virus (IB80) in birds, especially chickens.
  • IB80 This IB virus (including variants of the invention) is also referred to herein as "IB80.”
  • IB80 was isolated from the material obtained from a monitoring study of a clinically normal chicken flock at that time, and a pool of cecal tonsils was used for culture Organ material was homogenized in 1xPBS including gentamycin and amphotericin B at room temperature, then centrifuged and the supernatant filtered with a 0.45 ⁇ filter, followed by incubation of the filtrate at room temperature, appropriate methods and conditions to be used to isolate virus material are known to the person skilled in the art.
  • the isolated virus is a member of the family Coronaviridae, a family of RNA viruses with the largest known genomes. Accordingly, the invention relates to the isolated IB virus which belongs morphologically and phylogenetically to known members of the subfamily Coronavirinae and, therein, of the genus Gamma coronavirus, the species Avian coronavirus.
  • infectious bronchitis IB is a viral disease of birds, which mainly affects domestic chicken and pheasant, and the causative agent is Infectious Bronchitis Virus (IBV), a coronavirus.
  • the invention relates to a birds and, in particular, chickens-related, isolated IB virus as described and defined herein.
  • the invention herein relates to an isolated IB virus, corresponding to accession number 16061601 (June 16, 2016) or accession number 16070701 (July 7, 2016), which deposits, as noted above under "Filing Declaration", in the National Collection of Pathogenic Viruses (NCPV), Culture Collections, Public Health England, (Porton Down, Salisbury, SP4 0JG, UK)
  • NCPV National Collection of Pathogenic Viruses
  • the invention relates to an isolated IB virus comprising a) one or more nucleic acid segments selected from the group consisting from nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9,
  • one or more proteins comprising or consisting of an amino acid chain selected from the group of the amino acid sequences SEQ ID NOs: 1 1, 12, 13, 14, 15, 16, 17, 18, 19 and 20,
  • nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7 , 8, 9 or 10 and / or
  • one or more proteins comprising or consisting of an amino acid chain with an identity of> 85% to the amino acid sequence SEQ ID NO: 13 or to a
  • Amino acid sequence selected from the group of amino acid sequences with a Identity of> 98% to one of the amino acid sequences SEQ ID NOs: 1 1, 12, 14, 15, 16, 17, 18, 19 or 20.
  • the invention also relates to an isolated IB virus comprising under d) preferably a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 90%, more preferably> 95%, even more preferably> 98% and all particularly preferably> 99%, to SEQ ID NO: 3; and / or preferably a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 99% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7, 8, 9 or 10.
  • the Invention also an isolated IB virus comprising e) preferably one or more proteins, comprising or consisting of an amino acid chain with an identity of> 90%, more preferably of> 95%, even more preferably of> 98% and most preferably of > 99%, to the amino acid sequence SEQ ID NO: 13; and / or preferably to an amino acid sequence selected from the group of amino acid sequences with an identity of> 99% to one of the amino acid sequences SEQ ID NOs: 1 1, 12, 14, 15, 16, 17, 18, 19 or 20.
  • An isolated IB virus (IB80) according to the invention as defined above may in one embodiment of the invention be dead or attenuated (attenuated) or vital.
  • the invention relates to the complete genomic sequence of the isolated IB virus according to the invention, birds and in particular chickens.
  • the invention also relates to nucleic acid molecules isolated from the IB virus according to the invention, as defined above, or fragments thereof.
  • the invention also relates, as indicated above, to proteins or polypeptides isolated from the IB virus according to the invention, as defined above and / or encoded by a nucleic acid as defined above, including viral proteins isolated from cells which are immunogenic are infected with the IB virus but are not present in comparable uninfected cells; or fragments thereof.
  • the invention relates to a vector comprising a nucleic acid segment as defined above. Furthermore, in one aspect, the invention relates to an isolated antibody or isolated antigen-binding fragment thereof which immunospecifically binds to a virus, protein or nucleic acid as defined above.
  • the invention further relates in one aspect to a vaccine comprising a therapeutically and / or prophylactically effective amount of an IB virus, as defined above, or a therapeutically and / or prophylactically effective amount of one or more nucleic acids, as defined above and / or one or more proteins, as defined above, and a pharmaceutically acceptable carrier.
  • a vaccine, also called vaccination, is the administration of a vaccine to protect against a (communicable) disease is used to activate the immune system against specific substances, for example vaccines have been developed as a preventive measure against infectious diseases
  • a preventive vaccine against an infectious disease is based on a specific, active immunization against the pathogen and is therefore sometimes called an active vaccine
  • the aim of active vaccination is to enable the body's own immune system to respond to infection with the pathogen so rapidly and effectively that it results in no or only a weakened infectious disease.
  • Attenuated vaccines live vaccines, attenuated vaccines
  • inactivated vaccines dead vaccines
  • toxoid vaccines toxoid vaccines
  • passive vaccination also known as immunization
  • the vaccine has been given orally (mouth, "oral”) or nasal (nasal), also transdermally with dermal patches, and most of the active vaccines are administered intramuscularly
  • mouth, "oral” or nasal
  • nasal also transdermally with dermal patches
  • active vaccines are administered intramuscularly
  • eye drops eye drops
  • the active vaccine corresponds to the vaccine in the medical sense and is based on an active immunization. In doing so, the immune system is stimulated to produce pathogen-specific immunocompetence without having to go through the infectious disease itself.
  • the live vaccine contains attenuated, still reproducible pathogens that do not trigger the disease in immunocompetent vaccine. In a dead vaccine, however, these pathogens were killed; or there are only fragments of the pathogen.
  • Upon ingress of the vaccine into the body its proteins and / or sugar molecules are recognized as foreign body antigens by circulating and / or viable immune-competent white blood cells.
  • the primary immune response through pathogen-specific imprinting of immunocompetent lymphocytes in the form of long-lived memory cells.
  • Critical to the protection of a later infection is that for the body, the antigens of the vaccine are largely similar to those of the infectious disease agent. If the infection occurs, the memory cells on the invaded pathogen recognize the antigens of the former vaccine and cause lymphocytes to differentiate into short-lived plasma cells that produce antibodies, on the other hand to T lymphocytes and NK cells, which represent the cellular defense.
  • the vaccine should thus cause the persistence of immunity against the pathogen, so that it does not come to infection after infection due to specific and rapidly induced immune response to infectious disease.
  • Toxoid vaccines containing only the biologically inactive component (toxoid) of the toxin of a pathogen are also among the dead vaccines. They do not diminish the multiplication of the pathogens in the body. In case of an infection, they do not interrupt these, but prevent the outbreak of the clinical disease in the vaccine in so far that here the toxins of the pathogens are not effective.
  • Different live vaccines can be administered either simultaneously or at intervals of a few weeks. For dead vaccines, also in combination with live vaccines, the same applies. The applications should always follow the manufacturer's instructions.
  • a passive vaccination is indicated if there is a risk of suffering a serious infectious disease through contact with the pathogen, but the affected person's immune system is not affected by a prior vaccination or by an earlier (possibly also symptomless, "silent fever") infection
  • the affected person is injected with an immune serum that contains high concentrations of antibodies against the pathogen, since the immune system in this case does not actively produce its own antibodies, but rather it does so to the body of
  • This is preferably a passive immunization of the vaccine using preferably monoclonal antibodies produced by genetic engineering on cell cultures or, if these are not available, extracts from the blood of subjects who have already undergone the infectious disease in question , or out the blood of animals that were specifically infected with the pathogen (convalescent serum).
  • the advantage of immune serums is the faster onset of protection: the antibodies do not have to be formed within one to two weeks, but are available immediately after the injection of the immune serum for infection control.
  • the disadvantage is that the protection only lasts for a few weeks. Thereafter, the administered antibodies are degraded by the recipient and his organism is threatened by repeated infection with the same pathogen again. This is due to the fact that the immune system is not stimulated by the administration of immune serum, via memory cells to form their own immune memory with respect to the pathogens. If the immune serum is derived from animal or human, comes as a further disadvantage that it may contain traces of foreign protein or polysaccharides of the donor apart from the desired antibodies.
  • the recipient's immune system then initiates a cascade of immunological reactions against these alien components.
  • the antibodies enriched in the vaccine serum are excreted more quickly and thus remain effective shorter than desired.
  • repeated administration of external serum of the same species may result in an unwanted allergic reaction of the recipient in the form of a serum sickness or an allergic shock. Therefore, if possible, such immune sera are replaced by monoclonal antibodies.
  • the invention relates to a use of an IB virus (IB80) according to the invention, as defined above, or one or more nucleic acids, as defined above, and / or one or more proteins, such as those above are defined for the preparation of a vaccine for the prevention of a virus, as defined above, symptoms or diseases.
  • IB virus IB80
  • Symptoms or clinical pictures of the disease resulting from IBV infection affect the portal of entry or replication sites of the virus, in particular the connective tissue of the upper digestive and respiratory tract, as well as the ciliary epithelium of the respiratory tract, the reproductive tract and the kidneys.
  • respiratory distress, nasal discharge, wheezing respiratory sounds, sneezing and conjunctivitis should be mentioned.
  • the symptoms of the disease include general disorders with no appetite, decrease in water intake, oviduct infections, laying disorders such as pale, thin-shelled, deformed eggs, wind eggs, significantly reduced or completely missing laying activity (“false Leger”) and reduced hatching rate Kidney failure or resulting toxemia (toxemia) lead to the death of the affected animals, whereas a superficial serious respiratory problem, a tracheal occlusion may be due to the accumulation of mucus and other inflammatory products deaths.
  • the invention also relates to a use of an IB virus, as defined above, or one or more nucleic acids, as defined above, and / or one or more proteins, as defined above, for the production monoclonal or polyclonal antibody.
  • the invention also relates to a pharmaceutical mixture comprising a therapeutically and / or prophylactically effective amount of an antibody or an isolated antigen-binding fragment thereof for the therapeutic or prophylactic treatment of symptoms or diseases caused by a virus, as defined herein. Further aspects relating to the invention will be explained below in order to further illustrate the scope and meaning of the present invention.
  • the invention relates to the use of the isolated IB80 for diagnostic and therapeutic procedures.
  • the invention provides a method of detecting an antibody in a biological sample that is immunospecific for the genus gamma coronavirus, and the species Avian coronavirus, in particular for infectious bronchitis virus (IBV), and more particularly variant IB80, is, of the invention described herein at least one isolated IB virus according to the invention or one of the proteins or polypeptides according to the invention as described herein are used.
  • the invention provides a method for screening for an antibody that immunospecifically binds and neutralizes the infectious bronchitis virus (IB80) variant.
  • an antibody is useful for passive immunization or immunotherapy of an IB80 infected subject.
  • the invention provides isolated antibodies or antigen-binding fragments thereof, which immunospecifically bind to the above-described Infectious Bronchitis Virus (IB80) of the invention.
  • IB80 Infectious Bronchitis Virus
  • the invention relates to methods of detecting the presence, activity or expression of IB80, or fragments thereof, in a biological material such as cells, blood, saliva, urine, feces, etc.
  • the invention relates to a method of detecting the infectious bronchitis virus (IB80) of the present invention to detect its presence in a biological sample, the method comprising: (a) contacting the sample with an agent that selectively targets an infectious agent Bronchitis virus (IB80) binds; and (b) detecting if the agent binds to the infectious bronchitis virus (IB80) in the sample.
  • the invention relates to a method for determining the presence of the polypeptide of the invention in a biological sample, the method comprising: (a) contacting the biological sample with an agent that selectively binds to the polypeptide; and (b) detecting if the agent binds to the polypeptide in the sample.
  • the invention relates to a method for detecting the presence of a nucleic acid molecule derived from the IB80 of the invention in a biological sample, the method comprising: (a) contacting the biological sample with an agent that selectively binds to the nucleic acid binds; and (b) detecting if the agent binds to a nucleic acid in the sample.
  • the invention relates to a method for propagating the infectious bronchitis virus (IB80) according to the invention in host cells, cell lines and / or egg systems, for example hatching eggs, comprising infecting the host cells, cell lines and / or egg systems, for example hatching eggs, with the infectious agent isolated according to the invention lethal bronchitis virus (IB80), culturing the host cells, cell lines and / or egg systems, such as hatching eggs, to allow the virus to replicate and harvesting the resulting virions.
  • the present invention therefore also relates to the infectious bronchitis virus (IB80) infected host cells, cell lines and / or egg systems, for example hatching eggs.
  • infectious bronchitis virus (IB80) according to the invention is the deposit in NCPV in which infectious virus according to the invention (IB80) was deposited.
  • Host cells or suitable cell lines are generally available via cell banks, egg systems such as hatching eggs via the respective producers.
  • the invention relates to a method for detecting the presence of an antibody that immunologically binds IB80 in a biological sample, the method comprising: (a) contacting the biological sample with the host cell of the invention; and (b) detecting the antibody bound to the host cell.
  • the invention relates to vaccine preparations comprising the infectious bronchitis virus (IB80) of the invention, including recombinant and chimeric forms of the virus, the nucleic acid molecules comprised by the virus, or protein subunits of the virus.
  • the invention also relates to a vaccine formulation comprising a therapeutically or prophylactically effective amount of the Infectious Bronchitis Virus (IB80) of the invention, and a pharmaceutically acceptable carrier.
  • the invention relates to a vaccine formulation comprising a therapeutically or prophylactically effective amount of a protein extract of the Infectious Bronchitis Virus (IBV) of the invention or a subunit thereof and a pharmaceutically acceptable carrier.
  • the invention features a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7 , 8, 9 or 10; or a complement thereof, and a pharmaceutically acceptable carrier.
  • a nucleic acid molecule comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a
  • the invention features a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising any of the nucleic acid sequences of the invention or a complement thereof, and a pharmaceutically acceptable carrier.
  • the invention relates to an immunogenic formulation comprising an immunogenically effective amount of the Infectious Bronchitis Virus (IB80) of the invention and a pharmaceutically acceptable carrier.
  • the invention features an immunogenic formulation comprising an immunogenically effective amount of a protein extract of the Infectious Bronchitis Virus of the invention (IB80), or a subunit thereof, and a pharmaceutically acceptable carrier.
  • the invention features an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7 , 8, 9 or 10; or a complement thereof, and a pharmaceutically acceptable carrier.
  • the invention features an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule containing one of the other nucleic acid sequences of the invention or a complement thereof, and a pharmaceutically acceptable carrier.
  • the invention features an immunogenic formulation comprising an immunogenically effective amount of one of the polypeptides of the invention.
  • the present invention relates to pharmaceutical compositions comprising antiviral agents of the present invention and a pharmaceutically acceptable carrier.
  • the antiviral agent of the invention is an antibody that immunospecifically binds Infectious Bronchitis Virus (IB80).
  • the antiviral agent is a polypeptide or protein of the present invention or a nucleic acid molecule of the present invention.
  • the invention relates to a pharmaceutical composition comprising a prophylactically or therapeutically effective amount of an anti-infective bronchitis virus (IB80) agent and a pharmaceutically acceptable carrier.
  • kits containing compositions and formulations of the present invention relate to kits containing compositions and formulations of the present invention.
  • the invention relates to a kit comprising a container containing the immunogenic formulation of the invention.
  • the invention relates to a kit comprising a container containing the vaccine formulation of the invention.
  • the invention relates to a kit comprising a container containing the pharmaceutical composition of the invention.
  • the invention relates to a kit comprising a container containing the vaccine formulation of the invention.
  • the invention in another aspect, relates to a method of identifying a subject infected with the Infectious Bronchitis Virus (IB80) of the invention comprising: (a) recovering the total RNA from a biological sample obtained from the subject; (b) reverse transcription of total RNA to obtain cDNA; and (c) amplifying the cDNA using a set of primers derived from a nucleic acid sequence of the Infectious Bronchitis Virus (IB80) of the invention.
  • the invention furthermore relates to the use of the sequence information of the isolated infectious bronchitis virus (IB80) according to the invention for diagnostic and therapeutic methods.
  • IB80 isolated infectious bronchitis virus
  • the present invention relates to methods for the screening of antiviral agents that inhibit the infectious ability or replication of infectious bronchitis virus (IB80) or other variants thereof.
  • the invention further relates to methods for the production of recombinant or chimeric forms of infectious bronchitis virus (IB80).
  • the present invention is not limited to particular embodiments described, as it will be understood that they may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. Due to the sequence divergence of IB80 relative to all previously detected avian viruses, the present invention finds utility in the design of diagnostic assays to monitor IB80 disease in animal subjects, particularly birds, and to develop potent antivirals and vaccines , The IB virus of the present invention (IB80) is genetically> 20% different in the S1 gene from all other known IB viruses.
  • an antibody or an (antigen binding) fragment of an antibody that immunospecifically binds to a polypeptide of the invention refers to an antibody or fragment thereof that is immunospecifically attached to a virus of the invention, a protein of the invention, or to the (IBV) nucleotide sequence comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7 , 8, 9 or 10; coded polypeptide binds.
  • proteins according to the invention herein associated with the term "antibody” or "(antigen-binding) fragment of an antibody” comprise one or more proteins, comprising or consisting of an amino acid chain selected from the group of the amino acid sequences SEQ ID NOs: 11, 12 , 13, 14, 15, 16, 17, 18, 19 and 20, or one or more proteins comprising or consisting of an amino acid chain having an identity of> 85% to the amino acid sequence SEQ ID NO: 13 or to an amino acid sequence selected from Group of amino acid sequences with an identity of> 98% to one of the amino acid sequences SEQ ID NOs: 1 1, 12, 14, 15, 16, 17, 18, 19 or 20.
  • an antibody or fragment thereof immunospecifically binding to the polypeptide of the invention may cross-react with other antigens ilik or a fragment thereof, the immunospecifically binds to a polypeptide of the invention, not with other antigens.
  • An antibody or fragment thereof immunospecifically binding to the polypeptide of the invention can be identified, for example, by immunoassays or other methods known to those skilled in the art or otherwise as described herein.
  • immunospecific or the term “immunospecificity” is a term familiar to a person skilled in the art and frequently used in connection with antibodies or antigens.
  • immunospecific or “immunospecificity” generally describes the ability of a substance or compound, including nucleic acids, peptides, polypeptides, fragments thereof, to specifically react with an antibody molecule directed against it for antibody-antigen binding. This binding can be detected by immunological methods.
  • the terms mentioned are thus associated with the specific immune response which takes place after contact with, for example, an antigen-related immunological reaction of an affected subject;
  • the immune response optionally also includes, for example, the formation of specific T lymphocytes with said substance or compound, including nucleic acids, peptides, polypeptides, fragments thereof, or T lymphocytes specifically reactive with the antigen in an animal subject.
  • the presence of an immunospecific binding is tested in an experiment as described in Example 5.
  • an “isolated” or “purified” peptide or protein is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived or substantially free of chemical precursors or other chemicals when chemically synthesized
  • the term “substantially free of cellular material” includes preparations of a polypeptide / protein in which the polypeptide / protein is separate from cellular components of the cells from which it is isolated or recombinantly produced.
  • a polypeptide / protein that is substantially free of cellular material includes preparations of the polypeptide / protein that are contaminating with less than about 30%, 20%, 10%, 5%, 2.5%, and 1% (dry weight), respectively Protein.
  • the polypeptide / protein when it is recombinantly produced, it is also substantially free of culture medium, ie, the culture medium constitutes less than about 20%, 10% or 5% of the volume of the protein preparation.
  • the culture medium constitutes less than about 20%, 10% or 5% of the volume of the protein preparation.
  • a polypeptide / protein when produced by chemical synthesis, it is substantially free of chemical precursors or other chemicals, ie it is separated from chemical precursors or other chemicals involved in the synthesis of the protein. Accordingly, such preparations less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or other compounds than the polypeptide / protein fragment of interest.
  • the polypeptides / proteins are isolated or purified.
  • isolated refers to a particular biological or synthetic material separated from its natural or synthetic environment, in particular a virus, a viral component, a nucleic acid, RNA, DNA, cDNA, fragments thereof, nucleic acid segments, a protein, a Amino acid sequence, fragments thereof, an antibody or an antigen-binding fragment thereof, and the like materials, said particular material preferably being substantially free of other concomitant materials of any nature, for example, accompanying nucleic acids, proteins, lipids, carbohydrates, or other materials which the particular isolated material may be generally associated under natural or synthetic conditions, for example by association with another cellular material, culture medium or in a synthesis medium.
  • an "isolated" nucleic acid molecule or fragment thereof or a nucleic acid segment is thus, for example, each one or one that is separated and purified from other nucleic acid molecules present in the natural source of the nucleic acid molecule.
  • an "isolated" nucleic acid molecule such as an RNA molecule or cDNA molecule, may be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or others Chemicals when chemically synthesized.
  • the nucleic acid molecules encoding polypeptides / proteins of the invention are isolated or purified.
  • isolated nucleic acid molecule does not include nucleic acid and the like that is a member of a library but has not been separated and purified from the other nucleic acid molecules contained in the library.
  • fragment as used herein includes the indicated fragment lengths and all integers therebetween, including the endpoints specified in a specified range, and including any length to full length of a protein, polypeptide or nucleic acid .
  • having a biological activity of the protein or “having biological activities of the polypeptides of the invention” refers to the properties of the polypeptides or proteins which have a common biological activity, similar or identical structural domain, and / or sufficient amino acid identity to which A nucleotide sequence comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid
  • proteins of the invention herein associated with the term "with a biological activity of the protein” or "with biological activities of the polypeptides of the invention” comprise one or more proteins comprising or consisting of an amino acid chain selected from the group of the amino acid sequences SEQ ID NOs: 1 1, 12, 13, 14, 15, 16, 17, 18, 19 and 20; or one or more proteins, comprising or consisting of an amino acid chain with an identity of> 85% to the amino acid sequence SEQ ID NO: 13 or to an amino acid sequence selected from the group of amino acid sequences with an identity of> 98% to one of the amino acid sequences SEQ ID NOs : 1 1, 12, 14, 15, 16, 17, 18, 19 or 20.
  • the above-mentioned preferred% -dentities apply here as well to the above SEQ ID NOs.
  • Such common biological activities of the polypeptides of the invention include antigenicity and immunogenicity.
  • under stringent conditions refers to hybridization and washing conditions in which nucleotide sequences having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity with each other remain hybridized to each other .
  • hybridization conditions are described, for example but not limited to, in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6; Basic Methods in Molecular Biology, Elsevier Science Publishing Co., Inc., New York (1986), pp. 75-78 and 84-87. and Molecular Cloning, Cold Spring Harbor Laboratory, NY (1982), pp. 387-389, and are well known to those skilled in the art.
  • a preferred, non-limiting example of stringent hybridization conditions is hybridization in 6x sodium chloride / sodium citrate (SSC), 0.5% SDS at about 68 ° C, followed by one or more washes in 2x SSC, 0.5% SDS room temperature.
  • SSC sodium chloride / sodium citrate
  • Another preferred, non-limiting example of stringent hybridization studies The hybridization in 6 x SSC at about 45 ° C is followed by one or more washes in 0.2 SSC, 0.1% SDS at about 50-65 ° C.
  • variant refers to either a naturally occurring genetic mutant of IB80 or a recombinantly produced variation of this IBV variant, each of which has one or more mutations in its genome compared to IBV, which is a or a plurality of nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7 , 8, 9 or 10.
  • variant may also refer to either a naturally occurring variant of a given peptide or a recombinantly produced variation of a given peptide or protein in which one or more amino acid residues have been modified by amino acid substitution, addition or deletion.
  • homology refers to sequence similarity or, alternatively, sequence identity between two or more polynucleotide sequences, or two or more polypeptide sequences.
  • percent identity and % -ldentity as applied to polynucleotide sequences refer to the percentage of identical nucleotide matches between at least two polynucleotide sequences aligned using a standard algorithm can, in a standardized and reproducible manner, insert gaps into the compared sequences to optimize the alignment between two sequences and thus achieve a more meaningful comparison of the two sequences.
  • the percent identity between polynucleotide sequences may be determined using one or more computer algorithms or programs known in the art or described herein. For example, the percent identity may be determined using the default parameters (default parameter) of the CLUSTAL V algorithm as incorporated in version 3.12e of the MEGALIGN Sequence Alignment program LASERGENE software packages, a set of molecular biological analysis programs (DNASTAR, Madison, Wis.). CLUSTAL V is described in Higgins, DG and PM Sharp (1989; CABIOS 5: 151-153) and in Higgins, DG et al. (1992, CABIOS 8: 189-191).
  • the Clustal W algorithm is a widely used alignment program that is suitable for alignments of more than two sequences (multi-sequence alignment).
  • the Clustal W program uses a progressive alignment using the neighbor-joining algorithm to create a multiple sequence alignment.
  • BLAST Basic Local Alignment Search Tool
  • NCBI National Center for Biotechnology Information
  • BLAST 2 Sequences can also be interactively accessed and used on the Internet via the NCBI World Wide Web site.
  • the "BLAST 2 Sequences” tool can be used for both blastn and blastp (discussed below).
  • BLAST programs are commonly used with gap and other parameters set to the default settings. For example, to compare two nucleotide sequences, one can use blastn with the "BLAST 2 Sequences” version 2.0.12 tool (April 21, 2000), which is set to default parameters.
  • Percent identity can be measured over the length of an entire defined sequence, such as defined by a particular SEQ ID number, or measured for a shorter length, for example, over the length of a fragment taken from a larger defined sequence , For example, a fragment of at least 20, at least 30, at least 40, at least 50, at least 70, at least 100 or at least 200 consecutive nucleotides. Such lengths are exemplary only, and it is understood that any fragment length, supported by the sequences shown herein, in tables, figures, or sequence listings, can be used to describe a length over which the percent identity can be measured.
  • percent identity and % -ldentity refer to the percentage of identical residue matches between at least two aligned polypeptide sequences using a standardized algorithm. Methods of polypeptide sequence alignment are well known, and some alignment methods take conservative amino acid substitutions into account.Such conservative substitutions ("substitutions"), discussed above, generally conserve charge and hydrophobicity at the site of substitution, thereby reducing the structure (and therefore function) of the polypeptide.
  • percent similarity and percent similarity as applied to polypeptide sequences refer to the percentage of residue matches, including identical residue matches and conservative substitutions, between at least two aligned polypeptide sequences using a standardized algorithm. In contrast, conservative substitutions are not included in the calculation of percent identity between polypeptide sequences.
  • the PAM250 matrix is selected as the default residual weight table.
  • NCBI BLAST software series can be used.
  • the "BLAST 2 Use Sequences' version 2.0.12 tool (April 21, 2000) with blastp set to default parameter.
  • standard parameters can be for example: matrix: BLOSUM62; Open gap: 1 1 and expansion gap: 1 sanction; Gap x drop-off: 50; Expect: 10; Word size: 3; Filter: on.
  • Percent identity may be measured over the length of an entire defined polypeptide sequence, for example as defined by a particular SEQ ID number, or may be measured for a shorter length, for example, along the length of a fragment removed from a larger, defined polypeptide sequence, for example For example, a fragment of at least 15, at least 20, at least 30, at least 40, at least 50, at least 70, or at least 150 contiguous residuals.
  • a fragment of at least 15, at least 20, at least 30, at least 40, at least 50, at least 70, or at least 150 contiguous residuals are exemplary only and it is understood that any fragment length, supported by the sequences shown herein, in the tables, figures or sequence listings, can be used to describe a length over which the percent identity can be measured.
  • the term "agent” includes any chemical, biochemical or biological molecule; such as small molecules, proteins, polypeptides, antibodies, nucleic acid molecules, including DNA or RNA, and the like.
  • the present invention is based on the isolation and identification of a new variant of infectious bronchitis virus, IB80, and its sequencing.
  • IB80 was isolated from chickens with infectious bronchitis.
  • the isolated virus has a single-stranded RNA and is a member of the family Coronaviridae, a family of positive-oriented RNA viruses of the genus Gamma coronavirus, the species Avian coronavirus.
  • the invention relates to the isolated IB virus that is morphologically and phylogenetically related to known members of the coronaviridae, and more particularly the gammacoronaviruses.
  • the invention relates to an isolated IB virus containing a nucleic acid molecule having a nucleotide sequence which hybridizes under stringent conditions with one of the sequences defined according to the invention, the sequences according to the invention preferably being selected from the group: One or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9;
  • a nucleic acid of SEQ ID NO: 10 or
  • a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7, 8, 9 or 10; or wherein the isolated IB virus-containing nucleic acid molecule has a nucleotide sequence which is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID has NO.
  • the IB virus is killed.
  • the IB virus is attenuated.
  • the infectivity of the attenuated IB virus is reduced.
  • the infectivity is reduced at least 5x, 10x, 25x, 50x, 100x, 250x, 500x or 10,000x.
  • the replication ability of the attenuated IB virus is reduced.
  • the replication ability of the attenuated IB virus is reduced at least 5x, 10x, 25x, 50x, 100x, 250x, 500x, 1,000x, or 10,000x.
  • the ability of the attenuated IB virus to reduce protein synthesis is reduced.
  • the ability of the attenuated IB protein to protein synthesis is reduced at least 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1,000-fold or 10,000-fold ,
  • the ability of the attenuated IB virus to reduce assembly is reduced.
  • the ability of the attenuated IB virus to assemble is at least 5x, 10x, 25x, 50x, 100x, 250x, 500x, 1,000x, or 10,000x reduced.
  • the cytopathic effect of the attenuated IB virus is reduced.
  • the cytopathic effect of the attenuated IB virus is reduced at least 5 times, 10 times, 25 times, 50 times, 100 times, 250 times, 500 times, 1,000 times or 10,000 times
  • the invention provides the complete genomic sequence of the IB virus.
  • the IB virus comprises a nucleotide sequence of SEQ ID NO: 10 corresponding to the complete virus.
  • the invention relates to nucleic acid molecules isolated from IBV or fragments thereof.
  • the isolated nucleic acid molecule comprises one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7, 8, 9 or 10; or a complement thereof.
  • the above-mentioned preferred% -dentities also apply to the above SEQ ID NOs.
  • the nucleic acid molecule comprises a nucleotide sequence of at least 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 , 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800 or 4900 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 10 or a complement thereof; or at least 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500 or 6600 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 10, or a complement thereof.
  • the isolated nucleic acid molecule comprises a nucleotide sequence which, for the IBV amino acid sequence, comprises one or more proteins, comprising or consisting of an amino acid chain selected from the group of the amino acid sequences SEQ ID NOs: 1 1, 12, 13, 14, 15, 16 , 17, 18, 19 and 20; or for one or more proteins, comprising or consisting of an amino acid chain with an identity of> 85% to the amino acid sequence SEQ ID NO: 13 or to an amino acid sequence selected from the group of amino acid sequences with an identity of> 98% to one of the amino acid sequences SEQ ID NOs: 1 1, 12, 14, 15, 16, 17, 18, 19 or 20; or a complement of the nucleotide sequence encoding the IBV amino acid sequences of the aforementioned SEQ ID NOs.
  • the isolated nucleic acid molecule hybridizes under stringent conditions to a nucleic acid molecule having the nucleotide sequence of SEQ ID NOs: comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5 , 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7 , 8, 9 or 10; or a complement thereof, wherein the hybridizing nucleic acid molecule encodes an amino acid sequence having a biological activity exhibited by a polypeptide encoded by the nucleotide sequence of the aforementioned SEQ ID NOs.
  • the above SEQ ID NOs also apply here above preferred% -ldentticianen.
  • the invention relates to proteins or polypeptides, including viral proteins, which are isolated from cells infected with the IB virus, such as host cells, cell lines and / or egg systems, for example hatching eggs, but which are not in comparable uninfected ones Cells, such as host cells, cell lines and / or egg systems, such as hatching eggs, are present.
  • the amino acid sequences of one or more proteins comprising or consisting of an amino acid chain are selected from the group of the amino acid sequences SEQ ID NOs: 1 1, 12, 13, 14, 15, 16, 17, 18, 19 and 20 ; or one or more proteins, comprising or consisting of an amino acid chain with an identity of> 85% to the amino acid sequence SEQ ID NO: 13 or to an amino acid sequence selected from the group of amino acid sequences with an identity of> 98% to one of the amino acid sequences SEQ ID NOs : 1 1, 12, 14, 15, 16, 17, 18, 19 or 20; set out, or a fragment thereof.
  • the polypeptides or proteins of the present invention have a biological activity of the protein (including antigenicity and / or immunogenicity) which is represented by the sequence comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7 , 8, 9 or 10; is encoded.
  • the sequence comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an
  • polypeptides or proteins of the present invention have a biological activity of at least one protein having the amino acid sequence (including antigenicity and / or immunogenicity), such as this amino acid sequence, or a fragment thereof, set forth hereinabove.
  • amino acid sequence including antigenicity and / or immunogenicity
  • this amino acid sequence or a fragment thereof, set forth hereinabove.
  • preferred% -dentities also apply to the above SEQ ID NOs.
  • the invention relates to an isolated polypeptide encoded by the above-described nucleic acid molecule of the invention.
  • the isolated polypeptide comprises the amino acid sequence selected from the group consisting of: a) one or more proteins, comprising or consisting of an amino acid chain selected from the group of the amino acid sequences SEQ ID NOs: 1 1, 12, 13, 14 , 15, 16, 17, 18, 19 and 20; or one or more proteins, comprising or consisting of one Amino acid chain with an identity of> 85% to the amino acid sequence SEQ ID NO: 13 or to an amino acid sequence selected from the group of amino acid sequences with an identity of> 98% to one of the amino acid sequences SEQ ID NOs: 1 1, 12, 14, 15, 16 , 17, 18, 19 or 20; and b) an amino acid sequence having 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology to the amino acid sequence according to a).
  • the isolated polypeptide comprises the amino acid sequence of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 210, 220, 230 , 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 450, 500, 550, 600, 610, 620, 630, 640 , 650, 660, 670, 700, 710, 720, 730, 750, 800, 850, 900, 950, 1000, 1050, 1100, 150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550 , 1600, 1650, 1700, 1750, 1800 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2160, 2170, 2180, 2190 or 2200 contiguous amino acid residues of the amino acid sequence of SEQ ID NOs set forth
  • the invention relates to the use of an isolated IB virus for diagnostic and therapeutic procedures.
  • the invention provides a method for detecting an antibody that is immunospecific in a biological sample for the IB virus using the isolated IB virus of the invention described herein, or any of the proteins or polypeptides of the invention described herein.
  • the invention relates to a method of screening for an antibody that binds immunospecifically and neutralizes IBV or a combination of IBVs. Such an antibody is useful for passive immunization or immunotherapy of an IBV-infected subject.
  • the invention relates to an isolated antibody or antigen-binding fragment thereof, which immunospecifically binds to an IB virus genus of the invention described above.
  • the isolated antibody or an antigen-binding fragment thereof neutralizes a genus of the IB virus.
  • the isolated antibody or an antigen-binding fragment thereof immunospecifically binds to the above-described polypeptide of the invention.
  • the invention further relates to antibodies which specifically bind a polypeptide of the invention comprising a nucleotide sequence comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7 , 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or with an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7, 8, 9 or 10; a fragment thereof, or encoded by a nucleic acid comprising a nucleotide sequence which hybridizes under stringent conditions to one of the aforementioned nucleotide sequences, and / or any IB80 epitope having one or more biological activities of a polypeptide of the invention.
  • polypeptides comprise the proteins according to the invention, ie one or more proteins, comprising or consisting of an amino acid chain selected from the group of the amino acid sequences SEQ ID NOs: 1 1, 12, 13, 14, 15, 16, 17, 18, 19 and 20; or one or more proteins, comprising or consisting of an amino acid chain with an identity of> 85% to the amino acid sequence SEQ ID NO: 13 or to an amino acid sequence selected from the group of amino acid sequences with an identity of> 98% to one of the amino acid sequences SEQ ID NOs : 1 1, 12, 14, 15, 16, 17, 18, 19 or 20.
  • the above-mentioned preferred% identities apply here as well to the above SEQ ID NOs.
  • Such antibodies include, but are not limited to, polyclonal, monoclonal, bispecific, multispecific, human, humanized, chimeric antibodies, single chain antibodies, Fab fragments, F (ab ') 2 fragments, disulfide-linked Fvs, intrabodies, and fragments containing either a VL or VH domain or even a complementarity determining region (CDR) that specifically binds to a polypeptide of the invention.
  • CDR complementarity determining region
  • the invention relates to methods for detecting the presence, activity or expression of the IB virus of the invention in a biological material such as cells, blood, saliva, urine and the like.
  • the increased or decreased activity or expression of the IB virus in a sample relative to a control sample can be determined by contacting the biological material with an agent that directly or indirectly recognizes the presence, activity or expression of the IB virus can.
  • the detection means are the antibodies or nucleic acid molecules of the present invention.
  • the invention relates to a method for detecting the presence of the above-described IB virus of the invention in a biological sample, the method comprising: (a) contacting the sample with an agent that selectively binds to the IB virus; and (b) detecting if the agent binds to the IB virus in the sample.
  • the biological sample is selected from the group consisting of cells; Blood; Serum; Plasma; Kot; tracheal, choanal or cloacal and conjunctival smears.
  • that is Agent that binds to the IB virus an antibody.
  • the agent that binds to the IB virus is a nucleic acid molecule comprising the nucleotide sequence comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7 , 8, 9 or 10; or a complement thereof.
  • the above-mentioned preferred% -dentities also apply to the above SEQ ID NOs.
  • the agent that binds to the IB virus is a nucleic acid molecule comprising a nucleotide sequence of at least 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 , 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500 , 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500 or 6600 contiguous nucleotides of the nucleotide sequence of one of the aforementioned SEQ ID NOs.
