EP2855521A1 - Compositions et procédés associés à la prévention et au traitement d'une infection rabique - Google Patents

Compositions et procédés associés à la prévention et au traitement d'une infection rabique

Info

Publication number
EP2855521A1
EP2855521A1 EP12877555.8A EP12877555A EP2855521A1 EP 2855521 A1 EP2855521 A1 EP 2855521A1 EP 12877555 A EP12877555 A EP 12877555A EP 2855521 A1 EP2855521 A1 EP 2855521A1
Authority
EP
European Patent Office
Prior art keywords
seq
antibody
rabies
antibodies
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP12877555.8A
Other languages
German (de)
English (en)
Other versions
EP2855521A4 (fr
Inventor
Enyun Shen
Shiqi Ren
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Mountgate Innotech Hk Ltd
Original Assignee
MOUNTGATE GROUP Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by MOUNTGATE GROUP Ltd filed Critical MOUNTGATE GROUP Ltd
Priority to EP19156037.4A priority Critical patent/EP3508497A1/fr
Publication of EP2855521A1 publication Critical patent/EP2855521A1/fr
Publication of EP2855521A4 publication Critical patent/EP2855521A4/fr
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08—RNA viruses
    • G01N2333/145—Rhabdoviridae, e.g. rabies virus, Duvenhage virus, Mokola virus or vesicular stomatitis virus
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2469/00—Immunoassays for the detection of microorganisms
    • G01N2469/10—Detection of antigens from microorganism in sample from host

