Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/70—Vectors or expression systems specially adapted for E. coli
  • C12N15/73—Expression systems using phage (lambda) regulatory sequences
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
  • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
  • C12Q1/10—Enterobacteria
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing

Definitions

• sequence listing is submitted electronically via EFS-Web as an ASCII formatted sequence listing with a file named 1035526_ST25.txt, created on January 17, 2017, and having a size of 7 kilobytes and is filed concurrently with the specification.
• sequence listing contained in this ASCII formatted document is part of the specification and is herein incorporated by reference in its entirety.
• This invention relates to methods and systems for the detection of microorganisms using infectious agents.
• Microbial pathogens can cause substantial morbidity among humans and domestic animals, as well as immense economic loss. Also, detection of microorganisms is a high priority for the Food and Drug Administration (FDA) and Centers for Disease Control (CDC) given outbreaks of life-threatening or fatal illness caused by ingestion of food contaminated with certain microorganisms, e.g., Escherichia coli or Salmonella spp.
• FDA Food and Drug Administration
• CDC Centers for Disease Control
• PCR tests also include an amplification step and therefore are capable of both very high sensitivity and selectivity; however, the sample size that can be economically subjected to PCR testing is limited. With dilute bacterial suspensions, most small subsamples will be free of cells and therefore purification and/or lengthy enrichment steps are still required.
• the time required for traditional biological enrichment is dictated by the growth rate of the target bacterial population of the sample, by the effect of the sample matrix, and by the required sensitivity.
• most high sensitivity methods employ an overnight incubation and take about 24 hours overall. Due to the time required for cultivation, these methods can take up to three days, depending upon the organism to be identified and the source of the sample. This lag time is generally unsuitable as the contaminated food, water (or other product) may have already made its way into livestock or humans.
• increases in antibiotic-resistant bacteria and biodefense considerations make rapid identification of bacterial pathogens in water, food and clinical samples critical priorities worldwide.
• microorganisms such as bacteria and other potentially pathogenic microorganisms.
• Embodiments of the invention comprise compositions, methods, systems and kits for the detection of microorganisms.
• the invention may be embodied in a variety of ways.
• the invention comprises a recombinant bacteriophage comprising an indicator gene inserted into a late gene region of a bacteriophage genome.
• the recombinant bacteriophage is a genetically modified CBA120 genome.
• the recombinant bacteriophage is a genetically modified T4-like or Vil- like bacteriophage genome.
• the recombinant bacteriophage specifically infects E. coli 0157:H7.
• the recombinant bacteriophage can distinguish E. coli 0157:H7 in the presence of more than 100 other types of bacteria.
• the indicator gene can be codon-optimized and can encode a soluble protein product that generates an intrinsic signal or a soluble enzyme that generates signal upon reaction with substrate.
• Some recombinant bacteriophage further comprise an untranslated region upstream of a codon- optimized indicator gene, wherein the untranslated region includes a bacteriophage late gene promoter and a ribosomal entry site.
• the indicator gene is a luciferase gene.
• the luciferase gene can be a naturally occurring gene, such as Oplophorus luciferase, Firefly luciferase, Lucia luciferase, or Renilla luciferase, or it can be a genetically engineered gene.
• Some embodiments include selecting a wild-type bacteriophage that specifically infects a target pathogenic bacterium; preparing a homologous recombination plasmid/vector comprising an indicator gene; transforming the homologous recombination plasmid/vector into target pathogenic bacteria; infecting the transformed target pathogenic bacteria with the selected wild-type bacteriophage, thereby allowing homologous recombination to occur between the plasmid/vector and the bacteriophage genome; and isolating a particular clone of recombinant bacteriophage.
• the selected wild-type bacteriophage is CBA120.
• the selected wild-type bacteriophage is T4-like or Vil-like.
• preparing a homologous recombination plasmid/vector includes determining the natural nucleotide sequence in the late region of the genome of the selected bacteriophage; annotating the genome and identifying the major capsid protein gene of the selected bacteriophage; designing a sequence for homologous recombination downstream of the major capsid protein gene, wherein the sequence comprises a codon- optimized indicator gene; and incorporating the sequence designed for homologous recombination into a plasmid/vector.
• the step of designing a sequence can include inserting an untranslated region, including a phage late gene promoter and ribosomal entry site, upstream of the codon-optimized indicator gene.
• the homologous recombination plasmid comprises an untranslated region including a bacteriophage late gene promoter and a ribosomal entry site upstream of the codon-optimized indicator gene.
• compositions that include a recombinant indicator bacteriophage as described herein.
• compositions can include one or more wild-type or genetically modified infectious agents (e.g., bacteriophages) and one or more indicator genes.
• compositions can include cocktails of different indicator phages that may encode and express the same or different indicator proteins.
• the invention comprises a method for detecting a
• microorganism of interest in a sample comprising the steps of incubating the sample with a recombinant bacteriophage that infects the microorganism of interest, wherein the recombinant bacteriophage comprises an indicator gene inserted into a late gene region of the bacteriophage such that expression of the indicator gene during bacteriophage replication following infection of host bacteria results in a soluble indicator protein product, and detecting the indicator protein product, wherein positive detection of the indicator protein product indicates that the microorganism of interest is present in the sample.
• the wild-type bacteriophage is CBA120 and the target pathogenic bacterium is E. coli
• isolating a particular clone of recombinant bacteriophage comprises a limiting dilution assay for isolating a clone that demonstrates expression of the indicator gene.
• kits for detecting bacteria such as E. coli 0157:H7
• a sample including steps of incubating the sample with a recombinant bacteriophage derived from CBA120 and detecting an indicator protein product produced by the recombinant bacteriophage, wherein positive detection of the indicator protein product indicates that E. coli 0157:H7 is present in the sample.
• the sample can be a food, environmental, water, commercial, or clinical sample.
• the sample comprises beef or vegetables.
• the sample is first incubated in conditions favoring growth for an enrichment period of 9 hours or less, 8 hours or less, 7 hours or less, 6 hours or less, 5 hours or less, 4 hours or less, 3 hours or less, or 2 hours or less.
• the total time to results is less than 12 hours, less than 1 1 hours, less than 10 hours, less than 9 hours, less than 8 hours, less than 7 hours, or less than 6 hours.
• the ratio of signal to background generated by detecting the indicator is at least 2.0 or at least 2.5.
• the method detects as few as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 of the specific bacteria in a sample of a standard size for the food safety industry.
• Additional embodiments include systems and kits for detecting E. coli 0157:H7, wherein the systems or kits include a recombinant bacteriophage derived from CBA120. Some embodiments further include a substrate for reacting with an indicator to detect the soluble protein product expressed by the recombinant bacteriophage. These systems or kits can include features described for the bacteriophage, compositions, and methods of the invention. In still other embodiments, the invention comprises non-transient computer readable media for use with methods or systems according to the invention.
• Figure 1 shows a portion of the genome of the wild-type CBA120 bacteriophage and the annotated late gene region in particular.
• Figure 2 shows one embodiment of a plasmid designed for homologous
• Capsid protein gp23 (ORF187) is believed to represent the major capsid protein. As this virion protein is expressed at a very high level, any genes inserted into this region can be expected to have similar expression levels, as long as late gene promoters and/or other similar control elements are used.
• Figure 3 shows an embodiment of homologous recombination of the wild-type CBA120 genome in Figure 1 with the plasmid illustrated in Figure 2.
• Figure 4 depicts the isolation of recombinant bacteriophage from a mixture of wild- type and recombinant bacteriophage derived from transforming target bacteria with a plasmid carrying a sequence designed to recombine in homologous fashion with the natural bacteriophage genome, and then infecting the transformed bacteria with wild-type bacteriophage to allow homologous recombination.
• a series of sequential infection and dilution steps allow identification and isolation of recombinant phage that expresses an indicator/reporter gene.
• Figure 5 is an electron micrograph of one embodiment of a recombinant indicator bacteriophage, the CBA120NanoLuc bacteriophage.
• Figure 6 depicts the use of indicator bacteriophage encoding a soluble reporter (e.g., luciferase) to detect bacterial cells via detection of luciferase generated from replication of indicator bacteriophage during infection of the bacterial cells, according to an embodiment of the invention.
• a soluble reporter e.g., luciferase
• Figure 7 demonstrates the detection of pathogenic bacteria using different phage concentrations of CBA120NanoLuc for infecting samples with known numbers of cells, with 10 6 phage/mL yielding the highest signal to background ratio.
• Figure 8 demonstrates that replicates of experiments using 10 phage/mL
• CBA120NanoLuc for infecting samples with known numbers of cells show significant differences between signal from a single cell and signal from 0 cells, 2 cells, or more.
• Figure 9 demonstrates that the signal to background ratio for the experiment shown in Figure 8 is greater than 2.0.
• Figure 10 shows Relative Light Units (RLU) and signal to background ratios for detection of E. coli 0157:H7 in a 1 mL concentration sample from 25 g ground beef when the assay is conducted after 5, 6, and 7 hours of enrichment.
• RLU Relative Light Units
• Figure 11 summarizes detection of E. coli 0157:H7 in a 1 mL concentration sample from 25 g ground beef as shown in Figure 10 with confirmation of the results using a secondary method.
• Figure 12 shows RLU and signal to background ratios for detection of E. coli 0157:H7 in a 10 mL concentration sample from 25 g ground beef when the assay is conducted after 5 hours of enrichment with confirmation of the results using a secondary method.
• Figure 13 shows RLU and signal to background ratios for detection of E. coli 0157:H7 in 1 mL concentration samples from 125 g beef trim when the assay is conducted after 7, 8, and 9 hours of enrichment.
• Figure 14 shows RLU and signal to background ratios for detection of E. coli 0157:H7 in 10 mL concentration samples from 125 g beef trim when the assay is conducted after 7, 8, and 9 hours of enrichment.
• Figure 15 summarizes detection of E. coli 0157:H7 in 1 mL concentration samples from 125 g beef trim as shown in Figure 13 with confirmation of the results using a secondary method.
• Figure 16 summarizes detection of E. coli 0157:H7 in 10 mL concentration samples from 125 g beef trim as shown in Figure 14 with confirmation of the results using a secondary method.
• Figure 17 shows RLU and signal to background ratios for detection of E. coli 0157:H7 in 100 mL spinach wash filtered and subjected to a filter assay format with confirmation of the results using a secondary method.
• compositions, methods and systems that demonstrate surprising sensitivity for detection of a microorganism of interest in test samples (e.g., biological, food, water, and clinical samples). Detection can be achieved in a shorter timeframe than was previously thought possible using genetically modified infectious agents in assays performed without culturing for enrichment, or in some embodiments with minimal incubation times during which microorganisms could potentially multiply. Also surprising is the success of using a potentially high multiplicity of infection (MOI), or high concentrations of plaque forming units (PFU), for incubation with a test sample.
• MOI multiplicity of infection
• PFU plaque forming units
• compositions, methods, systems and kits of the invention may comprise infectious agents for use in detection of such microorganisms.
• the invention may comprise a composition comprising a recombinant bacteriophage having an indicator gene inserted into a late gene region of the bacteriophage.
• expression of the indicator gene during bacteriophage replication following infection of a host bacterium results in production of a soluble indicator protein product.
• the indicator gene may be inserted into a late gene (i.e., class III) region of the bacteriophage.
• the bacteriophage can be derived from T7, T4, T4-like, Vil, Vil-like (or Vil virus, per GenBank/NCBI), CBA120, or another wild-type or engineered bacteriophage.
• the invention comprises a method for detecting a microorganism of interest.
• the method may use an infectious agent for detection of the microorganism of interest.
• the microorganism of interest is a bacterium and the infectious agent is a bacteriophage.
• the method may comprise detection of a bacterium of interest in a sample by incubating the sample with a recombinant bacteriophage that infects the bacterium of interest.
• the recombinant bacteriophage comprises an indicator gene.
• the indicator gene may, in certain embodiments, be inserted into a late gene region of the bacteriophage such that expression of the indicator gene during bacteriophage replication following infection of host bacteria results in production of an indicator protein product.
• the method may comprise detecting the indicator protein product, wherein positive detection of the indicator protein product indicates that the bacterium of interest is present in the sample.
• the indicator protein is soluble.