  • the invention relates to a method for determining the presence of the above-described polypeptide of the invention in a biological sample, the method comprising: (a) contacting the biological sample with an agent that selectively binds to the polypeptide; and (b) detecting if the agent binds to the polypeptide in the sample.
  • the biological sample is selected from the group consisting of cells; Blood; Serum; Plasma; Kot; tracheal, choanal or cloacal and conjunctival smears.
  • the agent that binds to the polypeptide is an antibody or antigen-binding fragment thereof.
  • the invention relates to a method for detecting the presence of a first nucleic acid molecule derived from the above-described IB virus of the invention in a biological sample, the method comprising: (a) contacting the biological sample with an agent which selectively the nucleic acid binds; and (b) detecting if the agent binds to the nucleotide in the sample.
  • the agent that binds to the first nucleic acid molecule is a second nucleic acid molecule comprising the nucleotide sequence comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4 , 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprehensive a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7, 8 , 9 or 10; or a complement thereof.
  • the second nucleic acid molecule comprises at least 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500 or 6600 contiguous nucleotides of the nucleotide sequence of any one of the aforementioned SEQ ID NOs, or a complement thereof.
  • the invention relates to a method for propagating the IB80 in host cells, comprising infecting the host cells, cell lines and / or egg systems, for example hatching eggs, with an isolated Infectious Bronchitis Virus of the invention described above, culturing the host cells, cell lines and / or egg systems, such as hatching eggs, to allow the virus to replicate and harvesting resulting virions.
  • the present invention also relates to host cells, cell lines and / or egg systems, for example hatching eggs, which are infected with the virus according to the invention described above.
  • the host cell is a bird cell; According to the invention, all bird species are suitable, in particular chickens.
  • the egg system particularly relates to hatching eggs.
  • the egg system relates to embryonated eggs; For example, so-called SPF eggs, “Serumeier”, “Clean Eggs” are to be mentioned here in particular.
  • SPF eggs so-called SPF eggs, "Serumeier", "Clean Eggs” are to be mentioned here in particular.
  • the invention relates to a method of detecting the presence of an antibody in a biological sample immunologically binding IB virus, the method comprising: (a) contacting the biological sample with the above-described host cell of the invention; and (b) detecting the antibody bound to the cell.
  • the invention relates to vaccine preparations, including the IB virus of the invention, including recombinant and chimeric forms of the virus, the nucleic acid molecules or protein subunits of the virus comprised by the virus.
  • the vaccine preparations comprise the present the invention, the live but attenuated IB virus, with or without pharmaceutically acceptable carriers, including adjuvants.
  • the vaccine preparations of the invention comprise an inactivated or killed IB virus, variants of the IB virus or a combination thereof, with or without pharmaceutically acceptable carriers, including adjuvants.
  • Such attenuated or inactivated viruses can be produced by a series of passages of the virus in a host system, eg, a cell line, by inactivation methods, or by producing recombinant or chimeric forms of the virus. Accordingly, the present invention further relates to methods of producing the recombinant or chimeric forms of the IB viruses of the invention described herein.
  • the invention relates to a vaccine formulation comprising a therapeutically or prophylactically effective amount of the IB virus of the invention described above and a pharmaceutically acceptable carrier.
  • the invention relates to a vaccine formulation comprising a therapeutically or prophylactically effective amount of a protein extract of the IB virus of the invention described above, or a subunit thereof, and a pharmaceutically acceptable carrier.
  • the invention relates to a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7 , 8, 9 or 10; or a complement thereof, and a pharmaceutically acceptable carrier.
  • a nucleic acid molecule comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of
  • the invention relates to a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising any of the above-described nucleotide sequences of the invention, or a complement thereof, and a pharmaceutically acceptable carrier.
  • the invention features a vaccine formulation comprising a therapeutically or prophylactically effective amount of a protein extract of the IB virus of the invention described above, or a subunit thereof, and a pharmaceutically acceptable carrier.
  • the invention relates to a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7 , 8, 9 or 10; or a complement thereof, and a pharmaceutically acceptable carrier.
  • a nucleic acid molecule comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of
  • the invention relates to a vaccine formulation comprising a therapeutically or prophylactically effective amount of a nucleic acid molecule comprising any of the nucleotide sequences of the invention described above, or a complement thereof, and a pharmaceutically acceptable carrier.
  • the vaccine preparations of the present invention comprise a nucleic acid or a fragment of IB80, for example virus number 16061601 or accession number 16070701, or nucleic acid molecules comprising one or more nucleic acid segments selected from the group consisting of nucleic acids Sequences SEQ ID Nos: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7 , 8, 9 or 10; or a fragment thereof.
  • the vaccine preparations comprise a protein / polypeptide of the invention encoded by any of the nucleotide sequences set forth above, or a fragment thereof.
  • the vaccine preparations contain proteins / polypeptides of the invention comprising or consisting of an amino acid chain selected from the group of the amino acid sequences SEQ ID NOs: 1 1, 12, 13, 14, 15, 16, 17, 18, 19 and 20; or one or more proteins, comprising or consisting of an amino acid chain with an identity of> 85% to the amino acid sequence SEQ ID NO: 13 or to an amino acid sequence selected from the group of amino acid sequences with an identity of> 98% to one of the amino acid sequences SEQ ID NOs: 1 1, 12, 14, 15, 16, 17, 18, 19 or 20; or as encoded by any of the above nucleotide sequences of the invention, or a fragment thereof.
  • the present invention relates to methods for treating, alleviating, managing or preventing infectious bronchitis (this generally includes other symptoms caused by IB80) by the vaccine preparations or antibodies of the present invention alone or in combination with adjuvants, or other pharmaceutical acceptable excipients.
  • the present invention relates to methods for treating, alleviating, managing or preventing infectious bronchitis by administering the compositions and formulations of the invention, including the vaccine preparations or antibodies of the present invention, alone or in combination with antiviral drugs [eg amantadine, rimantadine, gancyclovir, Acyclovir, ribavirin, penciclovir, oseltamivir, foscarnet zidovudine (AZT), didanosine (DDL), lamivudine (3TC), zalcitabine (ddC), stavudine (d4T), nevirapine, delavirdine, indinavir, ritonavir, vidarabine, nelfinavir, saquinavir, Relenza, Tamiflu, pleconaril, interferons, etc.], with steroids and corticosteroids such as prednisone, cortisone, fluticasone and glucocortic drugs
  • the invention features an immunogenic formulation comprising an immunogenically effective amount of the IB virus of the invention described above and a pharmaceutically acceptable carrier.
  • the invention features an immunogenic formulation comprising an immunogenically effective amount of a protein extract of the IB80 virus of the present invention, or a subunit thereof, and a pharmaceutically acceptable carrier.
  • the invention features an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7 , 8, 9 or 10; a combination thereof or a complement thereof, and a pharmaceutically acceptable carrier.
  • the above-mentioned preferred% -dentities also apply to the above SEQ ID NOs.
  • the invention features an immunogenic formulation comprising an immunogenically effective amount of a nucleic acid molecule containing one of the nucleotide sequences of the invention described above, or a complement thereof, and a pharmaceutically acceptable carrier.
  • the invention relates to an immunogenic formulation comprising an immunogenically effective amount of any of the polypeptides of the invention described above.
  • the present invention relates to pharmaceutical compositions comprising antiviral agents of the present invention and a pharmaceutically acceptable carrier.
  • the antiviral agent of the invention is an antibody that immunospecifically binds IB80 or an IB80 epitope.
  • the antiviral agent is a polypeptide or protein of the present invention or nucleic acid molecule of the invention.
  • the invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a prophylactically or therapeutically effective amount of an anti-I B virus agent and a pharmaceutically acceptable carrier.
  • the anti-IB80 agent is an antibody or antigen-binding fragment thereof, which immunospecifically binds to the virus of accession number 16061601 or 16070701, or to polypeptides or proteins derived therefrom.
  • the anti-IB80 agent is a nucleic acid molecule comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7 , 8, 9 or 10; a combination thereof or a fragment thereof.
  • the anti-IB80 agent is a polypeptide encoded by a nucleic acid molecule comprising any of the nucleotide sequences set forth above, a combination thereof, or a fragment thereof having a biological activity of the polypeptide.
  • the above-mentioned preferred% -dentities also apply to the above SEQ ID NOs.
  • kits comprising compositions and formulations of the present invention.
  • the invention relates to a kit, comprising a container containing the immunogenic formulation of the invention described above.
  • the invention relates to a kit including a container containing the above-described pharmaceutical composition of the invention.
  • the invention relates to a kit, including a container containing the vaccine formulation of the invention described above.
  • the invention relates to a method of identifying a subject infected with the IB80 of the invention described above, including: (a) recovering the total RNA from a biological sample obtained from the subject; (b) reverse transcription of the total RNA to obtain cDNA; and (c) amplifying the cDNA using a set of primers derived from a nucleotide sequence of the IB virus of the invention described above.
  • the set of primers is derived from the nucleotide sequence of the genome of the IB virus of Accession No. 16061601 or 16070701. In another, the set of primers is derived from one of the nucleotide sequences of the invention described above, or a complement thereof.
  • the invention further relates to the use of the sequence information of the isolated IB80 virus for diagnostic and therapeutic procedures.
  • the invention relates to nucleic acid molecules suitable for use as primers, consisting of or including any of the nucleotide sequences of the invention set forth above, or a complement thereof, or at least a portion of the nucleotide sequence thereof.
  • the invention relates to nucleic acid molecules suitable for hybridization to the IB80 nucleic acid of the invention; including, but not limited to, PCR primers, reverse transcriptase primers, probes for Southern analysis, Northern blots, probes for real-time PCR, or other nucleic acid hybridization assays for detection of IB80 nucleic acids, for example consisting of or including one of the nucleotide sequences of the invention set forth above, a combination thereof, a complement thereof, or a portion thereof.
  • the invention further encompasses chimeric or recombinant IB80 viruses that are fully or partially encoded by the nucleotide sequences.
  • the present invention relates to methods for screening antiviral agents that inhibit the infectivity or replication of IB80, including variants thereof.
  • the invention further relates to methods for producing recombinant or chimeric forms of IB80.
  • the invention relates to vaccine preparations, including the IB80 virus, including recombinant and chimeric forms of the IB80 virus or subunits of the IB80 virus.
  • the present invention encompasses recombinant or chimeric viruses encoded by viral vectors derived from the genome of the IB80 virus of the invention described herein or natural variants thereof.
  • the recombinant virus is a virus derived from the IB80 virus of accession number 16061601 or 16070701.
  • natural variants of the IB80 viruses of the invention described herein include one or more mutations, including, but not limited to, point mutations, rearrangements, insertions, deletions, etc., in the genomic sequence. It is recognized that the mutations may or may not lead to a phenotypic change.
  • a chimeric virus of the invention is a recombinant IB80 virus further comprising a heterologous nucleotide sequence.
  • a chimeric virus may be encoded by a nucleotide sequence in which heterologous nucleotide sequences have been added to the genome or in which endogenous or native nucleotide sequences have been replaced by heterologous nucleotide sequences.
  • the chimeric viruses are encoded by the viral vectors of the invention which further comprise a heterologous nucleotide sequence.
  • a chimeric virus is encoded by a viral vector that may or may not contain nucleic acids that are non-native to the viral genome.
  • a chimeric virus is preferably encoded by a viral vector in which heterologous nucleotide sequences have been added, inserted, or substituted for native or non-native sequences.
  • the chimeric virus may be encoded by nucleotide sequences derived from different species or variants of the IB virus.
  • the chimeric virus is going through Nucleotide sequences encoding antigenic, derived from different species or variants of the IB virus polypeptides.
  • a chimeric virus may be of particular use for the production of recombinant vaccines for protection against two or more viruses (Tao et al., J. Viral., 72, 295- 2961, Durbin et al., 2000, J. Viral , 6821-6831, Skiadopoulos et al., 1998, J. Viral., 72, 1762-1768 (1998), Teng et al., 2000, J. Viral., 74, 9317-9321).
  • a virus vector derived from the IB80 virus that expresses one or more proteins of variants of the IB80 virus will protect a subject vaccinated with such a vector against both native IB80 virus and variant infections
  • Attenuated and replication-deficient viruses may be useful for vaccination with live vaccines, as has been suggested for other viruses.
  • the heterologous sequence to be incorporated into the viral vectors, which encode the recombinant or chimeric viruses of the invention includes sequences derived from or derived from different species or variants of IB80.
  • the chimeras or recombinant viruses of the invention are encoded by viral vectors derived from viral genomes wherein one or more sequences, intergenic regions, termini sequences or portions or entire ORF have been replaced by a heterologous or non-native sequence are.
  • the chimeric viruses of the invention are encoded by viral vectors derived from viral genomes wherein one or more heterologous sequences have been inserted or added into the vector.
  • the selection of the viral vector may depend on the species of the subject to be treated or protected for viral infection.
  • An attenuated IB80 virus can be used to provide the antigenic sequences.
  • the viral vectors can be constructed to provide antigenic sequences conferring protection against infection thereof by the IB80 of the invention and natural variants thereof.
  • the viral vectors can be engineered to provide one, two, three or more antigenic sequences.
  • the antigenic sequences may be derived from the same virus, from different species or variants of the same virus type or from different viruses.
  • the expression products and / or recombinant or chimeric virions obtained in accordance with the invention can be advantageously used in vaccine formulations.
  • the expression products and chimeric virions of the present invention can be engineered to produce vaccines against a broad spectrum of pathogens, including viral and bacterial antigens, tumor antigens, allergen antigens, and autoantigens involved in autoimmune diseases.
  • pathogens including viral and bacterial antigens, tumor antigens, allergen antigens, and autoantigens involved in autoimmune diseases.
  • One way to achieve this goal is to modify existing IB80 genes to contain foreign sequences in their respective external domains.
  • these chimeric viruses can be used to induce a protective immune response against the pathogen from which these determinants are derived.
  • the chimeric virions of the present invention can be engineered to confer vaccines for the protection of a subject from IB80 virus infections and variants thereof.
  • the present invention further relates to the use of viral vectors and recombinant or chimeric viruses of the invention to formulate vaccines against a broad spectrum of viruses and / or antigens.
  • the present invention also encompasses recombinant viruses of the invention, including a viral vector derived from the IB80 or variants thereof, which contains sequences resulting in a virus having a phenotype more suitable for use in vaccine formulations, e.g. an attenuated phenotype or with improved antigenicity.
  • the mutations and modifications may be in coding regions, in intergenic regions and in the leader and trailer sequences of the virus.
  • the invention relates to a host cell with a nucleic acid or a vector according to the invention.
  • Plasmid or viral vectors containing the polymerase components of the IB80 virus are generated in prokaryotic cells for expression of the components in the appropriate cell types (bacteria, insect cells, eukaryotic cells).
  • Full-length or partial copies of the IB80 genome containing plasmid or viral vectors are generated in prokaryotic cells for the expression of viral nucleic acids in vitro or in vivo.
  • the latter vectors contain if appropriate, other viral sequences for the production of chimeric viruses or chimeric virus proteins, they may be missing parts of the viral genome for the production of a replication-defective virus, and they may contain mutations, deletions or insertions to produce attenuated viruses.
  • the present invention relates to a host cell, cell line and / or egg system, for example Brutei, which is infected with an IB80 virus of accession number 16061601 or 16070701. Host cells or cell lines are generally available via cell banks, egg systems such as hatching eggs via the respective producers.
  • IBV Infectious copies of the IBV (as wild-type, attenuated, replication defective, or chimeric) are optionally prepared upon co-expression of the polymerase components according to the prior art technologies described above.
  • eukaryotic cells that transiently or stably express one or more full-length or partially expressed IB80 proteins are optionally used.
  • such cells are produced by transfection (proteins or nucleic acid vectors), infection (viral vectors) or transduction (viral vectors), and are useful for complementation of said wild-type, attenuated, replication-defective, or chimeric viruses.
  • the viral vectors and chimeric viruses of the present invention may modulate a subject's immune system by stimulating a humoral immune response, a cellular immune response, or by stimulating tolerance to an antigen.
  • a subject means preferably humans, primates, horses, cows, sheep, pigs, goats, dogs, cats, birds and rodents.
  • a subject means: bird species, especially chickens.
  • the invention relates to a proteinaceous molecule or IB80 virus-specific viral protein or a functional fragment thereof encoded by a nucleic acid according to the invention.
  • useful proteinaceous molecules are derived from any of the genes or genomic fragments derivable from the virus of the invention.
  • Such molecules, or their antigenic fragments as provided herein, are useful, for example, in diagnostic methods or kits and in pharmaceutical compositions such as subunit vaccines.
  • polypeptides which are replaced by a A nucleotide sequence comprising one or more nucleic acid segments selected from the group consisting of nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7 , 8, 9 or 10; or antigenic fragments thereof, for inclusion as an antigen or immunogenic subunit, but the inactivated whole virus can also be used.
  • the above-mentioned preferred% -dentities also apply to the above SEQ ID NOs.
  • those proteinaceous substances that are encoded by recombinant nucleic acid fragments of the IB80 genome, preferably those that are within the preferred limits and dimensions of ORFs, particularly to elicit specific IBV antibody or T cell responses, whether in vivo (eg for protective or therapeutic purposes or for the provision of diagnostic antibodies) or in vitro (eg by phage display technique or another technique useful for the production of synthetic antibodies).
  • IB80 polypeptides are within the scope of the present invention, including substitutions, alterations, modifications of amino acid or other alterations of amino acid that increase the function or immunogenic propensity of the immunogen or vaccine of the present invention or not change.
  • post translational modifications are equally within the scope of the present invention, illustrative including incorporation of naturally occurring amino acid (s), phosphorylation, glycosylation, sulfation, and addition of side groups such as biotinylation, fluorophores, lumiphors, radioactive groups, antigens, or other molecules ,
  • peptides and proteins are recombinantly expressed in eukaryotic cells.
  • eukaryotic cells include yeast, HeLa cells, 293 cells, COS cells, Chinese hamster ovary (CHO) cells, and many other cell types known in the art.
  • yeast yeast
  • HeLa cells yeast
  • 293 cells yeast
  • COS cells Chinese hamster ovary
  • Both eukaryotic and prokaryotic expression systems and cells are available, for example from Invitrogen Corp., Carlsbad, CA. It is understood that cell-free expression systems can be operated similarly.
  • an immunogenic polypeptide is a full-length IB80 protein.
  • an immunogen is full-length IB80 protein comprising one or more proteins comprising or consisting of an amino acid chain selected from the group of amino acid sequences SEQ ID NOs: 1 1, 12, 13, 14, 15, 16, 17, 18, 19 and 20; or one or more proteins, comprising or consisting of an amino acid chain with an identity of> 85% to the amino acid sequence SEQ ID NO: 13 or to an amino acid sequence selected from the group of amino acid sequences with an identity of> 98% to one of the amino acid sequences SEQ ID NOs : 1 1, 12, 14, 15, 16, 17, 18, 19 or 20. or a fragment thereof as described herein.
  • the above-mentioned preferred% -dentities also apply to the above SEQ ID NOs.
  • an immunogen has a minimum of 5 amino acids.
  • an immunogen is preferably a polypeptide.
  • the terms immunogen, polypeptide and antigen are used interchangeably. Modifications and changes may be made in the structure of the immunogens of the invention which are the subject of the application and still provide a molecule having similar or improved properties as the wild-type sequence (eg, a conservative amino acid substitution). For example, certain amino acids are optionally substituted by other amino acids in a sequence without appreciable loss of immunogenic activity.
  • polypeptide sequence Because it is the interactive capacity and nature of a polypeptide that defines the biological functional activity, certain amino acid sequence substitutions can be made in a polypeptide sequence and still obtain a polypeptide having the same or improved properties.
  • a polypeptide is used that has less or more immunogenic activity compared to the wild-type sequence.
  • the hydropathic index of amino acids is preferably considered.
  • the importance of the hydropathic amino acid index in conferring the interactive biological function on a polypeptide is well understood in the art. It is known that certain amino acids may be substituted for other amino acids having a similar hydropathic index or value and still yield a polypeptide having similar biological activity. Each amino acid has been assigned a hydropathicity index based on its hydrophobicity and charge characteristics.
  • indices are for example after Kyte and Doolittle: isoleucine (+4,5); Valine (+4.2); Leucine (+3.8); Phenylalanine (+2.8); Cysteine / cysteine (+2.5); Methionine (+1, 9); Alanine (+1, 8); Glycine (-0.4); Threonine (-0.7); Serine (-0.8); Tryptophan (-0.9); Tyrosine (-1, 3); Proline (-1, 6); Histidine (-3,2); Glutamate (-3.5); Glutamine (-3.5); Aspartate (-3.5); Asparagine (- 3,5); Lysine (-3.9); and arginine (-4.5).
  • the relative hydropathic character of the amino acid determines the secondary structure of the resulting polypeptide, which in turn defines the interaction of the polypeptide with other molecules such as enzymes, substrates, receptors, antibodies, antigens, and the like. It is known in the art that one amino acid can be replaced by another amino acid with a similar hydropathy index and still give a functionally equivalent immunogen. In such changes, preference is given to the substitution of amino acids whose hydropathic indices are within ⁇ 2, more preferably within ⁇ 1, and those within ⁇ 0.5 are most preferred.
  • amino acid substitutions generally rely on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like.
  • Exemplary substitutions that take into account various of the above properties and that are well known to those skilled in the art include (original residue: exemplary substitution): (Ala: Gly, Ser), (Arg: Lys), (Asn: Gin , His), (Asp: Glu, Cys, Ser), (Gin: Asn), (Glu: Asp), (Gly: Ala), (His: Asn, Gin), (lle: Leu, Val), (Leu : lle, Val), (Lys: Arg), (Met: Leu, Tyr), (Ser: Thr), (Thr: Ser), (Tip: Tyr), (Tyr: Trp, Phe), and (Val: ll , Leu).
  • the embodiments of this disclosure thus contemplate functional or biological equivalents of a polypeptide and immunogen as set forth above.
  • the embodiments of the polypeptides and immunogens optionally include variants having about 50%, 60%, 70%, 80%, 90% and 95% sequence identity to the polypeptide of interest.
  • the invention relates to vaccine formulations for the prevention and treatment of infections with IB80 virus.
  • the vaccine of the invention comprises recombinant and chimeric viruses of the IB80 virus.
  • the virus is attenuated.
  • inactivated vaccine formulations are prepared using conventional techniques to "kill" the viruses.
  • Inactivated vaccines are "dead” in the sense that their infectivity has been destroyed and no residual replicable virus is more detectable. Ideally, the infectivity of the virus is destroyed without affecting its immunogenicity.
  • the virus may be in cell culture or in egg System, for example in Brutei, especially in the allantois of a bird embryo (such as in particular in the allantoic chicken embryo) are grown, for example, purified by zonal ultra-centrifugation, for example by formaldehyde, ß-propiolactone, and / or other methods are inactivated and pooled.
  • the resulting vaccine can be inoculated intramuscularly, subcutaneously or intranasally.
  • Inactivated viruses are optionally formulated with a suitable adjuvant to enhance the immunological response.
  • suitable adjuvants illustratively include, but are not limited to, mineral gels, for example, aluminum hydroxide; surfactants such as lysolecithin, pluronic polyols, polyanions; peptides; Oil emulsions; and potentially useful animal or human adjuvants such as BCG and Corynebacterium parvum.
  • the present invention also relates to formulations of DNA vaccines comprising a nucleic acid or a fragment of the inventive IB virus, for example the virus of accession number 16061601 or 16070701 or nucleic acid molecules comprising one or more nucleic acid segments selected from the group consisting of Nucleic acids of the sequences SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8 and 9; or comprising a nucleic acid of SEQ ID NO: 10; or comprising a nucleic acid comprising or consisting of a nucleic acid segment having an identity of> 85% to SEQ ID NO: 3 or having an identity of> 98% to one of SEQ ID NOs: 1, 2, 4, 5, 6, 7 , 8, 9 or 10; or a fragment thereof.
  • a nucleic acid or a fragment of the inventive IB virus for example the virus of accession number 16061601 or 16070701 or nucleic acid molecules comprising one or more nucleic acid segments selected from the group consisting of Nucleic acids of the sequences SEQ
  • the DNA vaccine formulations of the present invention comprise a nucleic acid or fragment thereof encoding antibodies that immunologically bind IB viruses.
  • a vaccine DNA comprises a viral vector as derived from the IB virus, a bacterial plasmid or other expression vector carrying an insert with a nucleic acid molecule of the present invention operably linked to one or more Control elements to thereby enable expression of the proteins encoded by the nucleic acid molecule in a vaccinated subject.
  • Such vectors can be produced by recombinant DNA technology as recombinant or chimeric viral vectors carrying a nucleic acid molecule of the present invention.
  • a nucleic acid as used herein refers to single-stranded or double-stranded molecules, optionally DNA, including nucleotide bases A, T, C and G, or RNA, including bases A, U (replaces T), C and G.
  • the nucleic acid may be a coding strand or its complement.
  • Nucleic acids are optionally sequence identical to the sequence that occurs naturally or include alternative codons that encode the same amino acid as found in the naturally occurring sequence.
  • nucleic acids optionally include codons that are conservative substitutions of amino acids, as are well known in the art.
  • isolated nucleic acid means a nucleic acid separate from or substantially free of at least some of the other components of the naturally occurring organism, for example, usually the cell structural components found associated with nucleic acids in a cellular environment and / or other nucleic acids.
  • the isolation of nucleic acids is illustratively achieved by techniques such as lysis followed by phenol and chloroform extraction followed by ethanol precipitation of the nucleic acids.
  • the nucleic acids of this invention are illustratively isolated from cells according to methods well known in the art for the isolation of nucleic acids.
  • the nucleic acid encoding the peptide or polypeptide of the present invention is part of a recombinant nucleic acid construct comprising any combination of restriction sites and / or functional elements well known in the art to facilitate molecular cloning and other recombinant DNA manipulations ,
  • the present invention further relates to a recombinant nucleic acid construct containing a nucleic acid encoding a polypeptide of this invention.
  • a cDNA version of the (recombinant) polynucleotide it may be advantageous to use a cDNA version of the (recombinant) polynucleotide. It is believed that the use of a cDNA version offers advantages in that the size of the gene can generally be substantially smaller and can be more easily used to transfect the target cell than will a genomic gene, typically up to an order of magnitude larger will be as the cDNA gene. However, the invention does not exclude the possibility that, if desired, a genomic version of a particular gene may be used.
  • engineered cells are synonymous with “host cells” and are intended to refer to a cell or cell line into which an exogenous DNA segment or gene such as a cDNA or gene, has been introduced. Therefore, engineered cells are distinguishable from naturally occurring cells that do not contain a recombinantly-introduced exogenous DNA segment or gene.
  • a host cell, or cell line is optionally a naturally occurring cell or cell line transformed or transfected with an exogenous DNA segment or gene, or a cell or cell line that is unmodified.
  • a host cell preferably does not have a naturally occurring coding spike protein gene.
  • Constructed cells or cell lines are thus cells which have a gene or genes introduced by the hand of humans.
  • Recombinant cells illustratively include those having introduced cDNA or genomic DNA or RNA, and also include genes positioned adjacent to a promoter that is not naturally associated with the particular gene introduced.
  • an expression vector containing a polynucleotide under the control of one or more promoters is prepared.
  • a coding sequence "under the control" of a promoter one positions the 5 'end of the translational initiation site of the reading frame generally between about 1 and 50 nucleotides "downstream" of (i.e., 3' of) the chosen promoter.
  • the upstream promoter stimulates transcription of the inserted DNA and promotes expression of the encoded recombinant protein. This is the meaning of "recombinant expression” as used in context herein.
  • expression vectors containing the appropriate nucleic acids and transcriptional / translational control sequences to achieve protein or peptide expression in a variety of host expression systems.
  • Available cell types for expression include, but are not limited to, bacteria such as E. coli and B. subtilis transformed with recombinant phage DNA, plasmid DNA or cosmid DNA expression vectors.
  • Eukaryotic expression systems may also be used, such as yeasts, baculovirus and insect cells, or HEK cells. The depletion of IB80 virus
  • the IB80 virus of the present invention or variants thereof are optionally genetically engineered to have an attenuated phenotype.
  • the viruses of the invention exhibit an attenuated phenotype in a subject to which the virus is administered as a vaccine. Attenuation can be achieved by any method known to a person skilled in the art.
  • the attenuated phenotype of the viruses of the invention is effected, for example, by using a virus which, of course, does not replicate well in an intended host species, e.g., by diminished replication of the viral genome, by a reduced ability of the virus To infect the host cell or by a reduced ability of the viral proteins to mount an infectious viral particle relative to the wild-type species of the virus.
  • Attenuation Under attenuation (weaknesses, diminishing) or also virulence reduction, attenuation, in microbiology one understands the deliberate reduction of the pathogenic properties of a pathogen (virulence), while at the same time maintaining or only minimizing its ability to multiply. Attenuation also aims at maintaining the surface properties of the pathogen (epitopes), which are essential for the immune defense, and thus its immunogenicity. Therefore, attenuation is one way to make live vaccines for active immunization. The methods which can be used for this purpose are well known to the person skilled in the art.
  • the natural property of the pathogen is exploited in the beginning, although in a host that is unfavorable to it, it can initially grow small, but often does not cause any disease. This is explained, for example, in the case of viruses in that those receptors of the virus surface which allow uptake into a specific target cell are not adapted to the cells of the new host. Furthermore, in cell cultures, the genes for immune evasion and some virulence factors are unnecessary and are therefore often deleted.
  • those mutants of the pathogen are selected, which can still multiply and be replicated in a transmission to the original host (such as humans) in lesser numbers or with fewer disease symptoms. Attenuation is / can also the cultivation of the pathogen at less favorable, low Temperatures (about 25 ° C) can be used, in which the pathogens can also lose their virulence.
  • a monoclonal antibody is directed against exactly one specific epitope of an antigen.
  • animals must be immunized and then their plasma cells (from spleen or lymph nodes) recovered. Since the plasma cells have lost the capacity for cell division, a fusion with tumor cells must first take place.
  • the resulting cell hybrids are given by the plasma cells the property of producing and secreting a specific antibody and of the tumor cell's ability to divide theoretically infinitely in culture, and thus to theoretically live for an infinitely long time.
  • the present invention encompasses pharmaceutical mixtures (compositions), including antiviral agents of the present invention.
  • the antiviral agent is preferably an antibody that immunospecifically binds and neutralizes the IB80 virus or variants thereof or any proteins derived therefrom.
  • the antiviral agent is a polypeptide or nucleic acid molecule of the invention.
  • the pharmaceutical compositions are useful as antiviral prophylactic agents are illustratively administered to a subject when the subject has been exposed or is expected to be exposed to a virus.
  • Various delivery systems are known and understood by one of ordinary skill in the art to prepare them to administer the pharmaceutical composition of the invention.
  • compositions and pharmaceutical mixtures (compositions) of the invention may be administered by any suitable route, for example by infusion or bolus injection, through absorption through epithelial or mucosal linings (e.g., oral mucosa, kloakal and intestinal mucosa, etc.), optionally together with other biologically active agents , administered.
  • the administration is systemic or local. In a preferred embodiment, it is desirable to introduce the agents and pharmaceutical mixtures (compositions) of the invention into the lung by any suitable route. Pulmonary administration may also be accomplished, for example, by use of an inhaler or nebuliser, and formulation with an aerosolizing agent.
  • the administration of the drinking water or the administration by means of spray are preferred, and are particularly important for IB viruses, e.g. the viruses of the invention (IB80), is of importance.
  • IB80 the viruses of the invention
  • eye-drop application of the vaccine in which each animal is individually supplemented with a drop of the agent and pharmaceutical mixtures (compositions) of the invention , The solution is dropped into the eye.
  • the present invention also relates to a method for detecting an antibody which binds immunospecifically to the IB80 virus of the invention, for example, in a biological sample, including, for example, blood, serum, plasma, saliva, urate, stool, etc., from a subject present under one IBV infection suffers.
  • a sample for example, with the IB80 virus or a genomic nucleic acid sequence according to the invention is immobilized in contact directly on a substrate and the virus-bound antibody detected directly or indirectly by suitable methods.
  • Detection methods are well known to those skilled in the art, and include, for example Hybridization methods, labeling methods, detection probes,
  • Immunofluorescence assay It may be in vitro or in v / Vo methods.
  • the invention also relates to a method for the identification of agents or substances which inhibit the ability of the IBV virus, in particular the IB80, to infect a host or a host cell.
  • the invention relates to methods of identifying agents or substances that inhibit the ability of the IBV virus, particularly IB80, to replicate in a host or host cell. Any technique known to those skilled in the art can be used for this purpose.
  • the invention relates to methods for identifying agents or substances that replicate the ability of the IBV virus, particularly the IB80, to replicate in a species of bird, or more specifically, in poultry, eg, chickens. More particularly, the invention relates to methods of identifying agents or substances that inhibit the ability of the IBV virus, particularly the IB80, to infect a species of bird or, in particular, poultry, such as chickens. In certain embodiments, the invention relates to methods of identifying agents or substances that inhibit the ability of the IBV virus, particularly the IB80, to replicate in host cells, cell lines and / or egg systems, for example in hatching eggs.
  • the material used for virus isolation comes from the monitoring of a clinically normal chicken flock at that time.
  • a pool of caecaline salmon was used for cultural cultivation.
  • This organ material was mixed in 15 ml tubes with 1x PBS, pH 7-7.4 with 50 ⁇ g / ml gentamycin and 2.5 ⁇ g / ml amphotericin B, in the ratio 1:10.
  • the sample was homogenized in FastPrep-24 (MP Biomedicals) for 30 sec at room temperature. To clarify the organ material this was then centrifuged at 2,000 x g and 4 ° C for 20 minutes and the supernatant filtered with a 0.45 ⁇ filter. This was followed by incubation of the filtrate at room temperature for 30 minutes.
  • the virus replication was carried out by direct passage of the filtrate of the reconditioned cecal tonsils in SPF chicken eggs (VALO BioMedia). For this purpose, 200 ⁇ of this material were injected into the allantoic cavity (AH) of eggs (gross 10) with a cannula (0.5 ⁇ 16 mm) in the sterile workbench (clean room class A). Then the opening in the egg was closed with Uhu Alleskleber. Incubation was for 7 days at 37-38 ° C and a relative humidity of about 60%.
  • the inoculated eggs were regularly sheared on Absterber. After the 7 days, the eggs were chilled for 4 hours at 4 ° C. Subsequently, the eggs were opened with sterile scissors in the area of the air bubble and the harvest of the allantoic fluid by means of a transfer pipette. The harvest of the inoculated eggs was pooled.
  • the harvest was stored at -20 ° C.
  • the first passage crop was sterilized under sterile conditions with 1: 100 1xPBS, pH 7-7.4, and re-seeded at 200 ⁇ per egg into the allantoic cavity of SPF hatching eggs. These were sealed with Uhu Alleskleber and incubated for 4 days at 37 ° C and a relative humidity of about 50% for 4 days and shaved daily. A mortal within the first 24 hours after inoculation was rejected as nonspecific. The remaining eggs were chilled on day 4 for about 4 hours at 4 ° C and then their allantoic fluid was harvested as a pool under sterile conditions.
  • the allantoic fluid was again diluted 1: 100 with 1xPBS as inoculated into the allantoic cavity of SPF hatching eggs and incubated for 4 days. A mortal within the first 24 hours after inoculation was again discarded as nonspecific. The remaining eggs were chilled on day 4 for about 4 hours at 4 ° C and then their allantoic fluid was harvested as a pool under sterile conditions and frozen in 1-2 ml aliquots at -80 ° C.
  • RNA purification from the harvested allantoic fluid of a sample was carried out with the QIAamp Viral RNA Mini Kit® (Qiagen) according to the manufacturer's instructions. Subsequently, the IBV status of the samples was checked by means of a real-time PCR using the Kylt® IB Virus Kit (Kylt) according to the manufacturer's instructions. The IBV score was positive at a CT of 13.86.
  • the sequencing of the genome of the IB virus isolate was carried out according to the dideoxymethod of Sanger (Sanger and Coulsen, 1977) and was carried out by means of a 2-step RT-PCR protocol:
  • Reverse transcription was performed using the GoScript TM Reverse Transcription System (Promega) as recommended by the manufacturer. In this case, the reverse transcription on the one hand with the random primers contained in the kit (cDNA A) and on the other with 14 IBV-specific primers (cDNA B, Franzo et al., 2015, modified, see Table 1) performed (see Table 1). For the reverse transcription, 20 pmol of the primer mix (1.43 pmol per primer) were used for a reaction batch of 20 .mu. ⁇ .
  • the final protocol for the 20 ⁇ assay is composed as follows: 4 ⁇ of RNA purification of the sample, 1 ⁇ primer mix (random primer or IBV-specific primer mix), 4 ⁇ GoScript TM 5X Reaction Buffer, 2 , 4 ⁇ M 25 mM MgCl 2 , 1 ⁇ M PCR Nucleotide Mix, 0.5 ⁇ M Recombinant RNasin® Ribonuclease Inhibitor, 1 ⁇ M GoScript TM Reverse Transcriptase, 6, 1 ⁇ M nuclease-free water.
  • the temperature profile corresponded to the specifications of the manufacturer.
  • the protocol for the 20 ⁇ approach is composed as follows: 2 ⁇ cDNA, 2 ⁇ 10X Buffer for KOD Hot Start DNA Polymerase®, 1, 2 ⁇ M 25 mM MgS0 4 , 2 ⁇ _ dNTPs (2 mM each), 0.8 iL Forward Primer (10 ⁇ ), 0.8 ⁇ Reverse Primer (10 ⁇ ), 0.4 ⁇ KOD Hot Start DNA Polymerase® (1U / ⁇ ), 10.8 ⁇ nuclease-free water. After initial denaturation for 2 min at 95 ° C, 40 cycles were performed at 95 ° C for 20 sec, 60 ° C for 10 sec, and 70 ° C for 40 sec each (deviations for certain primer pairs [1-14]) are tabulated 3).
  • the purification of the PCR products was carried out using the QIAquick PCR Purification Kit® (Qiagen) according to the manufacturer's instructions.
  • the DNA concentration of the purified PCR products was determined using the NanoDrop® measurement principle and a NanoDrop® 2000c spectrophotometer.
  • the sequencing reaction was performed by MWG Eurofins (Ebersbach, Germany) using the Mix2Seq Kit according to the manufacturer's instructions.
  • Each PCR product was sequenced with the PCR primers (forward and reverse) and usually with an additional primer located further in the middle of the product. For PCR product 10, no additional intermediate primer was needed for sequencing. For PCR products 2 and 11, two internal primers were used for sequencing (see Table 5).
  • the evaluation of the sequencing was carried out with the software DNASTAR Lasergene. First, the individual chromatograms were checked and tailored. The individual fragments were then aligned to a reference sequence to assemble the entire genome sequence.
  • antigens eg allantoic fluid, egg skin, embryo homogenate, cell culture material can each be loaded with IB80 (or preferably IB80) - Particles)
  • Pipette 100 [iL into each well of the plate; cover with adhesive foil (also with all following steps!); Keep plates at 30 ° C for 2 hours.
  • Block Add 200 [iL blocking solution to each well; Keep plates at 30 ° C for 2 hours.
  • Evaluation The evaluation is carried out in relation to a test series which has been treated in exactly the same way as the antigen-loaded test series in which, however, an antigen is not contained (control). If a higher antibody binding is detected in the antigen-loaded samples, immunospecificity of the antibody tested is present. Used solutions:

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Wood Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • General Engineering & Computer Science (AREA)
  • Communicable Diseases (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pulmonology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Die Erfindung ist auf Mittel, Zusammensetzungen, Verwendungen und Verfahren zu einer neuen Variante des Infektiösen Bronchitis-Virus (IB-Virus) gerichtet.

Description

Infektiöse Bronchitis (IB)-Virus Varianten und diesbezügliche Zusammensetzungen, Verwendungen und Verfahren
Die Erfindung ist auf Mittel, Zusammensetzungen, Verwendungen und Verfahren zu einer neuen Variante des Infektiösen Bronchitis-Virus (IB-Virus) gerichtet. Die neue Variante wird hier auch als„IB80" bezeichnet.
Hinterlegungserklärung
Die Erfindung stellt die isolierten, Vögel betreffende Infektiöse Bronchitis-Virus-Varianten, kurz bezeichnet als I B-Viren, zur Verfügung, wie sie insbesondere bei der National Col- lection of Pathogenic Viruses (NCPV), Culture Collections, Public Health England, (Porton Down, Salisbury, SP4 OJG, UK) am 16. Juni 2016 unter der Hinterlegungsnummer 16061601 und am 7. Juli 2016 unter der Hinterlegungsnummer 16070701 im Rahmen des Budapester Vertrags über die internationale Anerkennung der Hinterlegung von Mikroorganismen für die Zwecke von Patentverfahren hinterlegt wurden. Proben der Hinterlegungen mit den angegeben Nummern 16061601 und 16070701 werden berech- tigten Einrichtungen ab dem Zeitpunkt der Hinterlegung für 30 Jahre und für die gesamte Lebensdauer eines Patents, welches basierend auf dieser Anmeldung erteilt wird oder die Priorität dieser Anmeldung in Anspruch nimmt, im Rahmen der Regelungen des Budapester Vertrags über die internationale Anerkennung der Hinterlegung von Mikroorganismen für die Zwecke von Patentverfahren zur Verfügung gestellt werden.
Hintergrund der Erfindung
In den vergangenen Jahren wurden häufig nennenswerte Legeleistungseinbrüche in Hühnerherden beobachtet, die mit üblichen gesundheitsfördernden Maßnahmen nicht oder nur unwesentlich zu mindern waren. Durch umfangreiches Beobachten entwickelte sich der Verdacht, dass dieser Legeleistungseinbruch auf ein Virus zurückzuführen sein könnte, ein Virus, das die Infektiöse Bronchitis auslöst.
Die Infektiöse Bronchitis (IB) ist eine Viruserkrankung der Vögel, die vor allem Haushuhn und Fasan befällt. Erreger ist das Infektiöse Bronchitis-Virus (IBV), ein Coronavirus.
Viren sind infektiöse Partikel, die sich als Virionen außerhalb von Zellen (extrazellulär) durch Übertragung verbreiten, aber als Viren nur innerhalb einer geeigneten Wirtszelle (intrazellulär) vermehren können. Alle Viren enthalten die genetische Information (zu ihrer Vermehrung und Ausbreitung, besitzen aber weder die Fähigkeit einer eigenständigen Replikation noch einen eigenen Stoffwechsel und sind deshalb auf den Stoffwechsel einer Wirtszelle angewiesen. Daher sind sich Virologen weitgehend darüber einig, Viren nicht zu den Lebewesen zu rechnen. Bislang sind etwa 3.000 Virenarten identifiziert worden. Viren befallen Zellen von Eukaryoten (Pflanzen, Pilze, Tiere, Menschen) und Prokaryoten (Bakterien und Archaeen).
Das Coronavirus ist Mitglied der Familie der Coronaviridae, die eine Familie innerhalb der Ordnung Nidovirales ist. Die Familie Coronaviridae wird auf der Grundlage von phylogenetischen Eigenschaften und Wirtsspektrum in zwei Unterfamilien und die Gattungen Alpha-, Beta- und Gamma- (ehemals Gruppen 1 , 2 und 3 der alten Gattung Coronavirus) und Deltacoronavirus sowie Torovirus und Bafinovirus unterteilt. Das Coronavirus ist der Unterfamilie Coronavirinae, darin der Gattung Gamma-Coronavirus, zugeordnet. Die Spezies-Bezeichnung nach ICTV (Report 2015) lautet: Avian Coronavirus. Diese umfasst neben dem Infektiöse Bronchitis-Virus (IBV), also den Erreger der Infektiösen Bronchitis, beispielsweise auch die ehemaligen Spezies Truthahn/Puten-Coronavirus (TCoV), Fasa- nen-Coronavirus (PhCoV), Enten-Coronavirus, Gänse-Coronavirus und Tauben- Coronavirus. Mit Genomlängen von mehr als 30.000 Nukleotiden gehören die Coronaviridae zu den RNA-Viren mit den größten bekannten Genomen. Im Gegensatz zur üblicherweise hohen Fehlerrate der RNA-Polymerase anderer RNA-Viren, die zu einer Beschränkung der Genomlänge auf etwa 10.000 Nukleotide führt, wird bei Coronaviren eine relativ hohe genetische Stabilität unter anderem durch eine 3'-5'-Exoribonuklease-Funktion des Proteins Nsp-14 erreicht. Das einzelsträngige RNA-Genom der Coronaviren ist etwa 27.600 bis 31.000 Nukleotide (nt) lang, womit Coronaviren die längsten Genome aller bekannten RNA-Viren aufweisen. Am 5'-Ende befinden sich eine 5'-Cap-Struktur und eine nicht- kodierende Region (UTR, untranslated region,„nicht translatierte Region") von etwa 200 bis 400 nt, die eine 65 bis 98 nt kurze, sogenannte Leader-Sequenz enthält. Am 3'-Ende fügt sich eine weitere UTR von 200 bis 500 nt an, die in einem poly(A)-Schwanz endet. Das Genom der Coronaviren enthält 6 bis 14 Offene Leserahmen (ORFs,„open reading frames"), von denen die beiden größten, die Gene für die Nichtstrukturproteine 1a und 1 b, nahe am 5'-Ende liegen und sich mit unterschiedlichen Leserastern geringfügig überlappen. Die Überlappungsstelle bildet eine Haarnadelstruktur, die bei 20 bis 30 % der Lesedurchläufe einen Leserastersprung bei der Translation an den Ribosomen ermöglicht und so zur Synthese von geringeren Mengen des 1 b-Proteins führt.
Morphologisch betrachtet besitzen die 120 bis 160 nm großen Virionen eine Virushülle, in die 3 oder 4 verschiedene Membranproteine eingelagert sind: Das große, glykosylierte S- Protein (180 bis 220 kDa) bildet als Trimer mit seinen keulenförmigen, etwa 20 nm nach außen ragenden Spikes (Peplomere) das charakteristische, kranzförmige Aussehen der Coronaviren (lat. Corona: Kranz, Krone). In geringeren Mengen liegt ein zweites Membranprotein E (9 bis 12 kDa) vor. Beim Humanen Coronavirus OC43 und den Coronaviren der Gruppe 2 liegt zusätzlich das HE-Protein (Hämagglutin-Esterase- Protein, 65 kDa) vor. Das ebenfalls in der Hülle verankerte M-Protein (23 bis 35 kDa) ist nach innen gerichtet und bekleidet die Innenseite der Virushülle (Matrixprotein). Im Inneren befindet sich ein helikaler Nukleoproteinkomplex. Dieser besteht aus dem Nukleoprotein N (50 bis 60 kDa), das mit einem Strang einer einzelsträngigen RNA mit positiver Polarität komplexiert ist. Bestimmte nach außen ragende Aminosäurereste des N-Proteins interagieren mit dem Matrixprotein M, so dass das Kapsid mit der Membraninnenseite assoziiert ist.
Die Vertreter der Virusfamilie Coronaviridae verursachen bei verschiedenen Wirbeltieren wie Säugetieren, Nagetieren, Fischen und Vögeln sehr unterschiedliche Erkrankungen. Coronaviren sind genetisch hochvariabel und einzelne Virusspezies können durch Über- Windung der Artenbarriere auch mehrere Wirtspezies infizieren. Bei Vögeln erfolgt die Ausscheidung des Virus über Sekrete und Exkrete. Eintrittspforten des Virus sind vor allem Lidbindehäute und Schleimhäute des oberen Verdauungstraktes und des Atemsystems. Die Übertragung erfolgt vor allem als Tröpfcheninfektion, wobei mit Viren beladene Staubpartikel und Tröpfchen weite Entfernungen zurücklegen können. Das Virus besiedelt das Flimmerepithel der Atemwege, aber auch der Reproduktionstrakt und die Nieren können befallen werden. In Geflügelbeständen breitet sich die Infektiöse Bronchitis (IB) rasch aus und vor allem Jungtiere zeigen eine hohe Erkrankungshäufigkeit. Die Mortalität variiert je nach Virus-Variante. Die Inkubationszeit beträgt 18 bis 36 Stunden. Klinisch treten Atemnot, Nasenausfluss, röchelnde Atemgeräusche, Niesen und Bindehautentzündung auf. Zudem sind Allgemeinstörungen mit Fressunlust und Rückgang der Wasseraufnahme zu beobachten. Eileiterinfektionen führen später zu Legestörungen wie blassen, dünnschaligen oder deformierten Eiern, Windeiern, deutlich verminderter oder vollständig fehlender Legetätigkeit („falsche Leger") und verminderter Schlupfrate. Die Dauer der Erkrankung sowie die klinischen Symptome können variieren. Häufig wird das Krankheitsgeschehen durch bakterielle Sekundärinfektionen verkompliziert. Bei manchen Virus-Stämmen kann eine Niereninfektion nachfolgen, die zu einer hohen Mortalität durch Nierenversagen bzw. Blutvergiftung (Toxinämie) führen kann. Bei vordergründiger Atemwegsproblematik verenden Hühner teils aufgrund von trachealer Okklusion durch Ansammlung von Schleim und Entzündungsprodukten. Die schnelle Ausbreitung im Bestand und die klinischen Erscheinungen erlauben eine Verdachtsdiagnose. Die Diagnosestellung kann mit Hilfe pathologischer Untersuchung verendeter Vögel sowie anhand molekularbiologischer, serologischer und virologischer Nachweisverfahren erfolgen. Differentialdiagnostisch kommen sämtliche Atemwegserkrankungen bzw. Erreger, die den Urogenitaltrakt beeinträchtigen, in Frage. Virale Infek- tionen wie z.B. Infektiöse Laryngotracheitis, Newcastle-Krankheit und das Egg-Drop- Syndrome, aber auch bakterielle Infektionen wie z.B. Mycoplasmose oder der Infektiöse Hühnerschnupfen sowie nicht infektiöse Erkrankungen (z.B. Fütterungsfehler, Managementfehler) sind abzugrenzen. Eine Behandlung der Infektiösen Bronchitis ist allenfalls symptomatisch möglich. Die Bekämpfung basiert daher vor allem auf der prophylakti- sehen Impfung, die bereits unmittelbar nach Schlupf des Kükens (Broiler) bzw. in den ersten Lebenswochen der Tiere erfolgen kann. Je nach Infektionsdruck ist die Impfung in gefährdeten Gebieten in regelmäßigen Abständen gemäß Impfstoffherstellerangaben, gegebenenfalls auch unter Einsatz verschiedener Impfstoff- Varianten, im Impfprogramm zu wiederholen. Derzeit erscheint aufgrund häufig auftretender Infektionen des Infektiösen Bronchitis Virus auch in geimpften Herden die Bekämpfungs- bzw. Prophylaxestrategie durchaus verbesserungswürdig. Die Haltung von Geflügel in der Aufzuchts- sowie Produktionsphase stellt angesichts des Vorkommens der Infektiösen Bronchitis nach wie vor eine große Herausforderung dar. Die Erkrankung eines Bestandes ist sowohl unter Aspekten der Tiergesundheit und somit dem Allgemeinbefinden der erkrankten Tiere, als auch unter wirtschaftlichen Aspekten von großer Bedeutung. Wie bereits eingangs erläutert ist die Infektiöse Bronchitis (IB) eine akute und hoch ansteckende Erkrankung der Atemwege von Hühnern. Die Krankheit wird durch das Infektiöse Bronchitis Virus (IBV), einem Coronavirus, verursacht und ist gekennzeichnet durch respiratorische und den Urogenitaltrakt betreffende Symptome einschließlich Keuchen, Niesen, tracheales Rasseln und Nasenausfluss. Bei jungen Hühnern kann schwere Atemnot sowie Nephritis auftreten. Bei Legehennen kann. Atemnot, , (erheblicher) Rückgang der Eierproduktion und Verlust der Eiqualität im Inneren (wässriges Eiweiß) und Äußeren (blasse Eier (bei Braunlegern), dünnschalige Eier, weiche, deformierte , raue Schalen, fehlende Schalen (Windeier)) beobachtet werden.
Zur Ätiologie des Infektiösen Bronchitis Virus (IBV) ist festzuhalten, dass IBV das erste beschriebene Coronavirus ist und genetisch und phänotypisch sehr stark variiert, mit hunderten von beschriebenen Serotypen und Stämmen. Coronaviren enthalten das größte bekannte virale RNA-Genom nach Anzahl von Nukleotiden, mit annähernd 30.000 Basen. Die RNA bildet einen einzelnen Strang und ein einzelnes Segment. Die IBV- Diversität basiert auf einem Fehler der Transkription, der von hoher Relevanz ist, wenn er in genomischen Sequenzen auftritt, die für Proteine kodieren, die bei der Anlagerung an die Zielzelle oder beim Induzieren von Immunantworten beteiligt sind. Aufgrund von Transkriptionsfehlern können Varianten auftreten, die in krankheitsanfälligen Hühnern einen evolutionären Vorteil für diese Variante aufweisen. Es können sehr große genomische Veränderungen stattfinden, z.B. mit vollständigem Gen-Austausch, durch Reassortment („Neuanordnung") bei der Replikation, wobei multiple subgenomische mRNAs erzeugt werden und das Reassortment bei Coinfektionen ermöglichen. Die gegenwärtige IBV-Problematik lässt sich somit wie folgt zusammenfassen:
Das Infektiöse Bronchitis Virus (IBV) ist der Erreger einer akuten und hoch ansteckenden Krankheit, die Hühner jeden Alters befällt und eine große wirtschaftliche Belastung in der Geflügelindustrie darstellt. Das Virus weist ein breites Spektrum von antigenetisch und genetisch unterschiedlichen Virustypen auf, was Prävention und Kontrolle dieses Erre- gers äußerst komplex macht. Das I B-Virus ist hauptsächlich beim Huhn zu finden. Darüber hinaus können das I B-Virus oder IBV-ähnliche und andere Vogelcoronaviren in Hausund Wildtieren, einschließlich Hausgeflügel. Rebhühnern. Gänsen, Tauben, Perlhühnern. Krickenten. Enten und Pfauen auftreten (Cavanagh, D., 2005, Coronaviruses in poultry and other birds, Avian Pathol. 34 (6), 439-448; Cavanagh, D., 2007, Coronavirus avian infection bronchitis virus, Vet. Res. 38(2), 281 -297).
Das IBV ist ein einzelsträng iges, positiv-orientiertes RNA-Virus der Familie Coronaviridae, Gattung Gammacoronavirus (Cavanagh und Naqi, 2003; International Committee on Taxonomy von Viren, http://www.ictvonline.org/virustaxonomy.asp). Das virale Genom enthält zwei nicht-translatierte Regionen (UTRs) am 5'- und 3'-Ende (Boursnell et al. 1987; Ziebuhr et al. 2000). zwei überlappende offene Leserahmen (ORFs). die für die Polyproteine 1 a und 1 ab kodieren, und Regionen, die für die wichtigsten Strukturproteine kodieren - Spike (S), Hülle (E), Membran (M) und Nucleocapsid (N) (Spaan et al. 1988; Sutou et al.. 1988.). Darüber hinaus wurden zwei akzessorische Gene. ORF3 und ORF5, welche die Proteine 3a und 3b beziehungsweise 5a und 5b exprimieren. beschrieben (Casais et al. 2005; Hodgson et al, 2006; Lai und Cavanagh, 1997). Das S-Protein (-3462 nt), das in der Oberfläche der Virusmembran lokalisiert ist, ist der wichtigste Auslöser für neutralisierende Antikörper (Cavanagh und Naqi, 1997; Winter et al., 2008) und ist für die Virusbindung und das Eindringen in die Wirtszellen verantwortlich (Cavanagh et al, 1986a; Koch et al, 1990; Niesters et al, 1987). Es wird post-translational an einer Spaltstelle mit multiplen basischen Aminosäuren (Cavanagh et al., 1986b) in die Amino-terminale S1- (-535 Aminosäuren) und die Carboxyl-terminale S2-Untereinheit (-627 Aminosäuren) gespalten.
Die Beobachtung, dass sich IB Serotypen auf der genomischen Ebene um 20% bis 25% und in bis zu 50% der Aminosäuren des S1 -Proteins (Cavanagh et al., 2005) unterscheiden können, hat zu beträchtlicher Aufmerksamkeit (Cavanagh und Gelb 2008) geführt. Solche Variabilität kann zu wichtigen biologischen Unterschieden zwischen Stämmen führen und als Ergebnis einer begrenzten Anzahl von Aminosäureveränderungen im Spike-Protein können neuartige Serotyp-Varianten entstehen. Nukleotid-Heterogenität ist im S1-Teil des S-Gens weit verbreitet und ist größtenteils innerhalb drei verschiedener hypervariabler Regionen (HVRS) des S1 -Gens (aa 38-67, 91-141 und 274-387) (Cavanagh et al. 1988; häufigsten Moore et al., 1997) enthalten. Demgemäß wurde üblicherweise die Analyse der vollständigen oder teilweisen S 1 -Gen-Nukleotidsequenz verwendet, um virale genetische Typen zu bestimmen. Derzeit sind mehr als 50 verschiedene antigenetische und genetische Typen von IBV anerkannt, einige mit erheblichen wirtschaftlichen Auswirkungen auf die Tierhaltung, und einige auf bestimmte geographische Gebiete beschränkt (de Wit et al, 201 1a: Jackwood, 2012). Wirksame Überwachung wird in erster Linie auf die Identifizierung des krankheits- verursachenden Virustyps gestützt (Jackwood und de Wit, 2013). Eine Vielzahl von Verfahren ist entwickelt worden, um IBV-Stämme zu differenzieren. Systeme, welche die antigenetischen oder genetischen Eigenschaften eines Isolats untersuchen, ermöglichen die Beschreibung von Serotypen und Genotypen, während Methoden, die auf die Immunantwort von Hühnern gegen einen IBV-Stamm ausgerichtet sind, zur Definition von Protektortypen führen (Lohr, 1988). Von großer Bedeutung ist jedoch, dass die Genotyp-, Serotyp- oder Protektortyp-basierten Ansätze IB- Viren nicht immer in der gleichen Weise eingruppieren. Mangels schneller und geeigneter biologischer Assays zur Klassifizierung von IBV sind Analysen der S1-Sequenzdaten die am häufigsten verwendeten Verfahren, um IBV-Stämme Gruppen zuzuordnen, die bislang scheinbar willkürlich in genetische Typen, Genotypen, Kladden oder Cluster unterteilt werden.
Das Infektiöse Bronchitis Virus (IBV) ist der Erreger einer hoch ansteckenden Krankheit in der globalen Geflügelindustrie, was gravierende wirtschaftliche Verluste verursacht. Das Virus existiert in einer Vielzahl genetisch unterschiedlicher Virustypen. Sowohl phylogenetische Analyse als auch Messungen der paarweisen Ähnlichkeit zwischen Nukleotid- oder Aminosäuresequenzen wurden verwendet, um IBV-Stämme zu klassifizieren. Bis vor kurzem gab es allerdings keinerlei Konsens über die Methode, mit der IBV-Sequenzen verglichen werden sollten. Heterogene Bezeichnungen genetischer Gruppen, die mit phylogenetischer Geschichte unvereinbar sind, wurden übernommen, was zu einer verwirrenden Koexistenz mehrerer Systeme der Genotypisierung führte. Die Akzeptanz einer international anerkannten viralen Nomenklatur ist jedoch von entscheidender Bedeutung für die Durchführung fundierter Studien und um neue Erkenntnisse bezüglich Epidemiologie und Evolution von IBV zu erzielen und zu evaluieren. Um die vorstehend beschriebene Problematik des Standes der Wissenschaft zu lösen, haben nun Valastro et al. ein, in 2016 publiziertes (Valastro V., Holmes E.C , Britton P., Fusaro A., Jackwood M.W., Cattoli G., Monne I., S1 gene-based phylogeny of infectious bronchi- tis virus: An attampt to harmonize virus Classification, Infection, Genetics and Evolution, 39 (2016), 349-364), neues Klassifikationsschema auf Basis phylogenetischer Beziehungen (basierend auf dem S1 -Gen) entwickelt, das aktualisiert und überarbeitet werden kann, sobald neue S1-Sequenzen verfügbar werden. Valastro et al. beschreiben ein einfaches und reproduzierbares, Phylogenie-basiertes Klassifizierungssystem, kombiniert mit einer eindeutigen und rationalen Nomenklatur der Abstammungslinie für die Zuordnung von IBV-Stämmen. Durch die Verwendung von vollständigen S1-Gensequenzen konnten diese miteinander verglichen und prozentuale Ähnlichkeiten und Divergenzen zueinander ermittelt werden. Die Sequenzanalysen resultierten in eine Einteilung in 6 Genotypen, wobei ein Grenzwert von ca. 30% Sequenzunterschied zwischen den einzelnen IBV-Stämmen im S1-Gen ermittelt wurde, ab dem die Stämme einem neuen Genotyp zugeordnet wurden. Die große Mehrheit der IBV-Stämme gehört dem Genotyp I an und bildet innerhalb dieses Genotyps wiederum Subcluster aus, welche als Linien innerhalb eines Genotyps bezeichnet werden. Für den Genotyp I werden insgesamt 27 Linien und für die Genotypen li-VI jeweils eine Linie beschrieben. Neben den Genotypen und Linien werden einzelne S1-Gensequenzen von IBV-Stämmen als UV (Unique Variant) bezeichnet. Diese konnten keiner der definierten Linien zugeordnet werden. Aufgrund der hohen Veränderungsrate innerhalb der I B-Viren, schlagen Valastro et al. vor, dass der Rück- schluss auf die phylogenetischen Beziehungen allein ein besser geeignetes Kriterium für die Sequenz-Klassifizierung darstellt als paarweise Sequenzvergleiche, zumal das von Valastro et al. vorgestellte Klassifikationsschema beim Auffinden neuer S1-Sequenzen aktualisiert und überarbeitet werden kann.
Vor dem Hintergrund der im Stand der Technik durch das Infektiöse Bronchitis Virus bei der Haltung von Geflügel insbesondere in der Aufzuchts- sowie Produktionsphase verur- sachten Probleme, wie insbesondere auch aufgrund der häufig sogar in geimpften Herden auftretenden Infektionen, liegt der Erfindung die Aufgabe zugrunde, Grundlagen für die Nachweis-, die Bekämpfungs- bzw. die Prophylaxestrategie bereitzustellen, wobei insbesondere die hier offenbarte neue IBV-Variante (IB80) als Erreger betroffen sein soll.
Die vorliegende Erfindung zielt somit auf einen deutlichen Fortschritt bei der Lösung der besonderen durch das IB80-Virus verursachten Problemstellungen in der Geflügelhaltung ab, mit dem Ziel schnellere, verlässlichere und effektivere Mittel für die Bekämpfung, insbesondere die Diagnostik, Prävention und/oder Behandlung von Infektiöser Bronchitis bei Vögeln bereitzustellen.
Beschreibung der Erfindung Gelöst wird die der Erfindung zugrundeliegende Aufgabe durch die Bereitstellung des in den Ansprüchen angegebenen Mittels wie das erfindungsgemäße IB-Virus (IB80), die erfindungsgemäße Nukleinsäure, das erfindungsgemäße Protein, der erfindungsgemäße Vektor, Antikörper, Impfstoff, die in den Ansprüchen angegebene Verwendung des erfindungsgemäßen IB-Virus und die erfindungsgemäße Pharmazeutische Mischung.
Dementsprechend sind die hier beschriebenen neuen erfindungsgemäßen Mittel, Verwendungen, Mischungen und Verfahren auf eine neue Variante IB80, und deren engste Verwandte gerichtet, wobei die erfindungsgemäßen Mittel, Verwendungen, Mischungen und Verfahren nützlich sind für die Diagnose und Prävention von Infektionen mit dem IB80-Virus; einschließlich der damit verbundenen Entwicklung von In-Vitro-Diagnostika, Impfstoffen und zur Vorbeugung von Infektiöser Bronchitis, und damit einhergehender Symptome oder Erkrankungsbilder, wie unten weiter erläutert. Die vorliegende Erfindung basiert auf der Isolierung und Identifizierung eines neuen IB- Virus (IB80) in Vögeln, insbesondere Hühnern. Dieses IB-Virus (einschließlich der erfindungsgemäßen Varianten) wird in diesem Text auch als„IB80" benannt. IB80 wurde aus dem bei einer Monitoringuntersuchung einer zu diesem Zeitpunkt klinisch unauffälligen Hühnerherde gewonnenem Material isoliert. Zur kulturellen Anzucht wurde ein Pool von Caecaltonsillen verwendet. Dieses Organmaterial wurde in 1xPBS inkl. Gentamycin und Amphotericin B bei Raumtemperatur homogenisiert, anschließend zentrifugiert und der Überstand mit einem 0,45 μηΊ-Filter filtriert. Anschließend folgte eine Inkubation des Filtrats bei Raumtemperatur. Entsprechende Methoden und die anzuwendenden Bedingungen zur Isolierung von Virus-Material sind dem Fachmann auf diesem Gebiet be- kannt.
Das isolierte Virus ist ein Mitglied der Familie der Coronaviridae, eine Familie von RNA- Viren mit den größten bekannten Genomen. Dementsprechend betrifft die Erfindung das isolierte IB-Virus, das morphologisch und phylogenetisch zu bekannten Mitgliedern der Unterfamilie Coronavirinae und, darin der Gattung Gamma-Coronavirus, der Spezies Avian Coronavirus angehört. Wie eingangs bereits erwähnt, ist die Infektiöse Bronchitis (IB) eine Viruserkrankung der Vögel, die vor allem Haushuhn und Fasan befällt und wobei der Erreger das Infektiöse Bronchitis-Virus (IBV), ein Coronavirus, ist. Zur weiteren Veranschaulichung im Rahmen der vorliegenden Erfindung wird hier insbesondere auf die weiter oben dargelegten Begriffe und Erläuterungen zu„Virus",„Coronavirus",„Ge- nom",„RNA-Viren",„Morphologie",„Infektiöse Bronchitis",„Ätiologie des Infektiöse Bronchitis Virus",„IB Serotypen",„Genotyp-, Serotyp- oder Protektortyp-basierte Ansätze zur Eingruppierung von IB-Viren", „viralen Nomenklatur", „Phylogenie-basiertes Klassifizierungssystem sowie„S1-Gen" bzw.„S1-Gensequenzen" verwiesen und auf die hier ausdrücklich zum leichteren Verständnis der vorliegenden Erfindung Bezug genommen wird. Kurze Beschreibung der erfindunqsqemäßen Sequenzen:
Sequenz Sequenz Sequenz Sequenz
ID NO: ID NO:
1 5'UTR 1 1 Prot 1a
2 Gen 1ab 12 Prot 1 b
3 Gen S 13 Prot S
4 Gen 3 14 Prot 3a
5 Gen M 15 Prot 3b
6 Nicht-kodierender Bereich 16 Prot 3c
7 Gen 5 17 Prot M
8 Gen N 18 Prot 5a
9 3'UTR 19 Prot 5b
10 Virus komplett 20 Prot N
In einem Aspekt betrifft die Erfindung somit ein Vögel und insbesondere Hühner betreffendes, isoliertes IB-Virus, wie hierin beschrieben und definiert. Insbesondere betrifft die Erfindung hierbei ein isoliertes IB-Virus, entsprechend der Hinterlegungsnummer 16061601 (16. Juni 2016) oder der Hinterlegungsnummer 16070701 (7. Juli 2016), wobei diese Hinterlegungen, wie oben unter „Hinterlegungserklärung" angegeben, bei der National Collection of Pathogenic Viruses (NCPV), Culture Collections, Public Health England, (Porton Down, Salisbury, SP4 0JG, UK) erfolgt sind. In einem weiteren Aspekt betrifft die Erfindung ein isoliertes IB-Virus umfassend a) eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9,
c) eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäurenkette ausgewählt aus der Gruppe der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 und 20,
d) eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10 und/oder
e) eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäurenkette mit einer Identität von > 85% zur Aminosäuresequenz SEQ ID NO: 13 oder zu einer
Aminosäuresequenz ausgewählt aus der Gruppe der Aminosäuresequenzen mit einer Identität zu > 98% zu einer der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 14, 15, 16, 17, 18, 19 oder 20.
Im vorstehenden Aspekt betrifft die Erfindung auch ein isoliertes IB-Virus umfassend unter d) vorzugsweise eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 90%, weiter bevorzugt zu > 95%, noch weiter bevorzugt zu > 98% und ganz besonders bevorzugt zu > 99%, zur SEQ ID NO: 3; und/oder vorzugsweise eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 99% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10. Im vorstehenden Aspekt betrifft die Erfindung auch ein isoliertes IB-Virus umfassend unter e) vorzugsweise eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäurenkette mit einer Identität von > 90%, weiter bevorzugt von > 95%, noch weiter bevorzugt von > 98% und ganz besonders bevorzugt von > 99%, zur Aminosäuresequenz SEQ ID NO: 13; und/oder vorzugsweise zu einer Aminosäuresequenz ausgewählt aus der Gruppe der Aminosäuresequenzen mit einer Identität zu > 99% zu einer der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 14, 15, 16, 17, 18, 19 oder 20.
Ein vorstehend definiertes erfindungsgemäßes isoliertes IB-Virus (IB80) kann in einer Ausführungsform der Erfindung tot oder attenuiert (abgeschwächt) oder vital sein. In einem weiteren Aspekt betrifft die Erfindung die vollständige genomische Sequenz des erfindungsgemäßen, Vögel und insbesondere Hühner betreffenden, isolierten IB-Virus.
In einem verwandten Aspekt betrifft die Erfindung auch aus dem erfindungsgemäßen IB- Virus isolierte Nukleinsäuremoleküle, wie zuvor definiert, oder Fragmente davon.
In einem weiteren Aspekt betrifft die Erfindung auch, wie zuvor angegeben, aus dem erfindungsgemäßen IB-Virus isolierte Proteine oder Polypeptide, wie zuvor definiert und/oder kodiert durch eine wie oben definierte Nukleinsäure, einschließlich viraler Proteine, die aus Zellen isoliert werden, die mit dem IB-Virus infiziert sind, aber nicht in vergleichbaren nicht-infizierten Zellen vorhanden sind; oder Fragmente davon.
In einem weiteren Aspekt betrifft die Erfindung einen Vektor, umfassend einen Nukleinsäureabschnitt wie oben definiert. Weiterhin betrifft die Erfindung in einem Aspekt einen isolierten Antikörper oder isoliertes antigenbindendes Fragment davon, der immunospezifisch an ein Virus, ein Protein oder eine Nukleinsäure, wie diese jeweils oben definiert sind, bindet.
Ferner betrifft die Erfindung in einem Aspekt einen Impfstoff, umfassend eine therapeu- tisch und/oder prophylaktisch wirksame Menge eines IB-Virus, wie dieser oben definiert ist, oder eine therapeutisch und/oder prophylaktisch wirksame Menge einer oder mehrerer Nukleinsäuren, wie diese oben definiert sind, und/oder eines oder mehrerer Proteine, wie diese oben definiert sind, und einen pharmazeutisch akzeptablen Träger.
Im Rahmen der vorliegenden Erfindung umfasst der Begriff "Impfstoff", oder der synony- me Begriff „Vakzin", neben der biologischen, therapeutischen und/oder präventiven Funktion von Impfstoffen (Vakzinen) insbesondere auch deren gesamte regulatorische Bandbreite, wie beispielsweise zugelassene Impfstoffe, zulassungsfreie Impfstoffe, einschließlich insbesondere sogenannter autogener und/oder bestandsspezifischer Impfstoffe, und/oder Impfstoffe im Entwicklungs- und Zulassungsverfahren. Eine Impfung, auch Schutzimpfung oder Vakzination genannt, ist die Gabe eines Impfstoffes mit dem Ziel, vor einer (übertragbaren) Krankheit zu schützen. Sie dient der Aktivierung des Immunsystems gegen spezifische Stoffe. Impfungen wurden z.B. als vorbeugende Maßnahme gegen Infektionskrankheiten entwickelt. Eine vorbeugende Impfung gegen eine Infektionskrankheit beruht auf einer spezifischen, aktiven Immunisie- rung gegen den Krankheitserreger und wird daher manchmal auch als Aktiv-Impfung bezeichnet. Ziel der aktiven Impfung ist es, das körpereigene Immunsystem zu befähigen, auf eine Infektion mit dem Erreger so rasch und wirksam zu reagieren, dass daraus keine oder nur eine abgeschwächte Infektionskrankheit resultiert. Es wird zwischen attenuierten Impfstoffen (Lebend Impfstoffe; abgeschwächte Impfstoffe) und Inaktivatimpfstoffen (Totimpfstoffe) unterschieden; zu letzteren gehören auch Toxoid- impfstoffe. Dagegen handelt es sich bei der Passiv-Impfung (auch Heilimpfung) um eine lediglich passive Immunisierung durch Gabe von Antikörpern.