Definitions

  • Rabies is a viral infection with nearly worldwide distribution that affects principally wild and domestic animals, but also affects humans. The infection causes a devastating and, if untreated, nearly invariably fatal encephalitis. More than 70,000 people die each year from rabies infections, and millions more require post-exposure treatment.
  • FIGs. 4A-4J are a series of graphs showing the percent survival of mice challenged with a variety of rabies viruses in a mouse neutralization test (MNT).
  • FIG. 4A YNI (human);
  • FIG. 4B DRV (deer);
  • FIG. 4C HN35 (Human);
  • FIG. 4D SC-CD09 (dog);
  • FIG. 4E GN07 (dog);
  • FIG. 4F ZJ-HZ09 (dog);
  • FIG. 4G BD06 (dog);
  • FIG. 4H JX08-45 (badger);
  • FIG. 4J ZJ-LA (badger).
  • FIG. 8 is a schematic representation of the expression vector pCHl A9.
  • FIG. 19 is a series of graphs showing serum RVNA titers in nonchallenged BALB/c mice.
  • FIG. 20 is a graph showing a comparison between an RVNA cocktail and HRIG with vaccine in Syrian hamsters.
  • amino acid includes naturally-occurring amino acids and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally-occurring amino acids.
  • Naturally-occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, ⁇ -carboxyglutamate, and O-phosphoserine.
  • Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally-occurring amino acid, i.e., an a-carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium.
  • Such analogs have modified R groups ⁇ e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally-occurring amino acid.
  • Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally- occurring amino acid.
  • Amino acids can be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, can be referred to by their commonly accepted single-letter codes.
  • Examples include: (i) a Fab fragment, a monovalent fragment consisting of the V L , V H , C L and CHi domains; (ii) a F(ab') 2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the V H and CHi domains; (iv) a Fv fragment consisting of the V L and V H domains of a single arm of an antibody, (v) a dAb fragment (Ward et al, Nature 341 : 544-546, 1989), which consists of a V H domain; and (vi) an isolated complementarity determining region (CDR).
  • a Fab fragment a monovalent fragment consisting of the V L , V H , C L and CHi domains
  • a F(ab') 2 fragment a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region
  • chimeric antibody means an antibody in which the Fc constant region of a monoclonal antibody from one species ⁇ e.g., a mouse Fc constant region) is replaced, using recombinant DNA techniques, with an Fc constant region from an antibody of another species ⁇ e.g., a human Fc constant region).
  • epitope means a protein determinant capable of specific binding to an antibody. Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three
  • an "epitope" of the rabies virus glycoprotein is a region of the protein to which the anti-rabies antibodies of the present technology specifically bind.
  • the term "effective amount” or “pharmaceutically effective amount” or “therapeutically effective amount” of a composition is a quantity sufficient to achieve a desired therapeutic and/or prophylactic effect, e.g., an amount which results in the prevention of, or a decrease in, the symptoms associated with a disease that is being treated, e.g., rabies infection.
  • the amount of a composition of the present technology administered to the subject will depend on the type and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. It will also depend on the degree, severity and type of disease. The skilled artisan will be able to determine appropriate dosages depending on these and other factors.
  • an effective amount refers to the quantity of anti-rabies antibody of the present technology which is partially or fully effective in neutralizing rabies virus.
  • the term "rabies” refers to viruses of the Lyssavirus genus, in the family Rhabdoviridae, order Mononegavirales. Lyssaviruses have helical symmetry, with a length of about 180 nm and a cross-sectional diameter of about 75 nm. These viruses are enveloped and have a single stranded RNA genome with negative- sense. The genetic information is packaged as a ribonucleoprotein complex in which RNA is tightly bound by the viral nucleoprotein. The RNA genome of the virus encodes five genes whose order is highly conserved: nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G) and the viral RNA polymerase (L).
  • N nucleoprotein
  • P phosphoprotein
  • M matrix protein
  • G glycoprotein
  • L viral RNA polymerase
  • non-human (e.g., murine) antibodies are chimeric antibodies which contain minimal sequence derived from non-human
  • humanized antibodies are human immunoglobulins in which hypervariable region residues of the recipient are replaced by hypervariable region residues from a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity.
  • donor antibody such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity.
  • FR residues of the human immunoglobulin are replaced by
  • humanized antibodies may comprise residues which are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance such as binding affinity.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence although the FR regions may include one or more amino acid substitutions that improve binding affinity.
  • the number of these amino acid substitutions in the FR are typically no more than 6 in the H chain, and in the L chain, no more than 3.
  • the humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human
  • residues from a "hypervariable loop” e.g., residues 26- 32 (LI), 50-52 (L2) and 91-96 (L3) in the V L , and 26-32 (HI), 52A-55 (H2) and 96-101 (H3) in the V H (Chothia and Lesk J. Mol. Biol. 196:901-917 (1987)).
  • nucleic acids or polypeptide sequences refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region (e.g., nucleotide sequence encoding an antibody described herein or amino acid sequence of an antibody described herein), when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual see, e.g., NCBI web site). Such sequences are then said to be
  • an "isolated” or “purified” polypeptide or biologically-active portion thereof is substantially free of cellular material or other contaminating polypeptides from the cell or tissue source from which the polypeptide is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized.
  • an isolated anti- rabies antibody would be free of materials that would interfere with diagnostic or therapeutic uses of the agent.
  • Such interfering materials may include enzymes, hormones and other proteinaceous and nonproteinaceous solutes.
  • an isolated rabies glycoprotein which is immunoreactive with an anti-rabies antibody of the present technology, would be substantially free of materials that would interfere with diagnostic or therapeutic uses of the polypeptide.
  • the terms "immunologically cross-reactive” and “immunologically- reactive” are used interchangeably to mean an antigen which is specifically reactive with an antibody which was generated using the same (“immunologically-reactive") or different (“immunologically cross-reactive") antigen.
  • the antigen is a rabies glycoprotein, a variant or subsequence thereof.
  • immunologically-reactive conditions means conditions which allow an antibody, generated to a particular epitope of an antigen, to bind to that epitope to a detectably greater degree than the antibody binds to substantially all other epitopes, generally at least two times above background binding, or at least five times above background. Immunologically-reactive conditions are dependent upon the format of the antibody binding reaction and typically are those utilized in immunoassay protocols. See Harlow & Lane, Antibodies, A Laboratory Manual (Cold Spring Harbor Publications, New York, 1988) for a description of immunoassay formats and conditions.
  • the term "medical condition” includes, but is not limited to, e.g, any condition or disease manifested as one or more physical and/or psychological symptoms for which treatment and/or prevention is desirable, and includes previously and newly identified diseases and other disorders.
  • a medical condition may be a rabies infection.
  • the term "monoclonal antibody” as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts.
  • a monoclonal antibody can be an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.
  • a monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
  • Monoclonal antibodies are highly specific, being directed against a single antigenic site.
  • each monoclonal antibody is directed against a single determinant on the antigen.
  • the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
  • Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including, e.g., but not limited to, hybridoma, recombinant, and phage display technologies.
  • the monoclonal antibodies to be used in accordance with the present methods may be made by the hybridoma method first described by Kohler et al, Nature 256:495 (1975), or may be made by recombinant DNA methods ⁇ See, e.g., U.S. Patent No. 4,816,567).
  • the "monoclonal antibodies” may also be isolated from phage antibody libraries using the techniques described in Clackson et ah, Nature 352:624-628 (1991) and Marks et al, J. Moh Biol. 222:581-597 (1991), for example.
  • polyclonal antibody means a preparation of antibodies derived from at least two (2) different antibody-producing cell lines. The use of this term includes preparations of at least two (2) antibodies that contain antibodies that specifically bind to different epitopes or regions of an antigen.
  • polypeptide As used herein, the terms “polypeptide”, “peptide” and “protein” are used interchangeably herein to mean a polymer comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres.
  • Polypeptide refers to both short chains, commonly referred to as peptides, glycopeptides or oligomers, and to longer chains, generally referred to as proteins.
  • Polypeptides may contain amino acids other than the 20 gene-encoded amino acids.
  • Polypeptides include amino acid sequences modified either by natural processes, such as post-translational processing, or by chemical modification techniques that are well-known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature.
  • the polypeptide contains polypeptide sequences from a rabies antibody protein.
  • post exposure prophylaxis refers to a treatment regime that is indicated for persons possibly exposed to a rabid animal. Possible exposures include bite exposure (i.e., any penetration of the skin by teeth) including animal bites, and non-bite exposure. PEP typically comprises the administration of anti-rabies antibodies in conjunction with a rabies vaccine, such as purified chick embryo cell (PCEC) vaccine (Rab Avert ® , Novartis, Basel, Switzerland; Rabipur ® , Chiron Behring GmbH & Co., Liederbach,
  • PCEC purified chick embryo cell
  • HRIG human rabies immune globulin
  • HRIG is an immunizing agent typically administered to an individual following exposure to rabies virus.
  • the term "recombinant" when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the material is derived from a cell so modified.
  • recombinant cells express genes that are not found within the native (non- recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.
  • specific binding means the contact between an anti- rabies antibody and an antigen with a binding affinity of at least 10 "6 M.
  • substitution is one of mutations that is generally used in the art. Those substitution variants have at least one amino acid residue in the anti-rabies antibody molecule replaced by a different residue. The sites of greatest interest for
  • substitutional mutagenesis include the hypervariable regions, but FR alterations are also contemplated. Substitutions may be conservative, that is, one amino acid is replaced with one of similar shape and charge. Conservative substitutions are well-known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyros
  • substitutions may be non-conservative such that a function or activity of the polypeptide is affected.
  • Non-conservative changes typically involve substituting a residue with one that is chemically dissimilar, such as a polar or charged amino acid for a nonpolar or uncharged amino acid, and vice versa.
  • the present disclosure generally provides anti-rabies antibodies, which can bind to rabies glycoprotein and neutralize the infectivity of a rabies virus.
  • the antibodies are useful for treating or preventing rabies infecting human and non- human subjects exposed to rabies virus. Accordingly, the various aspects of the present methods relate to the preparation, characterization, and manipulation of anti-rabies antibodies.
  • Antibodies of the present technology are useful alone or in combination with rabies therapies known in the art for treating or preventing rabies infection.
  • the present disclosure further relates to methods for administering anti-rabies antibodies of the present technology to a subject in need thereof.
  • the present disclosure encompasses anti-rabies antibodies that bind to rabies virus glycoprotein.
  • the antibodies comprise the antibodies summarized in Table 1.