• the invention may comprise a system.
• the system may contain at least some of the compositions of the invention.
• the system may comprise at least some of the components for performing the method.
• the system is formulated as a kit.
• the invention may comprise a system for rapid detection of a microorganism of interest in a sample, comprising: a component for incubating the sample with an infectious agent specific for the microorganism of interest, wherein the infectious agent comprises an indicator moiety; and a component for detecting the indicator moiety.
• the invention comprises software for use with the methods or systems.
• bacteriophage-based methods for amplifying a detectable signal indicating the presence of bacteria. In certain embodiments as little as a single bacterium is detected.
• the principles applied herein can be applied to the detection of a variety of microorganisms. Because of numerous binding sites for an infectious agent on the surface of a microorganism, the capacity to produce one hundred or more agent progeny during infection, and the potential for high level expression of an encoded indicator moiety, the infectious agent or an indicator moiety can be more readily detectable than the microorganism itself. In this way, embodiments of the present invention can achieve tremendous signal amplification from even a single infected cell.
• aspects of the present invention utilize the high specificity of binding agents that can bind to particular microorganisms, such as the binding component of infectious agents, as a means to detect and/or quantify the specific microorganism in a sample.
• binding agents that can bind to particular microorganisms, such as the binding component of infectious agents, as a means to detect and/or quantify the specific microorganism in a sample.
• the present invention utilizes the high specificity of infectious agents such as bacteriophage.
• an infectious agent may comprise an indicator moiety, such as a gene encoding a soluble indicator.
• the indicator may be encoded by the infectious agent, such as a bacteriophage, and the bacteriophage is designated an indicator phage.
• the indicator signal is amplified such that the single bacterium is detectable.
• Embodiments of the methods and systems of the invention can be applied to detection and quantification of a variety of microorganisms (e.g., bacteria, fungi, yeast) in a variety of circumstances, including but not limited to detection of pathogens from food, water, clinical and commercial samples.
• the methods of the present invention provide high detection sensitivity and specificity rapidly and without the need for traditional biological enrichment (e.g., culturing for enrichment), which is a surprising aspect as all available methods require culturing.
• detection is possible within a single replication cycle of the bacteriophage, which is unexpected.
• hybridization described herein are those well known and commonly used in the art. Known methods and techniques are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are discussed throughout the present specification unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer's
• solid support or “support” means a structure that provides a substrate and/or surface onto which biomolecules may be bound.
• a solid support may be an assay well (i.e., such as a microtiter plate or multi-well plate), or the solid support may be a location on a filter, an array, or a mobile support, such as a bead or a membrane (e.g., a filter plate or lateral flow strip).
• binding agent refers to a molecule that can specifically and selectively bind to a second (i.e., different) molecule of interest.
• the interaction may be non-covalent, for example, as a result of hydrogen bonding, van der Waals interactions, or electrostatic or hydrophobic interactions, or it may be covalent.
• soluble binding agent refers to a binding agent that is not associated with (i.e., covalently or non-covalently bound) to a solid support.
• an “analyte” refers to a molecule, compound or cell that is being measured.
• the analyte of interest may, in certain embodiments, interact with a binding agent.
• the term “analyte” may refer to a protein or peptide of interest.
• An analyte may be an agonist, an antagonist, or a modulator. Or, an analyte may not have a biological effect.
• Analytes may include small molecules, sugars, oligosaccharides, lipids, peptides, peptidomimetics, organic compounds and the like.
• an indicator moiety refers to a molecule that can be measured in a quantitative assay.
• an indicator moiety may comprise an enzyme that may be used to convert a substrate to a product that can be measured.
• An indicator moiety may be an enzyme that catalyzes a reaction that generates bioluminescent emissions (e.g., luciferase).
• an indicator moiety may be a radioisotope that can be quantified.
• an indicator moiety may be a fluorophore.
• other detectable molecules may be used.
• bacteriophage or “phage” includes one or more of a plurality of bacterial viruses.
• the terms “bacteriophage” and “phage” include viruses such as mycobacteriophage (such as for TB and paraTB), mycophage (such as for fungi), mycoplasma phage, and any other term that refers to a virus that can invade living bacteria, fungi, mycoplasma, protozoa, yeasts, and other microscopic living organisms and uses them to replicate itself.
• “microscopic” means that the largest dimension is one millimeter or less.
• Bacteriophages are viruses that have evolved in nature to use bacteria as a means of replicating themselves. A phage does this by attaching itself to a bacterium and injecting its DNA (or RNA) into that bacterium, and inducing it to replicate the phage hundreds or even thousands of times. This is referred to as phage amplification.
• late gene region refers to a region of a viral genome that is transcribed late in the viral life cycle.
• the late gene region typically includes the most abundantly expressed genes (e.g., structural proteins assembled into the bacteriophage particle).
• Late genes are synonymous with class III genes and include genes with structure and assembly functions.
• the late genes are transcribed in phage T7, e.g., from 8 minutes after infection until lysis, class I (e.g., RNA polymerase) is early from 4-8 minutes, and class II from 6-15 minutes, so there is overlap in timing of II and III.
• a late promoter is one that is naturally located and active in such a late gene region.
• culturing for enrichment refers to traditional culturing, such as incubation in media favorable to propagation of microorganisms, and should not be confused with other possible uses of the word “enrichment,” such as enrichment by removing the liquid component of a sample to concentrate the microorganism contained therein, or other forms of enrichment that do not include traditional facilitation of microorganism propagation. Culturing for enrichment for very short periods of time may be employed in some embodiments of methods described herein, but is not necessary and is for a much shorter period of time than traditional culturing for enrichment, if it is used at all.
• “recombinant” refers to genetic (i.e., nucleic acid) modifications as usually performed in a laboratory to bring together genetic material that would not otherwise be found. This term is used interchangeably with the term “modified” herein.
• RLU refers to relative light units as measured by a luminometer (e.g., GLOMAX® 96) or similar instrument that detects light.
• a luminometer e.g., GLOMAX® 96
• appropriate substrate e.g., NANOLUC® with NANO- GLO®
• time to results refers to the total amount of time from beginning of sample preparation to the collection of data. Time to results does not include any confirmatory testing time.
• Each of the embodiments of the methods and systems of the invention can allow for the rapid detection and quantification of microbes in a sample.
• methods according to the present invention can be performed in a shortened time period with superior results.
• Microbes detected by the methods and systems of the present invention include pathogens that are of natural, commercial, medical or veterinary concern. Such pathogens include Gram-negative bacteria, Gram-positive bacteria, mycoplasmas and viruses. Any microbe for which an infectious agent that is specific for the particular microbe has been identified can be detected by the methods of the present invention. Those skilled in the art will appreciate that there is no limit to the application of the present methods other than the availability of the necessary specific infectious agent/microbe pairs.
• Bacterial cells detectable by the present invention include, but are not limited to, bacterial cells that are food or water borne pathogens.
• Bacterial cells detectable by the present invention include, but are not limited to, all species of Salmonella, all strains of Escherichia coli, including, but not limited to E. coli 0157:H7, all species of Listeria, including, but not limited to L. monocytogenes, and all species of Campylobacter.
• Bacterial cells detectable by the present invention include, but are not limited to, bacterial cells that are pathogens of medical or veterinary significance.
• pathogens include, but are not limited to, Bacillus spp., Bordetella pertussis, Camplyobacter jejuni, Chlamydia pneumoniae, Clostridium perfringens, Enterobacter spp., Klebsiella pneumoniae, Mycoplasma pneumoniae, Salmonella typhi, Shigella sonnet, Staphylococcus aureus, and Streptococcus spp.
• the sample may be an environmental or food or water sample. Some embodiments may include medical or veterinary samples. Samples may be liquid, solid, or semi-solid. Samples may be swabs of solid surfaces. Samples may include environmental materials, such as the water samples, or the filters from air samples or aerosol samples from cyclone collectors. Samples may be of meat, poultry, processed foods, milk, cheese, or other dairy products. Medical or veterinary samples include, but are not limited to, blood, sputum, cerebrospinal fluid, and fecal samples and different types of swabs.
• samples may be used directly in the detection methods of the present invention, without preparation, concentration, or dilution.
• liquid samples including but not limited to, milk and juices, may be assayed directly.
• Samples may be diluted or suspended in solution, which may include, but is not limited to, a buffered solution or a bacterial culture medium.
• a sample that is a solid or semi-solid may be suspending in a liquid by mincing, mixing or macerating the solid in the liquid.
• a sample should be maintained within a pH range that promotes bacteriophage attachment to the host bacterial cell.
• a sample should also contain the appropriate concentrations of divalent and monovalent cations, including but not limited to Na + , Mg 2+ , and K + .
• a sample is maintained at a temperature that maintains the viability of any pathogen cells contained within the sample.
• the sample is maintained at a temperature that maintains the viability of any pathogen cell present in the sample.
• bacteriophages are attaching to bacterial cells
• steps in which bacteriophages are replicating within an infected bacterial cell or lysing such an infected cell it is preferable to maintain the sample at a temperature that promotes bacteriophage replication and lysis of the host.
• Such temperatures are at least about 25 degrees Celsius (C), more preferably no greater than about 45 degrees C, most preferably about 37 degrees C.
• samples be subjected to gentle mixing or shaking during bacteriophage attachment, replication and cell lysis.
• Assays may include various appropriate control samples. For example, control samples containing no bacteriophages or control samples containing bacteriophages without bacteria may be assayed as controls for background signal levels.
• compositions, methods, systems and kits of the invention may comprise infectious agents for use in detection of pathogenic microorganisms.
• the invention comprises a recombinant indicator bacteriophage, wherein the bacteriophage genome is genetically modified to include an indicator or reporter gene.
• the invention may include a composition comprising a recombinant bacteriophage having an indicator gene incorporated into the genome of the bacteriophage.
• a recombinant indicator bacteriophage can include a reporter or indicator gene.
• the indicator gene does not encode a fusion protein.
• expression of the indicator gene during bacteriophage replication following infection of a host bacterium results in a soluble indicator protein product.
• the indicator gene may be inserted into a late gene region of the bacteriophage. Late genes are generally expressed at higher levels than other phage genes, as they code for structural proteins.
• the late gene region may be a class III gene region and may include a gene for a major capsid protein.
• Some embodiments include designing (and optionally preparing) a sequence for homologous recombination downstream of the major capsid protein gene.
• the sequence comprises a codon-optimized reporter gene preceded by an untranslated region.
• the untranslated region may include a phage late gene promoter and ribosomal entry site.
• an indicator bacteriophage is derived from T7, T4 or another similar phage.
• An indicator bacteriophage may also be derived from T4-like, T7-like, Vil, Vil-like, CBA120, or another bacteriophage having a genome with at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 % homology to T7, T7-like, T4, T4-like, CBA120, Vil, or Vil-like (or Vil virus-like, per GenBank/NCBI) bacteriophages.
• the indicator phage is derived from a bacteriophage that is highly specific for a particular pathogenic microorganism.
• the genetic modifications may avoid deletions of wild-type genes and thus the modified phage may remain more similar to the wild-type infectious agent than many commercially available phage.
• Environmentally derived bacteriophage may be more specific for bacteria that are found in the environment and as such, genetically distinct from phage available
• phage genes thought to be nonessential may have unrecognized function.
• an apparently nonessential gene may have an important function in elevating burst size such as subtle cutting, fitting, or trimming functions in assembly. Therefore, deleting genes to insert an indicator may be detrimental.
• Most phages can package a DNA that is a few percent larger than their natural genome. With this consideration, a smaller indicator gene may be a more appropriate choice for modifying a bacteriophage, especially one with a smaller genome.
• OpLuc and NANOLUC® proteins are only about 20 kDa (approximately 500-600 bp to encode), while FLuc is about 62 kDa (approximately 1,700 bp to encode).
• the genome of T7 is around 40 kbp, while the T4 genome is about 170 kbp, and the genome of CBA120 is about 157 kbp.