Die Wirkungsweise und Wirksamkeit von Impfstoffen soll im Folgenden kurz erläutert werden. Je nach Impfstoff und Immunisierungsart (passive oder aktive Immunisierung) werden für die Verabreichung von Impfungen unterschiedliche Applikationsverfahren angewandt: Aktive Impfungen werden parenteral („unter Umgehung des Magen-Darm- Traktes") mit einer Spritze vorgenommen. Man unterscheidet dabei intradermale („in die Haut"), subkutane („unter die Haut") oder intramuskuläre („in den Muskel") Injektionen. Die intradermale Impfung kann auch mit einer Lanzette oder einer Impfpistole erfolgen. Für einige wenige Immunisierungen wurde bzw. wird der Impfstoff oral (in den Mund, „Schluckimpfung") oder nasal (in die Nase) verabreicht, auch transdermal mit Hautpflaster. Ein Großteil der aktiven Impfungen wird intramuskulär verabreicht. In der Wirtschafts- geflugelhaltung erfolgt die Gabe von Lebendvakzinen über das Tränkwasser, mittels Spray (Aerosol) oder über die Verabreichung von Augentropfen (,,eye-drop"-Verfahren). Inaktivatvakzine (Inaktivimpfstoffe) werden meist intramuskulär appliziert.
Die aktive Impfung entspricht der Impfung im medizinischen Sinne und beruht auf einer aktiven Immunisierung. Dabei wird das Immunsystem zur Bildung einer erregerspezifi- sehen Immunkompetenz angeregt, ohne die Infektionskrankheit selbst durchmachen zu müssen. Hierzu dienen Lebend- oder Totimpfstoffe. Der Lebendimpfstoff enthält abgeschwächte, noch vermehrungsfähige Erreger, welche die Krankheit beim immunkompetenten Impfling nicht auslösen. Bei einem Totimpfstoff wurden diese Erreger dagegen abgetötet; oder es liegen nur noch Bruchstücke des Erregers vor. Nach Eindringen des Impfstoffs in den Körper werden seine Eiweiße (Proteine) und/oder Zuckermoleküle durch im Blut zirkulierende und/oder gewebsständige immunkompetente weiße Blutkörperchen als körperfremde Antigene erkannt. Es folgt die primäre Immunantwort durch erregerspezifische Prägung immunkompetenter Lymphozyten in Form langlebiger Gedächtniszellen. Entscheidend für den Schutz bei einer späteren Infektion ist, dass für den Körper die Antigene des Impfstoffs denen des Erregers der Infektionskrankheit weitgehend gleichen. Kommt es nun zur Infektion, so erkennen die Gedächtniszellen am eingedrungenen Erreger die Antigene des früheren Impfstoffes und bewirken, dass sich einerseits Lymphozyten zu kurzlebigen Plasmazellen differenzieren, die Antikörper produzieren, andererseits zu T-Lymphozyten und NK-Zellen, welche die zelluläre Abwehr darstellen. Die Impfung soll also das Fortbestehen einer Immunität gegen den Erreger bewirken, so dass es nach Infektion aufgrund spezifischer und schnell induzierter Immunantwort nicht zur Infektionskrankheit kommt. Toxoidimpfstoffe, die nur den biologisch inaktiven Bestandteil (Toxoid) des Toxins eines Erregers enthalten (vergleiche z. B. das Tetanus-Toxoid), gehören ebenfalls zu den Totimpfstoffen. Sie vermindern nicht die Vermehrung der Erreger im Körper. Bei einer erfolgten Infektion unterbrechen sie diese nicht, verhindern aber den Ausbruch der klinischen Krankheit beim Geimpften insoweit, dass hier die Toxine der Erreger nicht wirksam werden. Unterschiedliche Lebendimpfstoffe können entweder simultan oder im Abstand von einigen Wochen verabreicht werden. Für Totimpfstoffe, auch in Kombination mit Lebend Impfstoffen, gilt Ähnliches. Die Applikationen sollten sich stets nach den Herstellerangaben richten. Eine passive Impfung ist dann indiziert, wenn die Gefahr besteht durch Kontakt mit dem Erreger eine schwerwiegende Infektionskrankheit zu erleiden, das Immunsystem des Betroffenen sich aber weder durch eine vorangegangene Impfung noch durch eine frühere (ggf. auch symptomlose,„stille Feiung") Infektion mit diesem Erreger auseinanderset- zen konnte, und der Infizierte somit nicht geschützt ist. Hierbei wird dem Betroffenen ein Immunserum injiziert, welches in hoher Konzentration Antikörper gegen den Krankheitserreger enthält. Da das Immunsystem in diesem Fall nicht aktiv eigene Antikörper produziert, sondern diese dem Körper von außen zugeführt werden, handelt es sich hierbei um eine passive Immunisierung des Impflings. Hierzu verwendet man bevorzugt gentechno- logisch auf Zellkulturen erzeugte monoklonale Antikörper oder, falls solche nicht zur Verfügung stehen, Extrakte aus dem Blut von Subjekten, die die betreffende Infektionskrankheit bereits durchgemacht haben, oder aus dem Blut von Tieren, die gezielt mit dem Erreger infiziert wurden (Rekonvaleszenten-Serum). Die passive Immunisierung ist also eine Notfallmaßnahme im Sinne einer Post-Expositionsprophylaxe. Der Vorteil von Immunseren ist der schneller einsetzende Schutz: Die Antikörper müssen nicht erst innerhalb von ein bis zwei Wochen gebildet werden, sondern stehen gleich nach der Injektion des Immunserums zur Infektionsabwehr zur Verfügung. Nachteilig ist, dass der Schutz nur einige Wochen anhält. Danach sind die verabreichten Antikörper vom Empfänger abgebaut und sein Organismus ist durch eine wiederholte Infektion mit demselben Erreger erneut gefährdet. Dies ist darauf zurückzuführen, dass das Immunsystem durch die Gabe von Immunserum nicht stimuliert wird, über Gedächtniszellen ein eigenes Immungedächtnis hinsichtlich der Erreger auszubilden. Falls das Immunserum von Tier oder Mensch stammt, kommt als weiterer Nachteil hinzu, dass es abgesehen von den gewünschten Antikörpern, Spuren von Fremdeiweiß oder Polysacchariden des Spenders enthalten kann. Das Immunsystem des Empfängers setzt dann eine Kaskade immunologischer Reaktionen gegen diese körperfremden Bestandteile in Gang. Dies führt dazu, dass die im Impfserum angereicherten Antikörper schneller ausgeschieden werden und damit kürzer als gewünscht wirksam bleiben. Bei wiederholter Gabe von Fremdserum besonders derselben Tierart kann es außerdem zu einer unerwünschten allergischen Reaktion des Empfängers in Form einer Serumkrankheit oder eines allergischen Schocks kommen. Daher werden solche Immunseren nach Möglichkeit durch monoklonale Antikörper ersetzt.
In einem anderen Aspekt betrifft die Erfindung eine Verwendung eines erfindungsgemäßen IB-Virus (IB80), wie dieser oben definiert ist, oder einer oder mehrerer Nukleinsäu- ren, wie diese oben definiert sind, und/oder eines oder mehrerer Proteine, wie diese oben definiert sind, für die Herstellung eines Impfstoffes zur Vorbeugung gegen durch ein Virus, wie dieses oben definiert ist, erzeugte Symptome oder Erkrankungen. Die aus einer IBV-Infektion resultierenden Symptome oder klinischen Erkrankungsbilder betreffen die Eintrittspforten bzw. Replikationsorte des Virus, also vor allem Lidbinde- und Schleimhäute des oberen Verdauungs- und Atemtraktes, sowie auf das Flimmerepithel der Atemwege, den Reproduktionstrakt und die Nieren. Klinisch sind Atemnot, Nasenaus- fluss, röchelnde Atemgeräusche, Niesen und Bindehautentzündung zu nennen. Zudem umfassen die Symptome der Erkrankung Allgemeinstörungen mit Fressunlust, Rückgang der Wasseraufnahme, Eileiterinfektionen, Legestörungen wie blasse, dünnschalige, deformierte Eier, Windeier, deutlich verminderte oder vollständig fehlende Legetätigkeit („falsche Leger") und verminderte Schlupfrate. Eine gegebenenfalls nachfolgende Niereninfektion kann aufgrund von Nierenversagen bzw. daraus resultierender Blutvergiftung (Toxinämie) zum Tod der betroffenen Tiere führen, wohingegen bei vordergründiger schwerwiegender Atemwegsproblematik eine tracheale Okklusion durch Ansammlung von Schleim und weiteren Entzündungsprodukten todesursächlich sein kann.
In einem weiteren Aspekt betrifft die Erfindung auch eine Verwendung eines IB-Virus, wie dieser oben definiert ist, oder einer oder mehrerer Nukleinsäuren, wie diese oben definiert sind, und/oder eines oder mehrerer Proteine, wie diese oben definiert sind, für die Herstellung monoklonaler oder polyklonaler Antikörper. Schließlich betrifft die Erfindung noch eine Pharmazeutische Mischung, umfassend eine therapeutisch und/oder prophylaktisch wirksame Menge eines Antikörpers oder eines isolierten antigenbindenden Fragmentes davon zur therapeutischen oder prophylaktischen Behandlung von durch ein Virus, wie dieses erfindungsgemäß definiert ist, erzeugten Symptomen oder Erkrankungen. Weitere, die Erfindung betreffende Aspekte sollen nachfolgend noch erläutert werden, um den Umfang und die Bedeutung der vorliegenden Erfindung weiter zu illustrieren.
In anderen Aspekten betrifft die Erfindung die Verwendung des isolierten IB80 für diagnostische und therapeutische Verfahren. In einer Ausführungsform stellt die Erfindung ein Verfahren zum Nachweis eines Antikörpers in einer biologischen Probe bereit, der immunospezifisch für die Gattung Gamma-Coronavirus, und die Spezies Avian Coronavirus insbesondere für das Infektiöse Bronchitis-Virus (IBV) und ganz besonders für die Variante IB80, ist, wobei von den hierin beschriebenen Erfindungsgegenständen mindestens ein erfindungsgemäßes isoliertes IB-Virus oder eines der erfindungsgemäßen Proteine oder Polypeptide, wie hierin beschrieben, eingesetzt werden.
In einer anderen spezifischen Ausführungsform stellt die Erfindung ein Verfahren zum Screenen auf einen Antikörper bereit, der die Variante Infektiöse Bronchitis-Virus (IB80) immunspezifisch bindet und neutralisiert. Ein solcher Antikörper ist für eine passive Immunisierung oder Immuntherapie eines mit IB80 infizierten Subjekts nützlich.
In einem weiteren Aspekt stellt die Erfindung isolierte Antikörper oder Antigen-bindende Fragmente davon bereit, welche immunspezifisch an das oben beschriebene Infektiöse Bronchitis-Virus (IB80) der Erfindung binden. In anderen Aspekten betrifft die Erfindung Verfahren zum Nachweis des Vorhandenseins, der Aktivität oder Expression von IB80, oder Fragmenten davon, in einem biologischen Material, wie Zellen, Blut, Speichel, Urat, Fäkalien usw.
In einem verwandten Aspekt betrifft die Erfindung ein Verfahren zum Nachweis des erfindungsgemäßen Infektiöse Bronchitis-Virus (IB80), um dessen Anwesenheit in einer biologischen Probe festzustellen, wobei das Verfahren umfasst: (a) Kontaktieren der Probe mit einem Agens, das selektiv an ein Infektiöse Bronchitis-Virus (IB80) bindet; und (b) Nachweisen, ob das Agens an das Infektiöse Bronchitis-Virus (IB80) in der Probe bindet.
In einem weiteren Aspekt betrifft die Erfindung ein Verfahren zur Bestimmung der Anwe- senheit des erfindungsgemäßen Polypeptids in einer biologischen Probe, wobei das Verfahren umfasst: (a) Kontaktieren der biologischen Probe mit einem Agens, das selektiv an das Polypeptid bindet; und (b) Nachweisen, ob das Agens an das Polypeptid in der Probe bindet. In einem weiteren Aspekt betrifft die Erfindung ein Verfahren zum Nachweis des Vorhandenseins eines aus dem erfindungsgemäßen IB80 abgeleiteten Nuklein- säure-Moleküls in einer biologischen Probe, wobei das Verfahren umfasst: (a) Kontaktieren der biologischen Probe mit einem Agens, das selektiv an die Nukleinsäure bindet; und (b) Nachweisen, ob das Agens an eine Nukleinsäure in der Probe bindet.
In einem weiteren Aspekt betrifft die Erfindung ein Verfahren zum Propagieren des erfindungsgemäßen Infektiöse Bronchitis-Virus (IB80) in Wirtszellen, Zelllinien und/oder Ei- Systemen, beispielsweise Bruteier, umfassend Infizieren der Wirtszellen, Zelllinien und/oder Ei-Systeme, beispielsweise Bruteier, mit dem erfindungsgemäß isolierten Infek- tiöse Bronchitis-Virus (IB80), Kultivieren der Wirtszellen, Zelllinien und/oder Ei-Systeme, beispielsweise Bruteier, um dem Virus zu ermöglichen, sich zu replizieren, und das Ernten der resultierenden Virionen. Die vorliegende Erfindung betrifft daher ebenfalls mit dem erfindungsgemäßen Infektiöse Bronchitis-Virus (IB80) infizierte Wirtszellen, Zelllinien und/oder Ei-Systeme, beispielsweise Bruteier. Beim erfindungsgemäßen Infektiöse Bronchitis-Virus (IB80) handelt es sich um die Hinterlegung bei NCPV, bei der infektiöses erfindungsgemäßes Virus (IB80) hinterlegt wurde. Wirtszellen bzw. geeignete Zelllinien sind allgemein über Zellbanken verfügbar, Ei-Systeme wie beispielsweise Bruteier über die jeweiligen Produzenten.
In einem weiteren Aspekt betrifft die Erfindung ein Verfahren zum Nachweis der Anwesenheit eines Antikörpers, der immunspezifisch IB80 bindet, in einer biologischen Probe, wobei das Verfahren umfasst: (a) Kontaktieren der biologischen Probe mit der erfindungsgemäßen Wirtszelle; und (b) Nachweisen des an die Wirtszelle gebunden Antikör- pers.
In einem weiteren Aspekt betrifft die Erfindung Impfstoffpräparate, die das erfindungsgemäße Infektiöse Bronchitis-Virus (IB80) umfassen, einschließlich rekombinante und chimäre Formen des Virus, die durch das Virus umfassten Nukleinsäuremoleküle, oder Protein-Untereinheiten des Virus. Die Erfindung betrifft auch eine Impfstoff-Formulierung, die eine therapeutisch oder prophylaktisch wirksame Menge des erfindungsgemäßen Infektiöse Bronchitis-Virus (IB80), und einen pharmazeutisch verträglichen Träger umfasst. In einer Ausführungsform betrifft die Erfindung eine Impfstoffformulierung, die eine therapeutisch oder prophylaktisch wirksame Menge eines Proteinextrakts des erfindungsgemäßen Infektiöse Bronchitis-Virus (IBV) oder eine Untereinheit davon und einen pharmazeutisch verträglichen Träger umfasst. In einem anderen Aspekt betrifft die Erfindung eine Impfstoffformulierung, die eine therapeutisch oder prophylaktisch wirksame Menge eines Nukleinsäuremoleküls, umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; oder jeweils ein Komplement davon, und einen pharmazeutisch verträglichen Träger umfasst. Insbesondere gelten hier für die vorstehenden SEQ ID Nos auch die oben angegebenen bevorzugten %-ldentitäten. In einem anderen Aspekt betrifft die Erfindung eine Impfstoffformulierung, die eine therapeutisch oder prophylaktisch wirksame Menge eines Nukleinsäuremoleküls, umfassend irgendeine der erfindungsgemäßen Nukleinsäuresequenzen oder ein Komplement davon, und einen pharmazeutisch verträglichen Träger. In einem verwandten Aspekt betrifft die Erfindung eine immunogene Formulierung, die eine immunogen wirksame Menge des erfindungsgemäßen Infektiöse Bronchitis-Virus (IB80) und einen pharmazeutisch verträglichen Träger umfasst. In einem anderen verwandten Aspekt betrifft die Erfindung eine immunogene Formulierung, die eine immunogen wirksame Menge eines Proteinextrakts des erfindungsgemäßen Infektiöse Bronchi- tis-Virus (IB80), oder eine Untereinheit davon, und einen pharmazeutisch verträglichen Träger umfasst.
In einem anderen verwandten Aspekt betrifft die Erfindung eine immunogene Formulierung, die eine immunogen wirksame Menge eines Nukleinsäuremoleküls, umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäureabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; oder jeweils ein Komplement davon, und einen pharmazeutisch verträglichen Träger. In einem anderen verwandten Aspekt betrifft die Erfindung eine immunogene Formulierung, die eine immunogen wirksame Menge eines Nukleinsäuremoleküls, enthaltend eine der anderen erfindungsgemäßen Nukleinsäuresequenzen oder ein Komplement davon, und einen pharmazeutisch verträglichen Träger umfasst. In einem anderen verwandten Aspekt betrifft die Erfindung eine immunogene Formulierung, die eine immunogen wirksame Menge eines der erfindungsgemäßen Polypeptide umfasst.
In einem anderen Aspekt betrifft die vorliegende Erfindung pharmazeutische Zusammensetzungen, die antivirale Agentien der vorliegenden Erfindung und einen pharmazeutisch verträglichen Träger umfassen. In einer spezifischen Ausführungsform ist das antivirale Agens der Erfindung ein Antikörper, der immunspezifisch das Infektiöse Bronchitis-Virus (IB80) bindet. In einer anderen spezifischen Ausführungsform ist das antivirale Agens ein Polypeptid oder Protein der vorliegenden Erfindung oder ein Nukleinsäuremolekül der vorliegenden Erfindung. In einem verwandten Aspekt betrifft die Erfindung eine pharmazeutische Zusammensetzung, die eine prophylaktisch oder therapeutisch wirksame Menge eines anti-Infektiöse Bronchitis-Virus (IB80)-Agens und einen pharmazeutisch verträglichen Träger umfasst.
Die Erfindung betrifft auch Kits, die Zusammensetzungen und Formulierungen der vorlie- genden Erfindung enthalten. So betrifft die Erfindung in einem anderen Aspekt ein Kit, umfassend einen Behälter, der die erfindungsgemäße immunogene Formulierung enthält. In einem weiteren Aspekt betrifft die Erfindung ein Kit, umfassend einen Behälter, der die erfindungsgemäße Impfstoffformulierung enthält. In einem anderen Aspekt betrifft die Erfindung ein Kit, umfassend einen Behälter, der die erfindungsgemäße pharmazeutische Zusammensetzung enthält. In einem weiteren Aspekt, betrifft die Erfindung ein Kit, umfassend einen Behälter, der die erfindungsgemäße Impfstoffformulierung enthält. In einem anderen Aspekt betrifft die Erfindung ein Verfahren zur Identifizierung eines Subjekts, das mit dem erfindungsgemäßen Infektiöse Bronchitis-Virus (IB80) infiziert ist, umfassend: (a) Gewinnen der gesamten RNA aus einer von dem Subjekt erhaltenen biologischen Probe; (b) reverse Transkription der gesamten RNA, um cDNA zu erhalten; und (c) Amplifizieren der cDNA unter Verwendung eines Satzes von Primern, die, von einer Nukleinsäuresequenz des erfindungsgemäßen Infektiöse Bronchitis-Virus (IB80) abgeleitet sind.
Die Erfindung betrifft ferner die Verwendung der Sequenzinformation des erfindungsge- mäßen isolierten Infektiöse Bronchitis-Virus (IB80) für diagnostische und therapeutische Verfahren.
In einem anderen Aspekt betrifft die vorliegende Erfindung Verfahren zum Screening von antiviralen Agentien, welche die Ansteckungsfähigkeit oder die Replikation von Infektiöse- Bronchitis-Viren (IB80) oder weiteren Varianten davon hemmen. Die Erfindung betrifft weiterhin Verfahren zur Herstellung von rekombinanten oder Chimären Formen vom Infektiöse Bronchitis-Virus (IB80).
Ausführliche Beschreibung der Bevorzugten Ausführungsformen
Es versteht sich, dass die vorliegende Erfindung nicht auf bestimmte beschriebene Ausführungsformen beschränkt ist, da solche selbstverständlich variieren können. Es ver- steht sich auch, dass die hier verwendete Terminologie nur dem Zweck der Beschreibung besonderer Ausführungsformen dient, und nicht als Einschränkung gedacht ist. Aufgrund der Sequenzdivergenz von IB80 relativ zu allen zuvor erfassten Vogel-Viren erweist sich die vorliegende Erfindung nützlich für die Gestaltung von diagnostischen Tests (Assays), um IB80-Erkrankungen bei tierischen Subjekten, insbesondere Vögeln, zu überwachen und um wirksame Virostatika und Impfstoffe zu entwickeln. Der IB Virus der vorliegenden Erfindung (IB80) ist genetisch im S1 Gen > 20% verschieden von allen anderen bekannten IB-Viren Varianten Die einzigartige Natur dieses IB- Virus stellte Herausforderungen an Isolierung, traditionelle molekular-basierte diagnostische Tests und an Ansätze zur Genomsequenzierung dar. Es wurde dennoch vollständig von den Erfindern sequenziert. Die hierin vorgesehenen Definitionen besitzen für die gesamte Beschreibung der hierin dargelegten Erfindung Geltung, einschließlich der oben vorgenommenen Zusammenfassung der Erfindung.
Der Begriff "ein Antikörper oder ein (antigenbindendes) Fragment eines Antikörpers, der immunspezifisch an ein Polypeptid der Erfindung bindet", wie er hierin verwendet wird, bezeichnet einen Antikörper oder ein Fragment davon, das immunspezifisch an ein erfindungsgemäßes Virus, ein erfindungsgemäßes Protein, oder an das durch eine (IBV) Nukleotidsequenz, umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; kodierte Polypeptid bindet. Die hier mit dem Begriff "Antikörper" oder„(antigenbindendes) Fragment eines Antikörpers" im Zusammenhang stehenden erfindungsgemäßen Proteine umfassen eines oder mehrere Protei- ne, umfassend oder bestehend aus einer Aminosäurenkette ausgewählt aus der Gruppe der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 13, 14, 15, 16, 17, 18 , 19 und 20; oder eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäurenkette mit einer Identität von > 85% zur Aminosäuresequenz SEQ ID NO: 13 oder zu einer Aminosäuresequenz ausgewählt aus der Gruppe der Aminosäuresequenzen mit einer Identität zu > 98% zu einer der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 14, 15, 16, 17, 18, 19 oder 20. Insbesondere gelten hier für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %-ldentitäten. Ein Antikörper oder ein Fragment davon, der immunspezifisch an das Polypeptid der Erfindung bindet, kann mit anderen Antigenen kreuzreagieren. Vorzugsweise kreuzreagiert ein Antikörper oder ein Fragment davon, der immunspezifisch an ein Polypeptid der Erfindung bindet, nicht mit anderen Antigenen. Ein Antikörper oder ein Fragment davon, die immunspezifisch an das Polypeptid der Erfindung binden, können beispielsweise durch Immunoassays oder andere dem Fachmann auf dem Gebiet bekannte Verfahren, oder auf andere wie hier beschriebene Weise, identifiziert werden.
Der Begriff „immunspezifisch" bzw. der Begriff „Immunospezifität" ist ein dem Fachmann geläufiger und häufig im Zusammenhang mit Antikörpern bzw. Antigenen verwendeter Begriff. So beschreibt der Begriff „immunspezifisch" bzw. „Immunospezifität" allgemein die Fähigkeit einer Substanz oder Verbindung, einschließlich Nukleinsäuren, Peptiden, Polypeptiden, Fragmenten derselben, spezifisch mit einem gegen sie gerichteten Antikörpermolekül im Sinne einer Antikörper-Antigen Bindung zu reagieren. Diese Bindung kann mit immunologischen Methoden nachgewiesen werden. Die genannten Begriffe stehen somit im Zusammenhang mit der spezifischen Immunantwort, die nach Kontakt mit z.B. einem Antigen erfolgende immunologische Reaktion eines betroffenen Subjekts erfolgt; die Immunantwort beinhaltet hierbei gegebenenfalls z.B. auch die Bildung von spezifischen mit der genannten Substanz oder Verbindung, einschließlich Nukleinsäuren, Peptiden, Polypeptiden, Fragmenten derselben, bzw. mit dem Antigen spezifisch reagierenden T-Lymphozyten in einem tierischen Subjekt. Bevorzugt wird das Vorliegen einer immunospezifischen Bindung mit einem Versuch wie in Beispiel 5 beschrieben geprüft. Ein "isoliertes" oder "gereinigtes" Peptid oder Protein ist im Wesentlichen frei von zellulärem Material oder anderen kontaminierenden Proteinen aus der Zelle oder Gewebequelle, aus dem das Protein stammt, oder im Wesentlichen frei von chemischen Vorläufern oder anderen Chemikalien, wenn es chemisch synthetisiert wird. Der Ausdruck "im Wesentlichen frei von zellulärem Material" umfasst Präparate von einem Polypeptid/Protein, in dem das Polypeptid/Protein von zellulären Komponenten der Zellen getrennt ist, aus dem es isoliert oder in dem es rekombinant produziert wurde. Somit umfasst ein Polypeptid/Protein, das im Wesentlichen frei von zellulärem Material ist, Präparate des Polypeptids /Proteins mit weniger als etwa 30%, 20%, 10%, 5%, 2,5% bzw. 1 % (nach Trockengewicht) kontaminierendes Protein. Wenn das Polypeptid/Protein rekombinant hergestellt wird, ist es vorzugsweise auch im Wesentlichen frei von Kulturmedium, d.h. das Kulturmedium macht weniger als etwa 20%, 10% oder 5% des Volumens der Proteinpräparation aus. Wenn ein Polypeptid/Protein durch chemische Synthese hergestellt wird, ist es vorzugsweise im Wesentlichen frei von chemischen Vorläufern oder anderen Chemikalien, d.h. es ist von chemischen Vorläufern oder anderen Chemikalien getrennt, die an der Synthese des Proteins beteiligt sind. Dementsprechend weisen solche Präpa- rationen des Polypeptids/Proteins weniger als etwa 30%, 20%, 10%, 5% (nach Trockengewicht) von chemischen Vorstufen oder anderen Verbindungen als das Polypeptid/Protein-Fragment von Interesse auf. In einer bevorzugten Ausführungsform der vorliegenden Erfindung sind die Polypeptide/Proteine isoliert oder gereinigt. Der hierin verwendete Begriff "isoliert", betrifft ein aus seiner natürlichen oder synthetischen Umgebung abgetrenntes und aufgereinigtes bestimmtes biologisches oder synthetisches Material insbesondere eines Virus, einer viralen Komponente, einer Nukleinsäure, RNA, DNA, cDNA, Fragmenten derselben, Nukleinsäureabschnitte, eines Proteins, einer Aminosäuresequenz, Fragmenten derselben, eines Antikörpers oder eines antigenbin- denden Fragments davon, und dergleichen Materialien, wobei das genannte bestimmte Material bevorzugt im Wesentlichen frei von anderen begleitenden Materialien beliebiger Natur ist, beispielsweise begleitenden Nukleinsäuren, Proteinen, Lipiden, Kohlenhydraten oder anderen Materialien, mit denen das bestimmte isolierte Material unter natürlichen oder synthetischen Bedingungen allgemein assoziiert sein kann, beispielsweise durch Assoziation mit einem anderen zellulärem Material, Kulturmedium oder in einem Synthesemedium.
Beispielsweise ist ein "isoliertes" Nukleinsäuremolekül oder Fragment davon oder ein Nukleinsäureabschnitt somit z.B. jeweils eines oder einer, das oder der von anderen in der natürlichen Quelle des Nukleinsäuremoleküls vorhandenen Nukleinsäuremolekülen abgetrennt und aufgereinigt ist. Darüber hinaus kann ein "isoliertes" Nukleinsäuremolekül, wie beispielsweise ein RNA-Molekül oder cDNA-Molekül, im Wesentlichen frei sein von anderem zellulären Material, oder Kulturmedium, wenn es durch rekombinante Techniken hergestellt wird, oder im Wesentlichen frei sein von chemischen Vorläufern oder anderen Chemikalien, wenn es chemisch synthetisiert wird. In einer bevorzugten Ausführungsform der Erfindung sind die Nukleinsäuremoleküle, die Polypeptide/Proteine der Erfindung kodieren, isoliert oder gereinigt. Der Begriff "isoliertes" Nukleinsäuremolekül umfasst keine Nukleinsäure und dergleichen, die ein Mitglied einer Bibliothek ist, aber nicht von den anderen in der Bibliothek enthaltenen Nukleinsäuremoleküle abgetrennt und aufgereinigt wurde. Der Begriff "Teil" oder "Fragment", wie hierin verwendet, schließt die angegebenen Fragmentlängen und alle ganzen Zahlen dazwischen, einschließlich der in einem festgelegten Bereich angegebenen Endpunkte, und einschließlich einer beliebigen Länge bis zur vollen Länge eines Proteins, Polypeptids oder Nukleinsäure mit ein. Der Ausdruck "mit einer biologischen Aktivität des Proteins" oder "mit biologischen Aktivitäten der Polypeptide der Erfindung" bezieht sich auf die Eigenschaften der Polypeptide oder Proteine, die eine gemeinsame biologische Aktivität, ähnliche oder identische Strukturdomäne, und/oder eine ausreichende Aminosäureidentität zum durch die Nukleotidsequenz, umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; kodierten Polypeptid aufweisen. Die hier mit dem Begriff "mit einer biologischen Aktivität des Proteins" oder "mit biologischen Aktivitäten der Polypeptide der Erfindung" im Zusammenhang stehenden erfindungsgemäßen Proteine umfassen eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäurenkette ausgewählt aus der Gruppe der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 13, 14, 15, 16, 17, 18 , 19 und 20; oder eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäurenkette mit einer Identität von > 85% zur Aminosäuresequenz SEQ ID NO: 13 oder zu einer Aminosäuresequenz ausgewählt aus der Gruppe der Aminosäuresequenzen mit einer Identität zu > 98% zu einer der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 14, 15, 16, 17, 18, 19 oder 20. Insbesonde- re gelten hier für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %-ldentitäten. Solche gemeinsamen biologischen Aktivitäten der Polypeptide der Erfindung umfassen Antigenität und Immunogenität.
Der Ausdruck "unter stringenten Bedingungen" bezieht sich auf Hybridisierung und Waschbedingungen, unter denen Nukleotidsequenzen, die mindestens 70%, mindestens 75%, mindestens 80%, mindestens 85%, mindestens 90% oder mindestens 95% Identität mit einander aufweisen, miteinander hybridisiert bleiben. Solche Hybridisierungsbedin- gungen sind beispielsweise beschrieben, aber nicht beschränkt darauf, in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1 -6.3.6; Basic Methods in Molecular Biology, Elsevier Science Publishing Co., Inc., New York (1986), S. 75-78 und 84-87. und Molecular Cloning, Cold Spring Harbor Laboratory, NY (1982), S. 387-389, und sind dem Fachmann auf dem Gebiet bestens bekannt. Ein bevorzugtes, nicht einschränkendes Beispiel für stringente Hybridisierungsbedingungen ist die Hybridisierung in 6 x Natriumchlorid/Natriumcitrat (SSC), 0,5 % SDS bei etwa 68 °C, gefolgt von einer oder mehreren Waschungen in 2 x SSC, 0,5 % SDS bei Raumtemperatur. Ein weiteres bevorzugtes, nicht einschränkendes Beispiel für stringente Hybridisierungsbe- dingungen ist die Hybridisierung in 6 x SSC bei etwa 45 °C, gefolgt von einer oder mehreren Waschungen in 0,2 SSC, 0, 1 % SDS bei etwa 50-65 °C.