  • the present technology includes antibodies that specifically bind epitopes which are conformational epitopes as well as nonconformational or linear epitopes. As noted above, conformational epitopes or nonconformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents.
  • Anti-rabies antibodies within the scope of the present technology include, e.g., but are not limited to, monoclonal, polyclonal, chimeric, humanized, diabody, and human monoclonal and human polyclonal antibodies which specifically bind the rabies glycoprotein, a homolog, derivative or a fragment thereof.
  • Antibodies useful for the methods disclosed herein include, e.g., but are not limited to, IgG (including IgGi, IgG 2 , IgG 3 , and IgG 4 ), IgA (including IgAi and IgA 2 ), IgD, IgE, or IgM, and IgY.
  • the anti-rabies antibodies of the present technology bind specifically to rabies glycoprotein.
  • the antibodies are capable to reducing the infectivity of rabies virus and do not reduce the immunogenicity of a rabies vaccine.
  • the antibodies are monoclonal antibodies, murine antibodies, chimeric antibodies, or humanized antibodies.
  • antibodies of the present technology comprise one or more heavy chain CDR amino acid sequences selected from the group consisting of DYIML (SEQ ID NO:57), DIYPYYGSTSYNLKFKG (SEQ ID NO:58), QGGDGNYVLFDY (SEQ ID NO:59), GFAMS (SEQ ID NO:60), TISSGGTYTYSPDSVMG (SEQ ID NO:61),
  • antibodies of the present technology comprise one or more light chain CDR amino acid sequences selected from the group consisting of KASQNVGTTVA (SEQ ID NO:63), SASYRYS (SEQ ID NO:64),
  • QQYNSYPFT (SEQ ID NO:65), KSTKSLLNSDGFTYLD (SEQ ID NO:66), LVSNRFS (SEQ ID NO:67), FQSNYLPFT (SEQ ID NO:68), or a variant thereof having one or more conservative amino acid substitutions.
  • the present technology comprises a nucleic acid encoding a rabies virus neutralizing antibody or fragment thereof. In some embodiments, the technology encompasses a host cell or nucleic acid encompassing the isolated nucleic acid encoding the antibody.
  • the present technology further includes antibodies which are anti-idiotypic to the antibodies of the present technology.
  • the antibodies of the present technology can be monospecific, bispecific, trispecific or of greater multispecificity. Multispecific antibodies can be specific for different epitopes of the rabies glycoprotein or can be specific for both the rabies glycoprotein as well as for heterologous compositions, such as a heterologous polypeptide or solid support material. See, e.g., WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt et al, J. Immunol. 147: 60-69 (1991); U.S. Pat. Nos. 5,573,920,
  • the antibodies can be from any animal origin including birds and mammals.
  • the antibodies are human, murine, rabbit, goat, guinea pig, camel, horse, or chicken.
  • the antibodies are chimeric.
  • the antibodies are humanized.
  • the antibodies of the present technology can be used either alone or in combination with other compositions.
  • the rabies virus neutralizing antibodies can be used in combination with one or more anti-rabies therapies known in the art, such as those discussed above.
  • Antibodies of the present technology may be administered to subject in need thereof prior to, subsequent to, or simultaneous to the administration of one or more additional rabies therapies, such as a rabies vaccine are included.
  • the antibodies of the present technology can further be recombinantly fused to a heterologous polypeptide at the N- or C-terminus or chemically conjugated (including covalently and non-covalently conjugations) to polypeptides or other compositions.
  • the antibodies can be recombinantly fused or conjugated to molecules useful as labels in detection assays and effector molecules such as heterologous polypeptides, drugs, or toxins. See, e.g., WO 92/08495; WO 91/14438; WO 89/12624; U.S. Pat. No. 5,314,995; and EP 0 396 387.
  • Anti-rabies antibodies specific for rabies virus glycoprotein is illustrated in Example 1, infra. It should be understood that not only are naturally-occurring antibodies suitable for use in accordance with the present disclosure, recombinantly engineered antibodies and antibody fragments, e.g., antibody-related polypeptides, which are directed to rabies glycoprotein and fragments thereof are also suitable.
  • Anti-rabies antibodies that can be subjected to the techniques set forth herein include monoclonal and polyclonal antibodies, and antibody fragments such as Fab, Fab', F(ab') 2 , Fd, scFv, diabodies, antibody light chains, antibody heavy chains and/or antibody fragments. Methods useful for the high yield production of antibody Fv-containing polypeptides, e.g., Fab' and F(ab') 2 antibody fragments have been described. See U.S. Pat. No. 5,648,237.
  • the antibody is an anti-rabies monoclonal antibody.
  • the anti-rabies monoclonal antibody may be a human or a mouse anti-rabies monoclonal antibody.
  • any technique that provides for the production of antibody molecules by continuous cell line culture can be utilized. Such techniques include, but are not limited to, the hybridoma technique ⁇ See, e.g., Kohler & Milstein, 1975.
  • MONOCLONAL ANTIBODIES AND CANCER THERAPY Alan R. Liss, Inc., pp. 77-96.
  • Human monoclonal antibodies can be utilized in the practice of the present technology and can be produced by using human hybridomas ⁇ See, e.g., Cote, et al, 1983. Proc. Natl. Acad. Sci. USA 80: 2026-2030) or by transforming human B-cells with Epstein Barr Virus in vitro ⁇ See, e.g., Cole, et al, 1985.
  • MONOCLONAL ANTIBODIES AND CANCER THERAPY
  • a population of nucleic acids that encode regions of antibodies can be isolated. PCR utilizing primers derived from sequences encoding conserved regions of antibodies is used to amplify sequences encoding portions of antibodies from the population and then reconstruct DNAs encoding antibodies or fragments thereof, such as variable domains, from the amplified sequences. Such amplified sequences also can be fused to DNAs encoding other proteins - e.g., a bacteriophage coat, or a bacterial cell surface protein - for expression and display of the fusion polypeptides on phage or bacteria.
  • proteins e.g., a bacteriophage coat, or a bacterial cell surface protein - for expression and display of the fusion polypeptides on phage or bacteria.
  • Amplified sequences can then be expressed and further selected or isolated based, e.g., on the affinity of the expressed antibody or fragment thereof for an antigen or epitope present on the rabies glycoprotein.
  • hybridomas expressing anti-rabies monoclonal antibodies can be prepared by immunizing a subject and then isolating
  • hybridomas from the subject's spleen using routine methods. See, e.g., Milstein et al, (Galfre and Milstein, Methods Enzymol (1981) 73 : 3-46). Screening the hybridomas using standard methods will produce monoclonal antibodies of varying specificity ⁇ i.e., for different epitopes) and affinity. A selected monoclonal antibody with the desired properties, e.g., rabies binding, can be used as expressed by the hybridoma, it can be bound to a molecule such as
  • polyethylene glycol to alter its properties, or a cDNA encoding it can be isolated, sequenced and manipulated in various ways.
  • Synthetic dendromeric trees can be added a reactive amino acid side chains, e.g., lysine to enhance the immunogenic properties of the rabies glycoprotein.
  • CPG-dinucleotide technique can be used to enhance the
  • the antibody of the present technology is an anti-rabies monoclonal antibody produced by a hybridoma which includes a B cell obtained from a transgenic non-human animal, e.g., a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene fused to an immortalized cell.
  • a hybridoma which includes a B cell obtained from a transgenic non-human animal, e.g., a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene fused to an immortalized cell.
  • Hybridoma techniques include those known in the art and taught in Harlow et al, Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 349 (1988); Hammerling et al, Monoclonal Antibodies And T-Cell Hybridomas, 563-681 (1981). Other methods for producing hybridomas and monoclonal antibodies are well-known to those of skill in the art.
  • the antibodies of the present technology can be produced through the application of recombinant DNA and phage display technology.
  • anti-rabies antibodies can be prepared using various phage display methods known in the art.
  • phage display methods functional antibody domains are displayed on the surface of a phage particle which carries polynucleotide sequences encoding them.
  • Phage with a desired binding property are selected from a repertoire or combinatorial antibody library (e.g., human or murine) by selecting directly with antigen, typically antigen bound or captured to a solid surface or bead.
  • Phage used in these methods are typically filamentous phage including fd and Ml 3 with Fab, Fv or disulfide stabilized Fv antibody domains are recombinantly fused to either the phage gene III or gene VIII protein.
  • methods can be adapted for the construction of Fab expression libraries ⁇ See, e.g., Huse, et al.,. Science 246: 1275-1281, 1989) to allow rapid and effective identification of monoclonal Fab fragments with the desired specificity for a rabies virus polypeptide, e.g., a polypeptide or derivatives, fragments, analogs or homologs thereof.
  • Other examples of phage display methods that can be used to make the antibodies of the present technology include those known in the art.
  • Fab, Fab' and F(ab') 2 fragments can also be employed using methods known in the art such as those disclosed in WO 92/22324; Mullinax et al, BioTechniques 12: 864-869, 1992; and Sawai et al., AJRI 34: 26-34, 1995; and Better et al, Science 240: 1041-1043, 1988.
  • hybrid antibodies or hybrid antibody fragments that are cloned into a display vector can be selected against the appropriate antigen in order to identify variants that maintained good binding activity, because the antibody or antibody fragment will be present on the surface of the phage or phagemid particle.
  • a display vector can be selected against the appropriate antigen in order to identify variants that maintained good binding activity, because the antibody or antibody fragment will be present on the surface of the phage or phagemid particle.
  • Other vector formats could be used for this process, such as cloning the antibody fragment library into a lytic phage vector (modified T7 or Lambda Zap systems) for selection and/or screening.
  • another aspect of the technology includes vectors containing one or more nucleic acid sequences encoding an anti-rabies antibody of the present technology.
  • the nucleic acid containing all or a portion of the nucleotide sequence encoding the anti-rabies antibody is inserted into an appropriate cloning vector, or an expression vector (i.e., a vector that contains the necessary elements for the transcription and translation of the inserted polypeptide coding sequence) by recombinant DNA techniques well-known in the art and as detailed below. Methods for producing diverse populations of vectors have been described by Lerner et al, U.S. Pat. No. 6,291, 160; 6,680, 192.
  • expression vectors useful in recombinant DNA techniques are often in the form of plasmids.
  • plasmid and “vector” can be used interchangeably as the plasmid is the most commonly used form of vector.
  • the present technology is intended to include such other forms of expression vectors that are not technically plasmids, such as viral vectors ⁇ e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
  • viral vectors permit infection of a subject and expression in that subject of a compound.
  • the expression control sequences are eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells.
  • the label can be coupled directly or indirectly to the desired component of an assay according to methods well-known in the art. As indicated above, a wide variety of labels can be used, with the choice of label depending on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions.
  • Anti-rabies antibodies may be evaluated for post-exposure prophylaxis in subjects exposed to rabies virus using methods known in the art such as those demonstrated in the Examples, infra. Briefly, animal subjects exposed to rabies virus may be administered one or more candidate anti-rabies antibodies as a component of post-exposure treatment. The antibody may be administered alone or in conjunction with known rabies therapies such as a vaccine. After a period of time sufficient for rabies infection to ensue, the survival rate of subjects administered the antibody is compared to appropriate controls, in which no candidate antibodies were administered.
  • Reduction in rabies virus infectivity is reflected by an increased rate or length of time of survival of subjects administered the candidate antibody as compared to controls. Illustrative results of such experiments are shown in the Examples, infra.
  • Anti-rabies antibodies can be used to detect an immunoreactive rabies or an immunoreactive rabies-like glycoprotein in a variety of standard assay formats. Such formats include immunoprecipitation, Western blotting, ELISA, radioimmunoassay, and