• the reporter gene should not be expressed endogenously by the bacteria (i.e., is not part of the bacterial genome), should generate a high signal to background ratio, and should be readily detectable in a timely manner.
• Promega's NANOLUC® is a modified Oplophorus gracilirostris (deep sea shrimp) luciferase.
• NANOLUC® combined with Promega's NANO-GLO®, an imidazopyrazinone substrate (furimazine), can provide a robust signal with low background.
• the indicator gene can be inserted into an untranslated region to avoid disruption of functional genes, leaving wild-type phage genes intact, which may lead to greater fitness when infecting non-laboratory strains of bacteria. Additionally, including stop codons in all three reading frames may help to increase expression by reducing read-through, also known as leaky expression. This strategy may also eliminate the possibility of a fusion protein being made at low levels, which would manifest as background signal (e.g., luciferase) that cannot be separated from the phage.
• background signal e.g., luciferase
• an indicator gene may express a variety of biomolecules.
• the indicator gene is a gene that expresses a detectable product or an enzyme that produces a detectable product.
• the indicator gene encodes a luciferase enzyme.
• a luciferase enzyme Various types of luciferase may be used.
• the luciferase is one of Oplophorus luciferase, Firefly luciferase, Lucia luciferase, Renilla luciferase, or an engineered luciferase.
• the luciferase gene is derived from Oplophorus .
• the indicator gene is a genetically modified luciferase gene, such as NANOLUC®.
• the present invention comprises a genetically modified bacteriophage comprising a non-bacteriophage indicator gene in the late (class III) gene region.
• the non-native indicator gene is under the control of a late promoter.
• a viral late gene promoter insures the reporter gene (e.g., luciferase) is not only expressed at high levels, like viral capsid proteins, but also does not shut down like endogenous bacterial genes or even early viral genes.
• the late promoter is a T4-, T7-, or Vil-like promoter, or another phage promoter similar to that found in the selected wild-type phage, i.e., without genetic modification.
• the late gene region may be a class III gene region, and the bacteriophage may be derived from T7, T4, T4-like, Vil, Vil-like, CBA120, or another natural bacteriophage having a genome with at least 70, 75, 80, 85, 90 or 95% homology to T7, T4, T4-like, Vil, Vil-like, or CBA120 phage.
• inserted or substituted nucleic acids comprise non-native sequences.
• a non-native indicator gene may be inserted into a bacteriophage genome such that it is under the control of a bacteriophage promoter.
• the non- native indicator gene is not part of a fusion protein. That is, in some embodiments, a genetic modification may be configured such that the indicator protein product does not comprise polypeptides of the wild-type bacteriophage.
• the indicator protein product is soluble.
• the invention comprises a method for detecting a bacterium of interest comprising the step of incubating a test sample with such a recombinant bacteriophage.
• expression of the indicator gene in progeny bacteriophage following infection of host bacteria results in a free, soluble protein product.
• the non-native indicator gene is not contiguous with a gene encoding a structural phage protein and therefore does not yield a fusion protein.
• some embodiments of the present invention express a soluble luciferase.
• fusion proteins may be less active than soluble proteins due, e.g., to protein folding constraints that may alter the conformation of the enzyme active site or access to the substrate.
• fusion proteins by definition limit the number of the moieties attached to subunits of a protein in the bacteriophage. For example, using a commercially available system designed to serve as a platform for a fusion protein would result in about 415 copies of the fusion moiety, corresponding to the about 415 copies of the gene 10B capsid protein in each T7 bacteriophage particle. Without this constraint, infected bacteria can be expected to express many more copies of the detection moiety (e.g., luciferase) than can fit on the bacteriophage.
• the detection moiety e.g., luciferase
• fusion proteins such as a capsid-luciferase fusion
• a capsid-luciferase fusion may inhibit assembly of the bacteriophage particle, thus yielding fewer bacteriophage progeny.
• a soluble, non-fusion indicator gene product may be preferable.
• the indicator phage encodes a reporter, such as a detectable enzyme.
• the indicator gene product may generate light and/or may be detectable by a color change.
• Various appropriate enzymes are commercially available, such as alkaline phosphatase (AP), horseradish peroxidase (HRP), or luciferase (Luc). In some embodiments, these enzymes may serve as the indicator moiety.
• Firefly luciferase is the indicator moiety.
• Oplophorus luciferase is the indicator moiety.
• NANOLUC® is the indicator moiety.
• Other engineered luciferases or other enzymes that generate detectable signals may also be appropriate indicator moieties.
• the use of a soluble detection moiety eliminates the need to remove contaminating parental phage from the lysate of the infected sample cells.
• any bacteriophage used to infect sample cells would have the detection moiety attached, and would be indistinguishable from the daughter bacteriophage also containing the detection moiety.
• detection of sample bacteria relies on the detection of a newly created (de novo synthesized) detection moiety
• using fusion constructs requires additional steps to separate old (parental) moieties from newly created (daughter
• bacteriophage moieties. This may be accomplished by washing the infected cells multiple times, prior to the completion of the bacteriophage life cycle, inactivating excess parental phage after infection by physical or chemical means, and/or chemically modifying the parental bacteriophage with a binding moiety (such as biotin), which can then be bound and separated (such as by streptavidin-coated sepharose beads).
• a binding moiety such as biotin
• the production and preparation of parental phage may include purification of the phage from any free detection moiety produced during the production of parental bacteriophage in bacterial culture.
• Standard bacteriophage purification techniques may be employed to purify some embodiments of phage according to the present invention, such as sucrose density gradient centrifugation, cesium chloride isopycnic density gradient centrifugation, HPLC, size exclusion
• Cesium chloride isopycnic ultracentrifugation can be employed as part of the preparation of recombinant phage of the invention, to separate parental phage particles from contaminating luciferase protein produced upon propagation of the phage in the bacterial host.
• the parental recombinant bacteriophage of the invention is substantially free of any luciferase generated during production in the bacteria. Removal of residual luciferase present in the phage stock can substantially reduce background signal observed when the recombinant bacteriophage are incubated with a test sample.
• the late promoter (class III promoter, e.g., from T7, T4, or Vil) has high affinity for RNA polymerase of the same bacteriophage that transcribes genes for structural proteins assembled into the bacteriophage particle. These proteins are the most abundant proteins made by the phage, as each bacteriophage particle comprises dozens or hundreds of copies of these molecules.
• the use of a viral late promoter can ensure optimally high level of expression of the luciferase detection moiety.
• the use of a late viral promoter derived from, specific to, or active under the original wild-type bacteriophage the indicator phage is derived from can further ensure optimal expression of the detection moiety.
• a standard bacterial (non-viral/non- bacteriophage) promoter may in some cases be detrimental to expression, as these promoters are often down-regulated during bacteriophage infection (in order for the bacteriophage to prioritize the bacterial resources for phage protein production).
• the phage is preferably engineered to encode and express at high level a soluble (free) indicator moiety, using a placement in the genome that does not limit expression to the number of subunits of a phage structural component.
• compositions of the invention may comprise one or more wild-type or genetically modified infectious agents (e.g., bacteriophages) and one or more indicator genes.
• compositions can include cocktails of different indicator phages that may encode and express the same or different indicator proteins.
• Embodiments of methods for making indicator bacteriophage begin with selection of a wild-type bacteriophage for genetic modification. Some bacteriophage are highly specific for a target bacterium. This presents an opportunity for highly specific detection.
• the methods of the present invention utilizes the high specificity of binding agents, associated with infectious agents, that recognize and bind to a particular
• microorganism of interest as a means to amplify a signal and thereby detect low levels of a microorganism (e.g., a single microorganism) present in a sample.
• infectious agents e.g., bacteriophage
• these infectious agents may be appropriate binding agents for targeting a microorganism of interest.
• infectious agents may be used. In alternate embodiments,
• bacteriophages bacteriophages, phages, mycobacteriophages (such as for TB and paraTB), mycophages
• the infectious agent may comprise a bacteriophage.
• well-studied phages of E. coli include Tl, T2, T3, T4, T5, T7, and lambda; other E. coli phages available in the ATCC collection, for example, include phiX174, S13, 0x6, MS2, phiVl, fd, PR772, and ZIK1.
• the bacteriophage may replicate inside of the bacteria to generate hundreds of progeny phage. Detection of the product of an indicator gene inserted into the bacteriophage genome can be used as a measure of the bacteria in the sample.
• CBA120 bacteriophage is genetically modified to include a reporter gene.
• the late gene region of a bacteriophage is genetically modified to include a reporter gene.
• a reporter gene is positioned downstream of the major capsid gene. In other embodiments, a reporter gene is positioned upstream of the major capsid gene.
• Some embodiments of methods for preparing a recombinant indicator bacteriophage include selecting a wild-type bacteriophage that specifically infects a target pathogenic bacterium; preparing a homologous recombination plasmid/vector that comprises an indicator gene; transforming the homologous recombination plasmid/vector into target pathogenic bacteria; infecting the transformed target pathogenic bacteria with the selected wild-type bacteriophage, thereby allowing homologous recombination to occur between the plasmid/vector and the bacteriophage genome; and isolating a particular clone of recombinant bacteriophage.
• Various methods for designing and preparing a homologous recombination plasmid are known.
• Various methods for transforming bacteria with a plasmid are known, including heat-shock, F pilus mediated bacterial conjugation, electroporation, and other methods.
• some embodiments of methods for preparing indicator bacteriophage include the steps of selecting a wild-type bacteriophage that specifically infects a target pathogenic bacterium; determining the natural sequence in the late region of the genome of the selected bacteriophage; annotating the genome and identifying the major capsid protein gene of the selected bacteriophage; designing a sequence for homologous recombination adjacent to the major capsid protein gene, wherein the sequence comprises a codon-optimized reporter gene; incorporating the sequence designed for homologous recombination into a plasmid/vector; transforming the plasmid/vector into target pathogenic bacteria; selecting for the transformed bacteria; infecting the transformed bacteria with the selected wild-type bacteriophage, thereby allowing homologous recombination to occur between the plasmid and the bacteriophage genome; determining the titer of the resulting recombinant bacteriophage lysate; and performing a limiting
• bacteriophage represent a detectable fraction of the mixture.
• the limiting dilution and titer steps can be repeated until at least 1/30 of the bacteriophage in the mixture are recombinant before isolating a particular clone of recombinant bacteriophage.
• a ratio of 1 : 30 recombinant: wild-type is expected to yield an average of 3.2 transducing units (TU) per 96 plaques (e.g., in a 96-well plate).
• TU transducing units
• Figure 1 depicts a schematic representation of the wild-type CBA120 bacteriophage genome.
• the late gene cluster 110 was identified, and open reading frames 120 (ORF) in the late gene region were annotated.
• ORF open reading frames 120
• the ORF187/gp23 putative gene for the major capsid protein 130 (MCP) was identified and its sequence, along with downstream sequence in the late gene cluster, was used to prepare a recombinant plasmid carrying the desired reporter gene.
• Some embodiments of methods of preparing a recombinant indicator bacteriophage include designing a plasmid that can readily recombine with the wild-type bacteriophage genome to generate recombinant genomes.
• designing a plasmid some embodiments include addition of a codon-optimized reporter gene, such as a luciferase gene.
• Some embodiments further include addition of elements into the upstream untranslated region. For example, in designing a plasmid to recombine with the CBA120 genome, an upstream untranslated region can be added between the sequence encoding the C-terminus of the gp23 / Major Capsid Protein and the start codon of the NANOLUC® reporter gene.
• the untranslated region can include a promoter, such as a T4, T4-like, T7, T7-like, CBA120, Vil, or Vil-like promoter.
• the untranslated region can also include a Ribosomal Entry / Binding Site (RBS), also known as a "Shine-Dalgarno Sequence" with bacterial systems. Either or both of these elements, or other untranslated elements, can be embedded within a short upstream untranslated region made of random sequences comprising about the same GC content as rest of the phage genome. The random region should not include an ATG sequence, as that will act as a start codon.
• RBS Ribosomal Entry / Binding Site
• plasmids There are numerous known methods and commercial products for preparing plasmids. For example PCR, site-directed mutagenesis, restriction digestion, ligation, cloning, and other techniques may be used in combination to prepare plasmids. Synthetic plasmids can also be ordered commercially (e.g., GeneWiz). Cosmids can also be employed, or the