Der Begriff "Variante", wie hierin verwendet, bezieht sich entweder auf eine natürlich vorkommende genetische Mutante von IB80 oder einer rekombinant hergestellten Varia- tion dieser IBV-Variante, von denen jede eine oder mehrere Mutationen in seinem Genom im Vergleich zum IBV, das eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10 umfasst, enthält. Insbesondere gelten hier (wie auch im übrigen Text) für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %-ldentitäten. Der Begriff "Variante" kann sich auch auf entweder eine natürlich vorkommende Variante eines gegebenen Peptids beziehen oder eine rekombi- nant hergestellte Variation eines gegebenen Peptids oder Proteins, in dem ein oder mehrere Aminosäurereste durch Aminosäure-Substitution, Addition oder Deletion modifiziert wurden.
Der Begriff "Homologie" bezieht sich auf Sequenzähnlichkeit oder alternativ Sequenzidentität zwischen zwei oder mehr Polynukleotidsequenzen, oder zwei oder mehr Polypeptidsequenzen.
Die Begriffe "Prozent-Identität" und "%-ldentität", wie auf Polynukleotidsequenzen angewandt, beziehen sich auf den Prozentsatz der identischen Nukleotid-Übereinstimmungen zwischen mindestens zwei, unter Verwendung eines standardisierten Algorithmus miteinander ausgerichteten Polynukleotidsequenzen („Alignment"). Ein solcher Algorithmus kann, in einer standardisierten und reproduzierbaren Weise, Lücken („Gap") in die verglichenen Sequenzen einfügen, um das Alignment zwischen zwei Sequenzen zu optimieren, und somit einen aussagekräftigeren Vergleich der beiden Sequenzen erreichen.
Die prozentuale Identität zwischen Polynukleotidsequenzen kann unter Verwendung von ein oder mehreren Computeralgorithmen oder im Stand der Technik bekannten oder hierin beschriebenen Programmen bestimmt werden. Zum Beispiel kann die prozentuale Identität unter Verwendung der Parameter der Voreinstellung (Standardparameter,„Default") des CLUSTAL V-Algorithmus, wie in die Version 3.12e des MEGALIGN Sequenz- Alignment-Programms integriert, bestimmt werden. Dieses Programm ist Teil des LASERGENE-Software-Pakets, einer Reihe von molekularbiologischen Analyseprogrammen (DNASTAR, Madison, Wis.). CLUSTAL V ist beschrieben in Higgins, D. G. und P. M. Sharp (1989; CABIOS 5: 151-153) und in Higgins, D. G. et al. (1992; CABIOS 8:189-191 ). Für paarweise Alignments von Polynukleotidsequenzen werden die Stan- dardparameter wie folgt festgelegt: Ktuple = 2, Gap Penalty = 5, Window= 4 und "Diago- nals Saved" = 4. Die "gewichtete" ("weighted") Residuum-Gewichtstabelle wird als Voreinstellung ausgewählt. Es kann insbesondere auch der CLUSTAL W-Algorithmus verwendet werden.
Der Clustal W Algorithmus ist ein weitverbreitetes Alignment Programm, welches für Alignments von mehr als zwei Sequenzen (Multi-Sequenz Alignment) geeignet ist. Das Clustal W Programm verwendet ein progressives Alignment unter Nutzung des Neighbour-joining Algorithmus zur Erstellung eines multiplen Sequenzalignments.
Alternativ dazu ist, eine Reihe von allgemein verwendeten und frei verfügbaren Sequenz- Vergleichsalgorithmen, die verwendet werden kann, das durch National Center for Bio- technology Information (NCBI) bereitgestellte Basic Local Alignment Search Tool (BLAST) (Altschul, S. F. et al. (1990) J. Mol. Biol. 215:403-410), das aus verschiedenen Quellen zur Verfügung steht, einschließlich der NCBI, Bethesda, Md., und auf der NCBI World Wide Web-Seite im Internet verfügbar ist. Die BLAST-Software-Reihe enthält verschiedene Programme, einschließlich Sequenzanalyse "blastn", die zum Ausrichten einer bekannten Polynukleotidsequenz mit anderen Polynukleotidsequenzen aus einer Vielzahl von Datenbanken verwendet wird. Ebenfalls erhältlich ist ein "BLAST 2 Sequences" genanntes Werkzeug, das für den direkten paarweisen Vergleich von zwei Nukleotidsequenzen verwendet wird. "BLAST 2 Sequences" kann auch über die NCBI World Wide Web-Seite im Internet interaktiv abgerufen und verwendet werden. Das "BLAST 2 Sequences" -Werkzeug kann sowohl für blastn und blastp (unten diskutiert) verwendet werden. BLAST-Programme werden üblicherweise mit Gap und anderen Parametern auf die Voreinstellungen eingestellt verwendet. Zum Beispiel kann man, um zwei Nukleotid-Sequenzen zu vergleichen, blastn mit dem "BLAST 2 Sequences" Werk- zeug der Version 2.0.12 (21. April 2000) verwenden, das auf Standardparameter eingestellt ist. Solche Standardparameter können zum Beispiel sein: Matrix: BLOSUM62; Reward für Match („Übereinstimmung"): 1 ; Penalty („Sanktion") für Mismatch („Nichtübereinstimmung"): -2; Open Gap: 5 und Erweiterungs-Gap: 2 Sanktionen; Gap x Drop-off: 50; Expect („Erwartung"): 10; Word Size („Wortgröße"): 1 1 ; Filter: ein. Prozentuale Identität kann über die Länge einer gesamten definierten Sequenz, wie beispielsweise durch eine bestimmte SEQ ID-Nummer definiert, gemessen werden, oder kann über eine kürzere Länge, beispielsweise über die Länge eines Fragments, das aus einer größeren definierten Sequenz entnommen ist, gemessen werden, zum Beispiel ein Fragment von mindestens 20, mindestens 30, mindestens 40, mindestens 50, mindestens 70, mindestens 100 oder mindestens 200 aufeinanderfolgenden Nukleotiden. Solche Längen sind nur beispielhaft, und es versteht sich, dass jede Fragmentlänge, gestützt durch die hierin gezeigten Sequenzen, in Tabellen, Abbildungen oder Sequenzauflistungen, verwendet werden kann, um eine Länge zu beschreiben, über die die prozentuale Identität gemessen werden kann.
Die Ausdrücke "Prozent-Identität" und "%-ldentität", wie auf Polypeptidsequenzen angewendet, beziehen sich auf den Prozentsatz identischer Residuum-Übereinstimmungen zwischen mindestens zwei ausgerichteten Polypeptidsequenzen unter Verwendung eines standardisierten Algorithmus. Methoden der Polypeptidsequenz-Ausrichtung („Alignment") sind gut bekannt. Einige Ausrichtmethoden berücksichtigen konservative Aminosäureaustausche. Solche konservativen Austausche („Substitutionen"), oben näher erläutert, konservieren im Allgemeinen die Ladung und Hydrophobizität an der Stelle der Substitution, wodurch sie die Struktur (und deshalb Funktion) des Polypeptids erhalten. Die Ausdrücke "Prozent-Ähnlichkeit" und "%-Ähnlichkeit", wie auf Polypeptidsequenzen angewandt, beziehen sich auf den Prozentsatz der Residuum-Übereinstimmungen, einschließlich identischer Residuum-Übereinstimmungen und konservativer Substitutionen, zwischen mindestens zwei ausgerichteten Polypeptidsequenzen unter Verwendung eines standardisierten Algorithmus. Im Gegensatz dazu werden konservative Substitutionen nicht in die Berechnung der prozentualen Identität zwischen Polypeptidsequenzen eingeschlossen.
Prozent Identität zwischen Polypeptidsequenzen kann unter Verwendung der Parameter der Voreinstellung (Standardparameter, „Default") des CLUSTAL V-Algorithmus, wie integriert in die Version 3.12e des MEGALIGN Sequenz-Alignment-Programms (oben beschrieben und referenziert), bestimmt werden. Für paarweise Alignments von Polypeptidsequenzen, unter Verwendung von CLUSTAL V, werden die Standard Parameter wie folgt festgelegt: Ktuple = 1 , Gap Penalty = 3, Window = 5, und "Diagonals Saved" = 5. Die PAM250 Matrix wird als Standard Residuum-Gewichtstabelle ausgewählt.
Alternativ kann die NCBI BLAST-Software-Reihe verwendet werden. Zum Beispiel für einen paarweisen Vergleich von zwei Polypeptidsequenzen kann man das "BLAST 2 Sequences' -Werkzeug der Version 2.0.12 (21. April 2000) mit blastp auf Standardparameter eingestellt verwenden. Solche Stand ardparameter können zum Beispiel sein: Matrix: BLOSUM62; Open Gap: 1 1 und Erweiterungs-Gap: 1 Sanktion; Gap x Drop-off: 50; Expect („Erwartung"): 10; Word-Size („Wortgröße"): 3; Filter: ein. Prozentuale Identität kann über die Länge einer gesamten definierten Polypeptidsequenz, beispielsweise wie durch eine bestimmte SEQ ID-Nummer definiert, gemessen werden, oder kann über eine kürzere Länge, beispielsweise über die Länge eines aus einer größeren, definierten Polypeptidsequenz entnommenen Fragments, gemessen werden, zum Beispiel ein Fragment von mindestens 15, mindestens 20, mindestens 30, mindestens 40, mindestens 50, mindestens 70 oder mindestens 150 zusammenhängenden Residuen. Solche Längen sind nur beispielhaft, und es versteht sich, dass jede Fragmentlänge, gestützt durch die hierin gezeigten Sequenzen, in den Tabellen, Abbildungen oder Sequenzauflistungen, verwendet werden können, um eine Länge zu beschreiben, über die die prozentuale Identität gemessen werden kann. Der Begriff „Mittel" („Agens") umfasst ein beliebiges chemisches, biochemisches oder biologisches Molekül; wie beispielsweise kleine Moleküle, Proteine, Polypeptide, Antikörper, Nukleinsäuremoleküle, einschließlich DNA oder RNA, und dergleichen.
Methoden und Zusammensetzungen bezogen auf das erfinderische IBV (IB80)
Die vorliegende Erfindung beruht auf der Isolierung und Identifizierung einer neuen Variante eines Infektiöse Bronchitis-Virus, IB80, und dessen Seguenzierung. IB80wurde aus Hühnern mit Infektiöser Bronchitis isoliert. Das isolierte Virus besitzt einen RNA- Einzelstrang und ist ein Mitglied der Familie Coronaviridae, eine Familie von positivorientierten RNA-Viren der Gattung Gamma-Coronavirus, der Spezies Avian Coronavirus. Dementsprechend betrifft die Erfindung das isolierte IB-Virus, das morpho- logisch und phylogenetisch mit bekannten Mitgliedern der Coronaviridae, und insbesondere der Gammacoronaviren, verwandt ist.
In einem weiteren Aspekt betrifft die Erfindung ein isoliertes IB-Virus, enthaltend ein Nukleinsäuremolekül mit einer Nukleotidseguenz, die unter stringenten Bedingungen mit einer der erfindungsgemäß definierten Seguenzen hybridisiert, wobei die erfindungsge- mäßen Seguenzen vorzugsweise ausgewählt sind aus der Gruppe: — eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9;
— eine Nukleinsäure der SEQ ID NO: 10; oder
— eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; oder wobei das isoliertes IB-Virus enthaltene Nukleinsäuremolekül eine Nukleotidsequenz aufweist, die mindestens 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% oder 99% Identität mit den vorstehend dargelegten SEQ ID NOs aufweist.
In einer Ausführungsform der vorliegenden Erfindung wird das IB-Virus getötet. In einer anderen, ist das IB-Virus abgeschwächt. In einer anderen wird die Infektiosität des abgeschwächten IB-Virus reduziert. In anderen wird die Infektiosität mindestens 5-fach, 10- fach, 25-fach, 50-fach, 100-fach, 250-fach, 500-fach oder 10.000-fach reduziert. In anderen wird die Replikationsfähigkeit des abgeschwächten IB-Virus reduziert. In einer anderen wird die Replikationsfähigkeit des abgeschwächten IB-Virus mindestens 5-fach, 10- fach, 25-fach, 50-fach, 100-fach, 250-fach, 500-fach, 1.000-fach oder 10.000-fach reduziert. In einer anderen, wird die Fähigkeit des abgeschwächten IB-Virus zur Proteinsynthese reduziert. In einer anderen wird die Fähigkeit des abgeschwächten IB-Virus zur Proteinsynthese mindestens 5-fach, 10-fach, 25-fach, 50-fach, 100-fach, 250-fach, 500- fach, 1.000-fach oder 10.000-fach reduziert. In einer anderen wird die Fähigkeit des abgeschwächten IB-Virus zum Zusammenbau reduziert. In einer anderen, wird die Fähigkeit des abgeschwächten IB-Virus zum Zusammenbau mindestens 5-fach, 10-fach, 25-fach, 50-fach, 100-fach, 250-fach, 500-fach, 1.000-fach oder 10.000-fach reduziert. In einer anderen wird die cytopathische Wirkung des abgeschwächten IB-Virus reduziert. In einer anderen wird die cytopathische Wirkung des abgeschwächten IB-Virus mindestens 5-fach, 10-fach, 25-fach, 50-fach, 100-fach, 250-fach, 500-fach, 1.000-fach oder 10.000- fach reduziert
In einem weiteren Aspekt stellt die Erfindung die vollständige genomische Sequenz des IB-Virus bereit. In einer speziellen Ausführungsform umfasst das IB-Virus eine Nukleotidsequenz von SEQ ID NO: 10, die dem kompletten Virus entspricht. In einem verwandten Aspekt betrifft die Erfindung Nukleinsäuremoleküle, isoliert aus IBV oder Fragmente davon. In einer Ausführungsform der vorliegenden Erfindung umfasst das isolierte Nukleinsäuremolekül eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; oder ein Komplement davon. Insbesondere gelten hier für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %-ldentitäten. In einer anderen, umfasst das Nukleinsäuremolekül eine Nukleotidsequenz mit mindestens 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800 oder 4900 zusammenhängenden Nukleotiden der Nukleotidsequenz von SEQ ID NO: 10 oder ein Komplement davon; oder mindestens 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500 oder 6600 benachbarte Nukleotide der Nukleotidsequenz von SEQ ID NO: 10, oder ein Komplement davon. In einer weiteren Ausführungsform umfasst das isolierte Nukleinsäuremolekül eine Nukleotidsequenz, die für die IBV-Aminosäuresequenz eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäurenkette ausgewählt aus der Gruppe der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 13, 14, 15, 16, 17, 18 , 19 und 20; oder für eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäurenkette mit einer Identität von > 85% zur Aminosäuresequenz SEQ ID NO: 13 oder zu einer Aminosäuresequenz ausgewählt aus der Gruppe der Aminosäuresequenzen mit einer Identität zu > 98% zu einer der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 14, 15, 16, 17, 18, 19 oder 20; kodiert, oder ein Komplement der Nukleotidsequenz, die für die IBV- Aminosäuresequenzen der vorstehend genannten SEQ ID NOs kodiert. In einer anderen hybridisiert das isolierte Nukleinsäuremolekül unter stringenten Bedingungen an ein Nukleinsäuremolekül mit der Nukleotidsequenz von SEQ ID NOs: umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäu- ren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; oder ein Komplement davon, wobei das hybridisierende Nukleinsäuremolekül für eine Aminosäuresequenz kodiert, die eine biologische Aktivität aufweist, die von einem Polypeptid gezeigt wird, das durch die Nukleotidsequenz der vorstehend genannten SEQ ID NOs kodiert wird. Insbesondere gelten hier für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %-ldentitäten. In einer anderen ist das Nukleinsäuremolekül RNA. In einer anderen ist das Nukleinsäuremolekül DNA.
In einem weiteren Aspekt betrifft die Erfindung Proteine oder Polypeptide, einschließlich viraler Proteine, die aus mit dem IB-Virus infizierten Zellen, wie Wirtszellen, Zelllinien und/oder Ei-Systeme, beispielsweise Bruteier, isoliert werden, die aber nicht in vergleichbaren nicht-infizierten Zellen, wie Wirtszellen, Zelllinien und/oder Ei-Systeme, beispielsweise Bruteier, vorhanden sind. In einer Ausführungsform der vorliegenden Erfindung werden die Aminosäuresequenzen eines oder mehrerer Proteine, umfassend oder bestehend aus einer Aminosäurekette ausgewählt aus der Gruppe der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 13, 14, 15, 16, 17, 18 , 19 und 20; oder eines oder mehrerer Proteine, umfassend oder bestehend aus einer Aminosäurekette mit einer Identität von > 85% zur Aminosäuresequenz SEQ ID NO: 13 oder zu einer Aminosäuresequenz ausgewählt aus der Gruppe der Aminosäuresequenzen mit einer Identität zu > 98% zu einer der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 14, 15, 16, 17, 18, 19 oder 20; dargelegt, oder ein Fragment davon. In einer Ausführungsform weisen die Polypeptide oder Proteine der vorliegenden Erfindung eine biologische Aktivität des Proteins (einschließlich Antigenität und/oder Immunogenität) auf, das durch die Sequenz umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukle- insäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäureabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; kodiert wird. In einer anderen, weisen die Polypeptide oder Proteine der vorliegenden Erfindung eine biologische Aktivität von mindestens einem Protein mit der Aminosäuresequenz (einschließlich der Antigenität und/oder Immunogenität) auf, wie diese Aminosäuresequenz, oder ein Fragment davon, hier vorstehend dargelegt ist. Insbesondere gelten hier für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %-ldentitäten.
In einem verwandten Aspekt betrifft die Erfindung ein isoliertes Polypeptid, das durch das oben beschriebene Nukleinsäuremolekül der Erfindung kodiert wird. In einer Ausführungsform der vorliegenden Erfindung umfasst das isolierte Polypeptid die Aminosäuresequenz ausgewählt aus der Gruppe bestehend aus: a) eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäurekette ausgewählt aus der Gruppe der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 und 20; oder eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäurekette mit einer Identität von > 85% zur Aminosäuresequenz SEQ ID NO: 13 oder zu einer Aminosäuresequenz ausgewählt aus der Gruppe der Aminosäuresequenzen mit einer Identität zu > 98% zu einer der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 14, 15, 16, 17, 18, 19 oder 20; und b) eine Aminosäuresequenz, die 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% oder 99% Homologie zu der Aminosäuresequenz gemäß a) besitzt. In einer anderen umfasst das isolierte Polypeptid die Aminosäuresequenz mit mindestens 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 450, 500, 550, 600, 610, 620, 630, 640, 650, 660, 670, 700, 710, 720, 730, 750, 800, 850, 900, 950, 1000, 1050, 1 100, 1 150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2160, 2170, 2180, 2190 oder 2200 zusammenhängenden Aminosäure-Residuen der Aminosäuresequenz von vorstehend dargelegten SEQ ID NOs.
In anderen Aspekten betrifft die Erfindung die Verwendung eines isolierten IB-Virus für diagnostische und therapeutische Verfahren. In einer Ausführungsform stellt die Erfindung ein Verfahren zum Nachweis eines Antikörpers bereit, der in einer biologischen Probe für das IB-Virus immunspezifisch ist, unter Verwendung des hierin beschriebenen erfindungsgemäßen isolierten IB-Virus, oder irgendeinem der hierin beschriebenen erfindungsgemäßen Proteine oder Polypeptide. In einer anderen spezifischen Ausfüh- rungsform betrifft die Erfindung ein Verfahren zum Screenen auf einen Antikörper, der immunspezifisch bindet und IBV oder eine Kombination von IBVs neutralisiert. Ein solcher Antikörper ist für eine passive Immunisierung oder Immuntherapie eines mit IBV infizierten Subjekts nützlich.
In einem weiteren Aspekt betrifft die Erfindung einen isolierten Antikörper oder ein Anti- gen-bindendes Fragment davon, der immunspezifisch an einen oben beschriebenen IB- Virus-Genus der Erfindung bindet. In einer Ausführungsform der vorliegenden Erfindung neutralisiert der isolierte Antikörper oder ein Antigen-bindendes Fragment davon einen Genus des IB-Virus. In einer anderen bindet der isolierte Antikörper oder ein Antigen- bindendes Fragment davon immunspezifisch an das oben beschriebene erfindungsge- mäße Polypeptid. Die Erfindung betrifft weiterhin Antikörper, die spezifisch ein Polypeptid der Erfindung binden, das durch eine Nukleotidsequenz, umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; kodiert wird, ein Fragment davon, oder das durch eine Nukleinsäure kodiert wird, umfassend eine Nukleotidsequenz, die unter stringenten Bedingungen an eine der vorstehend genannten Nukleotidsequenzen hybridisiert, und/oder ein beliebiges IB80-Epitop mit ein oder mehreren biologischen Aktivitäten eines Polypeptids der Erfindung. Diese Polypeptide umfassen die erfindungsgemäßen Proteine, d.h. eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäurenkette ausgewählt aus der Gruppe der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 13, 14, 15, 16, 17, 18 , 19 und 20; oder eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäurenkette mit einer Identität von > 85% zur Aminosäuresequenz SEQ ID NO: 13 oder zu einer Aminosäuresequenz ausgewählt aus der Gruppe der Aminosäuresequenzen mit einer Identität zu > 98% zu einer der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 14, 15, 16, 17, 18, 19 oder 20. Insbesondere gelten hier für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %-ldentitäten. Solche Antikörper schließen ein, sind aber nicht darauf beschränkt, polyklonale, monoklonale, bispezifische, multispezifische, menschliche, humanisierte, chimäre Antikörper, einzelkettige Antikörper, Fab-Fragmente, F(ab')2 -Fragmente, Disulfid-verknüpfte Fvs, Intrabodies und Fragmente enthaltend entweder eine VL oder VH-Domäne oder sogar einen Komplementarität-bestimmende Region (CDR;„complementarity determining region"), die spezifisch an ein Polypeptid der Erfindung bindet.
In anderen Aspekten betrifft die Erfindung Verfahren zum Nachweis des Vorhandenseins, der Aktivität oder der Expression des IB-Virus der Erfindung in einem biologischen Material, wie Zellen, Blut, Speichel, Urin und dergleichen. Die erhöhte oder verringerte Aktivität oder Expression des IB-Virus in einer Probe relativ zu einer Kontrollprobe kann durch Inkontaktbringen des biologischen Materials mit einem Mittel (Agens) bestimmt werden, das direkt oder indirekt das Vorhandensein, die Aktivität oder die Expression des IB-Virus erkennen kann. In einer Ausführungsform der vorliegenden Erfindung sind die Nachweismittel die Antikörper oder Nukleinsäuremoleküle der vorliegenden Erfindung.
In einem verwandten Aspekt betrifft die Erfindung ein Verfahren, zum Nachweis des Vorhandenseins des erfindungsgemäßen oben beschriebenen IB-Virus in einer biologischen Probe, wobei das Verfahren umfasst: (a) Kontaktieren der Probe mit einem Mittel, das selektiv an den IB-Virus bindet; und (b) Nachweisen, ob das Mittel an das IB-Virus in der Probe bindet. In einer Ausführungsform der vorliegenden Erfindung wird die biologische Probe ausgewählt aus der Gruppe bestehend aus Zellen; Blut; Serum; Plasma; Kot; trachealen, choanalen oder kloakalen und Bindehautabstrichen. In einer anderen, ist das Mittel, das an das IB-Virus bindet, ein Antikörper. In einer anderen ist das Mittel, das an das IB-Virus bindet, ein Nukleinsäuremolekül, umfassend die Nukleotidsequenz, umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfas- send eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; oder ein Komplement davon. Insbesondere gelten hier für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %-ldentitäten. In einer anderen ist das Mittel, das an das IB-Virus bindet, ein Nukleinsäuremolekül, umfassend eine Nukleotidsequenz mit mindestens 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500 oder 6600 benach- barten Nukleotiden der Nukleotidsequenz einer der vorstehend genannten SEQ ID NOs.
In einem weiteren Aspekt betrifft die Erfindung ein Verfahren zur Bestimmung der Anwesenheit des oben beschriebenen erfindungsgemäßen Polypeptids in einer biologischen Probe, wobei das Verfahren umfasst: (a) Kontaktieren der biologischen Probe mit einem Mittel, das selektiv an das Polypeptid bindet; und (b) Nachweisen, ob das Mittel an das Polypeptid in der Probe bindet. In einer Ausführungsform der vorliegenden Erfindung wird die biologische Probe ausgewählt aus der Gruppe bestehend aus Zellen; Blut; Serum; Plasma; Kot; trachealen, choanalen oder kloakalen und Bindehautabstrichen. In einer anderen ist das Mittel, das an das Polypeptid bindet, ein Antikörper oder ein Antigen- bindendes Fragment davon. In einem weiteren Aspekt betrifft die Erfindung ein Verfahren, zum Nachweis des Vorhandenseins eines ersten, vom oben beschriebenen erfindungsgemäßen IB-Virus abgeleiteten Nukleinsäuremoleküls in einer biologischen Probe, wobei das Verfahren umfasst: (a) Kontaktieren der biologischen Probe mit einem Mittel, das selektiv an die Nukleinsäure bindet; und (b) Nachweisen, ob das Mittel an das Nukleotid in der Probe bindet. In einer Ausführungsform der vorliegenden Erfindung ist das Mittel, das an das erste Nukleinsäuremolekül bindet, ein zweites Nukleinsäuremolekül, umfassend die Nukleotidsequenz, umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; oder ein Komplement davon. Insbesondere gelten hier für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %-ldentitäten. In einer anderen umfasst das zweite Nukleinsäuremolekül mindestens 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500 oder 6600 benachbarte Nukleotide der Nukleotidsequenz einer der vorstehend genannten SEQ ID NOs, oder ein Komplement davon.
In einem weiteren Aspekt betrifft die Erfindung ein Verfahren zum Propagieren des IB80 in Wirtszellen, umfassend das Infizieren der Wirtszellen, Zelllinien und/oder Ei-Systeme, beispielsweise Bruteier, mit einem oben beschriebenen erfindungsgemäßen isolierten Infektiöse Bronchitis-Virus, das Kultivieren der Wirtszellen, Zelllinien und/oder Ei- Systeme, beispielsweise Bruteier, um dem Virus zu ermöglichen, sich zu replizieren, und das Ernten sich ergebender Virionen. Ebenfalls betrifft die vorliegende Erfindung auch Wirtszellen, Zelllinien und/oder Ei-Systeme, beispielsweise Bruteier, die mit dem oben beschriebenen erfindungsgemäßen Virus infiziert sind. In einer Ausführungsform der vorliegenden Erfindung ist die Wirtszelle eine Vogelzelle; hierbei kommen erfindungsge- mäß alle Vogelspezies infrage, insbesondere Hühner. In einer Ausführungsform der vorliegenden Erfindung betrifft das Ei-System insbesondere Bruteier. In einer Ausführungsform der vorliegenden Erfindung betrifft das Ei-System embryonierte Eier; beispielsweise sind hier insbesondere sogenannte SPF-Eier, "Serumeier", "Clean Eggs" zu nennen. Es kommen Ei-Systeme an sich aller Vogelspezies infrage; bevorzugt Ei- Systeme aus Hühnern, beispielsweise Hühnereier. Es hat sich herausgestellt, dass sich Nierenzellen der grünen Meerkatze (African Green Monkey) als Wirtszellen besonders gut eignen. In einem weiteren Aspekt betrifft die Erfindung ein Verfahren zum Nachweis des Vorhandenseins eines Antikörpers in einer biologischen Probe, der immunspezifisch IB-Virus bindet, wobei das Verfahren umfasst: (a) Kontaktieren der biologischen Probe mit der oben beschriebenen erfindungsgemäßen Wirtszelle; und (b) Nachweisen des an die Zelle gebundenen Antikörpers.
In einem weiteren Aspekt betrifft die Erfindung Impfstoffprä parate, einschließlich des erfindungsgemäßen IB-Virus, einschließlich rekombinanter und chimärer Formen des Virus, die durch das Virus umfassten Nukleinsäuremoleküle oder Protein-Untereinheiten des Virus. In einer Ausführungsform umfassen die Impfstoffzubereitungen der vorliegen- den Erfindung das lebende, aber abgeschwächte IB-Virus, mit oder ohne pharmazeutisch annehmbare Träger, einschließlich Adjuvantien. In einer anderen umfassen die Impfstoffzubereitungen der Erfindung ein inaktiviertes oder abgetötetes IB-Virus, Varianten des IB- Virus oder einer Kombination davon, mit oder ohne pharmazeutisch annehmbare Träger, einschließlich Adjuvantien. Solche abgeschwächten oder inaktivierten Viren können durch eine Reihe von Passagen des Virus in einem Wirtssystem, z.B. einer Zelllinie, durch Inaktivierungsverfahren oder durch Herstellung rekombinanter oder chimärer Formen des Virus hergestellt werden. Dementsprechend betrifft die vorliegende Erfindung ferner Verfahren zur Herstellung der hierin beschriebenen rekombinanten oder Chimären Formen der erfindungsgemäßen IB-Viren.