  • Bio samples can be obtained from any tissue or body fluid of a subject.
  • the anti-rabies antibodies of the present technology are useful in post-exposure prophylaxis (PEP) therapy for subjects exposed to rabies virus.
  • PEP post-exposure prophylaxis
  • Possible exposures include bite exposure ⁇ i.e., any penetration of the skin by teeth) including animal bites, and non-bite exposure.
  • Non-bite exposure includes contact with infected animals or animal products, such as but not limited to hair, e.g., blood, tissue, urine, feces, and saliva.
  • PEP therapy typically comprises the administration of anti-rabies antibodies to a subject in need thereof in combination with a rabies vaccine.
  • compositions of the present technology may be employed in conjunction with other molecules useful in prophylaxis and/or treatment of rabies exposure or infection. For example, they may be co-administered with one or more vaccines against rabies virus.
  • the antibodies of the present technology may be administered before or after the one or more vaccines.
  • the antibodies may be administered in conjunction with rabies vaccines, including but not limited to, e.g., purified chick embryo cell vaccine (PCECV; RabAvert ® , Novartis, Basel, Switzerland; Rabipur ® , Chiron Behring GmbH & Co.,
  • compositions of the present technology may further be administered in conjunction with human rabies immune globulin (HRIG) or equine rabies immune globulin (ERIG).
  • HRIG human rabies immune globulin
  • ERIG equine rabies immune globulin
  • compositions of the present technology may optionally be administered as a single bolus to a subject in need thereof.
  • the dosing regimen may comprise multiple administrations performed at various times post-exposure.
  • the dosing regimen may comprise five doses of rabies vaccine intramuscularly and/or intraperitoneally on days 0, 3, 7, 14 and 28 after exposure.
  • the site of administration may vary relative to the site of rabies exposure.
  • compositions of the present technology may be administered into and around the wounds on day 0 or otherwise as soon as possible after exposure, with the remaining volume given intramuscularly at a site distant from the site.
  • all of the composition may be administered at a site distant to the site of exposure.
  • Compositions of the present technology may be administered at the same site or a different site as administration of a rabies vaccine.
  • antibodies of the present technology comprise pharmaceutical formulations which may be administered to subjects in need thereof in one or more doses. Dosage regimens can be adjusted to provide the desired response (e.g., a therapeutic response or a prophylactic response).
  • a single dosage of antibody range from 0.1-10,000 micrograms per kg body weight. In one embodiment, antibody concentrations in a carrier range from 0.2 to 2000 micrograms per delivered milliliter.
  • An exemplary treatment regime entails administration once per every two weeks or once a month or once every 3 to 6 months. Anti- rabies antibodies may be administered on multiple occasions. Intervals between single dosages can be hourly, daily, weekly, monthly or yearly. Intervals can also be irregular as indicated by measuring blood levels of antibody in the subject.
  • dosage is adjusted to achieve a serum antibody concentration in the subject of from about 75 ⁇ g/mL to about 125 ⁇ g/mL, 100 ⁇ g/mL to about 150 ⁇ g/mL, from about 125 ⁇ g/mL to about 175 ⁇ g/mL, or from about 150 ⁇ g/mL to about 200 ⁇ g/mL.
  • anti-rabies antibodies can be administered as a sustained release formulation, in which case less frequent administration is required. Dosage and frequency vary depending on the half-life of the antibody in the subject. The dosage and frequency of administration can vary depending on whether the treatment is prophylactic or therapeutic. In prophylactic applications, a relatively low dosage is administered at relatively infrequent intervals over a long period of time.
  • Toxicity In therapeutic applications, a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, or until the subject shows partial or complete amelioration of symptoms of disease. Thereafter, the patent can be administered a prophylactic regime.
  • an effective amount ⁇ e.g., dose) of anti-rabies antibody described herein will provide therapeutic benefit without causing substantial toxicity to the subject.
  • Toxicity of the anti-rabies antibody described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., by determining the LD 50 (the dose lethal to 50% of the population) or the LD 100 (the dose lethal to 100% of the population). The dose ratio between toxic and therapeutic effect is the therapeutic index.
  • the data obtained from these cell culture assays and animal studies can be used in formulating a dosage range that is not toxic for use in human.
  • the dosage of the anti-rabies antibody described herein lies within a range of circulating concentrations that include the effective dose with little or no toxicity.
  • the dosage can vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the subject's condition. See, e.g., Fingl et al, In: The Pharmacological Basis of Therapeutics, Ch. 1 (1975).
  • the anti-rabies antibody can be incorporated into pharmaceutical compositions suitable for administration.
  • the pharmaceutical compositions generally comprise recombinant or substantially purified native antibody and a pharmaceutically- acceptable carrier in a form suitable for administration to a subject.
  • Pharmaceutically- acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions for administering the antibody compositions ⁇ See, e.g., Remington 's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA 18 th ed., 1990).
  • the pharmaceutical compositions are generally formulated as sterile, substantially isotonic and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration.
  • GMP Good Manufacturing Practice
  • compositions, carriers, diluents and reagents are used interchangeably and represent that the materials are capable of administration to or upon a subject without the production of undesirable physiological effects to a degree that would prohibit administration of the composition.
  • pharmaceutically-acceptable excipient means an excipient that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and desirable, and includes excipients that are acceptable for veterinary use as well as for human pharmaceutical use. Such excipients can be solid, liquid, semisolid, or, in the case of an aerosol composition, gaseous.
  • “Pharmaceutically-acceptable salts and esters” means salts and esters that are pharmaceutically-acceptable and have the desired pharmacological properties. Such salts include salts that can be formed where acidic protons present in the composition are capable of reacting with inorganic or organic bases. Suitable inorganic salts include those formed with the alkali metals, e.g., sodium and potassium, magnesium, calcium, and aluminum. Suitable organic salts include those formed with organic bases such as the amine bases, e.g., ethanolamine, diethanolamine,
  • Such salts also include acid addition salts formed with inorganic acids (e.g., hydrochloric and hydrobromic acids) and organic acids (e.g., acetic acid, citric acid, maleic acid, and the alkane- and arene-sulfonic acids such as methanesulfonic acid and benzenesulfonic acid).
  • inorganic acids e.g., hydrochloric and hydrobromic acids
  • organic acids e.g., acetic acid, citric acid, maleic acid, and the alkane- and arene-sulfonic acids such as methanesulfonic acid and benzenesulfonic acid.
  • Pharmaceutically-acceptable esters include esters formed from carboxy, sulfonyloxy, and phosphonoxy groups present in the anti-rabies antibody, e.g., C 1-6 alkyl esters.
  • a pharmaceutically-acceptable salt or ester can be a mono-acid-mono-salt or ester or a di-salt or ester; and similarly where there are more than two acidic groups present, some or all of such groups can be salified or esterified.
  • the anti-rabies antibody named in this technology can be present in unsalified or unesterified form, or in salified and/or esterified form, and the naming of such anti-rabies antibody is intended to include both the original (unsalified and unesterified) compound and its pharmaceutically-acceptable salts and esters.
  • the anti-rabies antibody compositions of the present technology can be administered by parenteral, topical, intravenous, oral, subcutaneous, intraarterial, intradermal, transdermal, rectal, intracranial, intrathecal, intraperitoneal, intranasal; or intramuscular routes, or as inhalants.
  • the anti-rabies antibody can optionally be administered in combination with other agents that are at least partly effective in treating various diseases including various actin- or microfilament-related diseases.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial compounds such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating compounds such as
  • compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
  • the composition must be sterile and should be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, e.g., water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, e.g., by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal compounds, e.g., parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
  • isotonic compounds e.g., sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition a compound which delays absorption, e.g., aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the anti-rabies antibody in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the anti-rabies antibody into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • methods of preparation are vacuum drying and freeze-drying that yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • the antibodies of the present technology can be administered in the form of a depot injection or implant preparation which can be formulated in such a manner as to permit a sustained or pulsatile release of the active ingredient.
  • Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the anti-rabies antibody can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating compound such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening compound such as sucrose or saccharin; or a flavoring compound such as peppermint, methyl salicylate, or orange flavoring.
  • a binder such as microcrystalline cellulose, gum tragacanth or gelatin
  • an excipient such as starch or lactose, a disintegrating compound such as alginic acid, Primogel, or corn starch
  • a lubricant such as magnesium stearate or Sterotes
  • a glidant such as colloidal silicon dioxide
  • the anti-rabies antibody is delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
  • a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, e.g., for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
  • the anti-rabies antibody is formulated into ointments, salves, gels, or creams as generally known in the art.
  • the anti-rabies antibody can also be prepared as pharmaceutical compositions in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
  • suppositories e.g., with conventional suppository bases such as cocoa butter and other glycerides
  • retention enemas for rectal delivery.
  • the anti-rabies antibody is prepared with carriers that will protect the anti-rabies antibody against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions can also be used as pharmaceutically-acceptable carriers. These can be prepared according to methods known to those skilled in the art, e.g., as described in U.S. Pat. No. 4,522,811.
  • kits for the diagnosis, prophylaxis, and/or treatment of rabies infection comprising at least one antibody of the present technology, or a functional variant thereof.
  • the above described components of the kits of the present technology are packed in suitable containers and labeled for diagnosis, prophylaxis, and/or treatment rabies.
  • the above-mentioned components may be stored in unit or multi- dose containers, for example, sealed ampoules, vials, bottles, syringes, and test tubes, as an aqueous, preferably sterile, solution or as a lyophilized, preferably sterile, formulation for reconstitution.
  • the kit may further comprise a second container which holds a diluent suitable for diluting the pharmaceutical composition towards a higher volume. Suitable diluents include, but are not limited to, the pharmaceutically acceptable excipient of the pharmaceutical composition and a saline solution. Furthermore, the kit may comprise instructions for diluting the pharmaceutical composition and/or instructions for administering the pharmaceutical composition, whether diluted or not.
  • the containers may be formed from a variety of materials such as glass or plastic and may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper which may be pierced by a hypodermic injection needle).
  • the kit may further comprise more containers comprising a pharmaceutically acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, culture medium for one or more of the suitable hosts.