• CRISPR/CAS9 system could be used to selectively edit a bacteriophage genome.
• Figure 2 shows an embodiment of a plasmid designed to recombine with the CBA120 bacteriophage genome to generate a recombinant bacteriophage.
• This particular plasmid is designated pUC57.HR.CBA120.NanoLuc.
• the detection/indicator moiety is encoded by the NANOLUC® reporter gene 941-1540.
• the insert (396-1883) is in the standard AmpR version of pUC57.
• the major capsid protein C-terminal fragment is represented by 396-895, ORF187/ gp23.
• a T4-like phage late promoter consensus sequence (902-912) & Shine- Dalgarno Ribosomal Entry /Binding Site (927-934) within the 5' untranslated region are represented by 896-940.
• the codon-optimized NANOLUC® reporter gene is represented by 941-1540.
• the untranslated region (UTR) and ORF185 hypothetical protein N-Terminal fragment are represented by 1541-1838.
• the transcriptional terminator (1839-1883) is only in the plasmid, and does not become part of the phage genome as a result of recombination.
• the ORF187/gp23 fragment 396-895 is a part of a structural gene that encodes a virion protein. As these virion proteins are expressed at a very high level, any genes inserted into this region can be expected to have similar expression levels, as long as late gene promoters and/or other similar control elements are used.
• Figure 3 shows a schematic of the homologous recombination expected between the plasmid of Figure 2 and bacteriophage genome of Figure 1 to create recombinant
• the CBA120 phage genome is 157,304 base pairs, while the synthesized plasmid is 4,117 base pairs.
• the final recombinant genome resulting from recombination is 157,949 base pairs.
• indicator phage according to the invention comprise CBA120 bacteriophage genetically engineered to comprise a reporter gene such as a luciferase gene.
• an indicator phage can be the CBA120 bacteriophage wherein the genome comprises the sequence of the NANOLUC® gene.
• a recombinant CBA120 bacteriophage genome may further comprise a T4, T7, CBA120, Vil, or another late promoter.
• the indicator gene i.e., NANOLUC®
• NANOLUC® is inserted into the late gene region, just downstream of the gene encoding the major capsid protein, and thus creates recombinant bacteriophage genomes comprising the NANOLUC® gene.
• the construct may additionally comprise the consensus T4, T7, CBA120, Vil, or another late promoter or another suitable promoter to drive transcription and expression of the luciferase gene.
• the construct may also comprise a composite untranslated region synthesized from several UTRs. This construct ensures soluble luciferase is produced such that expression is not limited to the number of capsid proteins inherent in the phage display system.
• Figure 4 depicts the isolation of recombinant phage from the mixture of wild-type and recombinant bacteriophage resulting from the homologous recombination illustrated in Figure 3, using the plasmid construct shown in Figure 2.
• bacteria transformed with the homologous recombination plasmid are infected with bacteriophage, resulting in progeny phage with a mixture of parental and recombinant phage with a ratio of approximately 120 wild-type 432 : 1 recombinant phage 434.
• the resulting recombinant phage mix is diluted 404 into 96-well plates 406 to give an average of 3 recombinant transducing units (TU) per plate, which corresponds to about 3.8 infectious units (IU) of mostly wild-type phage per well.
• the 96- well plate is assayed for luciferase activity to identify wells 436 containing recombinant phage as compared to wells 440 containing wild-type bacteriophage.
• Bacteria 438 are added 408; for example, each well may contain about 50 of a turbid E. coli 0157:H7 culture. This allows the phage to replicate and produce the luciferase enzyme 442. After 2 hours of incubation at 37°C shown in 410, wells may be screened for the presence of luciferase 442.
• any positive wells are likely to have been inoculated with a single recombinant phage, and at this stage the mixture may contain a ratio of approximately 3.8 wild-type phage: 1 recombinant, an enrichment over the original 120: 1 ratio.
• soluble luciferase and phage were present at an approximate ratio of 16 wild-type: 1 recombinant. If necessary (i.e., if the ratio of recombinant: wild-type is lower than 1 :30), progeny from this enriched culture 412 may be subjected to additional limiting dilution assay(s) 414 to increase the ratio and determine the actual concentration of recombinant phage transducing units.
• TU per 96-well plate 416 may be aliquoted 414 from the first purification stock, leading to an approximate inoculation of -20 mostly wild-type phage per well of a second dilution assay plate 420. Any positive luciferase wells are likely to have been inoculated with a single recombinant along with -20 wild-type phage. These wells may be analyzed for presence of luciferase 442.
• soluble luciferase and phage are present at approximately 20 wild-type: 1 recombinant 420.
• a plaque assay may be performed 422 to screen for recombinants that express luciferase 446.
• One plaque may be removed from the plate to each well of a 96-well plate 424 and a luciferase assay performed 426 to determine which wells contained phage exhibiting luciferase activity 442.
• Wells 428 demonstrating luciferase activity represent pure recombinant phage 434, while wells without luciferase activity 430 represent pure wild-type phage 432.
• Individual plaques may then be suspended in buffer (e.g., 100 TMS) or media, and an aliquot (e.g., about 5 ⁇ ) added to a well containing a turbid E. coli 0157:H7 culture, and assayed after incubation (e.g., about 45 minutes to 1 hour at 37°C). Positive wells are expected to contain a pure culture of recombinant phage. Certain embodiments can include additional rounds of plaque purification.
• buffer e.g., 100 TMS
• an aliquot e.g., about 5 ⁇
• positive wells are expected to contain a pure culture of recombinant phage.
• Certain embodiments can include additional rounds of plaque purification.
• recombinant phage generated by homologous recombination of a plasmid designed for recombination with the wild-type phage genome can be isolated from a mixture comprising only 0.005% of total phage genomes.
• large scale production may be performed to obtain high titer recombinant indicator phage stocks appropriate for use in the E. coli 0157:H7 detection assay.
• cesium chloride isopycnic density gradient centrifugation may be used to separate phage particles from contaminating luciferase protein to reduce background.
• Figure 5 shows an electron micrograph of one embodiment of a recombinant indicator bacteriophage generated by recombination of the wild-type CBA120 bacteriophage genome shown in Figure 1 with the plasmid shown in Figure 2, as illustrated in Figure 3.
• the bacteriophage purified on a 5-20% sucrose density gradient were adsorbed onto a glow discharge-treated carbon film and stained with 2% uranyl acetate.
• the sample was viewed in a FEI Tecnai G 2 Spirit BioTwin Transmission Electron Microscope and the micrograph taken with an EagleTM 2K CCD.
• CBA120NanoLuc This indicator bacteriophage is designated "CBA120NanoLuc” (or “CBA120NanoLuc indicator phage”) and was utilized in the assays described herein. The data presented in Examples and Figures herein were obtained using this Indicator Phage for infection of bacteria in the sample being tested.
• recombinant bacteriophage having the reporter gene of interest e.g., luciferase gene such as Firefly, Oplophorus or an engineered luciferase such as NANOLUC®
• the reporter gene of interest e.g., luciferase gene such as Firefly, Oplophorus or an engineered luciferase such as NANOLUC®
• the invention may comprise methods of using infectious particles for detecting microorganisms.
• the methods of the invention may be embodied in a variety of ways.
• the invention may comprise a method for detecting a bacterium of interest in a sample comprising the steps of: incubating the sample with bacteriophage that infects the bacterium of interest, wherein the bacteriophage comprises an indicator gene such that expression of the indicator gene during bacteriophage replication following infection of the bacterium of interest results in production of a soluble indicator protein product; and detecting the indicator protein product, wherein positive detection of the indicator protein product indicates that the bacterium of interest is present in the sample.
• the assay may be performed to utilize a general concept that can be modified to accommodate different sample types or sizes and assay formats.
• Embodiments employing recombinant bacteriophage of the invention may allow rapid detection of specific bacterial strains, with total assay times under 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, or 12 hours, depending on the sample type, sample size, and assay format.
• Figure 6 illustrates an embodiment of an assay for detecting a bacterium of interest using a modified bacteriophage according to an embodiment of the invention.
• Aliquots of indicator phage 614 are distributed to the individual wells 602 of a multi-well plate 604, and then test sample aliquots containing bacteria 612 are added and incubated 606 for a period of time (e.g., 45 minutes at 37°C) sufficient for phage to replicate and generate soluble indicator 616 (e.g., luciferase).
• the plate wells 608 containing soluble indicator and phage may then be assayed 610 to measure the indicator activity on the plate 618 (e.g., luciferase assay). Experiments utilizing this method are described herein.
• test samples are not concentrated (e.g., by centrifugation) but are incubated directly with indicator phage for a period of time and subsequently assayed for luciferase activity.
• various tools e.g., a centrifuge or filter
• a 10 mL aliquot of a prepared sample may be extracted and centrifuged to pellet cells and large debris. The pellet can be resuspended in a smaller volume for enrichment or for testing (i.e., before infecting the sample with Indicator Bacteriophage).
• the sample may be enriched prior to testing by incubation in conditions that encourage growth.
• the enrichment period can be 1, 2, 3, 4, 5, 6, 7, or up to 8 hours or longer, depending on the sample type and size.
• the indicator bacteriophage comprises a detectable indicator moiety, and infection of a single pathogenic cell (e.g., bacterium) can be detected by an amplified signal generated via the indicator moiety.
• the method may comprise detecting an indicator moiety produced during phage replication, wherein detection of the indicator indicates that the bacterium of interest is present in the sample.
• the invention may comprise a method for detecting a bacterium of interest in a sample comprising the steps of: incubating the sample with a recombinant bacteriophage that infects the bacterium of interest, wherein the recombinant bacteriophage comprises an indicator gene inserted into a late gene region of the bacteriophage such that expression of the indicator gene during bacteriophage replication following infection of host bacteria results in production of a soluble indicator protein product; and detecting the indicator protein product, wherein positive detection of the indicator protein product indicates that the bacterium of interest is present in the sample.
• the amount of indicator moiety detected corresponds to the amount of the bacterium of interest present in the sample.
• the methods and systems of the invention may utilize a range of concentrations of parental indicator bacteriophage to infect bacteria present in the sample.
• the indicator bacteriophage are added to the sample at a concentration sufficient to rapidly find, bind, and infect target bacteria that are present in very low numbers in the sample, such as a single cell.
• the phage concentration can be sufficient to find, bind, and infect the target bacteria in less than one hour. In other embodiments, these events can occur in less than two hours, or less than three hours, following addition of indicator phage to the sample.
• the bacteriophage concentration for the incubating step is greater than 1 x 10 5 PFU/mL, greater than 1 x 10 6 PFU/mL, or greater than 1 x 10 7 PFU/mL.
• the recombinant infectious agent may be purified so as to be free of any residual indicator protein that may be generated upon production of the infectious agent stock.
• the recombinant bacteriophage may be purified using cesium chloride isopycnic density gradient centrifugation prior to incubation with the sample.
• this purification may have the added benefit of removing bacteriophage that do not have DNA (i.e., empty phage or "ghosts").
• the microorganism may be detected without any isolation or purification of the microorganisms from a sample.
• a sample containing one or a few microorganisms of interest may be applied directly to an assay container such as a spin column, a microtiter well, or a filter and the assay is conducted in that assay container.
• an assay container such as a spin column, a microtiter well, or a filter and the assay is conducted in that assay container.
• Aliquots of a test sample may be distributed directly into wells of a multi-well plate, indicator phage may be added, and after a period of time sufficient for infection, a lysis buffer may be added as well as a substrate for the indicator moiety (e.g., luciferase substrate for a luciferase indicator) and assayed for detection of the indicator signal.
• a substrate for the indicator moiety e.g., luciferase substrate for a luciferase indicator
• Some embodiments of the method can be performed on filter plates. Some embodiments of the method can be performed with or without concentration of the sample before infection with indicator phage.
• multi-well plates are used to conduct the assays.
• the choice of plates may affect the detecting step.
• some plates may include a colored or white background, which may affect the detection of light emissions.
• white plates have higher sensitivity but also yield a higher background signal.
• Other colors of plates may generate lower background signal but also have a slightly lower sensitivity.
• one reason for background signal is the leakage of light from one well to another, adjacent well.
• the choice of plate or other assay vessel may influence the sensitivity and background signal for the assay.
• Methods of the invention may comprise various other steps to increase sensitivity.
• the method may comprise a step for washing the captured and infected bacterium, after adding the bacteriophage but before incubating, to remove excess parental bacteriophage and/or luciferase or other reporter protein
• detection of the microorganism of interest may be completed without the need for culturing the sample as a way to increase the population of the microorganisms.