In einer anderen spezifischen Ausführungsform betrifft die Erfindung eine Impfstoffformulierung, die eine therapeutisch oder prophylaktisch wirksame Menge des oben beschriebenen erfindungsgemäßen IB-Virus und einen pharmazeutisch verträglichen Träger umfasst. In einer anderen betrifft die Erfindung eine Impfstoffformulierung, die eine thera- peutisch oder prophylaktisch wirksame Menge eines Proteinextrakts des oben beschriebenen erfindungsgemäßen IB-Virus, oder einer Untereinheit davon, und einen pharmazeutisch verträglichen Träger umfasst. In einem weiteren Aspekt betrifft die Erfindung eine Impfstoffformulierung, die eine therapeutisch oder prophylaktisch wirksame Menge eines Nukleinsäuremoleküls, umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; oder ein Kom- plement davon, und einen pharmazeutisch verträglichen Träger. Insbesondere gelten hier für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %- Identitäten. In einer anderen, betrifft die Erfindung eine Impfstoffformulierung, die eine therapeutisch oder prophylaktisch wirksame Menge eines Nukleinsäuremoleküls, umfassend irgendeine der oben beschriebenen erfindungsgemäßen Nukleotidsequenzen, oder ein Komplement davon, und einen pharmazeutisch verträglichen Träger. In einem weiteren Aspekt betrifft die Erfindung eine Impfstoffformulierung, die eine therapeutisch oder prophylaktisch wirksame Menge eines Proteinextrakts des oben beschriebenen erfindungsgemäßen IB-Virus, oder eine Untereinheit davon, und einen pharmazeutisch verträglichen Träger umfasst. In einem weiteren Aspekt betrifft die Erfindung eine Impfstoffformulierung, die eine therapeutisch oder prophylaktisch wirksame Menge eines Nukleinsäuremoleküls, umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; oder ein Komplement davon, und einen pharmazeutisch verträglichen Träger. Insbesondere gelten hier für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %-ldentitäten. In einer anderen betrifft die Erfindung eine Impfstoffformulierung, die eine therapeutisch oder prophylaktisch wirksame Menge eines Nukleinsäuremoleküls, umfassend irgendeine der oben beschriebenen erfindungsgemäßen Nukleotidsequenzen, oder ein Komplement davon, und einen pharmazeutisch verträglichen Träger. In noch einer anderen speziellen Ausführungsform umfassen die Impfstoffzubereitungen der vorliegenden Erfindung, eine Nukleinsäure oder ein Fragment des IB80, beispielsweise des Virus mit der Hinterlegungsnummer 16061601 oder mit der Hinterlegungsnummer 16070701 , oder Nukleinsäuremoleküle, umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID Nos: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; oder ein Fragment davon. In einer anderen umfassen die Impfstoffpräparationen ein Prote- in/Polypeptid der Erfindung, das durch eine der vorstehend dargelegten Nukleotidsequenzen, oder einem Fragment davon, kodiert wird. In einer speziellen Ausführungsform enthalten die Impfstoffpräparationen Proteine/Polypeptide der Erfindung, umfassend oder bestehend aus einer Aminosäurenkette ausgewählt aus der Gruppe der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 13, 14, 15, 16, 17, 18 , 19 und 20; oder eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäuren kette mit einer Identität von > 85% zur Aminosäuresequenz SEQ ID NO: 13 oder zu einer Aminosäuresequenz ausgewählt aus der Gruppe der Aminosäuresequenzen mit einer Identität zu > 98% zu einer der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 14, 15, 16, 17, 18, 19 oder 20; oder wie sie durch eine der oben genannten erfindungsgemäßen Nukleotidsequenzen, oder ein Fragment davon, kodiert werden. Weiterhin betrifft die vorliegende Erfindung Verfahren zum Behandeln, Lindern, Handhaben oder Verhindern von Infektiöser Bronchitis (dies schließt generell auch andere durch IB80 verursachte Symptome ein), indem die Impfstoffpräparationen oder Antikörper der vorliegenden Erfindung alleine oder in Kombination mit Adjuvantien, oder anderen phar- mazeutisch annehmbaren Hilfsstoffen verabreicht werden. Weiterhin betrifft die vorliegende Erfindung Verfahren zum Behandeln, Lindern, Handhaben oder Verhindern von Infektiöser Bronchitis durch die Verabreichung der erfindungsgemäßen Zusammensetzungen und Formulierungen, einschließlich der Impfstoffzubereitungen oder Antikörper der vorliegenden Erfindung, allein oder in Kombination mit antiviralen Medikamenten [z.B. Amantadin, Rimantadin, Gancyclovir, Aciclovir, Ribavirin, Penciclovir, Oseltamivir, Foscarnet Zidovudin (AZT), Didanosin (DDL), Lamivudin (3TC), Zalcitabin (ddC), Stavudin (d4T), Nevirapin, Delavirdin, Indinavir, Ritonavir, Vidarabine, Nelfinavir, Saquinavir, Relenza, Tamiflu, Pleconaril, Interferone, etc.], mit Steroiden und Corticosteroiden wie Prednison, Cortison, Fluticason und Glukokortikoid, Antibiotika, Analgetika, Bronchodilatoren oder anderen Behandlungen für Atemwegs- und/oder virale Infektionen.
In einem verwandten Aspekt betrifft die Erfindung eine immunogene Formulierung, die eine immunogen wirksame Menge des oben beschriebenen erfindungsgemäßen IB-Virus und einen pharmazeutisch verträglichen Träger umfasst. In einem anderen verwandten Aspekt betrifft die Erfindung eine immunogene Formulierung, die eine immunogen wirksame Menge eines oben beschriebenen Proteinextrakts des erfindungsgemäßen IB80-Virus, oder eine Untereinheit davon, und einen pharmazeutisch verträglichen Träger umfasst.
In einem anderen verwandten Aspekt betrifft die Erfindung eine immunogene Formulie- rung, die eine immunogen wirksame Menge eines Nukleinsäuremoleküls, umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; eine Kombination davon oder ein Komplement davon, und einen pharmazeutisch verträglichen Träger. Insbesondere gelten hier für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %-ldentitäten. In einem anderen verwandten Aspekt betrifft die Erfindung eine immunogene Formulierung, die eine immunogen wirksame Menge eines Nukleinsäuremoleküls, enthaltend eine der oben beschriebenen erfindungsgemäße Nukleotidsequenzen, oder ein Komplement davon, und einen pharmazeutisch verträglichen Träger umfasst. In einem anderen verwandten Aspekt betrifft die Erfindung eine immunogene Formulierung, die eine immunogen wirksame Menge eines der oben beschriebenen erfindungsgemäßen Polypeptide umfasst.
In einem anderen Aspekt betrifft die vorliegende Erfindung pharmazeutische Zusammensetzungen, die antivirale Mittel der vorliegenden Erfindung und einen pharmazeutisch verträglichen Träger umfassen. In einer spezifischen Ausführungsform ist das antivirale Mittel der Erfindung ein Antikörper, der immunspezifisch IB80 oder ein IB80-Epitop bindet. In einer anderen spezifischen Ausführungsform ist das antivirale Mittel ein Polypeptid oder Protein der vorliegenden Erfindung oder Nukleinsäuremolekül der Erfindung.
In einem verwandten Aspekt betrifft die Erfindung eine pharmazeutische Zusammenset- zung, die eine prophylaktisch oder therapeutisch wirksame Menge eines anti-l B-Virus- Mittel und einen pharmazeutisch verträglichen Träger umfasst. In einer Ausführungsform der vorliegenden Erfindung ist das anti-IB80-Mittel ein Antikörper oder ein Antigen- bindendes Fragment davon, der immunspezifisch an das Virus der Hinterlegungsnummer 16061601 oder 16070701 , oder an davon abgeleitete Polypeptide oder Proteine bindet. In einer anderen ist das anti-IB80-Mittel ein Nukleinsäuremolekül, umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; eine Kombination davon oder ein Fragment davon. In anderen ist das anti-IB80-Mittel ein Polypeptid, das von einem Nukleinsäuremolekül, umfassend eine der vorstehend dargelegten erfindungsgemäßen Nukleotidsequenzen, kodiert wird, eine Kombination davon, oder ein Fragment davon mit einer biologischen Aktivität des Polypeptids. Insbesondere gelten hier für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %-ldentitäten.
Die Erfindung betrifft auch Kits, umfassend Zusammensetzungen und Formulierungen der vorliegenden Erfindung. So betrifft in einem anderen Aspekt die Erfindung ein Kit, umfassend einen Behälter, der die oben beschriebene erfindungsgemäße immunogene Formulierung enthält.
In einem weiteren Aspekt betrifft die Erfindung ein Kit, einschließlich eines Behälters, der die oben beschriebene erfindungsgemäße pharmazeutische Zusammensetzung enthält. In einem weiteren Aspekt betrifft die Erfindung ein Kit, einschließlich eines Behälters, der die oben beschriebene erfindungsgemäße Impfstoff-Formulierung enthält.
In einem weiteren Aspekt betrifft die Erfindung ein Verfahren zum Identifizieren eines Subjekts, das mit dem oben beschriebenen erfindungsgemäßen IB80 infiziert ist, einschließlich: (a) Gewinnen der Gesamt-RNA aus einer von dem Subjekt erhaltenen biolo- gischen Probe; (b) reverse Transkription der Gesamt-RNA, um cDNA zu erhalten; und (c) Amplifizieren der cDNA unter Verwendung eines Satzes von Primern, die von einer Nukleotidsequenz des oben beschriebenen erfindungsgemäßen IB-Virus abgeleitet sind.
In einer Ausführungsform der vorliegenden Erfindung wird der Satz von Primern von der Nukleotidsequenz des Genoms des IB-Virus der Hinterlegungsnummer 16061601 oder 16070701 abgeleitet. In einer anderen wird der Satz von Primern abgeleitet aus einer der oben beschriebenen erfindungsgemäßen Nukleotidsequenzen, oder ein Komplement davon.
Die Erfindung betrifft ferner die Verwendung der Sequenzinformation des isolierten IB80- Virus für diagnostische und therapeutische Verfahren. In einer speziellen Ausführungs- form betrifft die Erfindung Nukleinsäuremoleküle, die für die Verwendung als Primer geeignet sind, bestehend aus oder einschließlich einer der erfindungsgemäßen, oben dargelegten Nukleotidsequenzen, oder ein Komplement davon, oder zumindest einem Teil der Nukleotidsequenz davon. In einer anderen spezifischen Ausführungsform betrifft die Erfindung Nukleinsäuremoleküle, die für die Hybridisierung an die erfindungsgemäße IB80-Nukleinsäure geeignet sind; einschließlich, aber nicht beschränkt auf, PCR-Primer, Reverse Transkriptase-Primer, Sonden für die Southern-Analyse, Northern Blots, Sonden für Real-Time PCR, oder andere Hybridisierungsanalysen für Nukleinsäure zum Nachweis von IB80-Nukleinsäuren, beispielsweise bestehend aus oder einschließlich einer der erfindungsgemäßen, oben dargelegten Nukleotidsequenzen, eine Kombination davon, ein Komplement davon, oder einem Teil davon. Die Erfindung umfasst ferner chimäre oder rekombinante IB80-Viren, die vollständig oder teilweise durch die Nukleotidsequenzen kodiert werden. In einem anderen Aspekt betrifft die vorliegende Erfindung Verfahren zum Screening von antiviralen Mitteln, die die Infektiosität oder Replikation von IB80 einschließlich Varianten davon hemmen.
Die Erfindung betrifft weiterhin Verfahren zur Herstellung von rekombinanten oder chimä- ren Formen von IB80.
In einem weiteren Aspekt betrifft die Erfindung Impfstoffpräparate einschließlich des IB80- Virus, einschließlich rekombinanter und chimärer Formen des IB80-Virus oder Untereinheiten des IB80-Virus. Die vorliegende Erfindung umfasst rekombinante oder chimäre Viren, die von viralen Vektoren kodiert werden, die aus dem Genom des hierin beschrie- benen erfindungsgemäßen IB80-Virus oder natürliche Varianten davon abgeleitet sind. In einer speziellen Ausführungsform ist das rekombinante Virus ein aus dem IB80 Virus der Hinterlegungsnummer 16061601 oder 16070701 abgeleitetes Virus. Es wird anerkannt, dass natürliche Varianten der hierin beschriebenen erfindungsgemäßen IB80-Viren eine oder mehrere Mutationen umfassen, einschließlich, aber nicht beschränkt auf, Punktmu- tationen, Umlagerungen, Insertionen, Deletionen usw., in der genomischen Sequenz. Es wird anerkannt, dass die Mutationen zu oder nicht zu einer phänotypischen Veränderung führen können.
In einer anderen spezifischen Ausführungsform ist ein chimäres Virus der Erfindung ein rekombinantes IB80-Virus, das weiter eine heterologe Nukleotidsequenz umfasst. In Übereinstimmung mit der vorliegenden Erfindung kann ein chimäres Virus durch eine Nukleotidsequenz kodiert werden, in der heterologe Nukleotidsequenzen zum Genom hinzugefügt wurden oder in der endogene oder native Nukleotidsequenzen durch heterologe Nukleotidsequenzen ersetzt worden sind.
Gemäß der vorliegenden Erfindung werden die Chimären Viren durch die viralen Vektoren der Erfindung kodiert, die ferner eine heterologe Nukleotidsequenz umfassen. In Übereinstimmung mit der vorliegenden Erfindung wird ein chimäres Virus durch einen viralen Vektor kodiert, der Nukleinsäuren enthalten oder auch nicht enthalten kann, die für das virale Genom nicht-nativ sind. In Übereinstimmung mit der Erfindung wird ein chimäres Virus bevorzugt durch einen viralen Vektor kodiert, in dem heterologe Nukleotid- Sequenzen hinzugefügt, inseriert oder für native oder nicht-native Sequenzen substituiert worden sind. In Übereinstimmung mit der vorliegenden Erfindung kann das chimäre Virus durch aus verschiedenen Spezies oder Varianten des IB-Virus abgeleitete Nukleotidsequenzen kodiert werden. Insbesondere wird das chimäre Virus durch Nukleotidsequenzen kodiert, die für antigene, aus verschiedenen Spezies oder Varianten des IB-Virus abgeleitete Polypeptide kodieren.
Ein chimäres Virus kann für die Erzeugung von rekombinanten Impfstoffen von besonderem Nutzen sein, zum Schutz gegen zwei oder mehr Viren (Tao et al., J. Viral. 72,2955- 2961 ; Durbin et al., 2000, J. Viral. 74, 6821 -6831 ; Skiadopoulos et al., 1998, J. Viral. 72, 1762-1768 (1998); Teng et al., 2000, J. Viral. 74, 9317-9321 ). Beispielsweise kann vorgesehen sein, dass ein aus dem IB80-Virus abgeleiteter Virusvektor, der ein oder mehrere Proteine von Varianten des IB80-Virus exprimiert, ein mit einem solchen Vektor geimpftes Subjekt sowohl gegen Infektionen durch das native IB80-Virus als auch die Variante schützen wird. Abgeschwächte und Replikation-defiziente Viren können für Impfzwecke mit Lebendvakzinen nützlich sein, wie es für andere Viren vorgeschlagen worden ist. (siehe zum Beispiel WO 02/057302, auf den Seiten 6 und 23; und Publikation der US-Patentanmeldung US 2008/0069838, die durch Bezugnahme hierin aufgenommen sind). In Übereinstimmung mit der vorliegenden Erfindung schließt die in die viralen Vektoren zu inkorporierende heterologe Sequenz, die für die rekombinanten oder Chimären Viren der Erfindung kodieren, Sequenzen ein, aus unterschiedlichen Spezies oder Varianten von IB80 erhalten oder abgeleitet werden.
In bestimmten Ausführungsformen werden die Chimären oder rekombinanten Viren der Erfindung durch virale Vektoren kodiert, die von viralen Genomen abgeleitet sind, worin eine oder mehrere Sequenzen, intergenetische Regionen, Termini-Sequenzen oder Teile oder gesamte ORF durch eine heterologe oder nicht-native Sequenz ersetzt worden sind. In bestimmten Ausführungsformen der Erfindung werden die Chimären Viren der Erfindung durch virale Vektoren kodiert, die von viralen Genomen abgeleitet sind, worin eine oder mehrere heterologe Sequenzen in den Vektor insertiert oder hinzugefügt worden sind.
Die Auswahl des viralen Vektors kann von der Spezies des Subjekts abhängen, die bezüglich einer Virusinfektion behandelt oder geschützt werden soll. Ein abgeschwächter IB80-Virus kann verwendet werden, um die antigenen Sequenzen bereitzustellen. In Übereinstimmung mit der vorliegenden Erfindung können die viralen Vektoren konstruiert werden, um antigene Sequenzen bereitzustellen, die Schutz gegen eine Infektion desselben durch das erfindungsgemäße IB80 und natürliche Varianten davon verleihen. Die viralen Vektoren können so konstruiert werden, um ein, zwei, drei oder mehrere antigene Sequenzen bereitzustellen. In Übereinstimmung mit der vorliegenden Erfindung können die antigenen Sequenzen vom gleichen Virus, von verschiedenen Spezies oder Varianten des gleichen Virus-Typs oder von verschiedenen Viren abstammen. Die Expressionsprodukte und/oder rekombinante oder chimäre Virionen, die in Übereinstimmung mit der Erfindung erhalten wurden, können in vorteilhafter Weise in Impfstoffformulierungen verwendet werden. Die Expressionsprodukte und Chimären Virionen der vorliegenden Erfindung können konstruiert sein, um Impfstoffe gegen ein breites Spektrum von Pathogenen zu erzeugen, einschließlich viraler und bakterieller Antigene, Tu- morantigene, Allergenantigene und an Autoimmunerkrankungen beteiligte Autoantigene. Eine Möglichkeit, dieses Ziel zu erreichen, beinhaltet bestehende IB80-Gene dahingehend zu modifizieren, dass sie Fremdsequenzen in ihren jeweiligen externen Domänen enthalten. Wo die heterologe Sequenzen Epitope oder Antigene von Krankheitserregern sind, können diese Chimären Viren verwendet werden, um eine schützende Immunant- wort gegen den Krankheitserreger zu induzieren, aus dem diese Determinanten abgeleitet sind. Insbesondere können die Chimären Virionen der vorliegenden Erfindung konstruiert werden, um Impfstoffe für den Schutz eines Subjektes vor Infektionen mit IB80-Virus und Varianten davon zu verleihen.
Somit betrifft die vorliegende Erfindung weiterhin die Verwendung von viralen Vektoren und erfindungsgemäßen rekombinanten oder Chimären Viren, um Impfstoffe gegen ein breites Spektrum von Viren und/oder Antigenen zu formulieren. Die vorliegende Erfindung umfasst auch erfindungsgemäße rekombinante Viren, einschließlich eines viralen aus dem IB80 oder Varianten davon abgeleiteten Vektors, der Sequenzen enthält, die zu einem Virus mit einem für die Verwendung in Impfstoffformulierungen besser geeigneten Phänotyp führen, z.B. ein abgeschwächter Phänotyp oder mit verbesserter Antigenität. Die Mutationen und Modifikationen können in kodierenden Regionen liegen, in intergenetischen Regionen und in den Leader- und Trailer-Sequenzen des Virus.
Die Erfindung betrifft eine Wirtszelle mit einer Nukleinsäure oder einem Vektor gemäß der Erfindung. Plasmid- oder virale Vektoren, die die Polymerase-Komponenten des IB80-Virus enthalten, werden in prokaryotischen Zellen für die Expression der Komponenten in den entsprechenden Zelltypen (Bakterien, Insektenzellen, eukaryotische Zellen) erzeugt. Plasmid- oder viralen Vektoren mit voller Länge oder teilweisen Kopien des IB80-Genoms enthalten, werden in prokaryotischen Zellen für die Expression von viralen Nukleinsäuren in vitro oder in vivo erzeugt. Die letztgenannten Vektoren enthalten gege- benenfalls andere virale Sequenzen für die Erzeugung von Chimären Viren oder Chimären Virusproteinen, ihnen fehlen gegebenenfalls Teile des viralen Genoms zur Erzeugung eines replikationsdefekten Virus, und sie enthalten gegebenenfalls Mutationen, Deletionen oder Insertionen zur Erzeugung von abgeschwächten Viren. Darüber hinaus betrifft die vorliegende Erfindung eine Wirtszelle, Zelllinie und/oder Ei-System, beispielsweise Brutei, die mit einem IB80-Virus der Hinterlegungsnummer 16061601 oder 16070701 infiziert ist. Wirtszellen bzw. Zelllinien sind allgemein über Zellbanken verfügbar, Ei-Systeme wie beispielsweise Bruteier über die jeweiligen Produzenten.
Infektiöse Kopien des IBV (als Wildtyp, abgeschwächt, replikationsdefekt oder chimär) werden optional bei Co-Expression der Polymerase-Komponenten gemäß den oben beschriebenen Technologien des Standes der Technik hergestellt.
Zusätzlich werden gegebenenfalls eukaryotische Zellen, die transient oder stabil ein oder mehrere IB80-Proteine in voller Länge oder partiell exprimieren, verwendet. Vorzugsweise werden solche Zellen durch Transfektion (Proteine oder Nukleinsäurevektoren), Infek- tion (virale Vektoren) oder Transduktion (virale Vektoren) hergestellt, und sind nützlich für die Komplementierung des genannten Wildtyps, abgeschwächter, replikationsdefekter oder chimärer Viren.
Die viralen Vektoren und Chimären Viren der vorliegenden Erfindung können gegebenenfalls das Immunsystem eines Subjekts modulieren, indem sie eine humorale Immunreak- tion, eine zelluläre Immunantwort stimulieren, oder durch Stimulieren einer Toleranz gegen ein Antigen. Wie hier verwendet, bedeutet ein Subjekt: bevorzugt Menschen, Primaten, Pferde, Kühe, Schafe, Schweine, Ziegen, Hunde, Katzen, Vogelarten und Nagetiere. Speziell bedeutet ein Subjekt: Vogelarten, ganz besonders Hühner.
Formulierung von Impfstoffen und Virostatika In einer bevorzugten Ausführungsform betrifft die Erfindung ein proteinartiges Molekül oder IB80-Virus spezifisches virales Protein oder ein funktionelles Fragment davon, das durch eine Nukleinsäure gemäß der Erfindung kodiert wird. Nützliche proteinartige Moleküle stammen beispielsweise aus einem der Gene oder genomischen Fragmenten, die aus dem Virus gemäß der Erfindung ableitbar sind. Solche Moleküle, oder deren antigene Fragmente, wie hierin vorgesehen, sind beispielsweise nützlich in diagnostischen Verfahren oder Kits und in pharmazeutischen Zusammensetzungen wie Untereinheit-Vakzinen. Besonders geeignet sind Polypeptide, die durch eine erfindungsgemäße Nukleotidsequenz, umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; kodiert werden, oder antigene Fragmente davon, für die Einbeziehung als Antigen oder Immunogen-Untereinheit, aber das inaktivierte ganze Virus kann ebenfalls verwendet werden. Insbesondere gelten hier für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %-ldentitäten. Besonders nützlich sind auch solche proteinartigen Substanzen, die durch rekombinante Nukleinsäurefragmente des IB80-Genoms kodiert werden, bevorzugt natürlich sind diejenigen, die innerhalb der bevorzugten Grenzen und Maße von ORFs liegen, insbesondere um spezifische IBV-Antikörper- oder T-Zellen-Reaktionen hervorzurufen, sei es in vivo (z.B. für schützende oder therapeutische Zwecke oder für die Bereitstellung von diagnostischen Antikörpern) oder in vitro (z.B. durch Phagen-Display-Technik oder einer anderen Technik, die für die Erzeugung synthetischer Antikörper nützlich ist).
Es wird anerkannt, dass zahlreiche Varianten, Analoga oder Homologe von IB80- Polypeptiden im Rahmen der vorliegenden Erfindung liegen, einschließlich Substitutionen, Änderungen, Modifikationen von Aminosäure oder andere Veränderungen von Aminosäure, die die Funktion oder immunogene Neigung des erfindungsgemäßen Immunogen oder Impfstoffs erhöhen, vermindern oder nicht verändern. Mehrere post- translationale Modifikationen liegen gleichermaßen innerhalb des Umfangs der vorliegenden Erfindung, veranschaulichend einschließlich Inkorporation von natürlich vorkommender Aminosäure(n), Phosphorylierung, Glycosylierung, Sulfatierung, und das Hinzufügen von Seitengruppen wie Biotinylierung, Fluorophore, Lumiphore, radioaktive Gruppen, Antigene oder andere Moleküle.
Verfahren zur Expression und Reinigung von natürlichen oder rekombinanten Peptiden und Proteinen sind in der Technik gut bekannt. Veranschaulichend, werden Peptide und Proteine rekombinant in eukaryotischen Zellen exprimiert. Beispielhafte eukaryontische Zellen umfassen Hefe, HeLa-Zellen, 293-Zellen, COS-Zellen, Ovarialzellen des chinesischen Hamsters (CHO), und viele andere in der Technik bekannte Zelltypen. Sowohl eukaryotische und prokaryotische Expressionssysteme und Zellen stehen zur Verfügung, beispielsweise von Invitrogen Corp., Carlsbad, CA. Es versteht sich, dass zellfreie Expressionssysteme ähnlich betrieben werden können. In einer bevorzugten Ausführungsform ist ein immunogenes Polypeptid ein IB80-Protein in voller Länge. Vorzugsweise ist ein Immunogen IB80-Protein voller Länge, umfassend eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäuren kette ausgewählt aus der Gruppe der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 13, 14, 15, 16, 17, 18 , 19 und 20; oder eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäurenkette mit einer Identität von > 85% zur Aminosäuresequenz SEQ ID NO: 13 oder zu einer Aminosäuresequenz ausgewählt aus der Gruppe der Aminosäuresequenzen mit einer Identität zu > 98% zu einer der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 14, 15, 16, 17, 18, 19 oder 20. oder ein Fragment davon, wie hierin beschrieben. Insbesondere gelten hier für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %-ldentitäten. Vorzugsweise hat ein Immunogen ein Minimum von 5 Aminosäuren. Wie hierin verwendet, ist ein Immunogen vorzugsweise ein Polypeptid. Im Kontext eines immunogenen Polypeptids werden die Begriffe Immunogen, Polypeptid und Antigen untereinander austauschbar verwendet. Es können Modifikationen und Änderungen in der Struktur der erfindungsgemäßen Immunogene vorgenommen werden, die Gegenstand der Anmeldung sind und immer noch ein Molekül mit ähnlichen oder verbesserten Eigenschaften wie die Wildtyp-Sequenz zu ergeben (z.B. eine konservative Aminosäuresubstitution). Beispielsweise werden gegebenenfalls bestimmte Aminosäuren durch andere Aminosäuren in einer Sequenz ohne nennenswerten Verlust an immunogene Aktivität substituiert. Weil es die interaktive Kapazität und Natur eines Polypeptids ist, die die biologische funktionelle Aktivität definiert, können in einer Polypeptidsequenz bestimmte Aminosäuresequenz-Substitutionen vorgenommen werden und dennoch ein Polypeptid mit gleichen oder verbesserten Eigenschaften erhalten werden. Optional wird ein Polypeptid verwendet, das weniger oder mehr immunogene Aktivität im Vergleich zur Wildtyp-Sequenz hat.
Bei Vornahme solcher Änderungen, wird der Hydropathie-Index von Aminosäuren bevorzugt berücksichtigt. Die Bedeutung des hydropathischen Aminosäureindex beim Verleihen der interaktiven biologischen Funktion an ein Polypeptid wird in der Technik allgemein verstanden. Es ist bekannt, dass bestimmte Aminosäuren für andere Aminosäuren mit einem ähnlichen hydropathischen Index oder Wert ersetzt werden können und noch ein Polypeptid mit ähnlicher biologischer Aktivität ergeben. Jeder Aminosäure wurde ein Hydropathie-Index auf der Grundlage ihrer Hydrophobizität und Ladungseigenschaften zugeordnet. Diese Indizes sind beispielsweise nach Kyte und Doolittle: Isoleucin (+4,5); Valin (+4,2); Leucin (+3,8); Phenylalanin (+2,8); Cystein/Cystein (+2,5); Methionin (+1 ,9); Alanin (+1 ,8); Glycin (-0,4); Threonin (-0,7); Serin (-0,8); Tryptophan (-0,9); Tyrosin (-1 ,3); Prolin (-1 ,6); Histidin (-3,2); Glutamat (-3,5); Glutamin (-3,5); Aspartat (-3,5); Asparagin (- 3,5); Lysin (-3,9); und Arginin (-4,5).
Es wird angenommen, dass der relative hydropathische Charakter der Aminosäure die Sekundärstruktur des resultierenden Polypeptids bestimmt, die wiederum die Wechsel- Wirkung des Polypeptids mit anderen Molekülen, wie Enzymen, Substraten, Rezeptoren, Antikörpern, Antigenen und dergleichen definiert. Es ist in der Technik bekannt, dass eine Aminosäure durch eine andere Aminosäure mit einem ähnlichen Hydropathie-Index ersetzt werden kann und dennoch ein funktionell äquivalentes Immunogen ergeben. Bei solchen Veränderungen ist die Substitution von Aminosäuren bevorzugt, deren hydropa- thische Indizes innerhalb von ± 2 liegen, besonders bevorzugt sind solche innerhalb ± 1 , und diejenigen innerhalb von ± 0,5 sind ganz besonders bevorzugt.
Wie oben dargelegt, beruhen Aminosäuresubstitutionen allgemein auf der relativen Ähnlichkeit der Aminosäureseitenketten-Substituenten, beispielsweise ihre Hydrophobie, Hydrophilie, Ladung, Größe und dergleichen. Beispielhafte Substitutionen, die verschie- dene der vorstehenden Eigenschaften zu berücksichtigen und die dem Fachmann auf dem Gebiet gut bekannt sind, umfassen (ursprünglicher Rest: beispielhafte Substitution): (Ala: Gly, Ser), (Arg: Lys), (Asn: Gin, His), (Asp: Glu, Cys, Ser), (Gin: Asn), (Glu: Asp), (Gly: Ala), (His: Asn, Gin), (lle: Leu, Val), (Leu: lle, Val), (Lys: Arg), (Met: Leu, Tyr), (Ser: Thr), (Thr: Ser), (Tip: Tyr), (Tyr: Trp, Phe) und (Val: lle, Leu). Die Ausführungsformen dieser Offenbarung ziehen somit funktionelle oder biologische Äquivalente eines Polypeptids und Immunogen in Betracht, wie oben dargelegt. Insbesondere umfassen die Ausführungsformen der Polypeptide und Immunogene gegebenenfalls Varianten mit etwa 50%, 60%, 70%, 80%, 90% und 95% Sequenzidentität zum Polypeptid von Interesse.
Die Erfindung betrifft Impfstoff-Formulierungen für die Prävention und Behandlung von Infektionen mit IB80-Virus. In bestimmten Ausführungsformen umfasst der Impfstoff der Erfindung rekombinante und Chimären Viren des IB80-Virus. In bestimmten Ausführungsformen ist das Virus abgeschwächt.
In einer anderen Ausführungsform dieses Aspekts der Erfindung werden inaktivierte Impfstoff-Formulierungen unter Verwendung herkömmlicher Techniken hergestellt, um die Viren zu "töten". Inaktivierte Impfstoffe sind "tot" in dem Sinne, dass ihre Infektiosität zerstört wurde und kein restliches vermehrungsfähiges Virus mehr nachweisbar ist. Idealerweise wird die Infektiosität des Virus zerstört, ohne seine Immunogenität zu beeinflussen. Um inaktivierte Impfstoffe herzustellen, kann das Virus in Zellkultur oder in Ei- System, z.B. im Brutei, insbesondere in der Allantois eines Vogelembryos (wie insbesondere z.B. im Allantois des Hühnerembryos) gezüchtet werden, beispielsweise durch zonale Ultra-Zentrifugation gereinigt, beispielsweise durch Formaldehyd, ß-Propiolacton, und/oder andere Verfahren inaktiviert und gepoolt werden. Der resultierende Impfstoff kann intramuskulär, subkutan oder intranasal inokuliert werden.
Inaktivierte Viren werden gegebenenfalls mit einem geeigneten Adjuvans formuliert, um die immunologische Antwort zu verstärken. Solche Adjuvantien umfassen veranschaulichend, sind aber nicht darauf beschränkt, Mineralgele, beispielsweise Aluminiumhydroxid; oberflächenaktive Substanzen wie Lysolecithin, Pluronic-Polyole, Polyanionen; Peptide; Öl-Emulsionen; und potentiell nützliche tierische oder menschliche Adjuvantien, wie BCG und Corynebacterium parvum.