  • the kits may optionally include instructions customarily included in commercial packages of therapeutic, prophylactic or diagnostic products, that contain information about, for example, the indications, usage, dosage, manufacture, administration, contraindications and/or warnings concerning the use of such therapeutic, prophylactic or diagnostic products.
  • kits are useful for detecting the presence of an immunoreactive rabies glycoprotein or an immunoreactive rabies-like glycoprotein in a biological sample, e.g., any body fluid including, but not limited to, e.g., serum, plasma, lymph, cystic fluid, urine, stool, cerebrospinal fluid, ascitic fluid or blood and including biopsy samples of body tissue.
  • a biological sample e.g., any body fluid including, but not limited to, e.g., serum, plasma, lymph, cystic fluid, urine, stool, cerebrospinal fluid, ascitic fluid or blood and including biopsy samples of body tissue.
  • the kit can comprise: one or more anti-rabies antibodies capable of binding a rabies glycoprotein or a rabies-like glycoprotein in a biological sample (e.g., an antibody or antigen- binding fragment thereof having the same antigen-binding specificity of antibodies produced by a deposited cell line selected from the group consisting of: CGMCC Accession Nos: 4805 and 4806); means for determining the amount of the rabies glycoprotein or rabies-like glycoprotein in the sample; and means for comparing the amount of the immunoreactive rabies glycoprotein or the immunoreactive rabies-like glycoprotein in the sample with a standard.
  • One or more of the anti-rabies antibodies may be labeled.
  • the kit components, e.g., reagents
  • the kit can further comprise instructions for using the kit to detect the immunoreactive rabies glycoprotein or the rabies-like glycoprotein.
  • the kit can comprise, e.g., 1) a first antibody, e.g., attached to a solid support, which binds to a rabies glycoprotein corresponding to the present technology; and, optionally; 2) a second, different antibody which binds to either the rabies glycoprotein or to the first antibody and is conjugated to a detectable label.
  • the kit can also comprise, e.g., a buffering agent, a preservative or a protein- stabilizing agent.
  • the kit can further comprise components necessary for detecting the detectable-label, e.g., an enzyme or a substrate.
  • the kit can also contain a control sample or a series of control samples, which can be assayed and compared to the test sample.
  • Each component of the kit can be enclosed within an individual container and all of the various containers can be within a single package, along with instructions for interpreting the results of the assays performed using the kit.
  • the kits of the present technology may contain a written product on or in the kit container.
  • the written product describes how to use the reagents contained in the kit, e.g., for detection of a rabies virus glycoprotein in vitro or in vivo, or for treatment or prevention of rabies infection in an individual in need thereof.
  • the use of the reagents can be according to the methods of the present technology.
  • Example 1 describes the preparation of murine monoclonal antibodies.
  • Examples 2-7 demonstrate the specificity of the illustrative antibodies for rabies virus glycoprotein, the capacity of the antibodies to neutralize rabies virus, competition among the antibodies for binding to rabies virus glycoprotein, the degree to which the antibodies effect the immunogenicity of a rabies vaccine, and the capacity of a combination of the antibodies to neutralize rabies virus.
  • Examples 8-15 demonstrate the production of chimeric and humanized versions of two of the illustrative antibodies, and characterization of their binding specificities, capacities to neutralize rabies virus, and use in post-exposure protection against rabies virus infection.
  • Example 1 Preparation and Characterization of Murine Rabies Virus Neutralizing Antibodies
  • the murine rabies virus neutralizing antibodies may be obtained by culturing a hybridoma which, in turn, may be obtained by immunizing a mouse with rabies glycoprotein and subsequently fusing the spleen cells or lymph node cells from the mouse with mouse myeloma cells.
  • the procedure for the preparation of the anti-rabies antibodies is detailed below with reference to the above described steps. This method for preparing an antibody of the present invention is intended only to be illustrative of the methods of preparation and is not limited thereto. Other known procedures may be followed.
  • the present technology utilizes a rabies girus glycoprotein (GenBank Accession No. ABY1950) as an immunogen to induce an antibody capable of neutralizing rabies virus.
  • the immunogen prepared is mixed with an adjuvant, such as Freund's complete or incomplete adjuvant and administerd to a mouse.
  • Suitable administration routes to immunize an experimental animal include the subcutaneous, intraperitoneal, intravenous, intradermal, and intramuscular injections, with subcutaneous and intraperitoneal injections being preferred. Immunizations are optionally performed by a single dose or, by several repeated doses at appropriate intervals.
  • the antibody production of immunized animals is determined by serum levels of an antigen-specific antibody. When high titers of antibody is achieved, animals can be used as a source for preparation of antibody-producing cells. In general, the antibody- producing cells may be collected at 3-5 days after the last injection with an immunogen.
  • Lymphocytes and plasma cells obtained from any suitable part of the animal are precursor cells to produce the antibody.
  • Lymphocyte or plasma cell sources include spleen, lymph nodes, peripheral blood, or any appropriate combination thereof, with spleen cells being the most common source.
  • single lymphocyte suspension is prepared from lymphoid tissue in which antibody producing cells are present.
  • the fusion technique includes washing spleen and myeloma cells with serum-free medium (such as RPMI 1640) or phosphate buffered saline (hereinafter referred to as "PBS") so that the number ratio of spleen cells to myeloma cells is approximately between 5: 1 and 10: 1, and then centrifuged.
  • serum-free medium such as RPMI 1640
  • PBS phosphate buffered saline
  • P3X63Ag8.653 and P3X63 Ag8 (X63), which can be acquired from ATCC.
  • the cell line selected is serially transferred into an appropriate medium, such as 8-azaguanine medium.
  • 8- azaguanine medium includes Iscove's Modified Dulbecco's Medium (hereinafter referred to as "IMDM”) or Dulbecco's, Modified Eagle Medium (hereinafter referred to as "DMEM”).
  • RPMI- 1640 medium supplemented with glutamine, 2-mercaptoethanol, gentamicin, fetal calf serum (hereinafter referred to as "FCS”), and 8-azaguanine.
  • mice-mouse hybridomas RV3D11E31 A9 and RV7G11 A32G11 which are a basis for antibodies of the present technology, were deposited with CGMCC on May 12, 2011, and have the accession numbers CGMCC 4805 and 4806, respectively.
  • RVNAs rabies virus neutralizing antibodies
  • Binding curves of the five RVNAs to RV glycoprotein as determined by indirect chemiluminescence enzyme immunoassay are shown in FIG. 1.
  • the glycoprotein was diluted to 1 :500 in PBS and then coated the microplate.
  • Five clones of RVNA were diluted to 10000, 2000, 400, 80, 16, 3.2 and 0.64 ng/mL, respectively.
  • Goat anti-mouse IgG2a-FIRP and goat anti-mouse IgG2b-FIRP were used as the enzyme conjugated secondary antibody.
  • Relative luminescence unit (RLU) represents the chemiluminescence signal.
  • anti-rabies antibodies of the present technology specifically bind rabies virus glycoprotein, and that they are useful in methods related to such specific binding, including methods for detecting rabies virus glycoprotein in a sample, or treating or preventing rabies infection in a subject in need thereof and methods for providing postexposure protection against rabies infection to a subject in need thereof.
  • the in vitro neutralizing potency of the five RVNAs and the neutralizing epitope recognized by the RVNAs was determined as described herein.
  • CVS-11 virus monolayers of neuroblastoma cells were infected with challenge virus standard- 11 (CVS-11) or other viruses at a multiplicity of infection (MOI) of 0.3 for 15 min at 37°C/0.5% C0 2 .
  • MOI multiplicity of infection
  • the virus inoculum was then removed, fresh medium was added to the cells, and incubation was continued for 40 h at 37°C/0.5% C0 2 .
  • the culture supernatants were collected and stored at - 80°C until further use.
  • Standard rapid fluorescent focus inhibition test for neutralization were performed as described previously in Smith et al. (A rapid fluorescent focus inhibition test (RFFIT) for determining rabies virus-neutralizing antibody. In: Meslin F-X, Kaplan MM, Koprowski H, eds. Laboratory techniques in rabies. 4th ed. Geneva, Switzerland: World Health Organization 1996; 181-192).
  • RFFIT rapid fluorescent focus inhibition test
  • their 50% neutralizing titers were compared with the 50% neutralizing titer of standard (standard GB), which was defined as 21.4 IU/mL.
  • standard GB standard
  • the results of the RFFIT test using CVS- 11 rabies virus is shown in Table 4.
  • 3D11E3, 3H10D3 and 5A1C10 can recognize the reduced glycoprotein.
  • the five RVNAs bind to the rabies virus glycoprotein (RVGP) which was treated with different buffers.
  • the glycoprotein was dissolved in carbonate buffer (CB), carbonate buffer including 0.1% sodium dodecyl sulfate (CB + 0.1% wt/vol SDS) and carbonate buffer including 0.1% Sodium dodecyl sulfate and 0.1% ⁇ -Mercaptoethanol (CB + 0.1% wt/vol SDS + ⁇ - ⁇ ), respectively and then coated the micro-plate.
  • CB carbonate buffer
  • CB + 0.1% wt/vol SDS carbonate buffer including 0.1% Sodium dodecyl sulfate and 0.1% ⁇ -Mercaptoethanol
  • the five RVNAs were diluted to 10000, 2000, 400, 80, 16, 3.2 and 0.64 ng/mL and then reacted with the RVGP.
  • 5A1C10 recognized linear epitopes and 6F11C1 and 7G11A3 recognized conformational epitopes.
  • neutralization including methods for treating or preventing rabies infection in a subject in need thereof, and methods for providing post-exposure protection against rabies virus to a subject in need thereof.
  • Data reflects survival of subjects 20 days following inoculation with rabies virus
  • neutralization including methods for treating or preventing rabies infection in a subject in need thereof, and methods for providing post-exposure protection against rabies virus to a subject in need thereof.
  • CLEIA (FIG. 5A-0). Briefly, a 96-well microplate was coated with rabies virus glycoprotein diluted to 1 :500 in PBS. Fifty microliters (50 ⁇ ) diluted anti-rabies antibody and 50 ⁇ . anti-rabies mAb-HRP were added to each well and incubated at 37°C for 1 hour. After the incubation, the plate was washed with washing solution and 50 ⁇ . mixed chemiluminescence substrate solution was added. The plate was kept in a dark room for 3 minutes and then the chemiluminescence intensity was measured.
  • the RLU of the well which had no anti-rabies mAb and only had anti-rabies mAb- HRP conjugate was defined as B0.
  • the RLU of the other wells which had both anti-rabies mAb and anti-rabies mAb-HRP conjugate was defined as B.
  • the binding rate was obtained by dividing BO by B.
  • the non-specific antibody did not block the binding of the five HRP- labeled RVNA (FIG. 5C, F, I, L, O), thereby serving as the negative control.
  • 3H10D3-HRP (FIG. 5D, E, F), 5A1C10-HRP (FIG. 5G, H, I) or 6F11C1- HRP (FIG. 5J, K, L) to the glycoprotein.
  • the competition of 3H10D3 or 3D11E3 was minor compared with that of the other three RVNAs for the binding of 7G11A3-HRP to RVGP (FIG. 5M, N, O).
  • the competition between 3D11E3, 3H10D3, and 7G11A3 was relatively minor compared to the other parings. On this basis, 3D11E3, 3H10D3, and
  • Example 6 Vaccine immunogenicity in non-challenged Syrian hamsters treated with 3D11E3, 3H10D3, 7G11A3, or Human Rabies Virus Immunoglobulin
  • GGGGAATTCGC AAAAGTCTACTTACGTTTTATTTCC AACTTTGTCCCCGA-3 ' (SEQ ID NO: 13) (EcoRI site is underlined) as a 3' primer.
  • the nucleotide sequence (SEQ ID NO: 14) of the designed Chi A9 V L gene flanked by Nhel and EcoRI sites (underlined) is shown in Table 9 along with the deduced amino acid sequence (SEQ ID NO: 15).
  • the signal peptide sequence is in italic.
  • the N-terminal amino acid residue (D) of the mature V L is double-underlined.
  • CDR sequences according to the definition of Kabat et al. (1991) are underlined.
  • the intron sequence is in italic.
  • the splice donor signals of the Chi A9 V H and V L exons were derived from the mouse germline JH2 and JK4 sequences, respectively. PCR-amplified fragments were gel- purified using NucleoSpin Extraction II Kit (Macherey-Nagel, Bethlehem, PA) and cloned into the pCR4Blunt-TOPO vector for sequence confirmation.
  • V H and V L The correct V fragments were digested with Spel and Hindlll (for V H ) or Nhel and EcoRI (for V L ), gel-purified and cloned into a mammalian expression vector carrying human gamma- 1 and kappa constant regions for production of chimeric Chi A9 IgGl/ ⁇ antibody.