• the total time required for detection is less than 12.0 hours, 1 1.0 hours, 10.0 hours, 9.0 hours, 8.0 hours, 7.0 hours, 6.0 hours, 5.0 hours, 4.0 hours, 3.0 hours, 2.5 hours, 2.0 hours, 1.5 hours, 1.0 hour, 45 minutes, or less than 30 minutes. Minimizing time to result is critical in food and environmental testing for pathogens.
• the method of the invention can detect individual microorganisms.
• the method may detect ⁇ 10 cells of the microorganism (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9 microorganisms) present in a sample.
• the recombinant bacteriophage is highly specific for E. coli 0157:H7.
• the recombinant bacteriophage can distinguish E. coli 0157:H7 in the presence of more than 100 other types of bacteria.
• the recombinant bacteriophage can be used to detect a single bacterium of the specific type in the sample.
• the recombinant bacteriophage detects as few as 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 of the specific bacteria in the sample.
• aspects of the present invention provide methods for detection of
• the indicator moiety may be associated with an infectious agent such as an indicator bacteriophage.
• the indicator moiety may react with a substrate to emit a detectable signal or may emit an intrinsic signal (e.g., fluorescent protein).
• the detection sensitivity can reveal the presence of as few as 50, 20, 10, 9, 8, 7, 6, 5, 4, 3, or 2 cells of the microorganism of interest in a test sample. In some embodiments, even a single cell of the microorganism of interest may yield a detectable signal.
• the bacteriophage is a T4-like or Vil-like bacteriophage.
• the recombinant bacteriophage is derived from CBA120. In certain embodiments, a CBA120 recombinant bacteriophage is highly specific for E.coli 0157:H7.
• the indicator moiety encoded by the infectious agent may be detectable during or after replication of the infectious agent.
• Many different types of detectable biomolecules suitable for use as indicator moieties are known in the art, and many are commercially available.
• the indicator phage comprises an enzyme, which serves as the indicator moiety.
• the genome of the indicator phage is modified to encode a soluble protein.
• the indicator phage encodes a detectable enzyme.
• the indicator may emit light and/or may be detectable by a color change.
• Various appropriate enzymes are commercially available, such as alkaline phosphatase (AP), horseradish peroxidase (HRP), or luciferase (Luc).
• these enzymes may serve as the indicator moiety.
• Firefly luciferase is the indicator moiety.
• Oplophorus luciferase is the indicator moiety.
• NANOLUC® is the indicator moiety.
• Other engineered luciferases or other enzymes that generate detectable signals may also be appropriate indicator moieties.
• the recombinant bacteriophage of the methods, systems or kits is prepared from wild-type bacteriophage CBA120.
• the indicator gene encodes a protein that emits an intrinsic signal, such as a fluorescent protein (e.g., green fluorescent protein or others). The indicator may emit light and/or may be detectable by a color change.
• the indicator gene encodes an enzyme (e.g., luciferase) that interacts with a substrate to generate signal.
• the indicator gene is a luciferase gene.
• the luciferase gene is one of Oplophorus luciferase, Firefly luciferase, Renilla luciferase, External Gaussia luciferase,
• Lucia luciferase or an engineered luciferase such as NANOLUC®, Rluc8.6-535, or Orange Nano-lantern.
• Detecting the indicator may include detecting emissions of light.
• a luminometer may be used to detect the reaction of indicator (e.g., luciferase) with a substrate.
• the detection of RLU can be achieved with a luminometer, or other machines or devices may also be used.
• a spectrophotometer, CCD camera, or CMOS camera may detect color changes and other light emissions.
• Absolute RLU are important for detection, but the signal to background ratio also needs to be high (e.g., > 2.0, > 2.5, or > 3.0) in order for single cells or low numbers of cells to be detected reliably.
• the indicator phage is genetically engineered to contain the gene for an enzyme, such as a luciferase, which is only produced upon infection of bacteria that the phage specifically recognizes and infects.
• the indicator moiety is expressed late in the viral life cycle.
• the indicator is a soluble protein (e.g., soluble luciferase) and is not fused with a phage structural protein that limits its copy number.
• the invention comprises a method for detecting a microorganism of interest comprising the steps of capturing at least one sample bacterium; incubating the at least one bacterium with a plurality of indicator phage; allowing time for infection and replication to generate progeny phage and express soluble indicator moiety; and detecting the progeny phage, or preferably the indicator, wherein detection of the indicator demonstrates that the bacterium is present in the sample.
• test sample bacterium may be captured by binding to the surface of a plate, or by filtering the sample through a bacteriological filter (e.g., 0.45 ⁇ pore size spin filter or plate filter).
• infectious agent e.g., indicator phage
• the microorganism captured on the filter or plate surface is subsequently washed one or more times to remove excess unbound infectious agent.
• a medium e.g., Luria-Bertani Broth, also called LB herein, or Tryptic Soy Broth or Tryptone Soy Broth, also called TSB herein
• LB Luria-Bertani Broth
• TSB Tryptone Soy Broth
• a surprising aspect of some embodiments of testing assays is that the incubation step with indicator phage only needs to be long enough for a single phage life cycle. The amplification power of using bacteriophage was previously thought to require more time, such that the phage would replicate for several cycles. A single replication cycle of indicator phage can be sufficient to facilitate sensitive and rapid detection according to some embodiments of the present invention.
• aliquots of a test sample comprising bacteria may be applied to a spin column and after infection with a recombinant bacteriophage and an optional washing to remove any excess bacteriophage, the amount of soluble indicator detected will be proportional to the amount of bacteriophage that are produced by infected bacteria.
• Soluble indicator e.g., luciferase
• Soluble indicator released into the surrounding liquid upon lysis of the bacteria may then be measured and quantified.
• the solution is spun through the filter, and the filtrate collected for assay in a new receptacle (e.g., in a luminometer) following addition of a substrate for the indicator enzyme (e.g., luciferase substrate).
• the indicator signal may be measured directly on the filter.
• the purified parental indicator phage does not comprise the detectable indicator itself, because the parental phage can be purified before it is used for incubation with a test sample.
• Expression of late (Class III) genes occurs late in the viral life cycle.
• parental phage may be purified to exclude any existing indicator protein (e.g., luciferase).
• expression of the indicator gene during bacteriophage replication following infection of host bacteria results in a soluble indicator protein product. Thus, in many embodiments, it is not necessary to separate parental from progeny phage prior to the detecting step.
• the microorganism is a bacterium and the indicator phage is a bacteriophage.
• the indicator moiety is soluble luciferase, which is released upon lysis of the host microorganism.
• the indicator substrate e.g., luciferase substrate
• the solid support is a 96-well filter plate (or regular 96-well plate), and the substrate reaction may be detected by placing the plate directly in the luminometer.
• the invention may comprise a method for detecting E. coli 0157:H7 comprising the steps of: infecting cells captured on a 96-well filter plate with a plurality of parental indicator phage capable of expressing luciferase upon infection; washing excess phage away; adding LB broth and allowing time for phage to replicate and lyse the specific E. coli target (e.g., 30-90 minutes); and detecting the indicator luciferase by adding luciferase substrate and measuring luciferase activity directly in the 96-well plate, wherein detection of luciferase activity indicates that the E. coli 0157:H7 is present in the sample.
• a method for detecting E. coli 0157:H7 comprising the steps of: infecting cells captured on a 96-well filter plate with a plurality of parental indicator phage capable of expressing luciferase upon infection; washing excess phage away; adding LB broth and allowing time for phage to
• the invention may comprise a method for detecting E. coli 0157:H7 comprising the steps of: infecting cells in liquid solution or suspension in a 96-well plate with a plurality of parental indicator phage capable of expressing luciferase upon infection; allowing time for phage to replicate and lyse the specific E. coli target (e.g., 30-120 minutes); and detecting the indicator luciferase by adding luciferase substrate and measuring luciferase activity directly in the 96-well plate, wherein detection of luciferase activity indicates that the E. coli 0157:H7 is present in the sample.
• no capturing step is necessary.
• the liquid solution or suspension may be a consumable test sample, such as a vegetable wash.
• the liquid solution or suspension may be vegetable wash fortified with concentrated LB Broth, Tryptic/Tryptone Soy Broth, Peptone Water or Nutrient Broth.
• the liquid solution or suspension may be bacteria diluted in LB Broth.
• lysis of the bacterium may occur before, during, or after the detection step.
• infected unlysed cells may be detectable upon addition of luciferase substrate in some embodiments.
• luciferase may exit cells and/or luciferase substrate may enter cells without complete cell lysis.
• spin filter system where only luciferase released into the lysate
• lysis is required for detection.
• lysis is not necessary for detection.
• the reaction of indicator moiety e.g., luciferase
• substrate may continue for 30 minutes or more, and detection at various time points may be desirable for optimizing sensitivity.
• indicator moiety e.g., luciferase
• luminometer readings may be taken initially and at 10- or 15-minute intervals until the reaction is completed.
• the bacteriophage concentration for this incubating step is greater than 7 x 10 6 , 8 x 10 6 , 9 x 10 6 , 1.0 x 10 7 , 1.1 x 10 7 , 1.2 x 10 7 , 1.3 x 10 7 , 1.4 x 10 7 , 1.5 x 10 7 , 1.6 x 10 7 , 1.7 x 10 7 , 1.8 x 10 7 , 1.9 x 10 7 , 2.0 x 10 7 , 3.0 x 10 7 , 4.0 x 10 7 , 5.0 x 10 7 , 6.0 x 10 7 , 7.0 x 10 7 , 8.0 x 10 7 , 9.0 x 10 7 , or 1.0 x 10 8 PFU/mL.
• Electron microscopy demonstrates that a crude phage lysate (i.e., before cesium chloride clean-up) may have greater than 50% ghosts. These ghost particles may contribute to premature death of the microorganism through the action of many phage particles puncturing the cell membrane. Thus ghost particles may have contributed to previous problems where high PFU concentrations were reported to be detrimental. Moreover, a very clean phage prep allows the assay to be performed with no wash steps, which makes the assay possible to perform without an initial concentration step. Some embodiments do include an initial concentration step, and in some embodiments this concentration step allows a shorter enrichment incubation time.
• testing methods may further include confirmatory assays.
• confirmatory assays A variety of assays are known in the art for confirming an initial result, usually at a later point in time.
• the samples can be cultured (e.g., CHROMAGAR®/DYNABEADS® assay as described in Example 4), PCR can be utilized to confirm the presence of the microbial DNA, or other confirmatory assays can be used to confirm the initial result.
• Figures 7-9 demonstrate data from basic assays (e.g., performed as shown in Figure 6) on samples derived from E. coli 0157:H7 cultures, using the CBA120NanoLuc Indicator Phage.
• Figure 7 demonstrates three different infecting phage concentrations, 10 5 , 10 6 , and 10 7 phage/mL.
• Figure 8 uses 6-10 replicates of each indicated cell number to demonstrate significant differences between signals from single cells as compared to zero cells (background) or higher numbers of cells.
• Figure 9 shows that the signal to background ratio for the experiment shown in Figure 8 is greater than 2.0. Example 3 also describes these experiments.
• Embodiments of beef assays include sample preparation steps. Some embodiments can include enrichment time. For example, enrichment for 1, 2, 3, 4, 5, 6, 7, or 8 hours may be needed, depending on sample type and size. Following these sample preparation steps, infection with a high concentration of recombinant bacteriophage that expresses a reporter or indicator can be performed in a variety of assay formats, such as that shown in Figure 6.
• Embodiments of beef assays can detect a single pathogenic bacterium in sample sizes corresponding to industry standards, with a reduction in time-to-results of 20-50%, depending on the sample type and size.
• Figures 10-16 show data from beef assay experiments using CBA120NanoLuc Indicator Bacteriophage, as described in Example 4.
• vegetable leaves e.g., spinach or lettuce
• Liquid can be added to the vegetable wash. For example, in some embodiments 5 mL of water are added per each gram (g) of vegetable. Other laboratory liquids (e.g., LB) may also be used. Leaves and solution can be mixed manually for a few minutes. Liquid can then be extracted from the plastic bag and can be used as the "vegetable wash.” Using this method, ⁇ 1 million "endogenous" bacterial contaminants were found to reside on a single spinach leaf (1-2 g).
• the assay is quantitative in that the signal detected is proportional to the amount of the bacterium of interest in the sample.
• known numbers of E. coli 0157:H7 cells can be added to vegetable wash samples to simulate contamination of vegetables with pathogenic bacteria.
• the experiment using vegetable wash samples described in Example 5 demonstrates marked differences between the signal from 0 cells, 1 cell, and 7 cells per assay, demonstrating the ability to detect single-digit cell numbers in vegetable wash.
• Using more bacterial cells per assay shows increasing signal in a dose-dependent manner.
• the vegetable wash contains about 10 6 non-target bacteria /mL, corresponding to at least 10 5 non-target bacteria per sample in this assay (including the 0 cells E. coli 0157:H7 control).
• the ability to discern as few as a single target bacterial cell from 10 5 non-target bacteria is surprising and again demonstrates the specificity and sensitivity of the assay.
• Figure 17 shows data from a vegetable wash experiment (Example 5).