In einem anderen Aspekt betrifft die vorliegende Erfindung auch Formulierungen von DNA-Vakzinen, die eine Nukleinsäure oder ein Fragment des erfindungsgemäßen IB- Virus, zum Beispiel das Virus der Hinterlegungsnummer 16061601 oder 16070701 oder Nukleinsäuremoleküle, umfassend eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9; oder umfassend eine Nukleinsäure der SEQ ID NO: 10; oder umfassend eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10; oder ein Fragment davon enthalten. Insbesondere gelten hier für die vorstehenden SEQ ID NOs auch die oben angegebenen bevorzugten %-ldentitäten. In einer anderen speziellen Ausführungsform umfassen die DNA-Vakzin-Formulierungen der vorliegenden Erfindung eine Nukleinsäure oder ein Fragment davon, die für Antikörper kodieren, die immunspezifisch IB-Viren binden. In DNA-Vakzin-Formulierungen umfasst eine Impfstoff-DNA einen viralen Vektor, wie er aus dem IB-Virus abgeleitet ist, ein bakterielles Plasmid oder einen anderen Expressionsvektor, der ein Insert mit einem Nukleinsäuremolekül der vorliegenden Erfindung trägt, funktionsfähig verknüpft mit ein oder mehreren Kontrollelementen, um dadurch die Expression der durch das Nukleinsäuremolekül kodierten Proteine in einem geimpften Subjekt zu ermöglichen. Solche Vektoren können durch rekombinante DNA-Technologie als rekom- binante oder chimäre virale Vektoren, die ein Nukleinsäuremolekül der vorliegenden Erfindung tragen, hergestellt werden.
Eine Nukleinsäure, wie hierin verwendet, bezieht sich auf Einzelstrang- oder Doppelstrang-Moleküle, die gegebenenfalls DNA sind, einschließlich der Nukleotidbasen A, T, C und G, oder RNA, einschließlich der Basen A, U (ersetzt T), C und G. Die Nukleinsäure kann einen kodierenden Strang oder dessen Komplement darstellen. Nukleinsäuren sind gegebenenfalls Sequenz-identisch mit der Sequenz, die natürlich vorkommt, oder umfassen alternative Codons, die die gleiche Aminosäure kodieren, wie diese in der natürlich vorkommenden Sequenz zu finden ist. Weiterhin umfassen Nukleinsäuren optional Codons, die konservative Substitutionen von Aminosäuren darstellen, wie sie in der Technik gut bekannt sind.
Wie hier verwendet, bedeutet der Begriff "isolierte Nukleinsäure" eine Nukleinsäure, die getrennt von oder im Wesentlichen frei sind von zumindest einigen der anderen Kompo- nenten des natürlich vorkommenden Organismus, beispielsweise üblicherweise die mit Nukleinsäuren in einer zellulären Umgebung assoziiert gefundenen Zellstrukturkomponenten und/oder anderen Nukleinsäuren. Die Isolierung von Nukleinsäuren wird veranschaulichend durch Techniken erreicht, wie Lyse, gefolgt von Phenol- und Chloroform- Extraktion, gefolgt von Ethanol-Präzipitation der Nukleinsäuren. Die Nukleinsäuren dieser Erfindung werden veranschaulichend aus Zellen isoliert, gemäß Verfahren, die in der Technik gut für die Isolierung von Nukleinsäuren bekannt sind. Alternativ können die Nukleinsäuren der vorliegenden Erfindung gegebenenfalls nach in der Literatur gut beschriebenen Standardprotokollen zur Synthese von Nukleinsäuren synthetisiert werden. Modifikationen der Nukleinsäuren der Erfindung werden auch in Erwägung gezogen, vorausgesetzt, dass die wesentliche Struktur und Funktion des Peptids oder Polypeptids, das durch die Nukleinsäure kodiert wird, beibehalten werden.
Die für das Peptid oder Polypeptid der vorliegenden Erfindung kodierende Nukleinsäure ist gegebenenfalls Teil eines rekombinanten Nukleinsäurekonstrukts, umfassend eine beliebige Kombination von Restriktionsstellen und/oder Funktionselementen, wie sie in der Technik gut bekannt sind, um die molekulare Klonierung und andere rekombinante DNA-Manipulationen zu erleichtern. Somit betrifft die vorliegende Erfindung weiterhin ein rekombinantes Nukleinsäurekonstrukt, enthaltend eine Nukleinsäure, die für ein Polypeptid dieser Erfindung kodiert.
Im Allgemeinen kann es vorteilhaft sein, eine cDNA-Version des (rekombinanten) Polynukleotids zu verwenden. Es wird angenommen, dass die Verwendung einer cDNA- Version Vorteile bietet, indem die Größe des Gens im Allgemeinen wesentlich kleiner sein kann und leichter eingesetzt werden kann, um die Zielzelle zu transfizieren, als ein genomisches Gen wird, das typischerweise bis zu einer Größenordnung größer sein wird als das cDNA-Gen. Allerdings schließt die Erfindung die Möglichkeit nicht aus, dass falls gewünscht eine genomische Version eines bestimmten Gens verwendet wird.
Wie hier verwendet, sind die Begriffe "konstruierte" und "rekombinante" Zellen gleichbedeutend mit "Wirtszellen" und sind beabsichtigt, sich auf eine Zelle oder Zelllinie zu beziehen, in die ein exogenes DNA-Segment oder Gen, wie eine cDNA oder ein Gen, eingeführt worden ist. Daher sind konstruierte Zellen unterscheidbar von natürlich vorkommenden Zellen, die kein rekombinant eingeführtes exogenes DNA-Segment oder Gen enthalten. Eine Wirtszelle, oder Zelllinie, ist gegebenenfalls eine natürlich vorkommende Zelle oder Zelllinie, die mit einem exogenen DNA-Segment oder Gen transformiert oder transfiziert ist oder eine Zelle oder Zelllinie, die nicht modifiziert ist. Eine Wirtszelle besitzt vorzugsweise nicht ein natürlich vorkommendes kodierendes Spike-Protein Gen. Konstruierte Zellen oder Zelllinien sind also Zellen, die ein Gen oder Gene, eingeführt durch die Hand des Menschen, aufweisen. Rekombinante Zellen umfassen veranschaulichend solche, die eine eingeführte cDNA oder genomische DNA oder RNA aufweisen, und umfassen auch Gene, die benachbart zu einem Promotor positioniert sind, der natürlicherweise nicht mit dem bestimmten eingeführten Gen assoziiert ist.
Um ein rekombinantes kodiertes Polypeptid in Übereinstimmung mit der vorliegenden Erfindung zu exprimieren, stellt man gegebenenfalls einen Expressionsvektor her, der ein Polynukleotid unter der Kontrolle eines oder mehrerer Promotoren enthält. Um eine kodierende Sequenz "unter die Kontrolle" eines Promotors zu bringen, positioniert man das 5'-Ende der Translationsinitiationsstelle des Leserahmens im Allgemeinen zwischen etwa 1 und 50 Nukleotiden "stromabwärts" von (d.h. von 3' von) dem gewählten Promotor. Der Promotor "stromaufwärts" stimuliert die Transkription der eingefügten DNA und fördert die Expression des kodierten rekombinanten Proteins. Dies ist die Bedeutung von "rekombinanter Expression" wie hier im Kontext verwendet.
Viele Standardtechniken sind verfügbar, um Expressionsvektoren zu konstruieren, enthaltend die entsprechenden Nukleinsäuren und Transkriptions-/Translations- Kontrollsequenzen, um in einer Vielzahl von Wirt-Expressionssystemen Protein oder Peptidexpression zu erreichen. Verfügbare Zelltypen zur Expression umfassen, sind aber nicht beschränkt auf, Bakterien, wie beispielsweise E. coli und B. subtilis, transformiert mit rekombinanter Phagen-DNA, Plasmid-DNA oder Cosmid-DNA-Expressionsvektoren. Es können auch eukaryotische Expressionssysteme verwendet werden, wie beispielsweise Hefen, Baculovirus und Insektenzellen, oder HEK Zellen. Die Abschwachung von IB80-Virus
Der erfindungsgemäße IB80-Virus oder Varianten davon sind optional genetisch so konstruiert, dass sie einen abgeschwächten Phänotyp aufweisen. Insbesondere zeigen die Viren der Erfindung einen abgeschwächten Phänotyp in einem Subjekt, dem das Virus als Impfstoff verabreicht wird. Abschwächung kann durch jedes für einen Fachmann bekanntes Verfahren erreicht werden. Ohne durch eine Theorie gebunden zu sein, wird der abgeschwächte Phänotyp der Viren der Erfindung bewirkt, beispielsweise durch Verwendung eines Virus, das natürlich nicht gut in einer beabsichtigten Wirtsart repliziert wird, beispielsweise durch verminderte Replikation des viralen Genoms, durch eine reduzierte Fähigkeit des Virus eine Wirtszelle zu infizieren, oder durch eine reduzierte Fähigkeit der viralen Proteine, ein infektiöses virales Partikel relativ zu den Wildtyp- Spezies des Virus zu montieren.
Unter Attenuierung (Schwächen, Vermindern) oder auch Virulenzminderung, Attenuation, versteht man in der Mikrobiologie die gezielte Verminderung der krankmachenden Eigen- schatten eines Erregers (Virulenz), wobei aber gleichzeitig seine Vermehrungsfähigkeit erhalten bleibt oder nur gering herabgesetzt wird. Bei der Attenuierung wird auch angestrebt, die für die Immunabwehr wesentlichen Oberflächeneigenschaften des Erregers (Epitope) und so seine Immunogenität zu erhalten. Daher ist die Attenuierung eine Möglichkeit, Lebend Impfstoffe für eine aktive Immunisierung herzustellen. Die dazu einsetzba- ren Verfahren sind dem Fachmann auf dem Gebiet gut bekannt.
Bei der Attenuierung wird die natürliche Eigenschaft des Erregers ausgenutzt, sich in einem für ihn ungünstigen Wirt zu Beginn zwar gering vermehren zu können, jedoch oft keine Erkrankung auszulösen. Dies wird etwa bei Viren dadurch erklärt, dass jene Rezeptoren der Virusoberfläche, die eine Aufnahme in eine spezifische Zielzelle ermöglichen, nicht auf die Zellen des neuen Wirtes angepasst sind. Weiterhin sind in Zellkulturen die Gene zur Immunevasion und manche Virulenzfaktoren unnötig und werden daher oftmals deletiert.
Nach mehrmaligen Passagen (z.B. in einer Zellkultur, Hühnerembryo oder einem lebenden Tier) werden jene Mutanten des Erregers selektiert, die sich noch vermehren können und bei einer Übertragung auf den ursprünglichen Wirt (etwa den Menschen) in geringerer Anzahl oder mit geringeren Erkrankungssymptomen repliziert werden. Zur Attenuierung wird/kann auch die Anzucht des Erregers bei ungünstigeren, niedrigen Temperaturen (etwa 25° C) verwendet werden, bei der die Erreger ebenfalls ihre Virulenz verlieren können.
Herstellung von Antikörpern
Techniken zur Gewinnung von Antikörpern oder antigen wirkenden Fragmenten davon sind dem Fachmann auf dem Gebiet gut bekannt. Beispielsweise ist ein monoklonaler Antikörper ist gegen genau ein spezifisches Epitop eines Antigens gerichtet. Zunächst müssen, wie bei der polyklonalen Antikörperherstellung beschrieben, Tiere immunisiert und dann deren Plasmazellen (aus Milz oder Lymphknoten) gewonnen werden. Da die Plasmazellen die Fähigkeit zur Zellteilung verloren haben, muss zuerst eine Verschmel- zung mit Tumorzellen erfolgen. Die so entstandenen Zellhybriden (Hybridom-Technik) erhalten von den Plasmazellen die Eigenschaft, einen bestimmten Antikörper zu produzieren und zu sezernieren und von der Tumorzelle die Fähigkeit, in Kultur sich theoretisch unendlich oft teilen zu können und somit theoretisch unendlich lange zu leben. Durch mehrfaches Vereinzeln (Klonieren) wird ein Stamm von Zellen gewonnen, der auf eine einzelne Hybridoma-Zelle und somit auf eine einzelne Plasma-Zelle zurückgeht. Die so erhaltenen Zelllinien können nun in Kultur unendlich stark expandiert werden und damit auch theoretisch unendlich große Mengen Antikörper produzieren. Da alle Zellen auf eine einzige Zelle zurückzuführen sind, handelt es sich bei allen Zellen einer Kultur um identische Kopien ein und derselben Zelle. Aufgrund dessen produzieren auch alle Zellen einen bestimmten, identischen Antikörper, der sich hinsichtlich seiner Eigenschaften (z. B. Bindungsstelle am Antigen, Stärke der Bindung etc.) genau definieren lässt und in theoretisch unbegrenzter Menge herstellbar ist.
Pharmazeutische Zusammensetzungen und Kits
Die vorliegende Erfindung umfasst pharmazeutische Mischungen (Zusammensetzungen), einschließlich antiviraler Mittel der vorliegenden Erfindung. In einer spezifischen Ausführungsform ist das antivirale Mittel vorzugsweise ein Antikörper, der immunspezifisch das IB80-Virus oder Varianten davon oder irgendwelche davon abgeleitete Proteine bindet und neutralisiert. In einer anderen spezifischen Ausführungsform ist das antivirale Mittel ein Polypeptid oder Nukleinsäuremolekül der Erfindung. Die pharmazeutischen Zusam- mensetzungen sind nützlich als antivirales prophylaktisches Mittel werden veranschaulichend einem Subjekt verabreicht, wenn der Gegenstand ausgesetzt wurde oder wird erwartet, dass ein Virus ausgesetzt. Dem Fachmann auf dem Gebiet sind verschiedene Abgabesysteme bekannt und er versteht, diese herzustellen, um die pharmazeutische Mischung (Zusammensetzung) der Erfindung zu verabreichen. Veranschaulichend seien genannt: Verkapselung in Liposomen, Mikropartikel, Mikrokapseln, rekombinante Zellen, die die mutanten Viren exprimieren, und Rezeptor-vermittelte Endozytose. Verfahren zum Einbringen umfassen, sind jedoch nicht beschränkt darauf, intradermale, intramuskuläre, intraperitoneale, intravenöse, subkutane, intranasale, epidurale und orale Wege. Die Mittel und pharmazeutischen Mischungen (Zusammensetzungen) der Erfindung können auf jedem geeigneten Weg, beispielsweise durch Infusion oder Bolusinjektion, durch Absorption durch Epithel- oder Schleimhautauskleidungen (beispielsweise Mundschleimhaut, kloakale und intestinale Mukosa, usw.), gegebenenfalls verabreicht zusammen mit anderen biologisch aktiven Mitteln, verabreicht werden. Die Verabreichung ist systemisch oder lokal. In einer bevorzugten Ausführungsform ist es wünschenswert, die Mittel und pharmazeutischen Mischungen (Zusammensetzungen) der Erfindung in die Lunge über jeden geeigneten Weg einzuführen. Pulmonale Verabreichung kann auch, beispielsweise durch Verwendung eines Inhalators oder Vernebier, und Formulierung mit einem Aerosolisierungsmittel erfolgen.
Im Rahmen der vorliegenden Erfindung stehen vorzugsweise bei der Massenapplikation von Lebend-Impfstoffen an Wirtschaftsgeflügel die Gabe über das Tränkwasser oder die Verabreichung mittels Spray (Aerosol) im Vordergrund, und sind namentlich bei IB-Viren, z.B. den erfindungsgemäßen Viren (IB80), von Bedeutung ist. Ebenfalls geeignet ist im Rahmen der vorliegenden Erfindung auch die die Impfstoffapplikation über das Auge, das sogenannte„eye-drop-Verfahren" von Bedeutung, bei dem jedem Tier einzeln ein Tropfen der, das Mittel und pharmazeutischen Mischungen (Zusammensetzungen) der Erfin- dung enthaltenden, Impflösung ins Auge getropft wird.
Nachweis-Assavs
Die vorliegende Erfindung betrifft auch ein Verfahren zum Nachweis eines Antikörpers, der immunspezifisch an das erfindungsgemäße IB80-Virus bindet, z.B. in einer biologischen Probe, einschließlich beispielsweise Blut, Serum, Plasma, Speichel, Urat, Stuhl usw. von einem Subjekt, das unter einer IBV-Infektion leidet. In einem solchen Verfahren wird eine Probe z.B. mit dem IB80-Virus oder einer erfindungsgemäßen genomischen Nukleinsäuresequenz in Kontakt direkt auf einem Substrat immobilisiert und der Virusgebundene Antikörper direkt oder indirekt durch geeignetes Verfahren detektiert. Detekti- onsverfahren sind dem Fachmann auf dem Gebiet gut bekannt, und umfassen z.B. Hybridisierungsmethoden, Markierungsmethoden, Detektionssonden,
Immunofluoreszenz-Assay. Es können in vitro- oder in v/Vo-Methoden sein.
Screeninq-Assavs zur Identifizierung von Antiviralen Mitteln
Die Erfindung betrifft schließlich noch ein Verfahren zur Identifizierung von Mitteln oder einer Substanzen, die die Fähigkeit des IBV Virus, insbesondere des IB80, hemmen, einen Wirt oder eine Wirtszelle zu infizieren. In bestimmten Ausführungsformen betrifft die Erfindung Verfahren zur Identifizierung von Mitteln oder Substanzen, die die Fähigkeit des IBV Virus, insbesondere des IB80, hemmen, in einem Wirt oder einer Wirtszelle zu replizieren. Jede Technik, die dem Fachmann bekannt ist, kann hierzu verwendet wer- den.
In bestimmten Ausführungsformen betrifft die Erfindung Verfahren zur Identifizierung von Mitteln oder Substanzen, die die Fähigkeit des IBV Virus, insbesondere des IB80, hemmen, in einer Vogelart oder insbesondere in Geflügel, z.B. Hühnern, zu replizieren. Genauer gesagt betrifft die Erfindung Verfahren zur Identifizierung von Mitteln oder Sub- stanzen, die die Fähigkeit des IBV Virus, insbesondere des IB80, hemmen, eine Vogelart oder insbesondere Geflügel, z.B. Hühner, zu infizieren. In bestimmten Ausführungsformen betrifft die Erfindung Verfahren zur Identifizierung von Mitteln oder Substanzen die die Fähigkeit des IBV Virus, insbesondere des IB80, hemmen, in Wirtszellen, Zelllinien und/oder Ei-Systemen, beispielsweise in Bruteiern, zu replizieren.
BEISPIELE
Beispiel 1 : Virusisolation:
Das zur Virusisolation verwendete Material entstammt der Monitoringuntersuchung einer zu diesem Zeitpunkt klinisch unauffälligen Hühnerherde. Zur kulturellen Anzucht wurde ein Pool von Caecaltonsillen verwendet. Dieses Organmaterial wurde in 15 ml-Röhrchen mit 1x PBS, pH 7-7,4 mit 50 μg/ml Gentamycin und 2,5 μg/ml Amphotericin B, im Verhältnis 1 :10 versetzt. Nach Zugabe von drei Edelstahl-Beads (Durchmesser 6 mm) wurde die Probe im FastPrep-24 (MP Biomedicals) für 30 sek bei Raumtemperatur homogenisiert. Zur Klärung des Organmaterials wurde dieses anschließend bei 2.000 x g und 4 °C für 20 Minuten zentrifugiert und der Überstand mit einem 0,45 μιη Filter filtriert. Anschließend folgte eine Inkubation des Filtrats bei Raumtemperatur für 30 Minuten.
Beispiel 2: Virusvermehrung:
Die Virusvermehrung erfolgte durch direkte Passagierung des Filtrats der aufgearbeiteten Caecaltonsillen in SPF-Hühnereiern (VALO BioMedia). Hierzu wurden in der Sterilwerkbank (Reinraumklasse A) je 200 μΙ dieses Materials in die Allantoishöhle (AH) von Eiern (Bruttag 10) mit einer Kanüle (0,5 x 16mm) injiziert. Anschließend wurde die Öffnung im Ei mit Uhu Alleskleber verschlossen. Die Inkubation erfolgte für 7 Tage bei 37-38°C und einer relativen Feuchte von etwa 60%.
Die beimpften Eier wurden regelmäßig auf Absterber geschiert. Nach den 7 Tagen wurden die Eier für ca. 4 Stunden bei 4°C gekühlt. Anschließend erfolgte die Öffnung der Eier mit einer sterilen Schere im Bereich der Luftblase und die Ernte der Allantoisflüssigkeit mittels Transferpipette. Die Ernte der beimpften Eier wurde gepoolt.
Bis zur weiteren Passagierung wurde die Ernte bei -20°C gelagert. Nach dem Auftauen wurde das Erntematerial der ersten Passage unter sterilen Bedingungen mit 1xPBS, pH 7-7,4 im Verhältnis 1 :100 verdünnt und erneut mit 200 μΙ je Ei in die Allantoishöhle von SPF-Bruteiern verimpft. Diese wurden mit Uhu Alleskleber verschlossen und für 4 Tage bei ca. 37°C und einer relativen Feuchte von ca. 50% für 4 Tage bebrütet und täglich geschiert. Ein Absterber innerhalb der ersten 24 Stunden nach Beimpfung wurde als unspezifisch verworfen. Die verbleibenden Eier wurden an Tag 4 für ca. 4 Stunden bei 4°C gekühlt und anschließend ihre Allantoisflüssigkeit unter sterilen Bedingungen als Pool geerntet.
Nach einer Zwischenlagerung bei -80°C wurde die Allantoisflüssigkeit erneut im Verhältnis 1 : 100 mit 1xPBS verdünnt, wie beschrieben in die Allantoishöhle von SPF-Bruteiern inokuliert und für 4 Tage bebrütet. Ein Absterber innerhalb der ersten 24 Stunden nach Beimpfung wurde wieder als unspezifisch verworfen. Die verbleibenden Eier wurden an Tag 4 für ca. 4 Stunden bei 4°C gekühlt und anschließend ihre Allantoisflüssigkeit unter sterilen Bedingungen als Pool geerntet und in 1-2 ml-Aliquots bei -80°C eingefroren.
Beispiel 3: Virusnachweis:
Die RNA-Aufreinigung aus der geernteten Allantoisflüssigkeit einer Probe erfolgte mit dem QIAamp Viral RNA Mini Kit® (Qiagen) nach Angaben des Herstellers. Anschließend wurde der IBV-Status der Proben anhand einer Real-Time PCR mit dem Kylt® IB Virus Kit (Kylt) nach Herstellerangaben überprüft. Das IBV-Ergebnis war positiv bei einem CT- Wert von 13,86. Nachfolgend wurden die Proben auf die IBV-Varianten 4/91 , Arkansas, Massachusetts, D1466, D274, QX, Italy02, Variant 02 und IB80 anhand der Kylt Real- Time PCRs Kylt® IBV-Variant 4/91 , Kylt® IBV-Variant Arkansas, Kylt® IBV-Variant Mas- sachusetts, Kylt® IBV-Variant D1466, Kylt® IBV-Variant D274, Kylt® IBV-Variant QX, Kylt® IBV-Variant Italy02, Kylt® IBV-Variant 02 und Kylt® IBV-Variant IB80 nach Angaben des Herstellers untersucht. Lediglich mit dem Kylt® IBV-Variant IB80 Kit wurde ein positives Ergebnis erzielt (CT 18,6), alle anderen IBV-Varianten konnten in den Proben nicht nachgewiesen werden. Beispiel 4: Genomsequenzierung:
Die Sequenzierung des Genoms des IB-Virusisolats erfolgte nach der Dideoxymethode von Sanger (Sanger und Coulsen, 1977) und wurde mittels eines 2-Schritt-RT-PCR Protokolls durchgeführt:
Die Reverse Transkription wurde mit dem GoScript™ Reverse Transcription System (Promega) nach Herstellerangaben durchgeführt. Dabei wurde die Reverse Transkription zum einen mit den im Kit enthaltenen Random Primern (cDNA A) und zum anderen mit 14 IBV-spezifischen Primern (cDNA B, Franzo et al., 2015, modifiziert, siehe Tabelle 1 ) durchgeführt (siehe Tabelle 1 ). Für die Reverse Transkription wurden 20 pmol des Pri- mer-Mixes (_ 1 ,43 pmol je Primer) auf einen Reaktionsansatz von 20 μΙ eingesetzt. Das finale Protokoll für den 20 μΙ Ansatz setzt sich folgendermaßen zusammen: 4 μ der RNA- Aufreinigung der Probe, 1 μΙ Primer-Mix (Random-Primer bzw. IBV-spezifischer Primer- Mix), 4 μ GoScript™ 5X Reaction Buffer, 2,4 μΙ 25 mM MgCI2, 1 μΙ PCR Nucleotide Mix, 0,5 μΙ Recombinant RNasin® Ribonuclease Inhibitor, 1 μΙ GoScript™ Reverse Transcriptase, 6, 1 μΙ Nuklease-freies Wasser. Das Temperaturprofil entsprach den Angaben des Herstellers.
Tabelle 1 : IBV-spezifische Primer für die Reverse Transkription
Primer-Bezeichnung Sequenz SEQ ID No
RT-IBVG-1 R TTTAGTAAAAAGACCACC 21
RT-IBVG-2R CATAC I I I I GCGCATC 22
RT-IBVG-3R AGAAAACCTACACCAG 23
RT-IBVG-4R GTAAAGAATGTACTAACC 24
RT-IBVG-5R ATAGTATC AAAG ACTAC AG G 25
RT-IBVG-6R CTCCATAAGAATCCTG 26
RT-IBVG-7R TAAAACTTGGTTGTTCC 27
RT-IBVG-8R TTCACATAAAGCATCAAC 28
RT-IBVG-9R GTCATACTCAAACTGC 29
RT-IBVG-10R CAAAATGCATTACTCGC 30
RT-IBVG-11 R CATATCTTCTTTTTGACC 31
RT-IBVG-12R TTTGAATCATTAAACAGAC 32
RT-IBVG-13R ACCAAC I I I AGGTGGC 33
RT-IBVG-14R TTGCTCTAACTCTATAC 34
Für die anschließende Amplifikation des Genoms wurden 14 Primer-Paare verwendet (Franzo et al., 2015, modifiziert, siehe Tabelle 2). Die 14 Amplikons enthalten jeweils überlappende Bereiche, um die vollständige Genomsequenz abbilden zu können.
Tabelle 2: Primer für die Genom-Amplifizierung Primer-Bezeichnung Sequenz Produkt- SEQ
Größe ID No (ca.)
P- IBVG ■1 F GCGCTAGATTTCCAACTTAACAAAACG 1999 bp 35
P- IBVG ■1 R GACTTGCGAAACAAGATGCCAAATGCC 36
P- IBVG ■2F TGGAGGCTTGCATATGGAAAAGTGCG 2333 bp 37
P- IBVG ■2R GGAATGAAGAGAATTTCTTTATCCTCAACATCATC 38
P- IBVG ■3F CGGAGGATGGTGTTAAATACCGC 2013 bp 39
P- IBVG ■3R CAAATAATATTAGAAAGACCAAATAAAGCCAATTCC 40
P- IBVG ■4F GATTC I I I I GATGTGTTACGCTATTGTGCAG 2153 bp 41
P- IBVG ■4R CCTGGTTTAGTATACTCACATACACTACC 42
P- IBVG ■5F CCTAATGGTGTTAGGCTTATAGTTCC 2162 bp 43
P- IBVG ■5R GTATCAAAGACTACAGGATCATACCATTG 44
P- IBVG ■6F CAGTTATTATTGGAG I I I GTGCTGAAG 2077 bp 45
P- IBVG ■6R GAATCCTGATCCGGAGTTGGACTTGGC 46
P- IBVG ■7F GTGGCAGCAGGTAATCAACC I I I AGG 2150 bp 47
P- IBVG ■7R ATAAAACTTG GTTGTTC C AATAACTAC AG G 48
P- IBVG ■8F GTGTCTATCC I I I CTACTATGACTAATAGGC 2074 bp 49
P- IBVG ■8R C AC ATAAAG C ATC AAC AG CTG C ATG AG 50
P- IBVG ■9F GGCAAGCAGAAGCGTACTACAGTAC 2064 bp 51
P- IBVG ■9R CTGCTTGACATTGGGTACTATTGGATTC 52
P- IBVG ■10F CGTTGTCTATGATATAGGCAACCCTAAAGG 1756 bp 53
P- IBVG ■10R GTATTGACAGAGTTGTGTATAC I I I GCC 54
P- IBVG ■11 F GTAACAGTGTCAATTGATTACCATAGC 2757 bp 55
P- IBVG ■11.2R TCCATACGCG I I I GTATGTACTCATCTG 56
P- IBVG ■12.2F CATAGGCGTAGAAGGTCTATTAGTG 201 1 bp 57
P- IBVG ■12.2R TTA I I I G CTGG AGTG CTATAAC AC ACTC 58
P- IBVG ■13F CATTATGCCTCTAATGAGTAAGTGTGG 2245 bp 59
P- IBVG ■13R AACTTTAGGTGGCTTTGGTCCTCC 60
P- IBVG ■14F GAAAAGCGCGAATTTATCTGAGAGAAGG 1845 bp 61
P- IBVG ■14R CATAGCCAATTAAACTTAACTTAAACTAAAA I I I AGCTC 62 Die Amplifikation erfolgte mit dem KOD Hot Start DNA Polymerase® Kit (Novagen) nach Angaben des Herstellers. Die Amplifikation mit den einzelnen Primerpaaren (1 -14) erfolgte jeweils sowohl mit der cDNA A, welche mit den Random-Primern synthetisiert wurde, als auch mit der cDNA B, welche mit den IBV-spezifischen Primern erhalten wurde. Das Protokoll für den 20 μΙ Ansatz setzt sich folgendermaßen zusammen: 2 μΙ cDNA, 2 μ 10X Buffer for KOD Hot Start DNA Polymerase®, 1 ,2 μΙ 25 mM MgS04, 2 μΙ_ dNTPs (2 mM each), 0,8 [iL Forward Primer (10 μΜ), 0,8 μΙ_ Reverse Primer (10 μΜ), 0,4 μΙ KOD Hot Start DNA Polymerase® (1 U/μΙ), 10,8 μΙ Nuklease-freies Wasser. Nach der initialen Denaturierung für 2 min bei 95°C wurden 40 Zyklen bei 95°C für 20 sec, 60°C für 10 sec und 70°C für jeweils 40 sec durchgeführt (Abweichungen für bestimmte Primerpaare [1 - 14]) sind Tabelle 3 zu entnehmen).
Tabelle 3: Abweichung bei der PCR-Amplifikation
PCR-Produkt Abweichung vom Standard-Protokoll
1 Keine
2 Extension 50 sec
3 Keine
4 Extension 50 sec, Annealing 56°C
5 Keine
6 Keine
7 Keine
8 Keine
9 Extension 50 sec, Annealing 56°C
10 Keine
11 Extension 50 sec
12 Extension 45 sec
13 Extension 50 sec, Annealing 58°C
14 Keine
Der Erfolg der Amplifikation wurde anschließend durch Kapillargelelektrophorese mit dem QIAxcel System® (Qiagen) und dem QIAxcel DNA Screening Kit überprüft. Je nach Qualität der Banden wurde entweder das Produkt, welches auf Grundlage der cDNA mit den Random Primern gebildet wurde (cDNA A), ausgewählt, oder das, welches auf Grundlage der cDNA mit den IBV-spezifischen Primern gebildet wurde (cDNA B), ausgewählt (siehe Tabelle 4).
Tabelle 4: Auswahl der PCR-Produkte für die Sequenzierung
PCR-Produkt cDNA
1 B
2 A
3 B
4 B
5 A
6 B
7 A
8 B
9 B
10 A
11 A
12 A
13 B
14 A
Die Aufreinigung der PCR-Produkte erfolgte mit dem QIAquick PCR Purification Kit® (Qiagen) nach Angaben des Herstellers.
Die DNA-Konzentration der aufgereinigten PCR-Produkte wurde mittels des NanoDrop® Messprinzips und eines NanoDrop® 2000c Spektrophotometers ermittelt. Die Sequenzierungsreaktion wurde von MWG Eurofins (Ebersbach, Deutschland) mit dem Mix2Seq Kit gemäß Herstellerangaben durchgeführt. Jedes PCR-Produkt wurde mit den PCR-Primern (Forward und Reverse) und in der Regel mit einem zusätzlichen Primer, welcher weiter mittig im Produkt liegt, sequenziert. Für das PCR-Produkt 10 war kein zusätzlicher Zwi- schenprimer mehr für eine Sequenzierung nötig. Für die PCR-Produkte 2 und 1 1 wurden zwei interne Primer zur Sequenzierung verwendet (siehe Tabelle 5).
Tabelle 5: Primer für die Sequenzierung, welche mittig im PCR-Produkt liegen Primer-Bezeichnung Sequenz SEQ ID No s ■IBVG ■1 F CCTAAGGATTACGCTGAAGCCTTTGC 63 s ■IBVG ■2F CACACCAATGTCTCAACTTGGTGC 64 s ■IBVG ■2R TCCAATGC I I I GGCAATCACTACCGT 65 s ■IBVG ■3.2F GTAGAAGCCTCACTACCATATCTGT 66 s ■IBVG ■4F GTTAAACCTACAGCATATGCTTACC 67 s ■IBVG ■5F GTATGATGGCAACGAG I I I GTTGG 68 s ■IBVG ■6F TCCTTGCATCTGATGATGTTGGAGAG 69 s ■IBVG ■7F TGACCCAAAGGATTGTGAAGATCTC 70 s ■IBVG ■8F CAAGGTCTTGTAGCAGATA I I I CTGG 71 s ■IBVG ■9F CATGAAAGTGGTTCAGCCTACAAC 72 s ■IBVG ■11 F TGCAAGTGCAAAGGTTAAAGTTAGTG 73 s ■IBVG ■H R GTAAGCATAACAGCAAGTATGAGATG 74 s ■IBVG ■12.2F CTAGTTCATTAGTAGCCTCAATGGCT 75 s ■IBVG ■13F CTTGGTACTGAACAAGCAGTTCAGC 76 s ■IBVG ■14F TCGTGCAGCAAAGATTATTCGGGAC 77
Die Auswertung der Sequenzierung erfolgte mit der Software DNASTAR der Firma Lasergene. Hierbei wurden zunächst die einzelnen Chromatogramme überprüft und zugeschnitten. Die einzelnen Fragmente wurden anschließend an eine Referenzsequenz aligned, um die Gesamtgenomsequenz zusammenzufügen.
Literaturangabe zu den Beispielen oben:
Giovanni Franzo, Valeria Listorti, Clive J. Naylor, Caterina Lupini, Andrea Laconi, Viviana Felice, Michele Drigo, Elena Catelli, Mattia Cecchinato, 2015. Molecular investigation of a full-length genome of a Q1-Iike IBV strain isolated in Italy in 2013. Virus Research 210, 77-80. Beispiel 5: Testsystem für Immunospezifität
Vorgehensweise:
1. Beschichten der Platten (z.B. 96-Well-lmmuno-Platten Maxisorb® Nunc, Wiesbaden) mit Antigen: Antigene (können sein z. B. Allantoisflüssigkeit, Eihaut, Embryo- Homogenisat, Zellkultur-Material jeweils mit IB80 belastet (oder bevorzugt IB80- Partikel)) 1 :4 (vol/vol) mit Beschichtungspuffer mischen oder unverdünnt, wenn Homogenisation von Geweben in Beschichtungspuffer erfolgte. In jedes Tüpfel der Platte 100 [iL pipettieren; mit Klebefolie abdecken (auch bei allen nachfolgenden Schritten!); Platten 2 Std bei 30°C halten.
2. Waschen. Abgießen. Platten 2 x mit Waschpuffer waschen. Platten auf Stapel von Handtuchpapier trocken klopfen.
3. Blockieren. In jedes Tüpfel 200 [iL Blockierunglösung pipettieren; Platten 2 Std bei 30°C halten.
4. Waschen. Blockierungslösung abgießen, Platten 3 x vorsichtig waschen, kurz trocken klopfen.
5. Zugabe des zu testenden Antikörpers in geeigneter Lösung im Zweifelsfall in PBS, pH 7,4
6. Bindung. Platten 2 Std bei Raumtemperatur.
7. Waschen. Platten 3 x mit Waschpuffer waschen; kurz trocken klopfen.
8. Nachweis der Antikörper-Antigenbindung mit einem geeigneten Nachweissystem, bevorzugt mittels eines sekundären Antikörpers.
9. Auswertung: Die Auswertung erfolgt gegenüber einer Testreihe, die genauso behandelt worden ist, wie die antigenbelastete Testreihe, in der allerdings ein Antigen nicht enthalten ist (Kontrolle). Sofern bei den antigengelasteten Proben eine höhere Antikörperbindung festgestellt wird, liegt Immunspezifität des getesteten Antikörpers vor. Verwendete Lösungen:
PBS, pH 7,4
Ein Liter Lösung enthält:
8,0 g Natriumchlorid (NaCI)
0,2 g Kaliumchlorid (KCl)
1 ,42 g Dinatriumhydrogenphosphat (Na2HP04)
ODER 1 ,78 g Dinatriumhydrogenphosphat Dihydrat (Na2HP04* 2 H20)
0,27 g Kaliumdihydrogenphosphat (KH2P04)
Waschpuffer
Tween 20 0,05% (Sigma-Aldrich, München)
in PBS
Beschichtungspuffer
Na2C03 1 ,59 g/l
NaHC03 2,93 g/l
NaN3 0,2 g/l
pH 9,6
Blockierungslösung:
PBS mit 2% Magermilchpulver oder 0, 1 % BSA (bovines Serumalbumin)