  • FIG.8 Design of humanized 1A9 V H and V L genes. CDR sequences together with framework amino acid residues important for maintaining the CDR structure were grafted from 1 A9 VH and VL into the corresponding selected human framework sequences.
  • CB958542 V L the human VK region encoded by the CB958542 cDNA (CB958542 V L ) (GenBank accession number; NIH-MGC EST Sequencing Project, 1999) was chosen as an acceptor for humanization.
  • CDR sequences of 1 A9 VL were first transferred to the corresponding positions of CB958542 VL. Next, at framework position 46, an amino acid residue from mouse 1 A9 VL was substituted for the corresponding human residue.
  • Hul A9 VH was designed as an exon including a signal peptide, a splice donor signal, and appropriate restriction enzyme sites for subsequent cloning into a mammalian expression vector.
  • the splice donor signal of the Hul A9 VH exon was derived from the human germline JH1 sequence. Since the signal peptide encoded by the mouse 1 A9 VH gene was predicted to be suboptimal for precise cleavage by the SIG-Pred signal peptide prediction software, the signal peptide sequence of the human DA980102 VH gene was used in Hul A9 VH.
  • Each of the genes encoding Hul A9 VLI and VL2 was designed as an exon including a signal peptide, a splice donor signal, and appropriate restriction enzyme sites for subsequent cloning into a mammalian expression vector.
  • the splice donor signal of the exons was derived from the human germline JK2 sequence.
  • the signal peptide sequence in each of the humanized Hul A9 V L I and V L 2 exons was derived from the corresponding mouse 1 A9 V L sequence.
  • Hul A9 V H and V L genes were constructed by GenScript USA (Piscataway, NJ). After digestion with Spel and Hindlll (for V H ) or Nhel and EcoRI (for V L ), HulA9 V H and V L genes were subcloned into corresponding sites in a mammalian expression vector for production in the human IgGl/ ⁇ form.
  • the resultant expression vector, pHul A9-1 expresses a humanized antibody containing the HulA9 V H and V L I regions (HulA9-l).
  • pHulA9-2 expresses a humanized antibody containing Hul A9 V H and V L 2 (HulA9-2).
  • the nucleotide sequence (SEQ ID NO: 16) of the Hul A9 V H gene flanked by Spel and Hindlll sites (underlined) is shown in Table 10 along with the deduced amino acid sequence (SEQ ID NO: 17).
  • the signal peptide sequence is in italic.
  • the N-terminal amino acid residue (Q) of the mature V H is double-underlined.
  • CDR sequences according to the definition of Kabat et al. (1991) are underlined.
  • the intron sequence is in italic.
  • nucleotide sequence (SEQ ID NO: 18) of the Hul A9 V L 1 gene flanked by Nhel and EcoRI sites is shown in Table 11 along with the deduced amino acid sequence (SEQ ID NO: 19).
  • the signal peptide sequence is in italic.
  • the N-terminal amino acid residue (D) of the mature V L is double-underlined.
  • CDR sequences according to the definition of Kabat et al. (1991) are underlined.
  • the intron sequence is in italic.
  • the nucleotide sequence (SEQ ID NO: 20) of the Hul A9 V L 2 gene flanked by Nhel and EcoRI sites (underlined) is shown in Table 12 along with the deduced amino acid sequence (SEQ ID NO: 21).
  • the signal peptide sequence is in italic.
  • the N-terminal amino acid residue (D) of the mature V L is double-underlined.
  • CDR sequences according to the definition of Kabat et al. (1991) are underlined.
  • the intron sequence is in italic.
  • NSO stable transfectants producing chimeric and humanized 1A9 IgGl/ ⁇ antibodies.
  • the expression vectors pChl A9, pHul A9-1 and pHul A9-2, respectively were introduced into the chromosome of a mouse myeloma cell line NSO (European Collection of Animal Cell Cultures, Salisbury, Wiltshire, UK).
  • NSO cells were grown in DME medium containing 10% FBS at 37°C in a 7.5% C0 2 incubator. Stable transfection into NSO was carried out by electroporation as described in Bebbington et al. (Bio/Technology 10: 169-175, 1992).
  • each expression vector was linearized using Fspl. Approximately 10 7 cells were transfected with 20 ⁇ g of linearized plasmid, suspended in DME medium containing 10% FBS, and plated into several 96-well plates. After 48 hr, selection media (DME medium containing 10% FBS, HT media supplement (Sigma, St. Louis, MO), 0.25 mg/ml xanthine and 1 ⁇ g/ml mycophenolic acid) was applied. Approximately 10 days after the initiation of selection, culture supernatants were assayed for antibody production.
  • NS0 stable transfectants producing a high level of Chi A9, Hul A9-1 and Hul A9-2 antibodies were adapted to growth in serum- free media using Hybridoma-SFM.
  • EC 50 values calculated using GraphPad Prism were 0.052 ⁇ g/ml for Chi A9, 0.025 ⁇ g/ml for Hul A9-1, and 0.016 ⁇ g/ml for Hul A9-2 (FIG. 10). This result indicates that both Hul A9-1 and Hul A9-2 retain the antigen binding affinity of chimeric 1 A9 antibody.
  • This Example describes the preparation of chimeric and humanized forms of the 7G11 A3 2G11 antibody described in Examples 1-6 above.
  • Mouse CT.RV 7G11 A3 2G11 (referred to as 2G11 in this Example) hybridoma cells were grown in
  • Hybridoma-SFM Invitrogen, Carlsbad, CA
  • FBS fetal bovine serum
  • variable region cDNAs for 2G11 heavy and light chains were amplified by polymerase chain reaction (PCR) with Phusion DNA polymerase (New England Biolabs, Beverly, MA) using 3' primers that anneal respectively to the mouse gamma-2a and kappa chain constant regions, and the 5 '-RACE primer (Universal Primer A Mix or Nested Universal Primer A) provided in the SMARTer RACE cDNA Amplification Kit.
  • PCR polymerase chain reaction
  • Phusion DNA polymerase New England Biolabs, Beverly, MA
  • 5 '-RACE primer Universal Primer A Mix or Nested Universal Primer A
  • V H heavy chain variable region
  • V L light chain variable region
  • the 3' primer has the sequence of SEQ ID NO: 3.
  • the amplified V H and V L cDNAs were cloned into the pCR4Blunt-TOPO vector (Invitrogen) for sequence determination. DNA sequencing was carried out at Tocore (Menlo Park, CA). Several heavy and light chain clones were sequenced and unique sequences homologous to typical mouse heavy and light chain variable regions were identified.
  • the nucleotide sequence (SEQ ID NO: 32) of mouse 2G11 V H cDNA is shown in Table 14 along with the deduced amino acid sequence (SEQ ID NO: 33).
  • the signal peptide sequence is in italic.
  • the N-terminal amino acid residue (E) of the mature V H is double- underlined.
  • CDR sequences according to the definition of Kabat et al. (Sequences of Proteins of Immunological Interests, Fifth edition, NIH Publication No. 91-3242, U.S. Department of Health and Human Services, 1991) are underlined.
  • the nucleotide sequence (SEQ ID NO: 34) of mouse 2G11 V L cDNA is shown in Table 15 along with the deduced amino acid sequence (SEQ ID NO: 35). Amino acid residues are shown in single letter code. The signal peptide sequence is in italic. The N- terminal amino acid residue (D) of the mature V L is double-underlined. CDR sequences according to the definition of Kabat et al. (1991) are underlined.
  • a gene encoding 2G11 V L was generated as an exon including a splice donor signal and appropriate flanking restriction enzyme sites by PCR.
  • Nucleotide sequence (SEQ ID NO: 40) of the designed 2G11 V L gene flanked by Nhel and EcoRI sites (underlined) is shown in Table 17 along with the deduced amino acid sequence (SEQ ID NO: 41).
  • the signal peptide sequence is in italic.
  • the N-terminal amino acid residue (D) of the mature V L is double-underlined.
  • CDR sequences according to the definition of Kabat et al. (1991) are underlined.
  • the intron sequence is in italic. Table 17.
  • a gene encoding Hu2Gl 1 V L was designed as an exon including a signal peptide, a splice donor signal, and flanking Nhel and EcoRI sites for subsequent cloning into a mammalian expression vector.
  • the splice donor signal was derived from the human germline JK4 sequence.
  • the signal peptide encoded by the mouse 2G11 V L gene was predicted to be suboptimal for precise cleavage by the SIG-Pred signal peptide prediction software, so that the signal peptide sequence of the human X72466 V L gene was used in Hu2Gl 1 V L .
  • HU2G11 V H I , V H 2 and V L genes were subcloned into corresponding sites in a mammalian expression vector for antibody production in the human IgGl/ ⁇ form.
  • the resultant expression vector, pHu2Gl 1-1 expresses a humanized antibody containing Hu2Gl 1 V H I and V L (HU2G11-1).
  • pHu2Gl 1-2 expresses a humanized antibody containing Hu2Gl 1 V H 2and V L (Hu2Gll-2).
  • the nucleotide sequence (SEQ ID NO: 42) of the Hu2Gl 1 V H 2 (also called V H R19I) gene flanked by Spel and Hindlll sites (underlined) is shown in Table 18 along with the deduced amino acid sequence (SEQ ID NO: 43).
  • the signal peptide sequence is in italic.
  • the N-terminal amino acid residue (E) of the mature V H is double-underlined.
  • CDR sequences according to the definition of Kabat et al. (1991) are underlined.
  • the boxed amino acid location indicates the difference between Hu2Gl 1 V H I and V H 2.
  • the intron sequence is in italic.
  • mice 7G11 A3 1H5 antibody 0.2 ⁇ g/ml; supplied by Asia Vision
  • competitor antibody Cho2Gl 1, Hu2Gl 1-1 or Hu2Gl 1-2; starting at a final concentration of 100 ⁇ g/ml and serial 3 -fold dilutions
  • anti-rabies antibodies of the present technology specifically bind rabies virus glycoprotein, and that they are useful in methods related to such specific binding, including methods for detecting rabies virus glycoprotein in a sample, or treating or preventing rabies infection in a subject in need thereof and methods for providing postexposure protection against rabies infection to a subject in need thereof.
  • Murine anti-rabies antibody m-lA9 1.9
  • RVGP was diluted to 1 :50, 1 : 100, 1 :200, 1 :400, 1 :800 and 1 : 1600 and then added in the micro-plate.
  • Murine RV 3D10-HRP and mouse anti-human IgG-HRP were used as the enzyme conjugate.
  • RVGP The binding of the humanized, chimeric and murine RVNAs 1 A9 to RVGP was determined by CLEIA (FIG. 16).
  • the chimeric and humanized 1A9 were used as capture (FIG. 16A-E) and detection (FIG. 16F-J) antibodies, respectively.
  • RVGP was diluted to 1 :50, 1 : 100, 1 :200, 1 :400, 1 :800 and 1 : 1600 and then added in the micro-plate.
  • Murine RV 3D 10- HRP and mouse anti-human IgG-HRP were used as the enzyme conjugate.
  • RLU related luminescence unit
  • the result showed that binding activity of the chimeric Chi A9 was superior to that of the humanized.
  • mice There were 8 mice in each experimental group. Also, 6 mice which were only administered PBS were used as negative control. On days 1, 2, 4, 8, 16 and 32, blood was collected from mice orbit. 8 mice sera were mixed to 4 sera in each experiment group and then determined the serum RVNA titer. On day 1, day 2 and day 4, serum RVNA titers were high in mice that received Hu2Gl 1-1/Hul A9-2 cocktail, were lower in mice that received 20 IU/kg HRIG (only 2 sera can meet the requirement of WHO, 0.5 IU/mL) and could not be detected in mice that only vaccinated. RVNA titer in mice that received Hu2Gl 1-1/Hul A9-2 cocktail remained high level during 8-32 days, higher than or equivalent with the RVNA titer in mice that received HRIG. This result indicated that
  • Example 18 Post-exposure protection performance of the two humanized RVNAs in human subjects
  • This example will demonstrate the post-exposure protection performance of the humanized 2G11 and 1 A9 in human subjects exposed to rabies virus.
  • Humans exposed to or suspected of being exposed to rabies virus are administered chimeric or humanized 2G11 or 1 A9 (1 mg/kg) with 16 hour decay, administered at the site of virus inoculation ⁇ i.e., the site of an animal bite). It is expected that treated subjects will display a 100% survival rate, will display fewer or no clinical symptoms of rabies than untreated subjects, and will display a faster and more complete recovery from the rabies exposure than untreated subjects.
  • anti-rabies antibodies of the present technology provide post-exposure protection against rabies infection in humans, and that they are useful in methods relating to such protection, including methods for treating or preventing rabies infection in a subject in need thereof and methods for providing post-exposure protection against rabies virus to a subject in need thereof.
  • Example 19 In vivo neutralizing performance of Hu2Gll-l/HulA9-2 Cocktail compared with polyclonal HRIG.
  • This example will demonstrate the in vivo neutralizing performance of the Hu2Gl 1- 1/Hul A9-2 cocktail in human subjects exposed to rabies virus.
  • Humans exposed to or suspected of being exposed to rabies virus are administered 1000, 500, 200 IU/kg Hu2Gl 1- 1/Hul A9-2 cocktail with 24 hour decay, administered at the site of virus inoculation ⁇ i.e., the site of an animal bite). It is expected that treated subjects will display a 100% survival rate, will display fewer or no clinical symptoms of rabies than untreated subjects, and will display a faster and more complete recovery from the rabies exposure than untreated subjects.