• the incubating step of the methods described herein comprises a final bacteriophage concentration of greater than 7 x 10 6 , 8 x 10 6 , 9 x 10 6 , 1.0 x 10 7 , 1.1 x 10 7 , 1.2 x 10 7 , 1.3 x 10 7 , 1.4 x 10 7 , 1.5 x 10 7 , 1.6 x 10 7 , 1.7 x 10 7 , 1.8 x 10 7 , 1.9 x 10 7 , 2.0 x 10 7 , 3.0 x 10 7 , 4.0 x 10 7 , 5.0 x 10 7 , 6.0 x 10 7 , 7.0 x 10 7 , 8.0 x 10 7 , 9.0 x 10 7 , or 1.0 x 10 8
• the methods of the invention require less than 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 hours for detection of a microorganism of interest.
• the methods can detect as few as 100, 50, 20, 10, 9, 8, 7, 6, 5, 4, 3, or 2 cells of the bacterium of interest. These are shorter timeframes than were previously thought possible. In some embodiments, even a single cell of the bacterium is detectable.
• the invention comprises systems (e.g., computer systems, automated systems or kits) comprising components for performing the methods disclosed herein, and/or using the modified bacteriophage described herein.
• the invention comprises systems (e.g., automated systems or kits) comprising components for performing the methods disclosed herein.
• indicator phage are comprised in systems or kits according to the invention. Methods described herein may also utilize such indicator phage systems or kits. Some embodiments described herein are particularly suitable for automation and/or kits, given the minimal amount of reagents and materials required to perform the methods.
• each of the components of a kit may comprise a self-contained unit that is deliverable from a first site to a second site.
• the invention comprises systems or kits for rapid detection of a microorganism of interest in a sample.
• the systems or kits may in certain embodiments comprise a component for incubating the sample with an infectious agent specific for the microorganism of interest, wherein the infectious agent comprises an indicator moiety and a component for detecting the indicator moiety.
• the infectious agent is a recombinant bacteriophage that infects the bacterium of interest, and the recombinant bacteriophage comprises an indicator gene inserted into a late gene region of the bacteriophage as the indicator moiety such that expression of the indicator gene during bacteriophage replication following infection of host bacteria results in a soluble indicator protein product.
• Some systems further comprise a component for capturing the microorganism of interest on a solid support.
• the invention comprises a method, system, or kit for rapid detection of a microorganism of interest in a sample, comprising an infectious agent component that is specific for the microorganism of interest, wherein the infectious agent comprises an indicator moiety, and a component for detecting the indicator moiety.
• the bacteriophage is a T4-like, Vil, Vil-like, or CBA120 bacteriophage.
• the recombinant bacteriophage is derived from CBA120.
• the recombinant bacteriophage is highly specific for a particular bacterium.
• the recombinant bacteriophage is highly specific for E. coli 0157:H7.
• the recombinant bacteriophage can distinguish E. coli 0157:H7 in the presence of more than 100 other types of bacteria.
• a system or kit detects a single bacterium of the specific type in the sample.
• a system or kit detects as few as 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 specific bacteria in the sample.
• the systems and/or kits may further comprise a component for washing the captured microorganism sample. Additionally or alternatively, the systems and/or kits may further comprise a component for determining amount of the indicator moiety, wherein the amount of indicator moiety detected corresponds to the amount of microorganism in the sample.
• the system or kit may comprise a luminometer or other device for measuring a lucif erase enzyme activity.
• the same component may be used for multiple steps.
• the steps are automated or controlled by the user via computer input and/or wherein a liquid-handling robot performs at least one step.
• the invention may comprise a system or kit for rapid detection of a microorganism of interest in a sample, comprising: a component for incubating the sample with an infectious agent specific for the microorganism of interest, wherein the infectious agent comprises an indicator moiety; a component for capturing the microorganism from the sample on a solid support; a component for washing the captured microorganism sample to remove unbound infectious agent; and a component for detecting the indicator moiety.
• the same component may be used for steps of capturing and/or incubating and/or washing (e.g., a filter component).
• Some embodiments additionally comprise a component for determining amount of the microorganism of interest in the sample, wherein the amount of indicator moiety detected corresponds to the amount of microorganism in the sample.
• a component for determining amount of the microorganism of interest in the sample wherein the amount of indicator moiety detected corresponds to the amount of microorganism in the sample.
• Such systems can include various embodiments and subembodiments analogous to those described above for methods of rapid detection of microorganisms.
• the microorganism is a bacterium and the infectious agent is a bacteriophage.
• the system may be fully automated, semi-automated, or directed by the user through a computer (or some combination thereof).
• the system may comprise a component for isolating the microorganism of interest from the other components in the sample.
• the invention comprises a system or kit comprising components for detecting a microorganism of interest comprising: a component for isolating at least one microorganism from other components in the sample; a component for infecting the at least one microorganism with a plurality of a parental infectious agent; a component for lysing the at least one infected microorganism to release progeny infectious agents present in the microorganism; and a component for detecting the progeny infectious agents, or with greater sensitivity, a soluble protein encoded and expressed by the infectious agent, wherein detection of the infectious agent or a soluble protein product of the infectious agent indicates that the microorganism is present in the sample.
• the infectious agent may comprise CBA120NanoLuc.
• the systems or kits may comprise a variety of components for detection of progeny infectious agents.
• the progeny infectious agent e.g., bacteriophage
• the indicator moiety in the progeny infectious agent may be a detectable moiety that is expressed during replication, such as a soluble luciferase protein.
• the invention may comprise a kit for rapid detection of a microorganism of interest in a sample, the system comprising: a component for incubating the sample with an infectious agent specific for the microorganism of interest, wherein the infectious agent comprises an indicator moiety; a component for capturing the microorganism from the sample on a solid support; a component for washing the captured microorganism sample to remove unbound infectious agent; and a component for detecting the indicator moiety.
• the same component may be used for steps of capturing and/or incubating and/or washing.
• kits can include various embodiments and subembodiments analogous to those described above for methods of rapid detection of microorganisms.
• the amount of indicator moiety detected corresponds to the amount of microorganism in the sample.
• microorganism is a bacterium and the infectious agent is a bacteriophage.
• kits may comprise a component for isolating the
• microorganism of interest from the other components in the sample.
• components are broadly defined and includes any suitable apparatus or collections of apparatuses suitable for carrying out the recited method.
• the components need not be integrally connected or situated with respect to each other in any particular way.
• the invention includes any suitable arrangements of the components with respect to each other.
• the components need not be in the same room. But in some embodiments, the components are connected to each other in an integral unit. In some embodiments, the same components may perform multiple functions.
• the system may be embodied in the form of a computer system.
• Typical examples of a computer system include a general-purpose computer, a programmed microprocessor, a microcontroller, a peripheral integrated circuit element, and other devices or arrangements of devices that are capable of implementing the steps that constitute the method of the present technique.
• a computer system may comprise a computer, an input device, a display unit, and/or the Internet.
• the computer may further comprise a microprocessor.
• the microprocessor may be connected to a communication bus.
• the computer may also include a memory.
• the memory may include random access memory (RAM) and read only memory (ROM).
• the computer system may further comprise a storage device.
• the storage device can be a hard disk drive or a removable storage drive such as a floppy disk drive, optical disk drive, etc.
• the storage device can also be other similar means for loading computer programs or other instructions into the computer system.
• the computer system may also include a
• the communication unit allows the computer to connect to other databases and the Internet through an I/O interface.
• the communication unit allows the transfer to, as well as reception of data from, other databases.
• the communication unit may include a modem, an Ethernet card, or any similar device which enables the computer system to connect to databases and networks such as LAN, MAN, WAN and the Internet.
• the computer system thus may facilitate inputs from a user through input device, accessible to the sy stem through 1/ O interface.
• a computing device typically will include an operating system that provides executable program instructions for the general administration and operation of that computing device, and typically will include a computer-readable storage medium (e.g., a hard disk, random access memory, read only memory, etc.) storing instructions that, when executed by a processor of the server, allow the computing device to perform its intended functions.
• a computer-readable storage medium e.g., a hard disk, random access memory, read only memory, etc.
• Suitable implementations for the operating system and general functionality of the computing device are known or commercially available, and are readily implemented by persons having ordinary skill in the art, particularly in light of the disclosure herein.
• the computer system executes a set of instructions that are stored in one or more storage elements, in order to process input data.
• the storage elements may also hold data or other information as desired.
• the storage element may be in the form of an information source or a physical memory element present in the processing machine.
• the environment can include a variety of data stores and other memory and storage media as discussed above. These can reside in a variety of locations, such as on a storage medium local to (and/or resident in) one or more of the computers or remote from any or all of the computers across the network. In a particular set of embodiments, the information may reside in a storage-area network ("SAN") familiar to those skilled in the art. Similarly, any necessary files for performing the functions attributed to the computers, servers, or other network devices may be stored locally and/or remotely, as appropriate.
• SAN storage-area network
• each such device can include hardware elements that may be electrically coupled via a bus, the elements including, for example, at least one central processing unit (CPU), at least one input device (e.g., a mouse, keyboard, controller, touch screen, or keypad), and at least one output device (e.g., a display device, printer, or speaker).
• CPU central processing unit
• input device e.g., a mouse, keyboard, controller, touch screen, or keypad
• at least one output device e.g., a display device, printer, or speaker
• Such a system may also include one or more storage devices, such as disk drives, optical storage devices, and solid-state storage devices such as random access memory (“RAM”) or read-only memory (“ROM”), as well as removable media devices, memory cards, flash cards, etc.
• ROM read-only memory
• Such devices can include a computer-readable storage media reader, a communications device (e.g., a modem, a network card (wireless or wired), an infrared communication device, etc.), and working memory as described above.
• the computer- readable storage media reader can be connected with, or configured to receive, a computer- readable storage medium, representing remote, local, fixed, and/or removable storage devices as well as storage media for temporarily and/or more permanently containing, storing, transmitting, and retrieving computer-readable information.
• the system and various devices also typically will include a number of software applications, modules, services, or other elements located within at least one working memory device, including an operating system and application programs, such as a client application or Web browser.
• Non-transient storage media and computer readable media for containing code, or portions of code can include any appropriate media known or used in the art, including storage media and communication media, such as but not limited to volatile and non-volatile, removable and non-removable media implemented in any method or technology for storage and/or transmission of information such as computer readable instructions, data structures, program modules, or other data, including RAM, ROM, EEPROM, flash memory or other memory technology, CD-ROM, digital versatile disk (DVD) or other optical storage, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage devices, or any other medium which can be used to store the desired information and which can be accessed by the a system device.
• storage media and communication media such as but not limited to volatile and non-volatile, removable and non-removable media implemented in any method or technology for storage and/or transmission of information such as computer readable instructions, data structures, program modules, or other data, including RAM, ROM, EEPROM, flash memory or other memory technology, CD-ROM, digital versatile disk (DVD
• a computer-readable medium may comprise, but is not limited to, an electronic, optical, magnetic, or other storage device capable of providing a processor with computer- readable instructions.
• Other examples include, but are not limited to, a floppy disk, CD- ROM, DVD, magnetic disk, memory chip, ROM, RAM, SRAM, DRAM, content- addressable memory ("CAM"), DDR, flash memory such as NAND flash or NOR flash, an ASIC, a configured processor, optical storage, magnetic tape or other magnetic storage, or any other medium from which a computer processor can read instructions.
• the computing device may comprise a single type of computer-readable medium such as random access memory (RAM). In other embodiments, the computing device may comprise two or more types of computer-readable medium such as random access memory (RAM), a disk drive, and cache.
• RAM random access memory
• the computing device may be in communication with one or more external computer-readable mediums such as an external hard disk drive or an external DVD or Blu-Ray drive.
• the embodiment comprises a processor which is configured to execute computer-executable program instructions and/or to access information stored in memory.
• the instructions may comprise processor-specific instructions generated by a compiler and/or an interpreter from code written in any suitable computer-programming language including, for example, C, C++, C#, Visual Basic, Java, Python, Perl, JavaScript, and ActionS cript (Adobe Systems, Mountain View, Calif).
• the computing device comprises a single processor.
• the device comprises two or more processors.
• Such processors may comprise a microprocessor, a digital signal processor (DSP), an application-specific integrated circuit (ASIC), field programmable gate arrays (FPGAs), and state machines.
• DSP digital signal processor
• ASIC application-specific integrated circuit
• FPGAs field programmable gate arrays
• Such processors may further comprise programmable electronic devices such as PLCs, programmable interrupt controllers (PICs), programmable logic devices (PLDs), programmable read-only memories (PROMs), electronically programmable read-only memories (EPROMs or EEPROMs), or other similar devices.
• PLCs programmable interrupt controllers
• PLDs programmable logic devices
• PROMs programmable read-only memories
• EPROMs or EEPROMs electronically programmable read-only memories
• the computing device comprises a network interface.
• the network interface is configured for communicating via wired or wireless communication links.
• the network interface may allow for communication over networks via Ethernet, IEEE 802.11 (Wi-Fi), 802.16 (Wi-Max), Bluetooth, infrared, etc.
• network interface may allow for communication over networks such as CDMA, GSM, UMTS, or other cellular communication networks.
• the network interface may allow for point-to-point connections with another device, such as via the Universal Serial Bus (USB), 1394 FireWire, serial or parallel connections, or similar interfaces.
• USB Universal Serial Bus
• suitable computing devices may comprise two or more network interfaces for communication over one or more networks.
• the computing device may include a data store in addition to or in place of a network interface.
• the computing device may be in communication with various user interface devices and a display.
• the display may use any suitable technology including, but not limited to, LCD, LED, CRT, and the like.
• the set of instructions for execution by the computer system may include various commands that instruct the processing machine to perform specific tasks such as the steps that constitute the method of the present technique.
• the set of instructions may be in the form of a software program.
• the software may be in the form of a collection of separate programs, a program module with a larger program or a portion of a program module, as in the present technique.
• the software may also include modular programming in the form of object-oriented programming.
• the processing of input data by the processing machine may be in response to user commands, results of previous processing, or a request made by another processing machine.
• a recombinant bacteriophage comprising an indicator gene inserted into a late gene region of the bacteriophage CBA120 genome.
• a method of preparing a recombinant indicator bacteriophage comprising: selecting a wild-type bacteriophage that specifically infects a target pathogenic bacterium; preparing a homologous recombination plasmid/vector comprising an indicator gene; transforming the homologous recombination plasmid/vector into target pathogenic bacteria; infecting the transformed target pathogenic bacteria with the selected wild-type bacteriophage, thereby allowing homologous recombination to occur between the plasmid/vector and the bacteriophage genome; and isolating a particular clone of recombinant bacteriophage.
• plasmid/vector comprises: determining the natural nucleotide sequence in the late region of the genome of the selected bacteriophage; annotating the genome and identifying the major capsid protein gene of the selected bacteriophage; designing a sequence for homologous recombination downstream of the major capsid protein gene, wherein the sequence comprises a codon-optimized indicator gene; and incorporating the sequence designed for homologous recombination into a plasmid/vector.
• designing a sequence further comprises inserting an untranslated region including a phage late gene promoter and ribosomal entry site upstream of the codon-optimized indicator gene.
• homologous recombination plasmid comprises an untranslated region including a bacteriophage late gene promoter and a ribosomal entry site upstream of the codon-optimized indicator gene.
• kit of paragraph 18 further comprising a substrate for reacting with an indicator to detect the soluble protein product expressed by the recombinant bacteriophage.
• Results depicted in the following examples demonstrate detection of a low number of cells, even a single bacterium, in a shortened time to results.
• Indicator Phage CBA120NanoLuc was created through homologous recombination using the following detailed procedures, as illustrated in Figures 1-3.
• the genomic sequence of the CBA120 bacteriophage was available on the National Center for Biotechnology Information's GenBank, filed under "Escherichia phage Cbal20,” ID 12291.
• the genome was fully annotated, though most of the genes were labeled as "hypothetical protein,” denoting that automated Open Reading Frame discover was used. Hypothetical proteins need only have a start and stop codon, and may not be expressed, as DNA regulation (promoters / enhancers / operators, etc.) are not defined in the sequence.
• the late gene region was determined by comparison with other phage genomes. CBA120, and all other Vil-like phage, fall under the Vil-like phage group (genus Vil virus or Vil virus), which are related to T4-like phages. Bacteriophage T4 being the most studied bacteriophage, many of the genes homologs could be found, and were labeled as such. This includes the late gene region, which consists of the highly expressed phage structural proteins. This region was targeted for insertion of the NANOLUC® reporter gene. The major capsid protein was specifically identified. As the major capsid protein typically has the highest expression, inserting the reporter directly downstream of the major capsid protein can maximize expression of the reporter.
• a sequence was designed to insert a codon-optimized NANOLUC® gene
• a homologous recombination (HR) plasmid was designed, initially with 500 bp upstream and downstream of the insert point.
• Previous HR plasmids using Firefly Luciferase as a reporter gave poor transformation, which was alleviated by using a shorter downstream region. Presumably, there was a toxic effect with the full 500 bp region selected against in the bacteria. As such, the modified downstream region extends only about 300 bp.
• the upstream region consisted of the 3' end of the major capsid protein, with the insert occurring immediately after the stop codon (TAA): SEQ ID NO: 1 ctttcatgctggaagttgaagcgaacggtatcggtgttgacaccc ⁇
• T4 late gene promoter consensus sequence which consists of the -10 ⁇ 70 factor consensus binding sequence (CTAAATAcCcc (SEQ ID NO: 2)).
• CAAATAcCcc SEQ ID NO: 2
• This promoter was designed based on compositing known -10 sequences. 14 random base pairs later, the ribosomal entry site, the Shine-Dalgarno consensus sequence (aaggaggt) was inserted, followed by 6 more random base pairs. The random base pairs were chosen to keep a similar GC content to other upstream untranslated regions.
• SEQ ID NO: 3 acgcgtCTAAATAcCccaaatactagtagataaggaggttttcga
• SEQ ID NO: 6 taaTTTGATAACAAACCCCGCTTCGGCGGGGTTTTTCTTTATAGG
• the full sequence was synthesized into a plasmid (GeneWiz).
• the plasmid was transformed into previously prepared E. coli 0157:H7 electroporation competent cells using the protocol included in the Bio-Rad MicroPulser Electroporation Apparatus Operating Instructions and Applications Guide (catalog # 165-2100).
• Synthesized plasmid DNA pUC57.CBA.HR.NanoLuc ) (4 ⁇ g plasmid DNA
• coli 0157:H7 electroporation competent cells derived from non-toxic E. coli 0157:H7 bacteria, ATCC 43888.
• the cell+DNA mix was transferred to an ice-cold Bio-Rad 0.1 cm electroporation cuvette, and subjected to the MicroPulser Electroporation Apparatus using program Eel .
• the mix was immediately transferred into 1 mL Recovery Medium (Life Technologies), and incubated for 1 hour at 42°C, 220 rpm.
• top 3 wells were mixed and inoculated into 4 mL LB+Amp and grown to 1.8xl0 7 cells/mL.
• Bacteria were infected with wild-type CBA120 bacteriophage from the Kutter lab (see Kutter et al., Virology Journal 2011, 8:430) at an MOI of 0.1, and the homologous recombination infection was incubated for 3 hours @ 37°C.
• Bacterial concentration was monitored for 4 hours; bacteria doubled by 2 hours, then began to drop, indicating a successful phage infection.
• the lysate was washed 3 times with TMS in an Amicon Ultra Concentrator, spun to concentrate the volume from 4 mL to 500 ⁇ ; TMS was added to bring the volume to 4 mL, and this series was repeated.
• limiting dilution assays based on the TCID50 (tissue culture infectious dose 50%) were used to both determine the concentration of infectious units (IU/mL), akin to number of virus particles or plaque forming units, and to determine the number of luciferase transducing units (TU/mL).
• the sample was serially diluted, with each dilution aliquoted into replicate wells with E. coli 0157:H7 bacteria. Any wells that showed luciferase activity must have been infected with at least one recombinant phage. Any wells that showed cell lysis had been infected by at least one phage.
• recombinant phage were isolated from a mixture comprising 0.83% of total phage.
• the phage mixtures were diluted into 96 well plates to give an average of 3 recombinant TU per plate, which corresponds to about 3.8 infectious units (IU) of mostly wild-type phage per well.
• Bacteria were added such that each well contained 50 of turbid E. coli 0157:H7. After 2 hours of incubation at 37°C, wells were sampled and screened for the presence of luciferase.
• any positive wells are likely to have been inoculated with a single recombinant phage, and at this stage the mixture contained an enriched ratio of 1 recombinant phage: 3.8 wild-type phage, which is an enrichment over the original 1 : 120 ratio.
• 7 were positive. Further rounds of limiting dilution assay were not necessary in this experiment.
• plaque assay was performed, wherein plaques were individually picked and screened for luciferase transducing ability, insuring about 3 recombinants were in the mix of plaques being screened. Each plaque was suspended in 100 TMS, and 5 was added to a well containing a turbid E. coli 0157:H7 culture, and wells were assayed after incubation for 45 minutes to 1 hour at 37°C.
• Figure 8 shows the data from 6-10 replicates, each using the same cell numbers from cell cultures in LB. A phage concentration of 10 6 phage/mL was used for infecting the sample, and infected cells were incubated for 2 hours at 37°C. Following the addition of lysis buffer and NANO-GLO® reagent, the reaction was read using a GLOMAX® 96 instrument. Figure 8 shows that CBA120NanoLuc can detect a single (1) cell with a signal that is significantly higher than background.
• Figure 9 shows from the data of Figure 8 that CBA120NanoLuc can detect a single (1) E. coli 0157:H7 cell with a signal to background ratio of >2.0.
• CBA120NanoLuc indicator phage for detecting E. coli 0157:H7 was also certified August 1, 2016 by the AOAC Research Institute (Certificate No. 081601).
• Example 4 Bacterial Detection in Beef Assays Using CBA120NanoLuc
• CBA120NanoLuc was used to detect E. coli 0157:H7 in beef assays.
• 50 RLU was used as the background value, and 3 times background value was considered positive (i.e., >150 RLU is positive, or Signal/Background > 3.0). There were no false positives or negatives when compared to the secondary confirmation method described below.
• pre-warmed TSB medium 42°C was added to the sample to 1:3 sample:medium (25g:75mL).
• the sample was blended with a Stomacher for 30 seconds on low setting/or equivalent, followed by incubation at 42°C without shaking.
• the bag was closed by folding over the top 2-3 times and clipping closed. After 5 hours (for 10 mL aliquots in the next step) or 6 hours (for 1 mL aliquots in the next step) of enrichment at 42°C, the bag was gently massaged to thoroughly mix the contents.
• NANO- GLO® reagent was prepared diluting the NANO-GLO® Luciferase Assay Substrate 1 :50 into NANO-GLO® Luciferase Assay Buffer, e.g., to make 1 mL of NANO-GLO® reagent, and 20 ⁇ , of NANO-GLO® Luciferase Assay Substrate was added to 1 mL of NANO- GLO® Luciferase Assay Buffer.
• the samples were incubated overnight (18-24 hours total or 13-19 additional hours) at 42°C ⁇ 1°. From the overnight culture, 1 mL was removed and the DYNABEADS® anti-E. coli 0157 procedure was followed. Briefly, 20 ⁇ , of IMS particles were added to the diluted overnight culture and incubated for 10 minutes at room temperature. Magnetic particles were isolated for 3 minutes with the magnet, then washed 3 times with PBS, 1 ml per wash. After the final wash, particles were plated onto
• CHROMAGAR® plates (BD #214984) and incubated 18-24 hours at 37°C ⁇ 1°.
• Figures 10-12 Data from 25 g beef samples are shown in Figures 10-12.
• Figures 10-11 correspond to the 1 mL concentration and Figure 12 to the 10 mL concentration of enriched samples. All positives were detected after 6 hours enrichment for the 1 mL concentration and after 5 hours enrichment for the 10 mL concentration.
• Figures 11-12 show confirmation by
• Figures 13-16 Data from 125 g beef samples are shown in Figures 13-16.
• Figures 13 and 15 correspond to the 1 mL concentration and
• Figures 14 and 16 correspond to the 10 mL concentration.
• Figures 15-16 show confirmation by DYN ABE AD S ®/ CHROM AGAR® plating. All positives were detected after 7 hours of enrichment.
• Figure 17 shows data from a spinach wash assay, including confirmatory results from DYN ABE AD S ®/ CHROM AGAR® plating.
• the ability to discern a single target bacterial cell from 10 5 non-target bacteria in vegetable wash is surprising and again demonstrates the specificity and sensitivity of the assay.

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Organic Chemistry (AREA)
• Genetics & Genomics (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Molecular Biology (AREA)
• Immunology (AREA)
• Biotechnology (AREA)
• Biochemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Physics & Mathematics (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Biomedical Technology (AREA)
• Microbiology (AREA)
• Biophysics (AREA)
• Analytical Chemistry (AREA)
• Urology & Nephrology (AREA)
• Virology (AREA)
• Hematology (AREA)
• Cell Biology (AREA)
• Food Science & Technology (AREA)
• Medicinal Chemistry (AREA)
• General Physics & Mathematics (AREA)
• Pathology (AREA)
• Toxicology (AREA)
• Plant Pathology (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Apparatus Associated With Microorganisms And Enzymes (AREA)

Applications Claiming Priority (4)

Publications (1)

Family

ID=59362121

Family Applications (1)

Country Status (8)

Families Citing this family (9)

Family Cites Families (14)

• 2017
  • 2017-01-18 MX MX2018008778A patent/MX2018008778A/es unknown
  • 2017-01-18 CN CN201780007083.9A patent/CN108884498A/zh active Pending
  • 2017-01-18 BR BR112018014166A patent/BR112018014166A2/pt active Search and Examination
  • 2017-01-18 WO PCT/US2017/013955 patent/WO2017127434A1/en active Application Filing
  • 2017-01-18 EP EP17703002.0A patent/EP3405590A1/en active Pending
  • 2017-01-18 JP JP2018536765A patent/JP2019509020A/ja not_active Withdrawn
  • 2017-01-18 CN CN202211045024.XA patent/CN115960844A/zh active Pending
  • 2017-01-18 AU AU2017209041A patent/AU2017209041B2/en active Active
  • 2017-01-18 CA CA3011704A patent/CA3011704A1/en active Pending
• 2021
  • 2021-12-02 JP JP2021196241A patent/JP2022024167A/ja active Pending

Also Published As

Similar Documents

Legal Events