Claims

Ansprüche
1. Isoliertes IB-Virus entsprechend einer der Hinterlegungsnummern 16061601 und 16070701 bei der National Collection of Pathogenic Viruses (NCPV), UK, oder umfassend
a) eine oder mehrere Nukleinsäureabschnitte ausgewählt aus der Gruppe bestehend aus Nukleinsäuren der Sequenzen SEQ ID NOs: 1 , 2, 3, 4, 5, 6, 7, 8 und 9, b) eine Nukleinsäure der SEQ ID NO: 10,
c) eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäurenkette ausgewählt aus der Gruppe der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 13, 14, 15, 16, 17, 18 , 19 und 20,
d) eine Nukleinsäure, umfassend oder bestehend aus einem Nukleinsäurenabschnitt mit einer Identität zu > 85% zur SEQ ID NO: 3 oder mit einer Identität zu > 98% zu einer der SEQ ID NOs: 1 , 2, 4, 5, 6, 7, 8, 9 oder 10 und/oder
e) eines oder mehrere Proteine, umfassend oder bestehend aus einer Aminosäurenkette mit einer Identität von > 85% zur Aminosäuresequenz SEQ ID NO: 13 oder zu einer Aminosäuresequenz ausgewählt aus der Gruppe der Aminosäuresequenzen mit einer Identität zu > 98% zu einer der Aminosäuresequenzen SEQ ID NOs: 1 1 , 12, 14, 15, 16, 17, 18, 19 oder 20.
2. Isolierte Nukleinsäure wie in Anspruch 1 definiert.
3. Isoliertes Protein, wie in Anspruch 1 definiert und/oder kodiert durch eine Nukleinsäure wie in Anspruch 1 definiert.
4. Vektor, umfassend einen Nukleinsäureabschnitt wie in Anspruch 1 definiert.
5. Isolierter Antikörper oder isoliertes antigenbindendes Fragment davon, der immunospezifisch an ein Virus, ein Protein oder eine Nukleinsäure, jeweils wie in Anspruch 1 definiert, bindet.
6. Isoliertes IB-Virus nach Anspruch 1 das tot oder attenuiert ist.
7. Impfstoff, umfassend eine therapeutisch und/oder prophylaktisch wirksame Menge eines IB-Virus nach Anspruch 1 oder 6 oder eine therapeutisch und/oder prophylaktisch wirksame Menge einer oder mehrerer Nukleinsäuren nach Anspruch 2 und/oder eines oder mehrerer Proteine nach Anspruch 3 und einen pharmazeutisch akzeptablen Träger.
8. Verwendung eines IB-Virus nach Anspruch 1 oder 6 oder einer oder mehrerer Nukleinsäuren nach Anspruch 2 und/oder eines oder mehrerer Proteine nach Anspruch 3 für die Herstellung eines Impfstoffes zur Vorbeugung gegen durch ein Virus nach Anspruch 1 erzeugte Symptome oder Erkrankungen.
9. Verwendung eines IB-Virus nach Anspruch 1 oder 6 oder einer oder mehrerer Nukleinsäuren nach Anspruch 2 und/oder eines oder mehrerer Proteine nach Anspruch 3 für die Herstellung monoklonaler oder polyklonaler Antikörper.
10. Pharmazeutische Mischung, umfassend eine therapeutisch und/oder pro- phylaktisch wirksame Menge eines Antikörpers oder eines isolierten antigenbin- denden Fragmentes davon zur therapeutischen oder prophylaktischen Behandlung von durch ein Virus nach Anspruch 1 erzeugten Symptomen oder Erkrankungen.
EP17755136.3A 2016-08-12 2017-08-14 Infektiöse bronchitis (ib)-virus varianten und diesbezügliche zusammensetzungen, verwendungen und verfahren Withdrawn EP3497206A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102016215118.5A DE102016215118A1 (de) 2016-08-12 2016-08-12 Infektiöse Bronchitis (IB)-Virus Varianten und diesbezügliche Zusammensetzungen, Verwendungen und Verfahren
PCT/EP2017/070616 WO2018029383A1 (de) 2016-08-12 2017-08-14 Infektiöse bronchitis (ib)-virus varianten und diesbezügliche zusammensetzungen, verwendungen und verfahren

Publications (1)

Publication Number Publication Date
EP3497206A1 true EP3497206A1 (de) 2019-06-19

Family

ID=59683552

Family Applications (1)

Application Number Title Priority Date Filing Date
EP17755136.3A Withdrawn EP3497206A1 (de) 2016-08-12 2017-08-14 Infektiöse bronchitis (ib)-virus varianten und diesbezügliche zusammensetzungen, verwendungen und verfahren

Country Status (5)

Country Link
US (1) US20230190909A1 (de)
EP (1) EP3497206A1 (de)
CA (1) CA3033886A1 (de)
DE (1) DE102016215118A1 (de)
WO (1) WO2018029383A1 (de)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113063939A (zh) * 2021-03-05 2021-07-02 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） 一种传染性支气管炎病毒的双抗夹心elisa检测试剂盒和检测方法以及应用
CN118546258A (zh) * 2024-06-03 2024-08-27 中国动物卫生与流行病学中心 一种鸡传染性支气管炎病毒抗原表位融合肽及其在间接elisa检测中的应用

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
UA93981C2 (ru) 2001-01-19 2011-03-25 Вироновативе Б.B. Вирус, который вызывает заболевание дыхательных путей у чувствительных k этому млекопитающих
US7375202B2 (en) 2003-03-24 2008-05-20 The University Of Hong Kong Human virus causing severe acute respiratory syndrome (SARS) and uses thereof
WO2016064841A1 (en) * 2014-10-20 2016-04-28 Auburn University Adaptation of attenuated infectious bronchitis virus (ibv) to embryonic kidney cells and vaccine thereby produced

Also Published As

Publication number Publication date
US20230190909A1 (en) 2023-06-22
DE102016215118A1 (de) 2018-02-15
CA3033886A1 (en) 2018-02-15
WO2018029383A1 (de) 2018-02-15
WO2018029383A8 (de) 2019-04-18

Similar Documents

Publication Publication Date Title
Baer The natural history of rabies
DE69334141T2 (de) Schweinevirus, Erreger der sich vermehrenden Erkrankung der Atemwege, Impstoffe und seine virale DNA
EP3172319B1 (de) Coronavirus
Beran Rabies and infections by rabies-related viruses
Pepin et al. Rift Valley fever virus (Bunyaviridae: Phlebovirus): an update on pathogenesis, molecular epidemiology, vectors, diagnostics and prevention
DE69936977T2 (de) Durch polynukleinsäuren vom reproduktiven und respiratorischen syndromvirus des schweines kodierte proteine
DE69935721T2 (de) Kälteadaptierte Pferdeinfluenzaviren
DE60012042T2 (de) Entepneumovirus und entsprechendes impfstoff
EP2102345B1 (de) Rsv f-protein und seine verwendung
CN106148287B (zh) 猪流行性腹泻病毒株及其疫苗组合物、制备方法和应用
DE3882599T2 (de) Hundecoronavirus-Impfstoff.
EP3408381B1 (de) Abgeschwächtes virus der infektiösen bronchitis
DE69017687T2 (de) Felincalicivirus-capsid-protein und nukleotidsequenz.
KR20150020623A (ko) Ｉｂ ｑｘ-유사 균주로부터 유래된 감염성 기관지염 백신
DE69233270T2 (de) Subeinheits-Impfstoff gegen Hundecoronavirus
WO2018029383A1 (de) Infektiöse bronchitis (ib)-virus varianten und diesbezügliche zusammensetzungen, verwendungen und verfahren
DE10221836A1 (de) Attenuierung von Metapneumovirus
WO2007020017A1 (en) Composition for bird immunization administered by aerosol
EA036116B1 (ru) Пестивирусные вакцины против врожденного тремора
Mishra et al. Studies on the pathogenicity of Newcastle disease virus isolates in guinea fowl
KR20210022165A (ko) 조류 레오바이러스 백신
DE69332375T2 (de) Hundecoronavirus s gen und verwendung davon
DE10152307A1 (de) Neue bakterielle Geflügelkrankheit
DE69734761T2 (de) Aus hemophilus paragallinarum abstammendes polypeptid und verfahren zu dessen herstellung
DE60011963T2 (de) Rekombinantes Newcastle-Krankheitsvirus zur in ovo Impfung

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20190312

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

RIN1 Information on inventor provided before grant (corrected)

Inventor name: ROENCHEN, SWAANTJE

Inventor name: BIELENBERG, WIEBKE

Inventor name: VOGEL, NATALIE

Inventor name: HANEKE, JENNIFER

Inventor name: BEHR, KLAUS-PETER

Inventor name: LIMAN, MARTIN

Inventor name: PETZOLDT, DIANA

Inventor name: OLDOPP, THERESA

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20200124

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20200604