Abstract

La présente invention concerne en général des anticorps anti-rabiques qui peuvent se lier au virus de la rage et neutraliser le virus de la rage. Des anticorps de la présente technologie sont utiles seuls ou en combinaison avec des thérapies connues dans la technique pour le traitement ou la prévention d'une infection rabique.
EP12877555.8A 2012-05-24 2012-05-24 Compositions et procédés associés à la prévention et au traitement d'une infection rabique Pending EP2855521A4 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP19156037.4A EP3508497A1 (fr) 2012-05-24 2012-05-24 Compositions et procédés associés à la prévention et au traitement d'une infection rabique

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2012/076012 WO2013174003A1 (fr) 2012-05-24 2012-05-24 Compositions et procédés associés à la prévention et au traitement d'une infection rabique

Related Child Applications (1)

Application Number Title Priority Date Filing Date
EP19156037.4A Division EP3508497A1 (fr) 2012-05-24 2012-05-24 Compositions et procédés associés à la prévention et au traitement d'une infection rabique

Publications (2)

Publication Number Publication Date
EP2855521A1 true EP2855521A1 (fr) 2015-04-08
EP2855521A4 EP2855521A4 (fr) 2016-03-02

Family

ID=49623026

Family Applications (2)

Application Number Title Priority Date Filing Date
EP19156037.4A Pending EP3508497A1 (fr) 2012-05-24 2012-05-24 Compositions et procédés associés à la prévention et au traitement d'une infection rabique
EP12877555.8A Pending EP2855521A4 (fr) 2012-05-24 2012-05-24 Compositions et procédés associés à la prévention et au traitement d'une infection rabique

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP19156037.4A Pending EP3508497A1 (fr) 2012-05-24 2012-05-24 Compositions et procédés associés à la prévention et au traitement d'une infection rabique

Country Status (12)

Country Link
US (1) US9290564B2 (fr)
EP (2) EP3508497A1 (fr)
JP (1) JP5868549B2 (fr)
KR (1) KR101937733B1 (fr)
CN (1) CN104603149B (fr)
BR (1) BR112014029274B1 (fr)
HK (1) HK1210187A1 (fr)
IN (1) IN2014KN02831A (fr)
MX (1) MX369626B (fr)
PH (1) PH12014502628B1 (fr)
SG (1) SG11201408330XA (fr)
WO (1) WO2013174003A1 (fr)

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104603149B (zh) * 2012-05-24 2017-06-30 万机集团有限公司 与预防和治疗狂犬病感染相关的组合物和方法
CN104193823B (zh) * 2014-08-22 2019-06-11 兰州生物制品研究所有限责任公司 一种抗狂犬病病毒特异性人源抗体及应用
US10988531B2 (en) * 2014-09-03 2021-04-27 Immunogen, Inc. Conjugates comprising cell-binding agents and cytotoxic agents
EP3831404A1 (fr) * 2014-11-18 2021-06-09 Humabs Biomed S.A. Anticorps à puissante activité de neutralisation du virus de la rage et d'autres lyssavirus et leurs utilisations
CA2995109A1 (fr) * 2015-08-13 2017-02-16 University Of Massachusetts Anticorps humains diriges contre la rage et utilisations de ces derniers
AR108516A1 (es) 2016-05-18 2018-08-29 Boehringer Ingelheim Int Moléculas de anticuerpo anti-pd1 y anti-lag3 para el tratamiento del cáncer
KR101990795B1 (ko) * 2017-12-07 2019-06-19 대한민국 광견병바이러스 특이 항체 및 이를 이용한 광견병바이러스 검출방법
CN109970852B (zh) * 2019-04-01 2020-10-13 浙江大学 分泌抗狂犬病毒m蛋白单克隆抗体的杂交瘤细胞株及应用
CN111171145B (zh) * 2020-01-21 2021-11-05 兰州生物制品研究所有限责任公司 一种抗狂犬病病毒单克隆抗体、制备方法及用途
CN111888470A (zh) * 2020-08-12 2020-11-06 赵静 具有中和狂犬病病毒效能的冲洗液及其活性检测方法
WO2023215746A2 (fr) * 2022-05-02 2023-11-09 Javelin Oncology, Inc. Anticorps anti-alppl2 et récepteurs antigéniques chimériques, et compositions et méthodes d'utilisation

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011080765A2 (fr) * 2010-01-04 2011-07-07 Indian Immunologicals Limited Diabody bivalent humain recombinant contre le virus de la rage et utilisation de celui-ci
WO2011137570A1 (fr) * 2010-05-06 2011-11-10 中国疾病预防控制中心病毒病预防控制所 Anticorps rvfab8 neutralisant d'origine humaine contre la glycoprotéine du virus de la rage
WO2011137571A1 (fr) * 2010-05-06 2011-11-10 中国疾病预防控制中心病毒病预防控制所 Anticorps rvfab5 neutralisant d'origine humaine contre la glycoprotéine du virus de la rage
WO2011137569A1 (fr) * 2010-05-06 2011-11-10 中国疾病预防控制中心病毒病预防控制所 Anticorps rvfab3 neutralisant humanisé contre la glycoprotéine du virus de la rage

Family Cites Families (77)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NL154600B (nl) 1971-02-10 1977-09-15 Organon Nv Werkwijze voor het aantonen en bepalen van specifiek bindende eiwitten en hun corresponderende bindbare stoffen.
NL154598B (nl) 1970-11-10 1977-09-15 Organon Nv Werkwijze voor het aantonen en bepalen van laagmoleculire verbindingen en van eiwitten die deze verbindingen specifiek kunnen binden, alsmede testverpakking.
NL154599B (nl) 1970-12-28 1977-09-15 Organon Nv Werkwijze voor het aantonen en bepalen van specifiek bindende eiwitten en hun corresponderende bindbare stoffen, alsmede testverpakking.
US3817837A (en) 1971-05-14 1974-06-18 Syva Corp Enzyme amplification assay
US3901654A (en) 1971-06-21 1975-08-26 Biological Developments Receptor assays of biologically active compounds employing biologically specific receptors
US3853987A (en) 1971-09-01 1974-12-10 W Dreyer Immunological reagent and radioimmuno assay
US3867517A (en) 1971-12-21 1975-02-18 Abbott Lab Direct radioimmunoassay for antigens and their antibodies
NL171930C (nl) 1972-05-11 1983-06-01 Akzo Nv Werkwijze voor het aantonen en bepalen van haptenen, alsmede testverpakkingen.
US3850578A (en) 1973-03-12 1974-11-26 H Mcconnell Process for assaying for biologically active molecules
US3935074A (en) 1973-12-17 1976-01-27 Syva Company Antibody steric hindrance immunoassay with two antibodies
US3939350A (en) 1974-04-29 1976-02-17 Board Of Trustees Of The Leland Stanford Junior University Fluorescent immunoassay employing total reflection for activation
US3996345A (en) 1974-08-12 1976-12-07 Syva Company Fluorescence quenching with immunological pairs in immunoassays
US4034074A (en) 1974-09-19 1977-07-05 The Board Of Trustees Of Leland Stanford Junior University Universal reagent 2-site immunoradiometric assay using labelled anti (IgG)
US3984533A (en) 1975-11-13 1976-10-05 General Electric Company Electrophoretic method of detecting antigen-antibody reaction
US4098876A (en) 1976-10-26 1978-07-04 Corning Glass Works Reverse sandwich immunoassay
US4275149A (en) 1978-11-24 1981-06-23 Syva Company Macromolecular environment control in specific receptor assays
US4277437A (en) 1978-04-05 1981-07-07 Syva Company Kit for carrying out chemically induced fluorescence immunoassay
US4391904A (en) 1979-12-26 1983-07-05 Syva Company Test strip kits in immunoassays and compositions therein
US4366241A (en) 1980-08-07 1982-12-28 Syva Company Concentrating zone method in heterogeneous immunoassays
US4714681A (en) 1981-07-01 1987-12-22 The Board Of Reagents, The University Of Texas System Cancer Center Quadroma cells and trioma cells and methods for the production of same
US4474893A (en) 1981-07-01 1984-10-02 The University of Texas System Cancer Center Recombinant monoclonal antibodies
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
GB8308235D0 (en) 1983-03-25 1983-05-05 Celltech Ltd Polypeptides
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US5028530A (en) 1985-01-28 1991-07-02 Xoma Corporation AraB promoters and method of producing polypeptides, including cecropins, by microbiological techniques
EP0229046B1 (fr) 1985-03-30 1994-05-04 BALLIVET, Marc Procede d'obtention d'adn, arn, peptides, polypeptides ou proteines, par une technique de recombinaison d'adn
US6492107B1 (en) 1986-11-20 2002-12-10 Stuart Kauffman Process for obtaining DNA, RNA, peptides, polypeptides, or protein, by recombinant DNA technique
WO1987001130A1 (fr) 1985-08-15 1987-02-26 Stauffer Chemical Company Microorganisme producteur de tryptophane
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
DE122007000007I1 (de) 1986-04-09 2007-05-16 Genzyme Corp Genetisch transformierte Tiere, die ein gewünschtes Protein in Milch absondern
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
EP0832981A1 (fr) 1987-02-17 1998-04-01 Pharming B.V. Séquences d'ADN pour diriger des protéines vers les glandes mammaires, afin d'être secrétées efficacement
US5258498A (en) 1987-05-21 1993-11-02 Creative Biomolecules, Inc. Polypeptide linkers for production of biosynthetic proteins
US4873316A (en) 1987-06-23 1989-10-10 Biogen, Inc. Isolation of exogenous recombinant proteins from the milk of transgenic mammals
DE68921982T4 (de) 1988-06-14 1996-04-25 Cetus Oncology Corp Kupplungsmittel und sterisch gehinderte, mit disulfid gebundene konjugate daraus.
US4925648A (en) 1988-07-29 1990-05-15 Immunomedics, Inc. Detection and treatment of infectious and inflammatory lesions
US5601819A (en) 1988-08-11 1997-02-11 The General Hospital Corporation Bispecific antibodies for selective immune regulation and for selective immune cell binding
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
KR0184860B1 (ko) 1988-11-11 1999-04-01 메디칼 리써어치 카운실 단일영역 리간드와 이를 포함하는 수용체 및 이들의 제조방법과 이용(법)
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
IL162181A (en) 1988-12-28 2006-04-10 Pdl Biopharma Inc A method of producing humanized immunoglubulin, and polynucleotides encoding the same
IE63847B1 (en) 1989-05-05 1995-06-14 Res Dev Foundation A novel antibody delivery system for biological response modifiers
US6291161B1 (en) 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertiore
US6291160B1 (en) 1989-05-16 2001-09-18 Scripps Research Institute Method for producing polymers having a preselected activity
US6291158B1 (en) 1989-05-16 2001-09-18 Scripps Research Institute Method for tapping the immunological repertoire
US6680192B1 (en) 1989-05-16 2004-01-20 Scripps Research Institute Method for producing polymers having a preselected activity
US6291159B1 (en) 1989-05-16 2001-09-18 Scripps Research Institute Method for producing polymers having a preselected activity
DE69029036T2 (de) 1989-06-29 1997-05-22 Medarex Inc Bispezifische reagenzien für die aids-therapie
US5633076A (en) 1989-12-01 1997-05-27 Pharming Bv Method of producing a transgenic bovine or transgenic bovine embryo
US5314995A (en) 1990-01-22 1994-05-24 Oncogen Therapeutic interleukin-2-antibody based fusion proteins
CA2078689C (fr) 1990-03-20 2003-02-11 Sherie L. Morrison Anticorps chimeriques dont des ligands se liant au recepteur remplacent une partie de la region constante de la chaine
ATE309376T1 (de) 1990-06-28 2005-11-15 Hoechst Ag Fusionsproteine mit immunglobulinanteilen, ihre herstellung und verwendung
US5304389A (en) 1991-06-18 1994-04-19 Mitsubishi Kasei Corporation Non-hygroscopic icing composition
GB9015198D0 (en) 1990-07-10 1990-08-29 Brien Caroline J O Binding substance
DK0585287T3 (da) 1990-07-10 2000-04-17 Cambridge Antibody Tech Fremgangsmåde til fremstilling af specifikke bindingsparelementer
ES2129029T5 (es) 1990-10-05 2005-10-16 Celldex Therapeutics, Inc. Inmunoestimulacion dirigida con reactivos biespecificos.
AU8727291A (en) 1990-10-29 1992-06-11 Cetus Oncology Corporation Bispecific antibodies, method of production, and uses thereof
EP0574395B1 (fr) 1990-11-09 2002-06-12 GILLIES, Stephen D. Immunoconjugues de cytokine
US6106835A (en) 1991-04-19 2000-08-22 Tanox, Inc. Modified binding molecules specific for T or B lymphocytes and their use as in vivo immune modulators
DE69214709T2 (de) 1991-04-26 1997-02-20 Surface Active Ltd Neue Antikörper und Verfahren zu ihrer Verwendung
US6492160B1 (en) 1991-05-15 2002-12-10 Cambridge Antibody Technology Limited Methods for producing members of specific binding pairs
US6225447B1 (en) 1991-05-15 2001-05-01 Cambridge Antibody Technology Ltd. Methods for producing members of specific binding pairs
DE69230142T2 (de) 1991-05-15 2000-03-09 Cambridge Antibody Tech Verfahren zur herstellung von spezifischen bindungspaargliedern
AU2238292A (en) 1991-06-14 1993-01-12 Xoma Corporation Microbially-produced antibody fragments and their conjugates
US7018809B1 (en) 1991-09-19 2006-03-28 Genentech, Inc. Expression of functional antibody fragments
DK0605522T3 (da) 1991-09-23 2000-01-17 Medical Res Council Fremgangsmåde til fremstilling af humaniserede antistoffer
DE69233408T2 (de) 1991-12-02 2005-09-22 Cambridge Antibody Technology Ltd., Melbourn Herstellung von Antikörpern auf Phagenoberflächen ausgehend von Antikörpersegmentbibliotheken.
DK1024191T3 (da) 1991-12-02 2008-12-08 Medical Res Council Fremstilling af autoantistoffer fremvist på fag-overflader ud fra antistofsegmentbiblioteker
EP0627940B1 (fr) 1992-03-05 2003-05-07 Board of Regents, The University of Texas System Utilisation d'immunoconjugués pour le diagnostic et/ou le traitement de tumeurs vascularisées.
DE614989T1 (de) 1993-02-17 1995-09-28 Morphosys Proteinoptimierung Verfahren für in vivo Selektion von Ligandenbindende Proteine.
US5827690A (en) 1993-12-20 1998-10-27 Genzyme Transgenics Corporatiion Transgenic production of antibodies in milk
WO1996013583A2 (fr) 1994-10-20 1996-05-09 Morphosys Gesellschaft Für Proteinoptimierung Mbh Hetero-association ciblee de proteines recombinees et de complexes fonctionnels
EP1990409A3 (fr) 1999-07-20 2011-05-18 MorphoSys AG Bactériophage
US7094571B2 (en) 2000-10-27 2006-08-22 The Board Of Regents Of The University Of Texas System Combinatorial protein library screening by periplasmic expression
US7083945B1 (en) 2000-10-27 2006-08-01 The Board Of Regents Of The University Of Texas System Isolation of binding proteins with high affinity to ligands
JP3523245B1 (ja) 2000-11-30 2004-04-26 メダレックス，インコーポレーテッド ヒト抗体作製用トランスジェニック染色体導入齧歯動物
CN104603149B (zh) * 2012-05-24 2017-06-30 万机集团有限公司 与预防和治疗狂犬病感染相关的组合物和方法

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011080765A2 (fr) * 2010-01-04 2011-07-07 Indian Immunologicals Limited Diabody bivalent humain recombinant contre le virus de la rage et utilisation de celui-ci
WO2011137570A1 (fr) * 2010-05-06 2011-11-10 中国疾病预防控制中心病毒病预防控制所 Anticorps rvfab8 neutralisant d'origine humaine contre la glycoprotéine du virus de la rage
WO2011137571A1 (fr) * 2010-05-06 2011-11-10 中国疾病预防控制中心病毒病预防控制所 Anticorps rvfab5 neutralisant d'origine humaine contre la glycoprotéine du virus de la rage
WO2011137569A1 (fr) * 2010-05-06 2011-11-10 中国疾病预防控制中心病毒病预防控制所 Anticorps rvfab3 neutralisant humanisé contre la glycoprotéine du virus de la rage

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
None *
See also references of WO2013174003A1 *

Also Published As

Publication number Publication date
JP2015525206A (ja) 2015-09-03
CN104603149B (zh) 2017-06-30
US20150110781A1 (en) 2015-04-23
EP3508497A1 (fr) 2019-07-10
BR112014029274B1 (pt) 2022-02-15
KR20150016590A (ko) 2015-02-12
MX369626B (es) 2019-11-13
WO2013174003A1 (fr) 2013-11-28
IN2014KN02831A (fr) 2015-05-08
JP5868549B2 (ja) 2016-02-24
HK1210187A1 (en) 2016-04-15
PH12014502628A1 (en) 2015-01-26
CN104603149A (zh) 2015-05-06
PH12014502628B1 (en) 2015-01-26
US9290564B2 (en) 2016-03-22
SG11201408330XA (en) 2015-01-29
EP2855521A4 (fr) 2016-03-02
BR112014029274A2 (pt) 2018-04-24
KR101937733B1 (ko) 2019-01-11
MX2014014412A (es) 2015-07-21

Similar Documents

Publication Publication Date Title
US9290564B2 (en) Compositions and methods related to the prevention and treatment of rabies infection
RU2761663C2 (ru) Антитела к pd-1 собак
US11591385B2 (en) Methods and compositions for the generation and use of humanized conformation-specific phosphorylated tau antibodies
JP6797111B2 (ja) イヌｐｄ−ｌ１と結合するｐｄ−ｌ１抗体
KR101732056B1 (ko) 중화 항-인플루엔자 ａ 바이러스 항체 및 이의 용도
US10450367B2 (en) Human antibodies against rabies and uses thereof
RU2765878C2 (ru) Антитела для лечения инфекции гепатитом в и связанных с ней заболеваний
CN107922939B (zh) 中和全部种类埃博拉病毒的感染性的单克隆抗体
KR20180084045A (ko) 비형 간염 표면 항원에 대한 항체 및 그의 용도
JP2021525071A (ja) Ｂ型肝炎抗体
US11827670B2 (en) Anti-CfaE antibodies and methods of use
CN114685653B (zh) 抗新冠病毒受体结合区域表位中和抗体及其应用
US20220340644A1 (en) Influenza neutralizing antibodies and their uses

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20141217

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAX Request for extension of the european patent (deleted)
RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 39/00 20060101ALI20151030BHEP

Ipc: C07K 16/10 20060101AFI20151030BHEP

Ipc: A61K 39/42 20060101ALI20151030BHEP

Ipc: C12N 15/13 20060101ALI20151030BHEP

Ipc: G01N 33/569 20060101ALI20151030BHEP

Ipc: A61P 31/14 20060101ALI20151030BHEP

RA4 Supplementary search report drawn up and despatched (corrected)

Effective date: 20160128

RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 39/00 20060101ALI20160122BHEP

Ipc: A61K 39/42 20060101ALI20160122BHEP

Ipc: G01N 33/569 20060101ALI20160122BHEP

Ipc: A61P 31/14 20060101ALI20160122BHEP

Ipc: C12N 15/13 20060101ALI20160122BHEP

Ipc: C07K 16/10 20060101AFI20160122BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20171018

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: MOUNTGATE INNOTECH (HK) LIMITED

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS