EP2379721A1 - Verbesserte säure- und lösungsmittelproduktion in mikroorganismen - Google Patents

Verbesserte säure- und lösungsmittelproduktion in mikroorganismen

Info

Publication number
EP2379721A1
EP2379721A1 EP09778907A EP09778907A EP2379721A1 EP 2379721 A1 EP2379721 A1 EP 2379721A1 EP 09778907 A EP09778907 A EP 09778907A EP 09778907 A EP09778907 A EP 09778907A EP 2379721 A1 EP2379721 A1 EP 2379721A1
Authority
EP
European Patent Office
Prior art keywords
host cell
nucleic acid
acid molecule
seq
acetobutylicum
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP09778907A
Other languages
English (en)
French (fr)
Inventor
Wolfgang Wach
Karsten Harms
Michael Klingeberg
Peter Duerre
Niklas Nold
Bettina Schiel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suedzucker AG
Original Assignee
Suedzucker AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suedzucker AG filed Critical Suedzucker AG
Publication of EP2379721A1 publication Critical patent/EP2379721A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/16—Butanols
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/52—Propionic acid; Butyric acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/54—Acetic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • the invention relates to methods and means for the biotechnological fermentative production of solvents, especially butanol, acetone and ethanol, as well as short-chain carboxylic acids such as acetic acid and butyric acid, especially in host cells of the genus Clostridium.
  • the invention provides novel methods and means for regulating the expression of enzyme activities involved in the acid and / or solvent production of the host cell.
  • Some strains of the genus Clostridium are capable of forming solvents, especially butanol, acetone and ethanol, from carbon sources such as carbohydrates, for example monosaccharides, disaccharides, starch and other polysaccharides.
  • solvents especially butanol, acetone and ethanol
  • the biotechnological production of solvents from clostridia has been known as an ABE process since the 1920s (US Pat. No. 1,315,585, Weizmann et al.). From the 1950s, however, this process was economically uninteresting due to advances in petrochemistry.
  • solvent-sensitive organisms may also be present, so that a specific control and regulation of the solvent production / solvent concentration in the culture medium is required.
  • Butyric acid is an important raw material for the production of butyric esters, which are used, for example, as fragrances and flavorings, of cellulose butyrate, a weather-resistant and impact-resistant plastic, and of pesticides. Butyric acid and butyrate are also important in the prophylaxis and therapy of the human and animal body.
  • the production of butyrate (and also acetate) as a metabolic The use of probiotic intestinal bacteria helps to preserve and restore intestinal function. Externally supplied butyrate has recently been used for the prophylaxis and treatment of inflammatory bowel disease. On the other hand, low levels of butyrate in the colon can cause disease and, for example, cause the differentiation of colon carcinoma cells.
  • Microorganisms which form optionally short-chain carboxylic acids such as butyrate, in particular bacteria of the genus Clostridium occur naturally in the intestine in particular of monogastric animals and humans. It is desirable to be able to use organisms, in particular clostridia, as probiotic organisms in order to maintain the health of the intestine and in particular to enable the treatment of chronic inflammatory bowel diseases, diarrheal diseases, irritable bowel and constipation.
  • microorganisms are also suitable for the biotechnological production of short-chain carboxylic acids, in particular butyric acid and acetic acid, and in particular on an industrial scale.
  • butyric acid is synthesized in a classical chemical way usually by the catalytic oxidation of butanol or by an oxo synthesis of propene and carbon monoxide
  • the biotechnological production of butyric acid takes place mainly by the direct fermentation of C2-C6 bodies, especially of Carbohydrates such as glucose or cleavage products such as glycerol.
  • the biotechnological synthesis does not require any starting petrochemical compounds such as propene, so that production from renewable raw materials that is independent of petrochemical processes is possible.
  • the known biotechnological processes for the production of butyric acid from carbohydrates are in need of improvement.
  • microorganisms hitherto used as solvent-producing organisms are known not to be primary and readily usable for the synthesis of short-chain carboxylic acids, in particular of butyric acid; the yield of short-chain carboxylic acids is so far too low in such organisms.
  • the invention is primarily based on the technical problem of providing methods and means for carrying them out, whereby solvents, especially butanol and optionally acetone and ethanol, or alternatively short-chain carboxylic acids, especially butyric acid and optionally acetic acid / acetate, in a microbiological host cell , especially in a solvent-forming host cell of the genus Clostridium, can be produced biotechnologically in high yield and above all in high volumetric productivity.
  • the technical problem is also to provide improved means of regulation, especially to increase solvent production and, alternatively, to increase the production of short chain carboxylic acids in these host cells.
  • agents should be simpler and more reliable and also be used in various species of the host cell genus and especially lead to an increase in the yield and preferably also the volumetric productivity in the fermentation.
  • a related technical problem is the provision of agents that allow for particularly simple and efficient control of metabolic activities and, in particular, enzyme activities associated with solvent production and, optionally, carboxylic acid production in the host cell.
  • the underlying technical problem is primarily solved by the provision of a nucleic acid molecule which is a regulator of solvent production or directly related to such a regulator.
  • the regulator modulates or regulates, that is induces, stimulates or suppresses, the expression of at least one gene encoding at least one metabolic factor, especially enzyme activity, of solvent production in a host cell.
  • a solvent-producing host cell is preferably selected from organisms of the genus Clostridium.
  • the invention relates to a nucleic acid molecule suitable for modulating the expression of at least one enzyme activity of solvent and / or acid production in a host cell, the molecule having a nucleic acid sequence selected from:
  • the nucleic acid molecule is an RNA molecule.
  • the modulation of the enzyme activity preferably takes place by regulation of at least one process selected from:
  • Transcription preferably at least one gene encoding the enzyme activity, and - translation of at least one gene transcript into a polyamino acid molecule containing or mediating the enzyme activity,
  • nucleic acid molecule binds to at least one structure mediating this process and modulates their function.
  • the invention relates to a nucleic acid molecule which is a genetic mutant of the nucleic acid molecule characterized in the first aspect, wherein the at least one genetic mutation is preferably selected from inversion, deletion and insertion of at least one nucleotide.
  • the invention relates to a transgenic host cell with modified acid and / or solvent production, wherein the expression of the nucleic acid molecule according to any one of the preceding aspects, in particular according to the first aspect, is inhibited or prevented.
  • this cell is a knock out mutant of the gene solB and / or a homolog or orthologue thereof.
  • the invention relates to a transgenic host cell with modified acid and / or solvent production, which contains the nucleic acid molecule according to one of the preceding aspects, in particular according to the first aspect, as a heterologous gene, preferably one or more copies thereof.
  • the invention relates to a vector containing at least one expressible copy of the nucleic acid molecule characterized in the above aspects.
  • the nucleic acid molecule is arranged expressible in sense orientation.
  • the nucleic acid molecule is arranged expressible in antisense orientation.
  • the invention relates to a transgenic host cell with modified acid and / or solvent production, which contains at least one expressible copy of the nucleic acid molecule characterized in the above aspects and / or the vector according to the fifth aspect of the invention, preferably one or several copies of it.
  • the invention relates to an RNA molecule, preferably produced or synthesized outside the cell, for modulating the expression of at least one enzyme activity of acid and / or solvent production in a host cell, the molecule being selected from:
  • RNA molecule which is transcribed from the nucleic acid molecule according to one of the preceding aspects, in particular according to the first aspect, and b) Fragments of (a) having the function of a regulator for modulating the expression of said enzyme activity in the host cell.
  • the invention relates to a host cell with modified acid and / or solvent production in which an RNA molecule according to the sixth aspect of the invention is introduced.
  • the introduced RNA molecule is in sense orientation.
  • the introduced RNA molecule is in antisense orientation.
  • the invention features: a process for producing a transgenic host cell having modified acid and / or solvent production, comprising the step of: genetically modifying the host cell having at least one structure selected from: nucleic acid molecules and vectors according to any one of the preceding aspects; in preferred embodiments according to the first aspect, alternatively according to the second aspect and alternatively according to the third aspect.
  • the host cell is or is genetically modified such that the nucleic acid molecule according to any of the above aspects, in particular according to the first aspect of the invention, is expressed in sense orientation.
  • the host cell is or is genetically modified, so that the nucleic acid molecule according to one of the above aspects, in particular according to the first aspect of the invention, is expressed in antisense orientation.
  • the invention relates to a process for the preparation of a transgenic host cell with modified acid and / or solvent production, comprising the step of: sluice the RNA molecule according to one of the preceding aspects, in particular according to the first or seventh aspect of the invention.
  • the invention relates to a process for the biotechnological production of solvents, preferably selected from acetone, butanol and ethanol, especially butanol, comprising the steps:
  • the invention relates to a process for the biotechnological production of short-chain carboxylic acids, in particular butyrate and / or acetate, or butyric acid and / or acetic acid, comprising the steps:
  • Figures 1A.B schematic representations (not to scale) of the so / -Operons in C. acetobutylicum, Figure 1A 1 and in other solvent-forming Clostridien, Figure 1 B.
  • FIG. 2 Position and sequence of the ⁇ / ⁇ gene in the intergenic region of the orfo gene and the ozone / ozone; it means: orf ⁇ : open reading frame; orfL: open reading frame; adhE: aldehyde / alcohol dehydrogenase; ctfA / ctfB: acetoacetyl-CoA: acetate / butyrate: CoA transferase; ade: acetoacetate decarboxylase
  • FIG. 3 Plasmid map of the vector pBS1 according to the invention for the overexpression of the promoterless so / ⁇ gene; Cloning of solB without promoter (SEQ ID NO: 2) in sense orientation with pftb / bu / c promoter based on the plasmid plMP1 to produce a C. acetobutylicum solB sense mutant according to the invention
  • FIG. 4 Plasmid map of the vector pBS7 according to the invention for the overexpression of the complete SO / ⁇ gene (SEQ ID NO: 1); Cloning of solB with ⁇ -own promoter on the basis of the plasmid pIMP1 to produce a C. acetobutylicum synth.
  • SolB sense mutant according to the invention
  • FIG. 5 Plasmid map of the vector pBS13 according to the invention for expressing an anf / sense construct of the so / ⁇ gene; Cloning of solB in anf / sense orientation with so / ß-own promoter and terminator (both in se ⁇ se orientation) based on the plasmid plMP1 to produce a C. acetobutylicum synth.
  • FIGS. 6A-D Plasmid maps of the vectors according to the invention pBS14, pBS15, pBS16 and pBS17 for the expression of antisense constructs of fragments (3'so / B75 Bp, 3'so / B115 Bp, 5'so / B72 Bp, 5 so 102 bp) of the so / ß gene; Cloning of fragments of solB in anf / sense orientation with so / ß-own promoter (in sense orientation) and terminator (in sense orientation) based on the plasmid plMP1 to produce mutants of the invention: C. acetobutylicum synth.
  • FIG. 7 Results of the qualitative RT-PCR for investigating the transcription of the ⁇ -gene: (-): Negative control of the corresponding sample (substitution of the reverse transcriptase by water),
  • (+) RT-PCR of the corresponding sample
  • S size standard (about 500 ng total RNA per RT-PC R-batch)
  • FIGS. 9A-B Product spectra of the growth tests of the type strain C. acetobutylicum ATCC 824 (wild type) (FIG. 8A), a C. acetobutylicum p IMP 1 mutant (FIG. 8B) and the C. acetobutylicum solB sense mutant (according to the invention, FIG. 8C ) in phosphate-limited minimal medium; Concentrations in mmol / l (mM) FIGS. 9A-B: acetone production (FIG. 9A) and butanol production, (FIG. 9B) of the type strain C. acetobutylicum ATCC 824 (wild-type, FIG. 9A) and the C. acetobutylicum solB sense mutant (according to the invention, FIG. 9B) on phosphate-limited minimal medium; Concentrations in mmol / l (mM)
  • 10A-D Product spectra of the growth tests of the type strain C. acetobutylicum ATCC 824 (wild-type, FIG. 10A), a first C. acetobutylicum synth.
  • SolB sense mutant (according to the invention, FIG. 10B), another C. acetobutylicum synth.
  • SolB sense- Mutant (according to the invention, Figure 10C) and still another C. acetobutylicum synth.
  • SolB sense mutant (according to the invention, Figure 10D) in phosphate-limited minimal medium; Concentrations in mmol / l (mM)
  • FIG. 11A-B acetone production (FIG. 11A) and butanol production (FIG. 11B) of the type strain C. acetobutylicum ATCC 824 (wild-type), a first C. acetobutylicum synth.
  • SolB sense mutant (according to the invention), another C. acetobutylicum synth.
  • solB sense mutant (according to the invention) and still another C. acetobutylicum synth. solB sense mutant (according to the invention) on phosphate-limited minimal medium; Concentrations in mmol / l (mM)
  • FIGS. 12A-B acetate production (FIG. 12A) and butyrate production (FIG. 12B) of the type strain C. acetobutylicum ATCC 824 (wild-type) and the C. acetobutylicum solB sense mutant (according to the invention) on phosphate-limited minimal medium; Concentrations in mmol / l (mM)
  • FIGS. 13A-B acetate production (FIG. 13A) and butyrate production (FIG. 13B) of the type strain C. acetobutylicum ATCC 824 (wild-type) and the C. acetobutylicum synth.
  • SolB sense mutants (inventive) according to) on phosphate-limited minimal medium; Concentrations in mmol / l (mM)
  • the sequence log contains:
  • TCCTTAAGATATAGCTTCTTTTATGTAGTATTATTTCAGAAGTC TACAAATTAAGTTATATTTAGACCCTGGGGTGTAACTATAGT ATTTAATATGTACTATTAATTAGGGTTATATATACTAGAACT TATCATGGTAAACATAAATATAAACTCAATTCTATTTATGCTCC TATAAAATTTTATAATATAGGAAAACTGCTAAATGTAAATTATA
  • KL08 (SEQ ID NO: 11): GGGAATACATATGTCGACACTCCCTTTTACTATTT
  • KL09 (SEQ ID NO: 12): CGGAATTCTATAAAATATAAATAATTTTC
  • sRNA short_new_F (SEQ ID NO: 13):
  • sRNA_new_R (SEQ ID NO: 14): GGAATCATATGTATATTTAG
  • snRNA_F (SEQ ID NO: 15): CTATAGTATTTAATATTGGTAC
  • acetobutylicum is a Gram-positive, strictly anaerobic and endospore-forming soil bacterium that has a biphasic fermentation metabolism. Historically, all strains of the genus Clostridium have been referred to as Clostridium acetobutylicum. Molecular genetic analyzes showed that C. acetobutylicum is composed of at least four different species, C. acetobutylicum, C. beijerinckii, C. saccharobutylicum and C. saccharoperbutylacetonicum, which also differ in the exact structure of the genome.
  • sugar-containing substrates are in the first phase of the metabolism associated with the logarithmic phase of growth, first to acetic acid (acetate) and butyric acid (butyrate), while in the second phase of the metabolism now the solvents acetone and Butanol are formed.
  • the conversion of the metabolite from the acid to the solvent production is known to occur regularly during the transition to the stationary phase of growth. Too high an acid concentration would lead to a collapse of the proton gradient across the cytoplasmic membrane.
  • the acid titer is reduced.
  • some of the acids can be taken up again from the medium. Endosporogenesis is initiated.
  • the genes necessary for solvent formation are on at least five separate operons ⁇ sol Operon, adc operon and adhE2 operon on a megaplasmid and bdhA and bdhB operon on the chromosome).
  • the strains C. beije ⁇ nckii, C. saccharobutylicum and C. saccharoperbutylacetonicum are also capable of producing solvents.
  • the genes of the so / operon and the adc operon unlike C. acetobutylicum, form a common polycistronic operon that is localized not on a megaplasmid but on the chromosome.
  • This so-operon contains no aldehyde / alcohol dehydrogenase (Ad-hE) but an aldehyde dehydrogenase (Ald).
  • Ad-hE aldehyde dehydrogenase
  • Ald aldehyde dehydrogenase
  • FIGS. 1A and 1B the two versions of the so / operons of clostridia are shown schematically.
  • Acetacetyl-CoA genes acetate / butyrate: CoA transferase (CoA transferase, ctfA and ctfB), acetoacetate decarboylase (ade), butanol dehydrogenases A and B (bdhA and bdhB) and aldehyde / alcohol Dehydrogenase E (adhE) with the potential membrane-bound electron carrier OrfL (orfL).
  • the genes orfL, adhE, ctfA and ctfB form the polycistronic so / operon, which is located divergently to the adc operon (FIG. 1A).
  • FIG. 2 shows a schematic representation of the described sequence region on the megaplasmid pSOL1
  • the so / ß gene of the invention which encodes a small, non-coding, regulatory RNA (sRNA).
  • sRNA small, non-coding, regulatory RNA
  • the longest open reading frame (ORF) in this region ( Figure 2: positions 102 to 146) would code for a 14 amino acid protein. This ORF and all other ORFs 1 found are preceded by no conserved ribosomal binding site.
  • the potential promoter in the 5 'region of the so / 8 gene is active throughout the growth of the strain C. acetobutylicum on phosphate limited minimal medium, both in the acid and in the solvent phase.
  • the SolB transcript (SolB mRNA) is detectable in both phases, that is during the entire growth (FIG. 3).
  • Any vector capable of replication in C. acetobutylicum is preferably provided with a constitutive, preferably the pto-bu / c promoter (promoter of the C. acetobutylicum Phosphotransbutyrylase butyrate kinase operon) or alternatively preferably provided with an inducible promoter, preferably the / ux /?-Analogous.
  • a constitutive preferably the pto-bu / c promoter (promoter of the C. acetobutylicum Phosphotransbutyrylase butyrate kinase operon) or alternatively preferably provided with an inducible promoter, preferably the / ux /?-Analogous.
  • a promoterless, sequence of the ⁇ -gene may be cloned behind the promoter in order to arrive at a transgenic host cell according to the invention.
  • the nucleic acid molecule according to the invention is preferably (a) a DNA molecule which is or can be transcribed into a regulator, in particular an RNA molecule, or (b) an RNA molecule which itself acts as a regulator or with a transcription system in Interaction occurs, especially to regulate the expression of at least one of the genes encoding enzyme activity of acid and / or solvent production.
  • the nucleic acid molecule according to the invention or used according to the invention is characterized primarily by having or exclusively having at least one or more of the nucleic acid sequences which are selected from the sequences according to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, complementary sequences thereof as well as modified sequences and fragments, having with them at least 80%, especially at least 90% sequence match.
  • the nucleic acid molecule consists of one of these sequences, that is to say it has essentially no other nucleotides or preferably no further nucleotides.
  • the invention also encompasses those nucleic acid molecules which have homologous sequences thereto, but which are characterized in that they at least fulfill the function according to the invention of regulating or modulating the expression of the enzyme activity in the host cell (functional analogues).
  • Homologous sequences within the meaning of the invention are, above all, those sequences which are obtained by replacement or omission of one or more nucleotides in the sequence.
  • the person skilled in the art knows common methods of inversion, deletion, addition and nucleotide exchange here.
  • nucleic acid molecule having a homologous sequence 1 to 10% of the total number of nucleotides in the molecule is replaced, supplemented or removed, in particular from 1 to 20, preferably from 1 to 10, nucleotides in the above characteristic sequences.
  • the invention also encompasses functionally analogous nucleic acid molecules that are homologs to the nucleic acid molecules characterized herein.
  • the invention also encompasses functionally analogous nucleic acid molecules that are orthologues to the nucleic acid molecules characterized herein.
  • the person skilled in the art knows in this connection the possibilities of finding genetic homologues and orthologues; he uses databases and / or known bioinformatics analysis.
  • the invention also encompasses those functionally analogous nucleic acid molecules wherein one or more nucleotides are replaced by one or more nucleotide analogues, purine and pyrimidine derivatives.
  • the invention further encompasses genetically modified or mutated nucleic acid molecules derived therefrom which are characterized in particular by the fact that their transcription in the host cell is suppressed or a mutated transcript is obtained which has at least the function according to the invention of regulating or modulating the expression of the enzyme activity in the Host cell not met.
  • the person skilled in the art knows the possibilities of generating genetic mutations in this connection.
  • the skilled person makes use of known and established methods. These are preferably selected from: insertion, deletion, inversion, substitution and addition of at least one nucleotide.
  • mutated nucleic acid molecule is the provision of knock-out mutants of host cells, in particular the provision of solB knock-out mutants and the provision of knock-out mutants of homologues and / or orthologs thereof.
  • the preparation of the mutants is preferably carried out in a conventional manner.
  • a preferred method is homologous recombination. The invention is not limited to this method.
  • a nucleic acid molecule according to the invention is preferably present in expressible form and preferably in an expression cassette.
  • the nucleic acid molecule may be present therein simply or preferably in multiple copy. It is preferably present in the genome of the host cell. In a preferred variant, it is present in the chromosome. In another preferred variant, it is present in a plasmid or megaplasmid of the cell. In a preferred variant, it is exclusively or preferably additionally present in one or more expression vectors which have been introduced into the host cell. It is preferably present as a DNA molecule and is preferably transcribed into one or more RNA molecules.
  • the nucleic acid molecule of the invention is a regulator or is directly related to such a regulator which preferably regulates and preferably enhances at least one gene expression process selected from transcription and translation of at least one of the metabolic genes for at least one enzyme activity of acid and / or solvent production or preferably inhibits.
  • the at least one enzyme activity is encoded at at least one gene locus of the host cell, especially a clostridial cell, which is selected from the so / operon and the adc operon.
  • the RNA molecule according to the invention when present in high concentration in the cell, is a modulator and preferably a repressor of solvent formation, especially of butanol formation.
  • RNA molecule exerts the effect either alone or optionally in combination with other factors on the enzyme activity of the host cell.
  • Preferred factors or cofactors are RNA molecules, DNA molecules and proteins, for example in the form of co-repressors.
  • the invention provides a convenient use of the "solB gene” which is transcribable into a central regulator molecule (SolB transcript) of the enzymes of solvent synthesis, especially acetone and butanol formation "Gene”, preferably as a DNA molecule, as well as the use of its transcript, preferably as an RNA molecule, before, as the preferred means which allows the regulation of acid and / or solvent production in a host cell.
  • SolB transcript central regulator molecule
  • Gene acetone and butanol formation
  • the invention in addition to the SolB transcript of a SoIB wild-type, preferably of C. acetobutylicum, the invention also encompasses fragments and functional analogs thereof, that is to say molecules which interact in analogous functionality with the target RNA target or target DNA or target protein target ,
  • the invention encompasses their use for regulating or modulating gene expression in host cells, above all in solvent-forming clostridia and above all in connection with the regulation of the solvent and acid production in the host cells.
  • both the inventive SolB transcript and its analogs, derivatives and fragments according to the invention act as regulators directly on the RNA level, ie function as RNA molecules.
  • the molecule according to the invention itself is an RNA or an RNA analogue: advantageously, as in the case of coding RNAs, it is not necessary first to translate it into a protein or peptide. It may preferentially and directly exert the regulatory effect as so-called "small non-coding regulatory RNA" on the target structures.
  • This RNA is used in a preferred embodiment according to the invention for stimulating the production of short-chain carboxylic acids, especially butyric acid, especially in cells of the genus Clostridium, or especially in primary solvent-forming organisms.
  • target structures are understood to mean, in particular, effectors and molecules of the transcription apparatus and of the translation, which serve for the expression and synthesis of genetically encoded enzyme activities.
  • a functionally analogous to the SolB transcript nucleic acid molecule (functional analogue) binds to at least one of the regulatory binding sites in the genome of the organism, preferably to the regulatory elements of at least one gene involved in the production of acid and / or solvent.
  • a binding site may itself be an RNA transcript of this gene.
  • the RNA molecule according to the invention thus has at least the regulatory binding sequence with the SolB transcript in common.
  • the invention thus also relates to a fragment containing a regulatory binding sequence which is a functional analogue according to the invention.
  • This preferably has a sequence of a length of 5 bp or more, 6 bp or more, 7 bp or more, 8 bp or more, 9 bp or more, 10 bp or more, 11 bp or more, 12 bp or more or 15 bp or more homologous with or homologous with the binding sequence in the SolB transcript.
  • This binding sequence is preferably contained in the sequences of the invention disclosed herein or consists thereof.
  • the nucleic acid molecule according to the invention interacts with mRNA or a DNA strand of a specific target gene, that is to say a gene which codes for the enzyme activity or parts thereof of the solvent synthesis or acid synthesis in the cell.
  • the nucleic acid molecule according to the invention interacts with one or more cofactors, in particular in the form of proteins.
  • the interaction occurs particularly at complementary sequence regions of the target gene.
  • the sequence region of the interaction which results in an inventive regulation of the system, can be very short according to the invention.
  • about 9 bases (bp), for example 5 to 14 bases (bp), of the SoIB RNA molecule are sufficient for interaction with the target structure (interaction sequence).
  • the interaction with a target mRNA leads to its degradation and / or blockade of the associated ribosome binding site, so that the corresponding gene can not (further) be translated.
  • the interaction sequence is preferably found at several locations in the genome of the host cell, so that the nucleic acid molecule according to the invention can advantageously simultaneously bind a plurality of target structures and thus preferably act regulatively on genes for enzyme activities.
  • the nucleic acid molecule according to the invention in the host cell regulates all enzyme activities which are associated with the production of the solvent or acid production.
  • the nucleic acid molecule according to the invention thus advantageously allows the regulation of a plurality of functionally related targets.
  • the interaction with the mRNA of the target gene is carried out by SoIB alone or, analogous to an Hfq-mediated RNA system, as known from E. coli, optionally together with one or more helper proteins.
  • a reduced effective concentration of the SolB transcript causes a modified and especially increased solvent production in the cell.
  • the inventors found surprisingly that with the expression or the increased expression of the so / ß gene to increase the concentration of the SolB transcript in the cell or with the suppression of expression to reduce the concentration of the solB transcript in the Cell, which can regulate acid and / or solvent production in the cell.
  • An increase in the concentration of the SolB transcript or of a functional analogue according to the invention surprisingly leads to a reduction in the solvent synthesis and at the same time to an increase in acid production.
  • a reduction in the concentration of the SolB transcript or functional analogue increases an increase in solvent synthesis and a reduction in acid production.
  • means and methods for increasing acid production and in particular for reducing solvent production in a host cell are provided.
  • the invention relates in particular to measures for increasing the effective concentration of the So I B transcript or a fragment, derivative or analogue thereof which has the regulatory effect of the SolB transcript (functional analogue) in the host cell.
  • Increasing the effective concentration of the SolB transcript or its functional analog in a cell is achieved by measures known per se. Particularly preferred variants are shown in more detail below.
  • a transformed host cell for this purpose, in which the ⁇ -gene and / or one or more analogous constructs or derivatives thereof are expressed and particularly over-expressed.
  • This is preferably achieved by transforming the host cell, preferably by at least one expression vector which contains at least one or preferably several copies of a nucleic acid molecule according to the invention, a functional derivative, analog or fragment thereof, preferably in sense orientation.
  • the expression of the nucleic acid molecule according to the invention in the host cell is preferably under the control of at least one constitutive promoter, in particular a promoter, which can mediate its overexpression.
  • the promoter is the original promoter of the so / 8 gene from C. acetobutylicum or a homologous promoter.
  • the variant is the promoter of the constitutive btb-buk promotor, that is to say the promoter of the phosphotransbutyrylase-butyrate kinase operon of C. acetobutylicum or a functionally analogous promoter.
  • promoter-up methods for the direct modification of the promoter, especially the so-called "promoter-up” method, wherein in particular the endogenous so / ß promoter replaced by a stronger, especially a constitutive endogenous promoter ("super promotor”) or is supplemented or the promoter is changed or mutated in a conventional manner, so that it mediates a stronger expression (overexpression) of the so / ß-gene.
  • a sense construct as a DNA or RNA molecule is introduced directly into the cell. This is done, for example, by temporary disintegration of the cell membrane by electroporation or by bombardment of the cell ("gene gun") Alternative methods are well known to the person skilled in the art.
  • one or more plasmids are preferably used which contain one or more copies of the expression cassette according to the invention and / or one or more copies of the nucleic acid molecule according to the invention.
  • the invention accordingly also provides a vector which contains the ⁇ -gene, that is to say at least one nucleic acid molecule according to the invention, or its analog, fragment or derivative thereof, preferably in sense orientation.
  • the vector is constructed on the basis of the plMP1 vector. Vector maps of preferred vectors used are shown in FIGS. 3 and 4.
  • the invention also provides a process for producing a transgenic host cell with reduced solvent production and in particular increased acid production, comprising the steps:
  • the S / B gene or a functional analog, fragment or derivative thereof is overexpressed or the regulatory molecule according to the invention is increasingly synthesized in the host cell, so that the effective concentration of the regulator molecule, in particular of the solB transcript, increases.
  • the invention also relates to a genetically modified cell which has an acid or solvent metabolism modified with the agents and processes according to the invention.
  • This is especially a transgenic host cell which preferably contains at least one vector according to the invention and / or contains a nucleic acid molecule according to the invention in sense orientation, preferably exclusively as a heterologous gene and in expressible form.
  • a nucleic acid molecule according to the invention in particular the SoIB transcript or its functional analogues, is preferably produced directly, outside a biological organism, above all via a chemical synthesis.
  • the chemical synthesis of the nucleic acid molecule, in particular RNA molecule takes place in a manner known per se.
  • the invention thus also relates to processes for the chemical synthesis of the SolB transcript or a functional analogue used according to the invention.
  • the chemical synthesis preferably uses the sequences disclosed herein.
  • the invention also relates to the chemical synthesis of deoxyribonucleic acid molecules, above all of DNA molecules, which are transcribable into an RNA molecule according to the invention.
  • the invention also relates to the nucleic acid molecule, in particular RNA molecule, for modifying the expression of at least one enzyme activity in a host cell, wherein the molecule is selected from:
  • RNA molecules which are selected from the nucleic acid molecule according to the invention, preferably selected from: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, and preferably having its nucleotide sequence, and
  • RNA molecule according to the invention or a population containing at least one second or further variant of the molecule, can be introduced into the host cell in a manner known per se, preferably by applying an electric field (electroporation), whereby the cell membrane of the living cells can be used in the short term these small molecules are rendered permeable without complete disintegration of the cells.
  • a transformation of the host cells is not necessary.
  • the regulation by the at least one externally introduced RNA molecule with the function or binding activity of the SolB transcript according to the invention can be carried out directly.
  • the invention also provides a process for increasing the production of acid, in particular the synthesis of short-chain carboxylic acids, in particular acetate and / or butyrate, in a host cell and improved processes for their biotechnological production.
  • at least one host cell in particular of the genus Clostridium, is provided and at least one RNA molecule with the function or binding activity of the SolB transcript according to the invention is introduced into the host cell.
  • the host cell modified in this way is preferably cultured in the presence of a metabolizable substrate, under conditions which allow the formation of the carboxylic acid from the substrate.
  • a solB knock out mutant of a host cell especially a solvent-forming cell of the genus Clostridium.
  • a solB knock out is produced by measures known per se, in particular by homologous recombination.
  • the invention preferably provides one or more measures known per se, preferably selected from deletion, substitution, insertion and inversion, in particular point mutation, of the ⁇ -gene or its homolog or orthologue or other functional analog in the host cell.
  • an alternative embodiment of this is the antisense inhibition of the so / ß gene, its homolog or orthologue or other functional analog in the host cell.
  • the effective concentration of the SolB transcript in the cell is reduced by introducing, preferably by transformation, one or more antisense constructs, preferably in the form of one or more expression vectors, into the cell.
  • one or more plasmids are preferably used which preferably contain one or more copies of the antisense construct in one or more expression cassette according to the invention.
  • the antisense construct is introduced as a DNA or RNA molecule in a manner known per se directly into the cell. This is done for example by temporary disintegration of the cell membrane by electroporation or by bombardment of the cell (gene gun). Alternative methods are well known to those skilled in the art.
  • the invention also relates to nucleic acid molecules which constitute an antisense construct of an endogenous ⁇ -gene, its homologue or orthologue or other functional analogue or a fragment thereof.
  • nucleic acid molecules according to the invention are derived by inversion from the aforementioned nucleic acid molecules in a manner known per se. It is understood that the invention relates to all analogs, fragments or derivatives thereof which enable the antisense inhibition according to the invention of the ⁇ -gene of a host cell according to the invention. One skilled in the art can readily provide such fragments.
  • fragments of the so / ⁇ gene are the following fragments of the so / ⁇ gene: 3'-so / ⁇ 75 bp (SEQ ID No: 7), 3'-so / ⁇ 115 bp (SEQ ID No: 8), 5'-so / 72Bp (SEQ ID No: 9), 5'-so / 102Bp (SEQ ID No: 10).
  • fragments of the ⁇ -gene are cloned in an antisense orientation in an expression vector and thus the host cell, preferably a solvent-forming Clostridium cell, is transformed.
  • the invention accordingly also provides a vector for suppressing the expression of the ⁇ -gene in the cell.
  • This contains a ⁇ -gene construct, ie at least one nucleic acid molecule according to the invention or its analogue, fragment or derivative thereof, preferably in antisense orientation.
  • a ⁇ -gene construct ie at least one nucleic acid molecule according to the invention or its analogue, fragment or derivative thereof, preferably in antisense orientation.
  • one or more copies of the nucleic acid molecule are in anti- sense orientation in expressible form, preferably in at least one expression cassette before, particularly preferably in conjunction with a constitutive or inducible promoter.
  • the vector is constructed on the basis of the plMP1 vector. Vector maps of preferred vectors used are shown in Figures 5 and 6.
  • the invention also provides a process for producing a genetically modified host cell with modified, in particular with increased, solvent production, comprising the steps:
  • nucleic acid molecule or vector according to the invention comprising at least one modified S / S gene construct, ie at least one nucleic acid molecule according to the invention or its analogue, fragment or derivative thereof, preferably in antisense orientation, into the host cell,
  • the regulator molecule according to the invention in particular the SoIB transcript, is synthesized in a reduced manner in the host cell so that the effective concentration of the regulator molecule is reduced.
  • the subject matter of the invention is also a host cell which has an acid or solvent metabolism modified with the agents and processes according to the invention.
  • This is especially a transgenic host cell, which preferably contains at least one vector according to the invention and / or an inventive Nucleinklakül in antisense orientation, preferably exclusively as a heterologous gene and in expressible form contains.
  • the invention also relates to processes for increasing solvent production, especially butanol production, in a host cell and to improved processes for the biotechnological production of solvents, especially butanol, to provide at least one such modified host cell, especially of the genus Clostridium.
  • the invention also relates to processes for the biotechnological production of solvents, in particular acetone and / or butanol production.
  • the host cell modified according to the invention is cultured, preferably in the presence of a metabolizable substrate, preferably under conditions which allow the formation of solvents, in particular of acetone and / or butanol, from the substrate.
  • a metabolizable substrate preferably under conditions which allow the formation of solvents, in particular of acetone and / or butanol, from the substrate.
  • the invention also provides a process for the preparation of a host cell with modified, in particular with increased, solvent production, comprising the steps:
  • nucleic acid molecule in the form of a, preferably externally synthesized, in particular isolated, RNA molecule, in antisense orientation into which
  • Host cell so that the so / B gene and / or its functional analogue, homolog or orthologue is suppressed or the effective concentration of the transcript is reduced.
  • the particularly modified, particularly transgenic, host cell according to the invention referred to therein is preferably selected from organisms of the genus Clostridium, especially the solvent-forming genera, more preferably from C. beijerinckii, C. saccharobutylicum, C. saccharoperbutylacetonicum and C. acetobutylicum.
  • the invention is not limited to these cells.
  • the invention is also applicable, for example, to acid- and / or solvent-forming transgenic host cells which have the enzyme equipment for the production of acid and / or solvent, in particular also homologous or orthologous genes to the solvent-forming clostridia.
  • the cultivation of the acid and / or solvent-forming host cell provided according to the invention can be carried out in co-cultivation with other cells of the same genus, which are in metabolic exchange with the host cells modified according to the invention.
  • other non-generic organisms can be used to increase the substrate spectrum. The person skilled in the art knows the possibilities of co-cultivation.
  • the substrate for the synthesis of acid and / or solvent according to the invention is preferably a carbon-containing substrate.
  • This is preferably vegetable material, which preferably contains a high proportion of carbohydrates, especially starch, lignocellulose, cellulose and / or sugar, as well as fiber material derived therefrom, extract obtained therefrom, molasses obtained therefrom, from recovered pulp and / or derived juice.
  • a preferred plant material is corn and / or the products derived therefrom.
  • Another preferred plant material is the sugar beet and / or the products derived therefrom.
  • Another preferred plant material is sugar cane and / or derived products, bagasse etc.
  • Preferred cereals are rice, wheat, barley, rye, oats.
  • Preferred sources of starch or sugar are horse chestnut, potato, batata, artichoke, cassava, chicory and soy.
  • Preferred lignocellulosic and cellulose sources are nutshells, wood, especially softwood, and fiber material derived therefrom, and wood waste, fruit peel and squeezed fruits such as grapes and citrus fruits, cereal straw, maize straw and bagasse.
  • co-cultures with primarily cellulose-metabolizing organisms can also be used.
  • the invention also relates to binding complexes which are associated with the regulation of solvent or acid production in the host cell, consisting of or comprising at least one nucleic acid molecule according to the invention, or its functionally analogous fragment, derivative or analog, having at least one target structure containing the binding site.
  • Binding complexes according to the invention are preferably obtained by processes having at least the following steps:
  • nucleic acid molecule which is preferably an RNA molecule
  • the structure preferably has a homologous base sequence with a complementary sequence homologous with the nucleic acid molecule according to the invention or a homologous sequence section thereof.
  • kit-of-parts which contains, or preferably consists of, at least one of the molecules or constructs described herein, especially in isolated form, for modulation of acid and / or solvent production in one herein closer characterized host cell.
  • the invention also provides a kit-of-parts containing at least one of the transgenic host cells described herein, wherein the effective concentration of the SolB transcript or a functionally analogous derivative or fragment thereof is increased compared to the wild type of the cell, or preferably consists of, for the biotechnological production of short-chain carboxylic acid.
  • the invention also provides a kit-of-parts which contains at least one of the transgenic host cells described herein wherein the effective concentration of the SolB transcript or a functionally analogous derivative or fragment thereof is reduced compared to the wild type of the cell preferably consists of, for the biotechnological production of solvents.
  • the invention also relates to the use of the molecules or constructs or kits for modulating the acidity described herein. and / or solvent production in a host cell characterized in more detail herein.
  • Preferred is the use for increasing the solvent synthesis.
  • Particularly preferred is the use for the synthesis of acetone.
  • Particularly preferred is the use for the synthesis of butanol.
  • use to increase acid synthesis is preferred. Particularly preferred is the use for the synthesis of acetate or acetic acid. Particularly preferred is the use for the synthesis of butyrate or butyric acid.
  • the cells were counted after centrifugation (14,000 rpm, 4 0 C, 1 min) rapidly in 2 ml reaction vessels schockgefro- in liquid nitrogen ren.
  • the cell pellet was resuspended in 0.7 ml ice-cold buffer ASE (see below) and were immediately resuspended 0.7 ml to 60 0 C heated Aqua phenol TM (water-saturated phenol; QBiogene company) was added and mixed vigorously for 30 sec. The mixture was then incubated for 10 min at 6O 0 C. The two phases were kept in suspension by repeated mixing.
  • RNA or DNA was achieved by addition of 2.5 vol. Ice-cold ethanol (96% v / v) and incubation for at least 30 min at -20 0 C. After centrifugation (14000 rpm, 30 min, 4 0 C) the sediment with 1 ml of ethanol (70%, v / v) was washed and centrifuged again. Finally, the sediment was dried in a SpeedVac vacuum centrifuge. Depending on the density of the culture used at the beginning, the sediment was taken up in 20-50 ⁇ l of DEPC water (diethylpyrocarbonate). RNA prepared in this manner often still showed contamination with DNA so that DNase treatment could be connected.
  • DEPC water diethylpyrocarbonate
  • RNase-free DNase deoxyribonuclease I, RNase free, Fermentas company
  • 20 ⁇ l of 10 ⁇ DNase buffer (10 ⁇ Reaction Buffer with MgCl 2 , Fermentas GmbH) and 50 U DNase I were included.
  • 20 ⁇ l of Na acetate solution (3 mol / l, pH 5.2) were added and phenol-chloroform extraction and ethanol precipitation were carried out.
  • RNA that was completely DNA-free this treatment could be repeated once or twice.
  • a standard PCR was used on the RNA. In the case of fully digested DNA, no specific PCR product was seen in the EtBr-stained agarose gel.
  • RNA was stored in 20-50 ul DEPC-water at -7O 0 C.
  • the DNA or RNA solution was admixed with 1 vol of phenol / chloroform / isoamyl alcohol (25: 24: 1, v / v / v) for 30 sec mixed and centrifuged for phase separation (13000 rpm, 5 min, RT). The upper aqueous phase was then transferred to a new reaction vessel and the procedure was repeated until no protein interphase could be detected after centrifugation. Thereupon, in order to remove any phenol residues, in a new reaction vessel, 1 volume of chloroform / isoamyl alcohol (24: 1, v / v) was added to the upper phase, mixed for 30 seconds and centrifuged again. The upper, DNA-containing phase was finally precipitated with ethanol.
  • RT-PCR was used to transcribe RNA into single-stranded cDNA using the enzyme reverse transcriptase.
  • a specific product was amplified in a second step, which corresponds to a standard PCR.
  • An amplicon was only obtained if the corresponding mRNA of a gene or an operon was formed in the course of transcription.
  • the SolB transcript approximately 500 ng of total RNA were used as template for each RT-PCR batch.
  • the primer used was snRNA_R (reverse primer) for cDNA synthesis and the subsequent PCR was complemented with the primer snRNA_F (forward primer). In the negative controls, the reverse transcriptase was replaced by water.
  • RNA 0.01-0.5 ⁇ g
  • Reverse primer (20 ⁇ mol / L): 1.5 ⁇ l (2.7 ⁇ mol / L)
  • RNase-free water ad 11 ⁇ l. The mixtures were incubated for 5 min at 70 ° C. and then rapidly cooled to 4 ° C.
  • RT reaction buffer 5x: 4 ⁇ l (1x); dNTP mixture (10 mmol / l): 2 ⁇ l (1 mmol / l); Ribolock TM (Fermentas Company) (40 U / ⁇ l): 1 ⁇ l (40 U); M-MuLV reverse transcriptase (Fermentas company) (20 U / ⁇ l): 2 ⁇ l (40 U), the samples were incubated for 1 h at 37 0 C. For a negative control, the reverse transcriptase was replaced with 2 ⁇ l of water.
  • Taq polymerase (1 U / ⁇ l) 5 ⁇ l (5 U); (NH 4 ) 2 SO 4 - reaction buffer (10x): 5 ⁇ l (1x); Forward primer (20 ⁇ mol / L): 1.5 ⁇ l (0.6 ⁇ mol / L); H 2 O: ad 50 ⁇ l.
  • the DNA fragments were separated and evaluated in a non-denaturing agarose gel electrophoresis.
  • the standard PCR for plasmid detection was carried out with Taq DNA polymerase (Fermentas GmbH).
  • Taq DNA polymerase Fermentas GmbH
  • the polymerase “PowerScript DNA Polymerase Short” (PAN-Biotech) or "High Fidelity PCR Enzyme Mix” (Fermentas) was used.
  • a typical PCR mixture contained the following components: Reaction Buffer (10X): 5 ⁇ l (1x); MgCl 2 (25 mmol / L): 3 ⁇ l (1.5 mmol / L); Primer A (100 ⁇ mol / L): 1 ⁇ l (2 ⁇ mol / L): Primer B (100 ⁇ mol / L): 1 ⁇ l (2 ⁇ mol / L); Template DNA; dNTP mixture (10 mmol / l): 1 ⁇ l (200 ⁇ mol / l); Polymerase: 1-2 ⁇ l (2-5 U); H 2 O: ad 50 ⁇ l.
  • PCR program Vorabdenatu- turing 3-5 min at 95 0 C; 32 cycles: denaturation 45 seconds at 95 0 C 1 hybridization 45 sec Temp variable elongation 0.5-1 min / 1 OOOnt at 72 0 C, elongation for 5 min at 72 0 C;. End: cooling at 12 0 C.
  • FIG. 7 shows the result of the qualitative RT-PCR for the investigation of the transcription of the ⁇ -gene: (-): Negative control of the corresponding sample (replacement of the reverse transcriptase by water), (+): RT-PCR of the corresponding sample, ( S): size standard (about 500 ng total RNA per RT-PCR-approach)
  • the potential promoter in the 5 'region of the so / ⁇ gene is active throughout the growth of strain C. acetobutylicum on phosphate limited minimal medium, both in the acid and in the solvent phase.
  • the SolB transcript (SolB mRNA) is detectable in both phases, ie throughout the growth.
  • Clostridium acetobutylicum ATCC 824 type strain for the methylation of plasmids: E. coli ER 2275 (trp-31, his-1, tonA2, rpsL104, supE44, xyl-7, mtl-2, metB1, e14-, ⁇ (lac) U169, endA1, recA1, R (zbgZ10 :: Tn10) Tcs, ⁇ (mcr-hsd-mrr) 114 :: 1510 [F proAB 1, laclqZ ⁇ M15, ZZD :: mini Tn10 (Km r)])
  • E. coli XL2-Blue (recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1, lac, [(F 1, proAB, laclqZ ⁇ M15, Tn10 Tet r) Amy CamR]) and E. coli XL1-Blue MRF ( ⁇ (mcrA) 183, ⁇ (mcrCB-hsdSMR-mrr) 173, endA1, supE44, thi-1, recA1, gyrA96, relA1, lac, [F, proAB, laclqZ ⁇ M15, Tn 10 (Tetr) ])
  • the plasmid pIMP1 is a fusion consisting of the E. coli cloning vector pUC18 and the B. subtilis plasmid pIM13, whose origin of replication and MLSr resistance determinant (ermC) enable the replication or clarithromycin resistance of C. acetobutylicum.
  • the copy number of plMP1 in this organism is 6-8 copies / cell.
  • the plasmids pBS1 to pBS17 were constructed according to the plasmid maps according to FIGS. 4 to 6.
  • the constitutively strong promoter of the C. acetobutylicum phosphotransbutyrylase-butyrate kinase (pttHbw / c) operon was synthesized using the oligonucleotides KL08 (SEQ ID NO: 11) and KL09 (SEQ ID NO: 12) amplified in a standard PCR (see Example 1) with chromosomal DNA as a template. After EcoRI-Ndel digestion, this 123 bp fragment was ligated into appropriately digested plMP1 plasmid.
  • ET buffer corresponds to ETM buffer without MgCl 2
  • C. acetobutylicum has with Cac824l a type II restriction endonuclease which recognizes and cuts the sequence motif 5'-GCNGC-3 '.
  • the methylation of the internal cytosine residue in the base sequences 5'-GCNGC-3 'or 5'-GGCC-3' by the methyltransferase ⁇ 3TI of the ⁇ . subtilis phage ⁇ 3T leads to a prevention of restriction by Cac824l. Since it could be shown that such methylated plasmid DNA could be transferred to C. acetobutylicum with a transformation efficiency which was two orders of magnitude higher than correspondingly unmethylated plasmid DNA, all plasmids constructed in this work were transferred to C. acetobutylicum should be subjected to such methylation.
  • the plasmids intended for electroporation in C. acetobutylicum were preferably methylated in vivo with the methyltransferase coded on the plasmids pAN1 or pANS1.
  • the E. coli strains ER2275 or XL1-Blue MRF 1 were used for this because they do not have any of the restriction systems McrA, McrBC and Mrr. These would cut DNA in which the cytosine of the sequence 5'-CG-3 'is methylated.
  • the plasmids pAN1 or pANS1 were first established in these strains and then transformed with the plasmid to be methylated.
  • the p15A origin of replication of pAN1 or pANS1 was compatible with the CoIEI replicon. All plasmids constructed for purposes of transformation of C. acetobutylicum carried this replicon.
  • the thus modified plasmid DNA was isolated from the E. coli strains by minipreparations.
  • the plasmids had to be pAN1 and pANS1 should not be removed separately from the plasmid preparations because they do not replicate in C. acetobutylicum.
  • Successful methylation was verified by restriction with Fnu4HI or Satl, methylation-sensitive isoschizomers of Cac824l.
  • the strains E. coli XL1-Blue MRF 'and XL2-Blue were used because they have a high transfusion efficiency.
  • a stock culture was first streaked on an LB plate with a suitable antibiotic for selection and incubated overnight at 37 ° C. A single colony was then transferred into 5 ml of LB medium with antibiotic and again LIN shaking at 37 0 C shaking incubated. This preculture was used as the inoculum for the main culture, 250 ml of SOB medium with antibiotic. At 18 0 C, the culture was shaken until an OD 6 oo of 0.5-0.6 (about 12-20 h) was reached. The cells were incubated for 10 min on ice and by centrifugal gation (5000 rpm, 10 min, 4 0 C) harvested.
  • the cell pellet was washed in 80 ml of ice-cold PIPES buffer, incubated on ice for 10 min and centrifuged again as described. Subsequently, the sediment was taken up in 20 ml of PIPES buffer and slowly, during a 1 minute incubation on ice, with DMSO (1, 5 ml, corresponding to a final concentration of 7%, v / v). Aliquots of 200 ⁇ l were pipetted into precooled 1.5 ml tubes and snap-frozen immediately in liquid nitrogen. At -70 C C, the cells could be stored without apparent degradation of transformation efficiency.
  • plasmid DNA or ligation mixture (up to 20 ul) was added by pipetting. After an incubation of 30-40 min on ice, the cells were exposed to a one-minute heat shock at 42 0 C, cooled briefly on ice and mixed with 800 ul LB medium. Immediately following incubation at 37 0 C with gentle shaking for 45-60 min. In the case of transformation of plasmids 20-50 .mu.l of the batch were plated on appropriate selection medium.
  • the batch was centrifuged (1000 rpm, 30 sec, RT), 850 ⁇ l of the supernatant were discarded, the cells were suspended in the remaining 150 ⁇ l of medium and these were plated out completely on selection medium.
  • DNA can be transferred with greater efficiency compared to artificially induced transformation.
  • E. co // - cells 250 ml LB-medium were inoculated with the overnight pre-culture of the ent-speaking strain and incubated to an OD600 of 0.6-0.8, shaking at 37 0 C. The culture were oo in achieving the desired OD 6 15 min on ice cooled and the cells are then collected by centrifugation (5000 rpm, 10 min, 4 0 C) harvested. The sediment was washed 2x with 250 ml of ice-cold water and twice in 10-30 ml of ice-cold glycerol (10%, v / v).
  • the cell pellet was finally taken up in 1 ml of ice-cold glycerol (10%, v / v), and the cell suspension was either immediately electroporated into 50 ⁇ l aliquots or snap frozen in liquid nitrogen. At -70 0 C for up to three months, the cells could be stored.
  • the appropriate amount of aliquots 50 ⁇ l per transformation
  • 100 ⁇ g of plasmid DNA were used, and in the electroporation of E.
  • coli ER2275 [pAN1] cells 1 ⁇ g of plasmid DNA was used. Ligation approaches had to be dialyzed before transformation if more than 100 ng of DNA were used per transformation approach.
  • the DNA was added to the cells on ice and the batch electroporated immediately.
  • a Gene Pulser-II with Pulse Controller Plus Bio-Rad Laboratories GmbH
  • the time constant was 4.6 to 4.9 ms.
  • 1 ml of LB medium was immediately added to the mixture, the cell suspension was transferred into a 1.5 ml reaction vessel and this was incubated for 1 h at 37 ° C. with shaking. Aliquots of 100-250 ⁇ l were then plated on LB selection medium.
  • the "peqGOLD Plasmid Miniprep” was used to isolate clean plasmid DNA in a short time using approximately 4 ml of E. coli overnight culture (yielding approximately 10 ⁇ g of plasmid DNA, depending on the E. coli used). co // strain) The exact execution of the individual work steps was carried out according to the manufacturer's instructions.
  • restriction digestion of DNA for analytical and preparative purposes was carried out according to the recommendations of the manufacturer in a volume of 10-200 ul at 37 0 C for usually 1 h.
  • the reaction could be stopped by heat inactivation (enzyme dependent, according to the manufacturer), phenol-chloroform extraction or purification with the "UltraClean15 Kit" (company Fermentas)
  • a buffer system was used in which all enzymes at least 50-100%
  • digestion of PCR fragments should take into account the fact that restriction enzymes usually require a certain nucleotide overhang to cut efficiently Therefore, in the production of such PCR fragments, which carried interfaces at the end of the DNA strand, care was taken to generate a nucleotide overhang of 5-8 bases, for each 1 ⁇ g of DNA approximately 10 U or at least 10 U of the restriction enzyme is used, 1 U is defined as the amount of enzyme necessary to produce 1 ⁇ g ⁇ -DNA at 37 0 C completely split in 60 min. Restriction digestion was checked by agarose gel electrophoresis.
  • Ligations were performed in 20 ⁇ l batches. As a rule, a molar ratio of vector to insert of 1: 3 to 1: 5 was sought.
  • the growth course of a bacterial culture was monitored by the increase in optical density (OD) using a spectrophotometer at a wavelength of 600 nm. The measurement was carried out in a 1 ml semi-micro-cuvette (layer thickness 1 cm) with appropriate medium as reference value. In order to ensure a linearity between the increase of the extinction and the number of cells, the samples were diluted with medium from absorbance readings of 0.4.
  • OD optical density
  • a precision pH meter was used for the determination of the pH of culture supernatants. To avoid contamination of the measuring electrode, the culture was centrifuged (10,000 Rpm, 10 min, room temperature) and the supernatant is transferred to a test tube.
  • the evaluation was done by Maestro Sampler Il Version 2.5 (company Chrompack). To enable a quantification of the samples Calibration runs were carried out with acetate, acetoin, acetone, butanol, butyrate and ethanol in the concentration 5 mmol / l. The automatic evaluation was based on the peak area calculation of calibration and internal standard.
  • RNA fragment of the SolB transcript (SolB mRNA) was synthesized. This RNA molecule was introduced into the Clostridia wild types by means of electroporation (see Example 2). The clostridia thus treated were cultured according to Example 2 and the product spectrum was analyzed.
  • Example 4 Product Spectra of Strains C. acetobutylicum plMP1 and C. acetobutylicum solB sense
  • the mutant C. acetobutylicum plMP1 carries the vector plMP1 without such / ß-construct. This strain serves as a control.
  • the mutant C. acetobutylicum solB sense carries the plasmid pBS1.
  • the plasmid was constructed based on the plMP1 vector. This vector was coated with the constitutive ptö-bu / c promoter. hen (promoter of Phosphotransbutyrylase butyrate kinase operon). Behind the promoter, the promoterless so / ⁇ gene was cloned in se ⁇ se orientation.
  • the vector map is shown in FIG.
  • FIGS. 8A to 8C show the product spectra of the growth tests of the type strain C. acetobutylicum ATCC 824 (wild type), FIG. 8A, a C. acetobutylicum plMP1 mutant, FIG. 8B, and the C. acetobutylicum solB sense mutant (according to the invention), FIG. 8C, in phosphate-limited minimal medium; Concentrations in mmol / l (mM).
  • Figures 9A and 9B show the acetone production, Figure 9A, and butanol production, Figure 9B, of the type strain C. acetobutylicum ATCC 824 (wild-type), Figure 9A, and the C. acetobutylicum solB sense mutant (according to the invention), Figure 9B, on phosphate-limited minimal medium; Concentrations in mmol / l (mM).
  • the type strain C. acetobutylicum ATCC 824 (wild type) and the C. acetobutylicum plMP1 mutant (control) produced an average of max. about 15 mmol / l acetone and about 70 mmol / l butanol:
  • the plasmid construct plMP1 has no discernible influence on the product spectrum of the host cell.
  • the C. acetobutylicum solB se ⁇ se mutant produces about 2 mmol / l acetone and about 2 to 15 mmol / l butanol. It produces about 90% less acetone and butanol than the type strain C. acetobutylicum ATCC 824 (wild-type).
  • Example 5 Product spectra of C. acetobutylicum synth. SolB sense mutants
  • SolB sense carries the plasmid pBS7.
  • the plasmid was constructed on the basis of the plMP1 vector.
  • the solB gene was cloned with its own promoter into the multiple cloning site of the vector (bamHI and EcoRI). The vector map is shown in FIG.
  • FIGS. 10A to 10C show product spectra of the growth tests of the type strain C. acetobutylicum ATCC 824 (wild type), FIG. 10A, a first C. acetobutylicum synth.
  • SolB sense mutant (according to the invention), FIG. 10B, another C. acetobutylicum synth.
  • SolB sense Mutant accordinging to the invention
  • FIG. 10C and still another C. acetobutylicum synth.
  • SolB sense mutant accordinging to the invention
  • FIG. 10D in phosphate-limited minimal medium; Concentrations in mmol / l (mM).
  • FIGS. 11A and 11B show the acetone production, FIG. 11A, and butanol production, FIG. 11B, of the type strain C. acetobutyl cum ATCC 824 (wild type), a first C. acetobutylicum synth.
  • SolB sense mutant (according to the invention), another C. acetobutylicum synth.
  • solB sense mutant (according to the invention) and still another C. acetobutylicum synth. solB se ⁇ se mutant (according to the invention) on phosphate-limited minimal medium; Concentrations in mmol / l (mM).
  • the type strain C. acetobutylicum ATCC 824 (wild-type) produces on average about 15 mmol / l acetone and about 70 mmol / l butanol. All C. acetobutylicum synth. SolB sense mutants produce almost no acetone and butanol.
  • Example 6 Product Spectra of C. acetobutylicum svnth. such as antisense mutants
  • the mutants C. acetobutylicum synth. SolB antisense carry the plasmid pBS13.
  • the plasmid was constructed on the basis of the plMP1 vector.
  • the promoter and the terminator of the solB gene were in se ⁇ se orientation, the rest of the so / ß gene (137 bp) as well as in other vectors fragments of the so / ß gene (3'so / ß 75 bp (pBS14) , 3'so / ß 115 Bp 1 (pBS15), 5'so / ß 72 bp (pBS16), 5'so / ß 102 bp (pBS17), were cloned in an anissense orientation between them.
  • the vector maps are shown in Figs 6A to 6D.
  • FIG. 12A shows the acetate production and FIG. 12B shows the butyrate production of the type strain C. acetobutylicum ATCC 824 (wild-type) and a C. acetobutylicum solB sense mutant (according to the invention) on phosphate-limited minimal medium; Concentrations in mmol / l (mM).
  • the cultivation of the cells was carried out according to the preceding examples.
  • the type strain C. acetobutylicum ATCC 824 (wild-type) produces up to about 66 mmol / l acetate
  • the mutant according to the invention C. acetobutylicum solB sense produces max. about 60 mmol / l acetate
  • the type strain C. acetobutylicum ATCC 824 (wild type) produces up to about 50 mmol / l butyrate
  • a mutant according to the invention C. acetobutyl cum solB sense produces about 105 mmol / l butyrate.
  • the mutant according to the invention C. acetobutylicum solB sense produces about twice as much butyrate as the wild type.
  • FIG. 13A shows the acetate production and FIG. 13B the butyrate production of the type strain C. acetobutylicum ATCC 824 (wild-type) and three C. acetobutylicum synth.
  • SolB sense mutants (according to the invention) on phosphate-limited minimal medium; concentration- in mmol / L (mM). The cultivation of the cells was carried out according to the preceding examples.
  • the type strain C. acetobutylicum ATCC 824 (wild-type) produces here up to about 55 mmol / l acetate, the mutants of the invention C. acetobutylicum synth. SolB sense produce up to about 30 mmol / l acetate.
  • the type strain C. acetobutylicum ATCC 824 (wild type) produces up to about 50 mmol / l butyrate, the mutants according to the invention of C. acetobutylicum synth.
  • SolB sense produce about 105 to 110 mmol / l butyrate.
  • the mutants of the invention C. acetobutylicum synth. SolB sense, produce about twice as much butyrate as the wild type.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Die Erfindung betrifft Verfahren und Mittel zur biotechnologisch fermentativen Herstellung von Lösungsmitteln, besonders von Butanol, Aceton und Ethanol, sowie von kurzkettigen Carbonsäuren wie Essigsäure und Buttersäure, besonders in Wirtszellen der Gattung Clostridium. Die Erfindung stellt neue Verfahren und Mittel zur Regulation der Expression von an der Säure- und/oder Lösungsmittelproduktion der Wirtszelle beteiligten Enzymaktivitäten bereit.

Description

VERBESSERTE SÄURE- UND LÖSUNGSMITTELPRODUKTION IN MIKROORGANISMEN
Beschreibung
Die Erfindung betrifft Verfahren und Mittel zur biotechnologisch fer- mentativen Herstellung von Lösungsmitteln, besonders von Butanol, Aceton und Ethanol, sowie von kurzkettigen Carbonsäuren wie Essigsäure und Buttersäure, besonders in Wirtszellen der Gattung Clostridium. Die Erfindung stellt neue Verfahren und Mittel zur Regulation der Expression von an der Säure- und/oder Lösungsmittelproduktion der Wirtszelle beteiligten Enzymaktivitäten bereit.
Stand der Technik
Einige Stämme der Gattung Clostridium, besonders Clostridium ace- tobutylicum, sind in der Lage, Lösungsmittel, vor allem Butanol, Aceton und Ethanol, aus Kohlenstoffquellen wie Kohlenhydrate, beispielsweise Monosaccharide, Disaccharide, Stärke und andere Polysaccharide, zu bilden. Die biotechnologische Lösungsmittelproduktion aus Clostridien ist als ABE-Verfahren seit den 1920er Jahren be- kannt (US 1 ,315,585, Weizmann et al.). Ab den 1950er Jahren war dieses Verfahren durch die Fortschritte in der Petrochemie jedoch wirtschaftlich uninteressant. Bei steigenden Rohölpreisen und der Forderung nach erneuerbaren Energie- und Rohstoffressourcen werden fermentative Verfahren zur Synthese von Energieträgern und Rohstoffen in jüngster Zeit sowohl unter wirtschaftlichen als auch unter ökologischen Gesichtspunkten wieder attraktiv. Im Stand der Technik sind sowohl diskontinuierliche (batchweise) als auch kontinuierliche Fermentationsverfahren bekannt. Die Butanol- ausbeuten bei der Fermentation von Kohlenhydraten mittels Clostri- dien sind bei bekannten Verfahren noch zu gering, um wirtschaftlich attraktiv zu sein. Zur Steigerung der Ausbeute und der volumetri- schen Produktivität sind inzwischen Mutanten und transgene Clostri- dien entwickelt worden. Teilweise werden verschiedene Clostridien- populationen co-kultiviert. Auch die kontinuierliche Fermentation wurde weiterentwickelt. Dennoch zeigt sich, dass die mit diesen Mit- teln erreichbaren Steigerungen noch zu gering ausfallen. Außerdem benötigen die transgenen Organismen spezielle Anforderungen bei der Kultivierung und sind instabil, was das biotechnologische Verfahren erschwert und verteuert. Es ist daher wünschenswert, die Ausbeutekapazität der Lösungsmittelproduktion in Mikroorganismen ins- besondere der Gattung Clostridium weiter zu verbessern.
Eine unkontrollierbare Steigerung der Lösungsmittelproduktion ist nicht erwünscht. In Co-Kulturen, die zur Erweiterung des Substratspektrums oder zur Steigerung der Ausbeute bekanntermaßen eingesetzt werden, können auch lösemittelempfindliche Organismen vorhanden sein, sodass eine gezielte Steuerung und Regulation der Lösungsmittelproduktion/Lösungsmittelkonzentration im Kulturmedium erforderlich wird.
Buttersäure ist ein wichtiger Rohstoff für die Herstellung von Buttersäureestern, welche beispielsweise als Duft- und Aromastoffe Ver- wendung finden, von Zellulosebutyrat, einem witterungsbeständigen und schlagfesten Kunststoff, sowie von Schädlingsbekämpfungsmitteln. Buttersäure und Butyrat sind außerdem in der Prophylaxe und Therapie des menschlichen und tierischen Körpers von Bedeutung. Die Produktion von Butyrat (und auch Acetat) als Stoffwechselpro- dukt probiotischer Darmbakterien trägt zum Erhalt und zur Wiederherstellung der Darmepitelfunktion bei. Extern zugeführtes Butyrat wird seit kurzem zur Prophylaxe und Therapie entzündlicher Darmerkrankungen eingesetzt. Niedrige Konzentrationen von Butyrat im Dickdarm können hingegen Krankheiten auslösen und beispielsweise die Differenzierung von Kolonkarzinomzellen bewirken. Mikroorganismen die fakultativ kurzkettige Carbonsäuren wie Butyrat bilden, insbesondere Bakterien der Gattung Clostridium kommen natürlicherweise im Darm insbesondere von monogastrischen Tieren und dem Menschen vor. Es ist wünschenswert, Organismen insbesondere Clostridien als probiotische Organismen einsetzen zu können, um die Gesunderhaltung des Darms zu erreichen und insbesondere die Therapie chronisch entzündlicher Darmerkrankungen, Durchfallerkrankungen, Reizdarm und Verstopfung zu ermöglichen.
Neben der Lösungsmittelproduktion kommen solche Mikroorganismen auch zur biotechnologischen Herstellung von kurzkettigen Carbonsäuren, insbesondere Buttersäure und Essigsäure, und insbesondere im großtechnischen Maßstab, in Betracht. Während Buttersäure bisher auf klassisch chemischem Wege in der Regel durch die katalytische Oxidation von Butanol oder durch eine Oxo-Synthese aus Propen und Kohlenstoff monoxid synthetisiert wird, erfolgt die biotechnologische Herstellung von Buttersäure hauptsächlich durch die direkte Vergärung von C2-C6 Körpern, vor allem von Kohlenhydraten wie Glucose oder Spaltungsprodukten wie Glycerol. Vorteil- hafterweise bedarf die biotechnologische Synthese keiner petroche- mischer Ausgangsverbindungen wie Propen, so dass eine von petro- chemischen Verfahren unabhängige Produktion aus nachwachsenden Rohstoffen möglich ist. Die bekannten biotechnologischen Verfahren zur Herstellung von Buttersäure aus Kohlenhydraten sind allerdings verbesserungswürdig. Insbesondere bisher als Lösungsmittel produzierende Organismen eingesetzte Mikroorganismen sind bekanntermaßen nicht pri- mär und ohne weiteres zur Synthese kurzkettiger Carbonsäuren, insbesondere von der Buttersäure verwendbar; die Ausbeute an kurzkettigen Carbonsäuren ist bei solchen Organismen bisher zu gering. Es besteht daher auch der Bedarf, die Synthese kurzkettiger Carbonsäuren, insbesondere der Buttersäure in solchen Zellen bes- ser regulieren und besonders stimulieren und steigern zu können.
Aufgabenstellung
Der Erfindung liegt vor allem das technische Problem zugrunde, Verfahren und Mittel zu deren Durchführung bereitzustellen, wodurch Lösungsmittel, besonders Butanol und gegebenenfalls Aceton und Ethanol, oder alternativ kurzkettige Carbonsäuren, besonders Butter- säure/Butyrat und gegebenenfalls Essigsäure/Acetat, in einer mikrobiologischen Wirtszelle, besonders in einer Lösungsmittel bildenden Wirtszelle der Gattung Clostridium, biotechnologisch in hoher Ausbeute und vor allem in hoher volumetrischer Produktivität hergestellt werden können. Das technische Problem besteht dabei auch darin, verbesserte Mittel zur Regulation, besonders zur Steigerung der Lösungsmittelproduktion und alternativ zur Steigerung der Produktion kurzkettiger Carbonsäuren, in diesen Wirtszellen bereitzustellen. Dabei sollen diese Mittel einfacher und zuverlässiger und auch in ver- schiedenen Spezies der Wirtszellengattung einsetzbar sein und besonders zu einer Steigerung der Ausbeute und bevorzugt auch der volumetrischen Produktivität bei der Fermentation führen. Ein damit verbundenes technisches Problem ist die Bereitstellung von Mitteln, die eine besonders einfache und wirkungsvolle Steuerung der Stoffwechselaktivitäten und insbesondere Enzymaktivitäten, die im Zusammenhang mit der Lösungsmittelproduktion und gege- benenfalls der Carbonsäureproduktion stehen, in der Wirtszelle ermöglichen.
Zusammenfassung der Erfindung
Das zugrunde liegende technische Problem wird primär gelöst durch die Bereitstellung eines Nucleinsäuremoleküls, das ein Regulator der Lösungsmittelproduktion ist oder mit einem solchen Regulator in direktem Zusammenhang steht. Der Regulator moduliert oder reguliert, das heißt induziert, stimuliert oder supprimiert, die Expression mindestens eines Gens, das mindestens einen Stoffwechselfaktor, besonders Enzymaktivität, der Lösungsmittelproduktion in einer Wirts- zelle kodiert. Eine lösungsmittelproduzierende Wirtszelle ist bevorzugt ausgewählt aus Organismen der Gattung Clostridium.
In einem ersten Aspekt betrifft die Erfindung: ein Nucleinsäuremole- kül, geeignet zur Modulation der Expression mindestens einer Enzymaktivität der Lösungsmittel- und/oder Säureproduktion in einer Wirtszelle, wobei das Molekül eine Nucleinsäuresequenz aufweist, welche ausgewählt ist aus:
a) SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 und SEQ ID NO: 10,
b) komplementären Sequenzen davon und c) abgewandelten Sequenzen und Fragmenten, die mit Sequenzen nach (a) oder (b) mindestens 80% Sequenzübereinstimmung besitzen und die Funktion eines Regulators zur Modulation der Expression dieser Enzymaktivität kodieren.
Bevorzugt ist das Nucleinsäuremolekül ein RNA-Molekül. Bevorzugt erfolgt die Modulation der Enzymaktivität durch Regulation mindestens eines Vorgangs, ausgewählt aus:
- Transkription bevorzugt mindestens eines die Enzymaktivität kodierenden Gens und - Translation mindestens eines Gen-Transkripts zu einem die Enzymaktivität aufweisenden oder vermittelnden Polyaminosäure- moleküls,
wobei das Nucleinsäuremolekül an mindestens eine diesen Vorgang vermittelnde Struktur bindet und deren Funktion moduliert.
In einem zweiten Aspekt betrifft die Erfindung: ein Nucleinsäuremolekül, das eine genetische Mutante des gemäß ersten Aspekt charakterisierten Nucleinsäuremoleküls ist, wobei die mindestens eine genetische Mutation bevorzugt ausgewählt ist aus: Inversion, Deletion und Insertion mindestens eines Nucleotids.
In einem dritten Aspekt betrifft die Erfindung: eine transgene Wirtszelle mit modifizierter Säure- und/oder Lösungsmittelproduktion, worin die Expression des von einem Nucleinsäuremolekül nach einem der vorstehenden Aspekte, insbesondere nach dem ersten Aspekt, gehemmt oder verhindert ist. Bevorzugt ist diese Zelle eine knock out-Mutante des Gens solB und/oder eines Homologs oder Orthologs davon. In einem vierten Aspekt betrifft die Erfindung: eine transgene Wirtszelle mit modifizierter Säure- und/oder Lösungsmittelproduktion, welche das Nucleinsäuremolekül nach einem der vorstehenden Aspekte, insbesondere nach dem ersten Aspekt, als heterologes Gen ent- hält, bevorzugt eine oder mehrere Kopien davon.
In einem fünften Aspekt betrifft die Erfindung: einen Vektor, enthaltend mindestens eine exprimierbare Kopie des in den vorstehenden Aspekten charakterisierten Nucleinsäuremoleküls. Bevorzugt ist das Nucleinsäuremolekül in sense-Orientierung exprimierbar angeordnet. In einer alternativen Variante ist das Nucleinsäuremolekül in anti- sense-Orientierung exprimerbar angeordnet.
In einem sechsten Aspekt betrifft die Erfindung: eine transgene Wirtszelle mit modifizierter Säure- und/oder Lösungsmittelproduktion, welche mindestens eine exprimierbare Kopie des in den vorstehen- den Aspekten charakterisierten Nucleinsäuremoleküls und/oder den Vektor nach dem fünften Aspekt der Erfindung enthält, bevorzugt eine oder mehrere Kopien davon.
In einem siebten Aspekt betrifft die Erfindung: ein bevorzugt außerhalb der Zelle hergestelltes oder synthetisiertes, RNA-Molekül zur Modulation der Expression mindestens einer Enzymaktivität der Säure- und/oder Lösungsmittelproduktion in einer Wirtszelle, wobei das Molekül ausgewählt ist aus:
a) RNA-Molekül, welches aus dem Nucleinsäuremolekül nach einem der vorstehenden Aspekte, insbesondere nach dem ersten Aspekt, transkribierbar ist, und b) Fragmenten von (a), welche die Funktion eines Regulators zur Modulation der Expression dieser Enzymaktivität in der Wirtszelle haben.
In einem achten Aspekt betrifft die Erfindung: eine Wirtszelle mit mo- difizierter Säure- und/oder Lösungsmittelproduktion, worin ein RNA- Molekül nach dem sechsten Aspekt der Erfindung eingeschleust ist. Bevorzugt liegt das eingeschleuste RNA-Molekül in sense- Orientierung vor. In einer alternativen Ausführung liegt das eingeschleuste RNA-Molekül in antisense-Orientierung vor.
In einem neunten Aspekt betrifft die Erfindung: ein Verfahren zur Herstellung einer transgenen Wirtszelle mit modifizierter Säure- und/oder Lösungsmittelproduktion, enthaltend den Schritt: genetisches Modifizieren der Wirtszelle mit mindestens einer Struktur ausgewählt aus: Nucleinsäuremolekülen und Vektoren nach einem der vorstehenden Aspekte; in bevorzugten Ausführungen nach dem ersten Aspekt, alternativ nach dem zweiten Aspekt und alternativ nach dem dritten Aspekt.
Bevorzugt ist oder wird die Wirtszelle genetisch modifiziert, so dass das Nucleinsäuremolekül nach einem der vorstehenden Aspekte, insbesondere nach dem ersten Aspekt der Erfindung in sense- Orientierung exprimiert wird. In einer alternativen Variante ist oder wird die Wirtszelle genetisch modifiziert, so dass das Nucleinsäuremolekül nach einem der vorstehenden Aspekte, insbesondere nach dem ersten Aspekt der Erfindung in antisense-Orientierung expri- miert wird.
In einem zehnten Aspekt betrifft die Erfindung: ein Verfahren zur Herstellung einer transgenen Wirtszelle mit modifizierter Säure- und/oder Lösungsmittelproduktion, enthaltend den Schritt: Ein- schleusen des RNA-Moleküls nach einem der vorstehenden Aspekte, insbesondere nach dem ersten oder siebten Aspekt der Erfindung.
In einem elften Aspekt betrifft die Erfindung: ein Verfahren zur bio- technologischen Herstellung von Lösungsmittel, bevorzugt ausgewählt aus Aceton, Butanol und Ethanol, besonders Butanol, enthaltend die Schritte:
- Bereitstellen einer Wirtszelle gemäß der Erfindung, worin die effektive Konzentration des Transkripts des in dem ersten Aspekt der Erfindung charakterisierten Nucleinsäuremoleküls im Vergleich zum Wildtyp der Zelle vermindert ist;
- Kultivieren der Wirtszelle in Kulturmedium und in Gegenwart eines Substrats unter Bedingungen, welche die Bildung von Lösungsmittel aus dem Substrat ermöglichen; und
- Gewinnen des Lösungsmittels aus Kulturmedium und/oder
Wirtszelle.
In einem zwölften Aspekt betrifft die Erfindung: ein Verfahren zur biotechnologischen Herstellung von kurzkettigen Carbonsäuren, insbesondere Butyrat und/oder Acetat, beziehungsweise Buttersäure und/oder Essigsäure enthaltend die Schritte:
- Bereitstellen einer Wirtszelle gemäß der Erfindung, worin die effektive Konzentration des Transkripts des in dem ersten Aspekt der Erfindung charakterisierten Nucleinsäuremoleküls im Vergleich zum Wildtyp der Zelle erhöht ist;
- Kultivieren der Wirtszelle in Kulturmedium und in Gegenwart eines Substrats unter Bedingungen, welche die Bildung von kurzkettigen Carbonsäuren aus dem Substrat ermöglichen; und
- Gewinnen der kurzkettigen Carbonsäure aus Kulturmedium und/oder Wirtszelle.
Beschreibung der Figuren
Figuren 1A.B: schematische Darstellungen (nicht maßstabsgetreu) des so/-Operons in C. acetobυtylicum, Figur 1A1 und bei anderen lösungsmittelbildenden Clostridien, Figur 1 B.
Figur 2: Lage und Seguenz des so/ß-Gens im intergenen Be- reich des orfö-Gens und des so/-Operons; es bedeuten: orfδ: Offener Leserahmen; orfL: Offener Leserahmen; adhE: Aldehyd/Alkohol- Dehydrogenase; ctfA/ctfB: Acetacetyl-CoA: Acetat/Butyrat: CoA- Transferase; ade: Acetacetat-Decarboxylase
Figur 3: Plasmidkarte des erfindungsgemäßen Vektors pBS1 zur Überexpression des promotorlosen so/ß-Gens; Klonierung von solB ohne Promotor (SEQ ID NO: 2) in sense Orientierung mit pftb/bu/c-Promotor auf Basis des Plasmids plMP1 zur Erzeugung einer erfindungsgemäßen C. acetobutylicum solB sense-Mutante
Figur 4: Plasmidkarte des erfindungsgemäßen Vektors pBS7 zur Überexpression des kompletten so/ß-Gens (SEQ ID NO: 1); Klonierung von solB mit so/ß-eigenem Promotor auf Basis des Plasmids plMP1 zur Erzeugung einer erfindungsgemäßen C. acetobutylicum synth. solB sense-Mutante
Figur 5: Plasmidkarte des erfindungsgemäßen Vektors pBS13 zur Expression eines anf/sense-Konstrukts des so/ß-Gens; Klonierung von solB in anf/sense-Orientierung mit so/ß-eigenem Promotor und Terminator (beide in seπse-Orientierung) auf Basis des Plasmids plMP1 zur Erzeugung einer erfindungsgemäßen C. aceto- butylicum synth. solB antisense-Mutanie
Figuren 6A-D: Plasmidkarten der erfindungsgemäßen Vektoren pBS14, pBS15, pBS16 und pBS17 zur Expression von antisense- Konstrukten von Fragmenten (3'so/B 75 Bp, 3'so/ß 115 Bp, 5'so/ß 72 Bp, 5'solB 102 Bp) des so/ß-Gens; Klonierung von Fragmenten von solB in anf/sense-Orientierung mit so/ß-eigenem Promotor (in sense- Orientierung) und Terminator (in sense-Orientierung) auf Basis des Plasmids plMP1 zur Erzeugung von erfindungsgemäßen Mutanten: C. acetobutylicum synth. 3'so/ß 75 Bp antisense (pBS14; Figur 6A), C. acetobutylicum synth. 3'so/ß 115 Bp antisense (pBS15; Figur 6B), C. acetobutylicum synth. 5'so/ß 72 Bp antisense (pBS16; Figur 6C) und C. acetobutylicum synth. 5'so/ß 102 Bp antisense (pBS17; Figur 6D)
Figur 7: Ergebnisse der qualitativen RT-PCR zur Untersuchung der Transkription des so/ß-Gens: (-): Negativkontrolle der entsprechenden Probe (Ersatz der Reversen Transkriptase durch Was- ser),
(+): RT-PCR der entsprechenden Probe, (S): Größenstandard (ca. 500 ng Gesamt-RNA je RT-PC R-Ansatz)
Figuren 8A-C: Produktspektren der Wachstumsversuche des Typstamms C. acetobutylicum ATCC 824 (Wildtyp) (Figur 8A), einer C. acetobutylicum p I M P 1 -Mutante (Figur 8B) und der C. acetobutylicum solB sense-Mutante (erfindungsgemäß, Figur 8C) in phosphatlimitiertem Minimalmedium; Konzentrationen in mmol/l (mM) Figuren 9A-B: Acetonproduktion (Figur 9A) und Butanolproduktion, (Figur 9B) des Typstamms C. acetobutylicum ATCC 824 (Wildtyp, Figur 9A) und der C. acetobutylicum solB sense-Mutante (erfindungsgemäß, Figur 9B) auf phosphatlimitiertem Minimalmedium; Konzentrationen in mmol/l (mM)
Figuren 10A-D: Produktspektren der Wachstumsversuche des Typstamms C. acetobutylicum ATCC 824 (Wildtyp, Figur 10A), einer ersten C. acetobutylicum synth. solB sense-Mutante (erfindungsgemäß, Figur 10B), einer weiteren C. acetobutylicum synth. solB sense- Mutante (erfindungsgemäß, Figur 10C) und noch einer weiteren C. acetobutylicum synth. solB sense-Mutante (erfindungsgemäß, Figur 10D) in phosphatlimitiertem Minimalmedium; Konzentrationen in mmol/l (mM)
Figuren 11A-B: Acetonproduktion (Figur 11A) und Butanolproduktion (Figur 11 B) des Typstamms C. acetobutylicum ATCC 824 (Wildtyp), einer ersten C. acetobutylicum synth. solB sense-Mutante (erfindungsgemäß), einer weiteren C. acetobutylicum synth. solB sense- Mutante (erfindungsgemäß) und noch einer weiteren C. acetobutylicum synth. solB sense-Mutante (erfindungsgemäß) auf phosphatlimi- tiertem Minimalmedium; Konzentrationen in mmol/l (mM)
Figuren 12A-B: Acetatproduktion (Figur 12A) und Butyratproduktion (Figur 12B) des Typstamms C. acetobutylicum ATCC 824 (Wildtyp) und der C. acetobutylicum solB sense-Mutante (erfindungsgemäß) auf phosphatlimitiertem Minimalmedium; Konzentrationen in mmol/l (mM)
Figuren 13A-B: Acetatproduktion (Figur 13A) und Butyratproduktion (Figur 13B) des Typstamms C. acetobutylicum ATCC 824 (Wildtyp) und der C. acetobutylicum synth. solB sense-Mutanten (erfindungs- gemäß) auf phosphatlimitiertem Minimalmedium; Konzentrationen in mmol/l (mM)
Detaillierte Beschreibung der Erfindung
Die Erfindung wird anhand der Figuren und der Ausführungsbeispiele näher charakterisiert, ohne dass diese beschränkend zu verstehen wären.
Die im Zusammenhang mit der Beschreibung der Erfindung verwendeten Fachausdrücke werden im herkömmlichen, dem Fachmann bekannten Sinn verstanden, außer es werden ausdrücklich davon abweichende Angaben gemacht.
Das Sequenzprotokoll enthält:
- die Sequenz des so/ß-Gens mit Promotor- und Terminatorregion (SEQ ID NO: 1 ):
TTCAGAAGTCTACAAATTAAGTTTATATTTAGACCCTGGGGTG TAACTATAGTATTTAATATTGGTACTATTAATTAGGGTTATATA TACTAGAACTTATCATGGTAAACATAAATATAAACTCAATTCTA TTTATGCTCCTATAAAATTTTATAATATAGGAAAACTGCTAAAT GTAAATTATACGTTTACATTTAGCAGTTTATΠT
- die Sequenz des so/ß-Gens ohne Promotorregion (SEQ ID NO: 2):
TAGACCCTGGGGTGTAACTATAGTATTTAATATTGGTACTATT
AATTAGGGTTATATATACTAGAACTTATCATGGTAAACATAAAT ATAAACTCAATTCTATTTATGCTCCTATAAAATTTTATAATATAG GAAAACTGCTAAATGTAAATTATACGTTTACATTTAGCAGTTTA - die Sequenz des so/ß-Gens ohne Promotor- und ohne Terminatorregion (SEQ ID NO: 3):
TAGACCCTGGGGTGTAACTATAGTATTTAATATTGGTACTATT AATTAGGGTTATATATACTAGAACTTATCATGGTAAACATAAAT ATAAACTCAATTCTATTTATGCTCCTATAAAATTTTATAATATAG
GAAAA
- 5'del so/8-Fragment (SEQ ID NO: 4), in Plasmid pBS1 zur Herstellung von C. acetobutylicum solB sense-Mutante:
TATGTAGACCCTGGGGTGTAACTATAGTATTTAATATTGGTAC TATTAATTAGGGTTATATATACTAGAACTTATCATGGTAAACAT
AAATATAAACTCAATTCTATTTATGCTCCTATAAAATTTTATAAT ATAGGAAAACTGCTAAATGTAAATTATACGTTTACATTTAGCA GTTTATTTTAAACCTTCATA I I I I I CTAAATATACA
- so/ß-Fragment (SEQ ID NO: 5), in Plasmid pBS7 zur Herstellung von C. acetobutylicum synth. solB sense-Mutante:
TCCTTAAGATATAGCTTCTTTTATGTAGTATTATTTCAGAAGTC TACAAATTAAGTTTATATTTAGACCCTGGGGTGTAACTATAGT ATTTAATATTGGTACTATTAATTAGGGTTATATATACTAGAACT TATCATGGTAAACATAAATATAAACTCAATTCTATTTATGCTCC TATAAAATTTTATAATATAGGAAAACTGCTAAATGTAAATTATA
CGTTTACATTTAGCAGTTTATTTTAAACCTTCATG
- antisense so/ß-Fragment (SEQ ID NO: 6), in Plasmid pBS13 zur Herstellung von C. acetobutylicum synth. solB antisense-Mutanle:
TCCTTAAGATATAGCTTCTTTTATGTAGTATTATTTCAGAAGTC TACAAATTAAGTTTATA I I I I I I CCTATATTATAAAATTTTATAG
GAGCATAAATAGAATTGAGTTTATATTTATGTTTACCATGATAA GTTCTAGTATATATAACCCTAATTAATAGTACCAATATTAAATA CTATAGTTACACCCCAGGGTCTACTGCTAAATGTAAATTATAC GTTTACATTTAGCAGTTTATTTTAAACCTTCATG
- 31 75Bp solB-Fragment (SEQ ID NO: 7), in Plasmid pBS14 zur Her- Stellung von C. acetobutylicum synth. solB 3' 75 Bp-Mutante:
TTTTCCTATATTATAAAATTTTATAGGAGCATAAATAGAATTGA GTTTATATTTATGTTTACCATGATAAGTTCT
- 31 115 Bp solB-Fragment (SEQ ID NO: 8), in Plasmid pBS15 zur Herstellung von C. acetobutylicum synth. solB 3' 115 Bp-Mutante:
TTTTCCTATATTATAAAATTTTATAGGAGCATAAATAGAATTGA
GTTTATATTTATGTTTACCATGATAAGTTCTAGTATATATAACC CTAATTAATAGTACCAATATTAAATAC
- 5' 72 Bp so/B-Fragment (SEQ ID NO: 9), in Plasmid pBS16 zur Herstellung von C. acetobutylicum synth. solB 5' 72 Bp-Mutante:
GATAAGTTCTAGTATATATAACCCTAATTAATAGTACCAATATT
AAATACTATAGTTACACCCCAGGGTCTA
- 5' 102 Bp so/B-Fragment (SEQ ID NO: 10), in Plasmid pBS17 zur Herstellung von C. acetobutylicum synth. solB 5' 102 Bp-Mutante
TAGAATTGAGTTTATATTTATGTTTACCATGATAAGTTCTAGTA TATATAACCCTAATTAATAGTACCAATATTAAATACTATAGTTA CACCCCAGGGTCTA - Primer gemäß nachfolgender Ausführungsbeispiele (SEQ ID NO: 1 1 bis SEQ ID NO: 16):
- zur Amplifikation des pfib-bu/c-Promotors (Λ/del):
KL08 (SEQ ID NO: 1 1 ): GGGAATACATATGTCGACACTCCCTTTTACTATTT
- zur Amplifikation des pto-bu/c-Promotors (EcoRI):
KL09 (SEQ ID NO: 12): CGGAATTCTATAAAATATAAATAATTTTC
- zur Amplifikation des promotorlosen so/ß-Gens (Λ/del):
sRNAkurz_neu_F (SEQ ID NO: 13):
CAAATTAAGTTCATATGTAGAC
- zur Amplifikation des promotorlosen so/ß-Gens (Λ/del):
sRNA_neu_R (SEQ ID NO: 14): GGAATCATATGTATATTTAG
- Forward-Primer für RT-PCR:
snRNA_F (SEQ ID NO: 15): CTATAGTATTTAATATTGGTAC
- Reverse-Primer für RT-PCR:
snRNA_R (SEQ ID NO: 16): GAGCATAAATAGAATTGAG C. acetobutylicum ist ein gram-positives, strikt anaerobes und Endo- sporen bildendes Bodenbakterium, das einen biphasischen Gärungsstoffwechsel aufweist. Historisch wurden alle Stämme der Gattung Clostridium als Clostridium acetobutylicum bezeichnet. Moleku- largenetische Analysen zeigten, dass es sich bei C. acetobutylicum um mindestens vier verschiedene Spezies, C. acetobutylicum, C. beijerinckii, C. saccharobutylicum und C. saccharoperbutylacetoni- cum, handelt, welche sich auch in der genauen Strukturierung des Genoms unterscheiden. Vor allem zuckerhaltige Substrate (Kohlen- stoffquellen) werden in der ersten Phase des Stoffwechsels der mit der logarithmischen Phase des Wachstums einhergeht, zunächst zu Essigsäure (Acetat) und Buttersäure (Butyrat) umgesetzt, während in der zweiten Phase des Stoffwechsels nunmehr die Lösungsmittel Aceton und Butanol gebildet werden. Die Umstellung des Stoffwech- sels von der Säure- auf die Lösungsmittelproduktion erfolgt bekanntermaßen regelmäßig beim Übergang in die stationäre Phase des Wachstums. Zu hohe Säurekonzentrationen würden zu einem Zusammenbruch des Protonengradienten über der Cytoplasma- membran führen. Durch das Umschalten des Stoffwechsels auf die Produktion der neutralen Lösungsmittel reduziert sich der Säuretiter. Außerdem kann ein Teil der Säuren aus dem Medium wieder aufgenommen werden. Die Endosporenbildung wird initiiert. Da die Lösungsmittel Aceton und Butanol erst zu einem späten Zeitpunkt des Wachstums gebildet werden, ist die Lösungsmittelbildung im Orga- nismus stark reguliert. Die Regulation der Lösungsmittelbildung bzw. die Regulation der Gene, die an der Lösungsmittelbildung beteiligt sind, stellt somit einen primären Ansatzpunkt dar, über den die Lösungsmittelproduktion der Clostridien verbessert werden kann.
In C. acetobutylicum sind die Gene, die zur Lösungsmittelbildung notwendig sind, auf mindestens fünf getrennten Operonen {sol- Operon, adc-Operon und adhE2-Operon auf einem Megaplasmid sowie bdhA- und bdhB-Operon auf dem Chromosom) lokalisiert.
Neben C. acetobutylicum sind auch die Stämme C. beijeήnckii, C. saccharobutylicum und C. saccharoperbutylacetonicum zur Lö- sungsmittelproduktion fähig. In diesen Stämmen bilden die Gene des so/-Operons und des adc-Operons, abweichend von C. acetobutylicum, ein gemeinsames polycistronisches Operon, das nicht auf einem Megaplasmid, sondern auf dem Chromosom lokalisiert ist. Dieses so/-Operon enthält keine Aldehyd/Alkohol-Dehydrogenase (Ad- hE), sondern eine Aldehyd-Dehydrogenase (AId). In den Figuren 1A und 1 B sind die beiden Versionen der so/-Operons von Clostridien schematisch dargestellt.
Ohne an die Theorie gebunden sein zu wollen, liegen bei C. acetobutylicum die meisten der an der Lösungsmittelbildung direkt oder indi- rekt beteiligten Gene separat vom Bakterienchromosom (3,9 MBp) auf einem 192 kBp großen Megaplasmid pSOLL Direkt an der Lösungsmittelsynthese beteiligt sind die Gene der Acetacetyl-CoA: Acetat/Butyrat: CoA-Transferase (CoA-Transferase, ctfA und ctfB), der Acetacetat-Decarboylase (ade), der Butanol-Dehydrogenasen A und B (bdhA und bdhB) und der Aldehyd-/Alkohol-Dehydrogenase E (adhE) mit dem potentiellen membrangebundenen Elektronenüberträger OrfL (orfL). Die Gene orfL, adhE, ctfA und ctfB bilden dabei das polycistronische so/-Operon, das divergent zum adc-Operon lokalisiert ist (Figur 1A). Stromaufwärts des so/-Operons ist das Gen für eine Glykosylase/Deglykosylase (orfS) lokalisiert. Figur 2 zeigt eine schematische Darstellung des beschriebenen Sequenzbereichs auf dem Megaplasmid pSOLl In der intergenen Region zwischen dem o/f5-Gen und dem sol- Operon befindet sich das erfindungsgemäße so/ß-Gen, das für eine kleine, nicht-kodierende, regulative RNA (sRNA) kodiert. In Figur 2 ist der entsprechende Sequenzbereich der intergenen Region aufge- führt. Hervorgehoben in Figur 2 sind die Sequenzabschnitte einer potentiellen σA-abhängigen Promotorstruktur mit einer -35-Region (Konsensus: TTGACA) und einer -10-Region (Konsensus: TATAAT) im Abstand von 17 Bp sowie eine Haarnadelstruktur (ΔG = -17,35 kcal/mol) gefolgt von einer Poly-U-Sequenz, die gegebenenfalls ei- nen Rho-unabhängigen Terminator darstellt. Der längste offene Leserahmen (ORF) in diesem Bereich (Figur 2: Position 102 bis 146) würde für ein 14 Aminosäuren großes Protein kodieren. Diesem ORF sowie allen weiteren gefundenen ORF1 geht keine konservierte Ribo- somenbindestelle voraus.
Der potentielle Promotor im 5'-Bereich des so/8-Gens ist während des gesamten Wachstums des Stammes C. acetobutylicum auf phosphatlimitiertem Minimalmedium aktiv, und zwar sowohl in der Säure- als auch in der Lösungsmittelphase. Das SolB-Transkript (SolB-mRNA) ist in beiden Phasen, das heißt während des gesamten Wachstums, nachweisbar (Figur 3).
Ein beliebiger Vektor, der zur Replikation in C. acetobutylicum fähig ist, z. B. Vektor auf Basis von plMP1 , wird bevorzugt mit einem kon- stitutiven, vorzugsweise dem pto-bu/c-Promotor (Promotor des C. acetobutylicum Phosphotransbutyrylase-Butyratkinase-Operons) oder alternativ bevorzugt mit einem induzierbaren Promotor versehen, vorzugsweise dem /ux/?-Analog. Hinter den Promotor kann bevorzugt entweder die komplette, oder alternativ bevorzugt eine promotorlose Sequenz des so/ß-Gens kloniert werden, um zu einer erfindungsgemäßen transgenen Wirtszelle zu gelangen. Das erfindungsgemäße Nucleinsäuremolekül ist bevorzugt (a) ein DNA-Molekül, welches in einen Regulator, besonders ein RNA- Molekül, transkribiert wird, oder werden kann, oder (b) ein RNA- Molekül, welches selbst als Regulator fungiert oder mit einem Transkriptionssystem in Wechselwirkung tritt, vor allem um die Expression mindestens eines der Gene, das für Enzymaktivität der Säure- und/oder Lösungsmittelproduktion kodiert, zu regulieren.
Das erfindungsgemäße oder erfindungsgemäß verwendete Nucleinsäuremolekül ist primär dadurch charakterisiert, dass es zumindest eine oder mehrere der Nucleinsäuresequenzen aufweist oder ausschließlich aufweist, welche ausgewählt sind aus den Sequenzen gemäß SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 und SEQ ID NO: 10, komplementären Sequenzen davon sowie abgewandelte Sequenzen und Fragmente, die mit diesen eine mindestens 80%ige, besonders mindestens 90%ige Sequenzübereinstimmung aufweisen. In einer besonderen Variante der Erfindung besteht das Nucleinsäuremolekül aus einer dieser Sequenzen, das heißt, es weist im Wesentlichen keine anderen oder bevorzugt keine weiteren Nucleotide auf.
Die Erfindung umfasst auch solche Nucleinsäuremoleküle, welche dazu homologe Sequenzen aufweisen, welche aber dadurch charakterisiert sind, dass diese zumindest die erfindungsgemäße Funktion der Regulation oder Modulation der Expression der Enzymaktivität in der Wirtszelle erfüllen (Funktionsanaloga). Homologe Sequenzen im Sinne der Erfindung sind vor allem solche Sequenzen, welche durch Austausch oder Weglassen eines oder mehrerer Nucleotide in der Sequenz erhalten werden. Der Fachmann kennt hier gängige Methoden der Inversion, Deletion, Addition und des Nucleotidaustausches. In bevorzugten Varianten der Erfindung sind im Nucleinsäuremolekül mit homologer Sequenz 1 bis 10 % der Gesamtzahl der Nucleotide im Molekül ersetzt, ergänzt oder entfernt, insbesondere sind dies 1 bis 20, bevorzugt 1 bis 10 Nucleotide in den vorstehend charakteris- tischen Sequenzen.
Die Erfindung umfasst auch funktionsanaloge Nucleinsäuremoleküle, die Homologe zu den hierin charakterisierten Nucleinsäuremolekülen sind. Die Erfindung umfasst auch funktionsanaloge Nucleinsäuremoleküle, die Orthologe zu den hierin charakterisierten Nucleinsäuremo- lekülen sind. Der Fachmann kennt in diesem Zusammenhang die Möglichkeiten, genetische Homologe und Orthologe aufzufinden; er bedient sich hierbei Datenbanken und/oder bekannter bioinformati- scher Analyse.
Die Erfindung umfasst auch solche funktionsanalogen Nucleinsäu- remoleküle, worin ein oder mehrere Nucleotide durch ein oder mehrere Nucleotidanaloga, Purin- und Pyrimidin-Derivate, ersetzt sind.
Die Erfindung umfasst weiter auch davon abgeleitete genetisch modifizierte oder mutierte Nucleinsäuremoleküle, welche vor allem dadurch charakterisiert sind, dass deren Transkription in der Wirtszelle unterdrückt ist oder ein mutiertes Transkript erhalten wird, welches zumindest die erfindungsgemäße Funktion der Regulation oder Modulation der Expression der Enzymaktivität in der Wirtszelle nicht erfüllt. Der Fachmann kennt in diesem Zusammenhang die Möglichkeiten, genetische Mutationen zu erzeugen. Zur Herstellung der Mu- tation am Nucleinsäuremolekül, insbesondere dem solB Gen, greift der Fachmann auf bekannte und etablierte Verfahren zurück. Diese sind bevorzugt ausgewählt aus: Insertion, Deletion, Inversion, Substitution und Addition mindestens eines Nucleotids. Eine erfindungs- gemäße bevorzugte Anwendung solcher mutierter Nucleinsäuremo- lekül ist die Bereitstellung von knock out-Mutanten von Wirtszellen, insbesondere die Bereitstellung von solB knock out-Mutanten sowie die Bereitstellung von knock out-Mutanten von Homologen und/oder Orthologen davon. Die Herstellung der Mutanten erfolgt bevorzugt in an sich bekannter Weise. Eine bevorzugte Methode ist die homologe Rekombination. Die Erfindung ist aber nicht auf dieses Verfahren beschränkt.
Ein erfindungsgemäßes Nucleinsäuremolekül liegt bevorzugt in exprimierbarer Form und bevorzugt in einer Expressionskassette vor. Das Nucleinsäuremolekül kann darin einfach oder bevorzugt in mehrfacher Kopie vorliegen. Es liegt bevorzugt im Genom der Wirtszelle vor. In einer bevorzugten Variante liegt es im Chromosom vor. In einer anderen bevorzugten Variante liegt es in einem Plasmid oder Megaplasmid der Zelle vor. In einer bevorzugten Variante liegt es ausschließlich oder bevorzugt zusätzlich, in einem oder mehreren Expressionsvektoren vor, die in die Wirtszelle eingeschleust wurden. Es liegt bevorzugt als DNA-Molekül vor und wird bevorzugt in ein oder mehrere RNA-Moleküle transkribiert.
Das erfindungsgemäße Nucleinsäuremolekül ist ein Regulator oder steht im direkten Zusammenhang mit einem solchen Regulator, der bevorzugt mindestens einen Vorgang der Genexpression, ausgewählt aus Transkription und Translation mindestens eines der stoffwechselrelevanten Gene für mindestens eine Enzymaktivität der Säure- und/oder Lösungsmittelproduktion, reguliert und bevorzugt steigert oder bevorzugt hemmt. Bevorzugt ist die mindestens eine Enzymaktivität an mindestens einem Genort der Wirtszelle, besonders einer Clostridienzelle, kodiert, welcher ausgewählt ist aus dem so/-Operon und dem adc-Operon. Die Erfinder fanden überraschend, dass das erfindungsgemäße Nuc- leinsäuremolekül vor allem als kleine, nicht kodierende, regulatorische RNA (SolB-Transkript) fungiert. Wenn es in einer alternativen erfindungsgemäßen Variante als DNA vorliegt, ist es in eine solche RNA transkribierbar. Das erfindungsgemäße RNA-Molekül stellt, wenn es in hoher Konzentration in der Zelle vorhanden ist, einen Modulator und bevorzugt einen Repressor der Lösungsmittelbildung, vor allem der Butanolbildung dar.
Das RNA-Molekül übt die Wirkung entweder allein oder gegebenen- falls in Kombination mit anderen Faktoren auf die Enzymaktivität der Wirtszelle aus. Bevorzugte Faktoren oder Co-Faktoren sind RNA- Moleküle, DNA-Moleküle und Proteine, beispielsweise in Form von Co-Repressoren.
Die Erfindung stellt also eine zweckmäßige Verwendung des „solB- Gen" bereit, welches in ein zentrales Regulator-Molekül (SolB- Transkript) der Enzyme der Lösungsmittelsynthese, besonders der Aceton- und Butanolbildung, transkribierbar ist. Die Erfindung sieht also sowohl die Verwendung des „Gens", bevorzugt als DNA- Molekül, als auch die Verwendung dessen Transkripts, bevorzugt als RNA-Molekül, vor, und zwar als das bevorzugte Mittel, welches die Regulation der Säure- und/oder Lösungsmittelproduktion in einer Wirtszelle ermöglicht.
Die Erfindung umfasst neben dem SolB-Transkript eines SoIB- Wildtyps, bevorzugt von C. acetobutylicum, auch dessen Fragmente und Funktionsanaloge, das heißt also Moleküle, die in analoger Funktionalität mit den Zielstrukturen Ziel-RNA oder Ziel-DNA oder Ziel-Protein, interagieren. Die Erfindung umfasst deren Verwendung zur Regulation oder Modulation der Genexpression in Wirtszellen, vor allem in lösemittelbildenden Clostridien und vor allem im Zusammenhang mit der Regulation der Lösungsmittel- und Säureproduktion in den Wirtszellen.
Die Erfinder fanden überraschend, dass sowohl das erfindungsge- mäße SolB-Transkript als auch dessen erfindungsgemäßen Analoge, Derivate und Fragmente als Regulator unmittelbar auf RNA-Ebene wirken, das heißt als RNA-Moleküle fungieren. In einer bevorzugten Ausführung ist das erfindungsgemäße Molekül selbst eine RNA oder ein RNA-Analog: Es braucht vorteilhafterweise nicht, wie bei kodie- renden RNAs, erst in ein Protein oder Peptid translatiert werden. Es kann die regulatorische Wirkung bevorzugt und unmittelbar als sogenannte „kleine nicht kodierende regulatorische RNA" an den Zielstrukturen ausüben.
Diese RNA dient in einer erfindungsgemäß bevorzugten Ausführung zur Stimulation der Produktion kurzkettiger Carbonsäuren, besonders Buttersäure, besonders in Zellen der Gattung Clostridium, oder insbesondere in primär lösungsmittelbildenden Organismen.
Im Zusammenhang mit der vorliegenden Erfindung werden unter „Zielstrukturen" vor allem Effektoren und Moleküle des Transkript- ionsapparats sowie der Translation verstanden, welche zur Expression und Synthese genetisch kodierter Enzym aktivitäten dienen.
Ein im Sinne der Erfindung dem SolB-Transkript funktionsanaloges Nucleinsäuremolekül (Funktionsanalog) bindet an zumindest eine der regulatorisch funktionierenden Bindungsstellen im Genom des Orga- nismus, bevorzugt an die regulatorischen Elemente mindestens eines an der Säure- und/oder Lösemittelproduktion beteiligten Gens. Eine solche Bindungsstelle kann selbst ein RNA-Transkript dieses Gens sein. Das erfindungsgemäße RNA-Molekül hat also zumindest die regulatorisch wirksame Bindesequenz mit dem SolB-Transkript gemeinsam. Gegenstand der Erfindung ist somit auch ein eine regulatorische Bindesequenz beinhaltendes Fragment, das ein erfindungsgemäßes Funktionsanalog ist. Dieses weist bevorzugt eine Sequenz einer Länge von 5 Bp oder mehr, von 6 Bp oder mehr, von 7 Bp oder mehr, von 8 Bp oder mehr, 9 Bp oder mehr, 10 Bp oder mehr, 11 Bp oder mehr, 12 Bp oder mehr oder 15 Bp oder mehr auf, die mit der Bindesequenz im SolB-Transkript homolog ist oder dieser entspricht. Diese Bindesequenz ist bevorzugt in den hierin offenbar- ten erfindungsgemäßen Sequenzen enthalten oder besteht daraus.
Ohne an die Theorie gebunden sein zu wollen, interagiert das erfindungsgemäße Nucleinsäuremolekül mit mRNA oder einem DNA- Strang eines bestimmten Zielgens, das heißt eines Gens, das für die Enzymaktivität oder Teile davon der Lösungsmittelsynthese bezie- hungsweise Säuresynthese in der Zelle kodiert. In einer anderen oder zusätzlichen Ausprägung interagiert das erfindungsgemäße Nucleinsäuremolekül mit einem oder mehreren Co-Faktoren, insbesondere in Form von Proteinen.
Die Interaktion erfolgt besonders an komplementären Sequenzberei- chen des Zielgens. Der Sequenzbereich der Interaktion, welche eine erfindungsgemäße Regulation des Systems zur Folge hat, kann erfindungsgemäß sehr kurz sein. Ohne an die Theorie gebunden sein zu wollen, reichen etwa 9 Basen (Bp), zum Beispiel 5 bis 14 Basen (Bp), des SoIB RNA-Moleküls für eine Interaktion mit der Zielstruktur aus (Interaktionssequenz).
Ohne an die Theorie gebunden sein zu wollen, führt die Interaktion mit einer Ziel-mRNA zu deren Abbau und/oder zur Blockade der zugehörigen Ribosomenbindestelle, so dass das entsprechende Gen nicht (weiter) translatiert werden kann. Die Interaktionssequenz findet sich bevorzugt an mehreren Stellen im Genom der Wirtszelle wieder, so dass das erfindungsgemäße Nucleinsäuremolekül vorteilhafterweise gleichzeitig mehrere Zielstrukturen binden und damit bevor- zugt auf Gene für Enzymaktivitäten regulativ wirken kann. Bevorzugt reguliert das erfindungsgemäße Nucleinsäuremolekül in der Wirtszelle sämtliche Enzymaktivitäten, die im Zusammenhang mit der Lösungsmittelproduktion beziehungsweise Säureproduktion stehen. Das erfindungsgemäße Nucleinsäuremolekül erlaubt also vorteilhaft die Regulation mehrerer funktionell zusammengehöriger Targets.
Die Interaktion mit der mRNA des Zielgens erfolgt durch SoIB allein oder, analog eines Hfq-vermittelten RNA-Systems, wie es aus E. coli bekannt ist, gegebenenfalls zusammen mit einem oder mehreren Helferproteinen.
Ohne an die Theorie gebunden sein zu wollen, verursacht eine verringerte effektive Konzentration des SolB-Transkripts, das heißt des erfindungsgemäßen Nucleinsäuremoleküls, eine modifizierte und besonders eine erhöhte Lösungsmittelproduktion in der Zelle. Die Erfinder fanden überraschend, dass mit der Expression beziehungs- weise der verstärkten Expression des so/ß-Gens zur Steigerung der Konzentration des SolB-Transkripts in der Zelle oder mit der Sup- pression der Expression zur Verringerung der Konzentration des SolB-Transkripts in der Zelle, die Säure- und/oder Lösungsmittelproduktion in der Zelle reguliert werden kann. Eine Erhöhung der Kon- zentration des SolB-Transkripts oder eines erfindungsgemäßen Funktionsanalogs davon führt überraschenderweise zu einer Verminderung der Lösungsmittelsynthese und gleichzeitig zu einer Steigerung der Säureproduktion. Umgekehrt führt eine Verringerung der Konzentration des SolB-Transkripts oder des Funktionsanalogs zu einer Steigerung der Lösungsmittelsynthese und zu einer Verminderung der Säureproduktion.
In einer ersten Ausführung der Erfindung werden Mittel und Verfahren zur Steigerung der Säureproduktion und insbesondere zur Ver- ringerung der Lösungsmittelproduktion in einer Wirtszelle bereit gestellt. Die Erfindung betrifft dazu vor allem Maßnahmen zur Erhöhung der effektiven Konzentration des So I B-Transkripts oder eines Fragments, Derivats oder Analogs davon, welches die regulierende Wirkung des SolB-Transkripts aufweist (Funktionsanalog), in der Wirts- zelle. Die Erhöhung der effektiven Konzentration des SolB- Transkripts oder seines Funktionsanalogs in einer Zelle wird durch an sich bekannte Maßnahmen erreicht. Besonders bevorzugte Varianten sind nachfolgend näher dargestellt.
In einer bevorzugten Variante wird dazu eine transformierte Wirtszel- Ie bereitgestellt, worin das so/ß-Gen und/oder ein oder mehrere analoge Konstrukte oder Derivate davon exprimiert und besonders über- exprimiert werden. Dies wird bevorzugt durch Transformieren der Wirtszelle, bevorzugt durch mindestens einen Expressionsvektor, der mindestens eine oder bevorzugt mehrere Kopien eines erfindungs- gemäßen Nucleinsäuremoleküls, eines funktionalen Derivats, Analogs oder Fragments davon, und zwar bevorzugt in sense- Orientierung, enthält, erreicht.
Die Expression des erfindungsgemäßen Nucleinsäuremoleküls in der Wirtszelle steht bevorzugt unter der Kontrolle mindestens eines kon- stitutiven Promotors, besonders eines Promotors, der dessen Überexpression vermitteln kann. In einer bevorzugten Variante ist der Promotor der originäre Promotor des so/8-Gens aus C. acetobutyli- cum oder ein homologer Promotor. In einer anderen bevorzugten Variante ist der Promotor der konstitutive btb-buk-Promoior, das heißt der Promotor des Phosphotransbutyrylase-Butyratkinase- Operons von C. acetobutylicum oder ein funktionsanaloger Promotor.
Weitere an sich bekannte Verfahren zur Überexpression können ebenfalls eingesetzt werden und zählen zum Gegenstand der Erfindung. Dazu zählen zum Beispiel Verfahren zur direkten Modifikation des Promotors, besonders das so genannte „promotor-up" Verfahren, worin vor allem der endogene so/ß-Promotor durch einen stärkeren, besonders einen konstitutiven endogenen Promotor („Super- promotor") ersetzt oder ergänzt wird oder der Promotor in an sich bekannter Weise verändert oder mutiert wird, so dass dieser eine stärkere Expression (Überexpression) des so/ß-Gens vermittelt.
In einer bevorzugten Variante wird ein sense-Konstrukt als DNA- oder RNA-Molekül unmittelbar in die Zelle eingeführt. Dies erfolgt beispielsweise durch zeitweise Desintegration der Zellmembran durch Elektroporation oder durch Beschuss der Zelle („gene gun"). Alternative Verfahren sind dem Fachmann hinreichend bekannt.
Zur Transformation der Wirtszelle werden bevorzugt ein oder mehrere Plasmide eingesetzt, welche eine oder mehrere Kopien der erfin- dungsgemäßen Expressionskassette und/oder ein oder mehrere Kopien des erfindungsgemäßen Nucleinsäuremoleküls enthalten.
Gegenstand der Erfindung ist demgemäß auch ein Vektor, welcher das so/ß-Gen, das heißt mindestens ein erfindungsgemäßes Nuc- leinsäuremolekül, oder dessen Analog, Fragment oder Derivat da- von, enthält, und zwar bevorzugt in sense-Orientierung. Bevorzugt liegen eine oder mehrere Kopien des Nucleinsäuremoleküls in exprimierbarer Form, bevorzugt in mindestens einer Expressionskassette vor, besonders bevorzugt in Verbindung mit einem konstitu- tiven oder induzierbaren Promotor. In einer bevorzugten Variante wird der Vektor auf Basis des plMP1 -Vektors konstruiert. Vektorkarten bevorzugt verwendeter Vektoren sind in den Figuren 3 und 4 dargestellt.
Gegenstand der Erfindung ist auch ein Verfahren zur Herstellung einer transgenen Wirtszelle mit verminderter Lösungsmittelproduktion und insbesondere einer gesteigerten Säureproduktion, enthaltend die Schritte:
Bereitstellen einer Wirtszelle der Gattung Clostridium und
Transformieren der Wirtszelle mit einem erfindungsgemäßen Nuc- leinsäuremolekül und/oder Vektor, welcher ein oder mehrere erfindungsgemäße Nucleinsäuremoleküle bevorzugt in sense- Orientierung enthält,
so dass das so/ß-Gen oder ein funktionales Analog, Fragment oder Derivat davon überexprimiert beziehungsweise das erfindungsgemäße Regulatormolekül in der Wirtszelle vermehrt synthetisiert wird, sodass sich die effektive Konzentration des Regulatormoleküls, insbesondere also des SolB-Transkripts, erhöht.
Gegenstand der Erfindung ist auch eine genetisch modifizierte Zelle, welche einen mit den erfindungsgemäßen Mitteln und Verfahren modifizierten Säure- oder Lösungsmittelstoffwechsel aufweist. Besonders ist dies eine transgene Wirtszelle, welche bevorzugt mindestens einen erfindungsgemäßen Vektor enthält und/oder ein erfindungsgemäßes Nucleinsäuremolekül in sense Orientierung, bevorzugt ausschließlich als heterologes Gen und in exprimierbarer Form, enthält. In einer besonderen Ausführungsform der Erfindung wird ein erfindungsgemäßes Nucleinsäuremolekül, besonders das SoIB- Transkript oder dessen Funktionsanaloge, bevorzugt direkt, außerhalb eines biologischen Organismus, vor allem über eine chemische Synthese, hergestellt. Die chemische Synthese des Nucleinsäuremo- leküls, besonders RNA-Moleküls, erfolgt in an sich bekannter Weise. Die Erfindung betrifft somit auch Verfahren zur chemischen Synthese des erfindungsgemäß eingesetzten SolB-Transkripts oder eines Funktionsanalogs davon. Die chemische Synthese greift dabei vor- zugsweise auf die hierin offenbarten erfindungsgemäßen Sequenzen zurück.
Neben der chemischen Synthese erfindungsgemäßer RNA-Moleküle betrifft die Erfindung auch die chemische Synthese von Desoxyribo- nucleinsäuremolekülen, vor allem also von DNA-Molekülen, welche in ein erfindungsgemäßes RNA-Molekül transkribierbar sind.
Gegenstand der Erfindung ist auch das Nucleinsäuremolekül, besonders RNA-Molekül, zur Modifikation der Expression mindestens einer Enzymaktivität in einer Wirtszelle, wobei das Molekül ausgewählt ist aus:
a) RNA-Molekülen, welche von dem erfindungsgemäßen Nucleinsäuremolekül, bevorzugt ausgewählt aus: SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 und SEQ ID NO: 10, kodiert werden und bevorzugt dessen Nucleotidsequenz aufwei- sen, und
b) Abwandlungen oder Fragmente davon, die zumindest die Funktion eines Regulators zur Modulation der Expression dieser Enzymaktivität in der Wirtszelle aufweisen. Ein erfindungsgemäßes RNA-Molekül, oder eine Population enthaltend noch mindestens eine zweite oder weitere Variante des Moleküls, kann in an sich bekannter Weise in die Wirtszelle eingebracht werden, vorzugsweise durch Anlegen eines elektrischen Feldes (Elektroporation), wodurch die Zellmembran der lebenden Zellen kurzfristig für diese kleinen Moleküle durchlässig gemacht wird, ohne dass es zu einer vollständigen Desintegration der Zellen kommt.
In dieser alternativen Ausführungsform der Erfindung ist eine Transformation der Wirtszellen, beispielsweise mit Vektoren, nicht notwen- dig. Die Regulation durch das mindestens eine von extern eingebrachte RNA-Molekül mit der Funktion oder Bindungsaktivität des erfindungsgemäßen SolB-Transkripts kann unmittelbar erfolgen. In dieser Ausführungsform besteht vorteilhafterweise auch keine Promotor-Abhängigkeit wie bei Überexpressionsplasmiden.
Gegenstand der Erfindung ist auch ein Verfahren zur Steigerung der Säureproduktion, besonders der Synthese kurzkettiger Carbonsäuren, insbesondere also Acetat und/oder Butyrat, in einer Wirtszelle sowie verbesserte Verfahren zu deren biotechnologischer Herstellung. Erfindungsgemäß wird mindestens eine Wirtszelle, besonders der Gattung Clostridium, bereitgestellt und mindestens ein RNA- Molekül mit der Funktion oder Bindungsaktivität des erfindungsgemäßen SolB-Transkripts in die Wirtszelle eingeschleust. Zur biotechnologischen Herstellung dieser Carbonsäuren wird die so modifizierte Wirtszelle bevorzugt in Gegenwart eines verstoffwechselbaren Substrats kultiviert, und zwar unter Bedingungen, welche die Bildung der Carbonsäure aus dem Substrat ermöglichen. Der Fachmann kennt die Möglichkeiten, entsprechende Bedingungen zu wählen und zu finden, die die Verwirklichung dieser erfindungsgemäßen Lehre gestatten. In einer zweiten Ausführung der Erfindung werden Mittel und Verfahren zur Steigerung der Lösungsmittelproduktion in einer Wirtszelle bereit gestellt. Die Verringerung der effektiven Konzentration des SolB-Transkripts oder eines Funktionsanalogs davon in einer Wirts- zelle wird erfindungsgemäß durch an sich bekannte Maßnahmen erreicht. Besonders bevorzugte Varianten sind nachfolgend näher dargestellt.
In einer bevorzugten Variante ist vorgesehen, eine solB knock out- Mutante einer Wirtszelle, besonders einer lösungsmittelbildenden Zelle der Gattung Clostridium, bereitzustellen. Ein solB knock out wird durch an sich bekannte Maßnahmen, insbesondere durch homologe Rekombination, erzeugt. Bevorzugt sieht die Erfindung eine oder mehrere an sich bekannte Maßnahmen, bevorzugt ausgewählt aus Deletion, Substitution, Insertion und Inversion, insbesondere Punktmutation, des so/ß-Gens beziehungsweise seines Homologs oder Orthologs oder sonstigen Funktionsanalogs in der Wirtszelle vor.
Eine alternative Ausführung davon ist die antisense-Hemmung des so/ß-Gens, seines Homologs oder Orthologs oder sonstigen Funkti- onsanalogs in der Wirtszelle. In einer bevorzugten Ausführung der Erfindung wird die effektive Konzentration des SolB-Transkripts in der Zelle dadurch vermindert, dass, bevorzugt durch Transformation, ein oder mehrere antisense-Konstrukte, bevorzugt in Form eines oder mehrerer Expressionsvektoren in die Zelle eingebracht werden. Zur Transformation der Wirtszelle werden bevorzugt ein oder mehrere Plasmide eingesetzt, welche eine oder mehrere Kopien des anti- sense Konstrukts bevorzugt in einer oder mehreren erfindungsgemäßen Expressionskassette enthalten. In einer bevorzugten Variante wird das antisense Konstrukt als DNA- oder RNA-Molekül in an sich bekannter Weise unmittelbar in die Zelle eingeführt. Dies erfolgt beispielsweise durch zeitweise Desintegration der Zellmembran durch Elektroporation oder durch Beschuss der Zelle (gene gun). Alternative Verfahren sind dem Fachmann hinreichend bekannt.
Die Erfindung betrifft demgemäß auch Nucleinsäuremoleküle, die ein antisense Konstrukt eines endogenen so/ß-Gen, seines Homologs oder Orthologs oder sonstigen Funktionsanalogs oder eines Frag- ments davon darstellen. Solche erfindungsgemäßen Nucleinsäuremoleküle leiten sich erfindungsgemäß durch Inversion von den vorbezeichneten Nucleinsäuremolekülen in an sich bekannter Weise ab. Es versteht sich, dass die Erfindung sämtliche Analoge, Fragmente oder Derivate davon betrifft, welche die erfindungsgemäße anti- sense-Hemmung des so/ß-Gens einer Wirtszelle ermöglichen. Der Fachmann kann solche Fragmente ohne Weiteres daraus bereitstellen. Erfindungsgemäß besonders bevorzugt sind folgende Fragmente des so/ß-Gens: 3'-so/ß 75 Bp (SEQ ID No: 7), 3'-so/ß 115 Bp (SEQ ID No: 8), 5'-so/ß 72 Bp (SEQ ID No: 9), 5'-so/ß 102 Bp (SEQ ID No: 10). Bevorzugt werden Fragmente des so/ß-Gens, in antisense Orientierung in einem Expressionsvektor kloniert und damit die Wirtszelle, bevorzugt eine lösungmittelbildende Clostridium Zelle, transformiert.
Gegenstand der Erfindung ist demgemäß auch ein Vektor zur Unter- drückung der Expression des so/ß-Gens in der Zelle. Dieser enthält ein so/ß-Gen-Konstrukt, das heißt mindestens ein erfindungsgemäßes Nucleinsäuremolekül oder dessen Analog, Fragment oder Derivat davon, und zwar bevorzugt in antisense Orientierung. Bevorzugt liegen eine oder mehrere Kopien des Nucleinsäuremoleküls in anti- sense Orientierung in exprimierbarer Form, bevorzugt in mindestens einer Expressionskassette vor, besonders bevorzugt in Verbindung mit einem konstitutiven oder induzierbaren Promotor. In einer bevorzugten Variante wird der Vektor auf Basis des plMP1 -Vektors kon- struiert. Vektorkarten bevorzugt verwendeter Vektoren sind in den Figuren 5 und 6 dargestellt.
Gegenstand der Erfindung ist auch ein Verfahren zur Herstellung einer genetisch modifizierten Wirtszelle mit modifizierter, besonders mit gesteigerter, Lösungsmittelproduktion, enthaltend die Schritte:
Bereitstellen einer Wirtszelle, besonders der Gattung Clostridium, und
Einschleusen eines erfindungsgemäßen Nucleinsäuremoleküls oder Vektors enthaltend mindestens ein modifiziertes so/S-Gen- Konstrukt, das heißt mindestens ein erfindungsgemäßes Nuclein- säuremolekül oder dessen Analog, Fragment oder Derivat davon, und zwar bevorzugt in antisense-Orientierung, in die Wirtszelle,
so dass die Expression des so/S-Gens oder eines funktionalen Ho- mologs oder Orthologs davon supprimiert wird beziehungsweise das erfindungsgemäße Regulatormolekül, besonders also das SoIB- Transkript, in der Wirtszelle vermindert synthetisiert wird, so dass sich die effektive Konzentration des Regulatormoleküls vermindert.
Gegenstand der Erfindung ist auch eine Wirtszelle, welche einen mit den erfindungsgemäßen Mitteln und Verfahren modifizierten Säureoder Lösungsmittelstoffwechsel aufweist. Besonders ist dies eine transgene Wirtszelle, welche bevorzugt mindestens einen erfindungsgemäßen Vektor enthält und/oder ein erfindungsgemäßes Nucleinsäuremolekül in antisense-Orientierung, bevorzugt ausschließlich als heterologes Gen und in exprimierbarer Form, enthält.
Die Erfindung betrifft auch Verfahren zur Steigerung der Lösungsmittelproduktion, besonders der Butanolproduktion, in einer Wirtszelle sowie verbesserte Verfahren zur biotechnologischen Herstellung von Lösungsmitteln, besonders von Butanol, wobei mindestens eine derart modifizierte Wirtszelle, besonders der Gattung Clostridium, bereitgestellt wird.
Die Erfindung betrifft auch Verfahren zur biotechnologischen Herstel- lung von Lösungsmitteln, besonders der Aceton- und/oder Butanolproduktion. Dazu wird die erfindungsgemäß modifizierte Wirtszelle, bevorzugt in Gegenwart eines verstoffwechselbaren Substrats, kultiviert, und zwar bevorzugt unter Bedingungen, welche die Bildung von Lösungsmitteln, besonders von Aceton und/oder Butanol, aus dem Substrat ermöglichen. Der Fachmann kennt die Möglichkeiten, entsprechende Bedingungen zu wählen und zu finden, die die Verwirklichung dieser erfindungsgemäßen Lehre gestatten.
Gegenstand der Erfindung ist auch ein Verfahren zur Herstellung einer Wirtszelle mit modifizierter, besonders mit gesteigerter, Lö- sungsmittelproduktion, enthaltend die Schritte:
Bereitstellen einer Wirtszelle, besonders der Gattung Clostridium und
Einschleusen des erfindungsgemäßen Nucleinsäuremoleküls in Form eines, bevorzugt extern synthetisierten, insbesondere isolier- ten, RNA-Moleküls, und zwar in antisense Orientierung, in die
Wirtszelle, so dass das so/B-Gen und/oder dessen Funktionsanalog, Homolog oder Ortholog supprimiert beziehungsweise die effektive Konzentration des Transkripts vermindert wird.
In beiden vorstehend charakterisierten Ausführungen der Erfindung ist die dort in Bezug genommene erfindungsgemäß modifizierte, besonders transgene, Wirtszelle bevorzugt ausgewählt aus Organismen der Gattung Clostridium, besonders die lösemittelbildenden Gattungen, besonders bevorzugt aus C. beijerinckii, C. saccharobutyli- cum, C. saccharoperbutylacetonicum und C. acetobutylicum. Die Erfindung ist nicht auf diese Zellen beschränkt. Die Erfindung ist beispielsweise auch auf säure- und/oder lösemittelbildende transgene Wirtszellen, welche die Enzymausstattung für die Säure- und/oder Lösungsmittelproduktion, insbesondere auch homologe oder ortholo- ge Gene zu den lösemittelbildenden Clostridien aufweisen, anwend- bar.
Die Kultivierung der erfindungsgemäß bereitgestellten säure- und/oder lösungsmittelbildenden Wirtszelle kann in Co-Kultivierung mit anderen Zellen derselben Gattung erfolgen, die mit den erfindungsgemäß modifizierten Wirtszellen in Stoffwechselaustausch ste- hen. Zur Co-Kultivierung können auch andere, gattungsfremde Organismen herangezogen werden, um das Substratspektrum zu erhöhen. Der Fachmann kennt die Möglichkeiten der Co-Kultivierung.
Das Substrat zur erfindungsgemäßen Synthese von Säure und/oder Lösungsmittel ist bevorzugt ein kohlenstoffhaltiges Substrat. Dieses ist vorzugsweise pflanzliches Material, welches bevorzugt einen hohen Anteil an Kohlenhydraten, vor allem Stärke, Lignocellulose, CeI- lulose und/oder Zucker, enthält, sowie daraus gewonnenes Fasermaterial, daraus gewonnener Extrakt, daraus gewonnene Melasse, dar- aus gewonnene Pulpe und/oder daraus gewonnener Saft. Ein bevorzugtes Pflanzenmaterial ist Mais und/oder die daraus abgeleiteten Produkte. Ein weiteres bevorzugtes Pflanzenmaterial ist die Zuckerrübe und/oder die daraus abgeleiteten Produkte. Ein weiteres bevor- zugtes Pflanzenmaterial ist Zuckerrohr und/oder die daraus abgeleiteten Produkte, Bagasse etc. Weitere bevorzugte Materialien sind Getreide- oder Faserpflanzen und/oder daraus abgeleitete Produkte, Stroh, Stover (Getreide-Ernterückstände), besonders Com Stover (Mais-Ernterückstände). Bevorzugte Getreide sind Reis, Weizen, Gerste, Roggen, Hafer. Bevorzugte Stärke- oder Zuckerquellen sind Rosskastanie, Kartoffel, Batate, Artischocke, Maniok, Zichorie und Soja. Bevorzugte Lignocellulose- und Cellulosequellen sind Nuss- schalen, Holz, besonders Weichholz, sowie daraus gewonnenes Fasermaterial und Holzabfälle, Fruchtschalen und ausgepresste Früch- te wie Trauben und Zitrusfrüchte, Getreide-Stroh, Mais-Stroh und Bagasse. Bei überwiegend Zellstoff-haltigen Pflanzen und/oder Pflanzenfasern können auch Co-Kulturen mit primär Zellstoff- verstoffwechselnden Organismen eingesetzt werden.
Die Erfindung betrifft schließlich auch Bindungskomplexe, welche mit der Regulation der Lösungsmittel- oder Säureproduktion in der Wirtszelle im Zusammenhang stehen, bestehend aus oder enthaltend: mindestens einem erfindungsgemäßen Nucleinsäuremolekül, oder dessen funktionsanaloges Fragment, Derivat oder Analog, mit mindestens einer die Bindungsstelle enthaltenden Zielstruktur.
Erfindungsgemäße Bindungskomplexe werden vorzugsweise erhalten durch Verfahren mit zumindest den Schritten:
Bereitstellen des erfindungsgemäßen Nucleinsäuremoleküls, welches bevorzugt ein RNA-Molekül ist, und Inkontaktbringen des Nucleinsäuremoleküls mit mindestens einer eine Bindungsstelle zur Bindung des Nucleinsäuremoleküls aufweisenden Struktur, besonders ein DNA-Molekül, RNA-Molekül und/oder Protein.
Als Bindungsstelle weist die Struktur vorzugsweise eine homologe Basenabfolge auf mit einer mit dem erfindungsgemäßen Nucleinsäu- remolekül homologen komplementären Sequenz oder einem homologen Sequenzabschnitt davon.
Gegenstand der Erfindung ist auch ein Kit (kit-of-parts), welches mindestens eines der hierin beschriebenen Moleküle oder Konstruk- te, besonders in isolierter Form, enthält oder bevorzugt daraus besteht, zur Modulation der Säure- und/oder Lösungsmittelproduktion in einer hierin näher charakterisierten Wirtszelle.
Gegenstand der Erfindung ist auch ein Kit (kit-of-parts), welches mindestens eine der hierin beschriebenen transgenen Wirtszellen, worin die effektive Konzentration des SolB-Transkripts oder eines funktionsanalogen Derivats oder Fragments davon im Vergleich zum Wildtyp der Zelle erhöht ist, enthält oder bevorzugt daraus besteht, zur biotechnologischen Herstellung von kurzkettiger Carbonsäure.
Gegenstand der Erfindung ist auch ein Kit (kit-of-parts), welches mindestens eine der hierin beschriebenen transgenen Wirtszellen, worin die effektive Konzentration des SolB-Transkripts oder eines funktionsanalogen Derivats oder Fragments davon im Vergleich zum Wildtyp der Zelle reduziert ist, enthält oder bevorzugt daraus besteht, zur biotechnologischen Herstellung von Lösungsmittel.
Die Erfindung betrifft auch die Verwendung der hierin beschriebenen Moleküle oder Konstrukte oder Kits zur Modulation der Säure- und/oder Lösungsmittelproduktion in einer hierin näher charakterisierten Wirtszelle. Bevorzugt ist die Verwendung zur Steigerung der Lösungsmittelsynthese. Besonders bevorzugt ist die Verwendung zur Synthese von Aceton. Besonders bevorzugt ist die Verwendung zur Synthese von Butanol.
In alternativen Varianten der Erfindung ist die Verwendung zur Steigerung der Säuresynthese bevorzugt. Besonders bevorzugt ist die Verwendung zur Synthese von Acetat oder Essigsäure. Besonders bevorzugt ist die Verwendung zur Synthese von Butyrat oder Butter- säure.
Beispiel 1 : Analyse der so/5-Expression in C. acetobutylicum
1.1 Isolierung von Gesamt-RNA
Die Zellen wurden nach Zentrifugation (14000 Upm, 4 0C, 1 min) rasch in 2-ml-Reaktionsgefäßen in flüssigem Stickstoff schockgefro- ren. Das Zellsediment wurde in 0,7 ml eiskaltem ASE-Puffer (siehe unten) resuspendiert und sofort wurden 0,7 ml auf 60 0C erwärmtes AquaPhenol™ (wassergesättigtes Phenol; Firma QBiogene) zugegeben und für 30 sec kräftig gemischt. Der Ansatz wurde anschließend für 10 min bei 6O0C inkubiert. Die beiden Phasen wurden durch wie- derholtes Mischen in Suspension gehalten. Nach Zentrifugation (13000 Upm, 10 min, 4 0C) wurde die wässrige Phase in ein 2-ml- Reaktionsgefäß überführt und mit 0,6 ml AquaPhenol™ versetzt. Nach dem Mischen wurde erneut zentrifugiert und die Phenol- Behandlung so lange wiederholt, bis keine Interphase mehr zu er- kennen war. Abschließend erfolgte jeweils eine Extraktion mit AquaPhenol™/ReadyRead™ (Firma QBiogene) (1 :1 v/v) bzw. Rea- dy/Red™ (Firma QBiogene). Nach Beendigung der Behandlung wurde die RNA einer Ethanolfällung unterzogen.
ASE-Puffer:
Na-Acetat 164 mg 20 mmol/l
SDS 0,5 g 0,5 % (w/v)
EDTA 37 mg 1 mmol/l
H2O ad 100 ml pH 5,5
1.2 Ethanolfällung
Die Fällung der RNA bzw. DNA wurde durch Zugabe von 2,5 Vol. eiskaltem Ethanol (96 % v/v) und Inkubation für mindestens 30 min bei -20 0C erreicht. Nach Zentrifugation (14000 Upm, 30 min, 4 0C) wurde das Sediment mit 1 ml Ethanol (70 %, v/v) gewaschen und erneut zentrifugiert. Abschließend erfolgte das Trocknen des Sediments in einer SpeedVac-Vakuumzentrifuge. Je nach Dichte der zu Anfang eingesetzten Kultur, wurde das Sediment in 20-50 μl DEPC- Wasser (Diethylpyrocarbonat) aufgenommen. Auf diese Weise präparierte RNA wies oft noch eine Verunreinigung mit DNA auf, so dass eine DNase-Behandlung angeschlossen werden konnte.
1.3 DNase-Behandlung von wässrigen RNA-Lösungen
Für die DNase-Behandlung wurde RNase-freie-DNase („Deoxyribo- nuclease I, RNase free, Firma Fermentas) in einem Ansatz mit einem Gesamtvolumen von 200 μl verwendet, in dem 20 μl 10x DNase- Puffer (10x Reaction Buffer with MgCI2, Fermentas GmbH) und 50 U DNase I enthalten waren. Nach einer Inkubation von 1 h bei 37 "C wurden 20 μl Na-Acetatlösung (3 mol/l, pH 5,2) zugeben und eine Phenol-Chloroform-Extraktion sowie eine Ethanolfällung durchgeführt. Um RNA zu erhalten, die vollständig von DNA befreit war, konnte diese Behandlung ein- bis zweimal wiederholt werden. Als Kontrolle auf eine DNA-Kontamination diente eine Standard-PCR auf die RNA. Im Fall vollständig verdauter DNA war kein spezifisches PCR- Produkt im EtBr-gefärbten Agarose-Gel zu sehen.
Die RNA wurde in 20-50 μl DEPC-Wasser bei -7O0C gelagert.
1.4 Phenol-Chloroform-Extraktion
Um DNA- bzw. RNA-Lösungen von Proteinverunreinigungen zu befreien, wurde die DNA- bzw. RNA-Lösung mit 1 Vol. Phe- nol/Chloroform/lsoamylalkohol (25:24:1 , v/v/v) versetzt, 30 sec gemischt und zur Phasentrennung zentrifugiert (13000 Upm, 5 min, RT). Die obere wässrige Phase wurde anschließend in ein neues Reaktionsgefäß überführt und die Prozedur so oft wiederholt, bis nach Zentrifugation keine Proteininterphase mehr zu erkennen war. Daraufhin erfolgte, zur Entfernung eventuell vorhandener Phenolreste, in einem neuen Reaktionsgefäß die Zugabe von 1 Vol. Chloro- form/lsoamylalkohol (24: 1 , v/v) zur oberen Phase, 30 s Mischen und eine erneute Zentrifugation. Die obere, DNA-haltige Phase wurde schließlich mit Ethanol gefällt.
15 RT-PCR
Die RT-PCR wurde eingesetzt, um RNA mit Hilfe des Enzyms Reverse Transkriptase in einzelsträngige cDNA umzuschreiben. Ausgehend von dieser cDNA wurde in einem zweiten Schritt, der einer Standard-PCR entspricht, ein spezifisches Produkt amplifiziert. Ein Amplifikat wurde nur erhalten, wenn die entsprechende mRNA eines Gens oder eines Operons im Zuge der Transkription gebildet worden war. Für das SolB-Transkript wurden je RT-PCR-Ansatz ca. 500 ng Ge- samt-RNA als Matritze eingesetzt. Als Primer wurde snRNA_R (Reverse-Primer) für die cDNA-Synthese verwendet und die anschließende PCR mit dem Primer snRNA_F (Forward-Primer) komplemen- tiert. In den Negativkontrollen wurde die Reverse Transkriptase durch Wasser ersetzt. Pro RT-PCR-Ansatz wurden angesetzt: RNA: 0,01-0,5 μg; Reverse-Primer (20 μmol/l): 1 ,5 μl (2,7 μmol/l); RNase freies Wasser: ad 11 μl. Die Ansätze wurden für 5 min bei 70 0C inkubiert und anschließend schnell auf 4 0C abgekühlt. Nach Zugabe von: RT-Reaktionspuffer (5x): 4 μl (1x); dNTP-Gemisch (10 mmol/l): 2 μl (1 mmol/l); Ribolock™ (Firma Fermentas) (40 U/μl): 1 μl (40 U); M-MuLV-Reverse Transkriptase (Firma Fermentas) (20 U/μl): 2 μl (40 U) wurden die Proben 1 h bei 37 0C inkubiert. Für eine Negativkontrolle wurde die Reverse Transkriptase durch 2 μl Wasser ersetzt.
Nach Inaktivierung für 10 min bei 70 0C schloss sich eine Standard- PCR mit der Taq-DNA-Polymerase an. Pro Ansatz wurden dafür eingesetzt: Taq-Polymerase (1 U/μl) 5 μl (5 U); (NH4)2SO4- Reaktionspuffer (10x): 5 μl (1x); Forward-Primer (20 μmol/l): 1 ,5 μl (0,6 μmol/l); H2O: ad 50 μl. Die DNA-Fragmente wurden in einer nicht-denaturierenden Agarose-Gelelektrophorese aufgetrennt und ausgewertet.
16 Standard-PCR
Die Standard-PCR zum Plasmidnachweis erfolgte mit Taq-DNA- Polymerase (Fermentas GmbH). Zur Amplifikation von DNA- Bereichen, die im Anschluss kloniert wurden, wurde die Polymerase „PowerScript DNA Polymerase Short" (Firma PAN-Biotech) oder „High Fidelity PCR Enzyme Mix" (Firma Fermentas) verwendet. Ein typischer PCR-Ansatz enthielt folgende Komponenten: Reaktionspuffer (1Ox): 5 μl (1x); MgCI2 (25 mmol/l): 3 μl (1 ,5 mmol/l); Primer A (100 μmol/l): 1 μl (2 μmol/l): Primer B (100 μmol/l): 1 μl (2 μmol/l); Matrizen-DNA; dNTP-Gemisch (10 mmol/l): 1 μl (200 μmol/l); PoIy- merase: 1-2 μl (2-5 U); H2O: ad 50 μl. PCR-Programm: Vorabdenatu- rierung 3-5 min bei 95 0C; 32 Zyklen: Denaturierung 45 s bei 95 0C1 Hybridisierung 45 s Temp. variabel, Elongation 0,5-1 min/1 OOOnt bei 72 0C, Elongation 5 min bei 72 0C; Ende: Kühlung bei 12 0C.
1.7 Ergebnis
Figur 7 zeigt das Ergebnis der qualitativen RT-PCR zur Untersuchung der Transkription des so/ß-Gens: (-): Negativkontrolle der entsprechenden Probe (Ersatz der reversen Transkriptase durch Wasser), (+): RT-PCR der entsprechenden Probe, (S): Größenstandard (ca. 500 ng Gesamt-RNA je RT-PCR-Ansatz)
Der potentielle Promotor im 5'-Bereich des so/ß-Gens ist während des gesamten Wachstums des Stammes C. acetobutylicum auf phosphatlimitiertem Minimalmedium aktiv, und zwar sowohl in der Säure- als auch in der Lösungsmittelphase. Das SolB-Transkript (SolB-mRNA) ist in beiden Phasen, das heißt während des gesamten Wachstums, nachweisbar.
Beispiel 2: Transformation von C. acetobutylicum
Folgende Bakterienstämme wurden verwendet:
- als Wirtszelle: Clostridium acetobutylicum ATCC 824 (Typstamm) - zur Methylierung von Plasmiden: E. coli ER 2275 (trp-31 , his-1 , tonA2, rpsL104, supE44, xyl-7, mtl-2, metB1 , e14-, Δ(lac)U169, endA1 , recA1 , R(zbgZ10::Tn10)Tcs, Δ(mcr-hsd-mrr)114::1510, [F1 proAB, laclqZΔM15, zzd::mini, Tn10 (Kmr)])
- zur Transformation: E. coli XL2-Blue (recA1 , endA1 , gyrA96, thi-1 , hsdR17, supE44, relA1 , lac, [F1, proAB, laclqZΔM15, Tn10 (Tetr), amy, Camr]) und E. coli XL1-Blue MRF (Δ(mcrA)183, Δ(mcrCB- hsdSMR-mrr)173, endA1 , supE44, thi-1 , recA1 , gyrA96, relA1 , lac, [F, proAB, laclqZΔM15, Tn 10 (Tetr)])
Folgende Plasmide wurden verwendet:
- plMP1 (4,7 kBp) Emr, Apr, pMB1 oh CoIEI , ori(+) plM13
Als Primer (Oligodesoxynukleotide) wurden verwendet: SEQ ID NO: 11 bis 16
2.1 Konstruktion der Plasmide
Als Ausgangsplasmid wurde das Plasmid plMP1 gewählt, dessen Funktionalität in C. acetobutylicum zweifelsfrei gezeigt werden konnte. Das Plasmid plMP1 ist eine Fusion, bestehend aus dem E. coli Klonierungsvektor pUC18 und dem B. subtilis Plasmid plM13, dessen Replikationsursprung und MLSr-Resistenzdeterminante (ermC) die Replikation in bzw. Clarithromycinresistenz von C. acetobutylicum ermöglichen. Die Kopienzahl von plMP1 beträgt in diesem Organismus 6-8 Kopien/Zelle.
Die Plasmide pBS1 bis pBS17 wurden nach den Plasmidkarten gemäß Figuren 4 bis 6 konstruiert. Im ersten Schritt wurde der konstitu- tiv starke Promotor des C. acetobutylicum Phosphotransbutyrylase- Butyratkinase-(pttHbw/c-)Operons mit Hilfe der Oligonukleotide KL08 (SEQ ID NO: 11) und KL09 (SEQ ID NO: 12) in einer Standard-PCR (siehe Beispiel 1) mit chromosomaler DNA als Matritze amplifiziert. Nach einem EcoRI-Ndel-Verdau wurde dieses 123-Bp-große Fragment in entsprechend verdautes plMP1 -Plasmid ligiert. In die Ndel- Schnittstelle des resultierenden Plasmids pBS77 wurde im zweiten Schritt das über eine Standard-PCR mit den Oligonucleotiden sRNA- kurz_neu_F (SEQ ID NO: 13) und sRNA_neu_R (SEQ ID NO: 14) (siehe auch Beispiel 1 ) amplifizierte und Λ/del-verdaute promotorlose, gesamte so/ß-Gen bzw. 284 Bp oder an/feense-Konstrukte davon (siehe nachfolgende Beispiele) ligiert. Als Matrize für die Standard- PCR diente chromosomale DNA.
Die Richtigkeit der Monierten Sequenzen wurde über eine Sequenzierung (MWG) überprüft. Alle Plasmide wurden erfolgreich methy- liert und in C. acetobutylicum transformiert.
2.1.1 Elektrotransformation von C. acetobutylicum
Um die Zellen für die Elektroporation vorzubereiten, wurden 5 ml CGM-Medium in Hungate-Röhrchen mit ca. 50 μl einer zuvor auf 75 0C erhitzten Sporensuspension beimpft und Übernacht bei 37 0C stehend inkubiert. Mit der gut gewachsenen Kultur wurden 50 ml CGM-Medium beimpft und bei 37 0C stehend so lange inkubiert, bis sie eine OD600 von ca. 0,6 (logarithmisch wachsende Zellen) erreicht hatten. ETM-Puffer:
Saccharose 92,3 g 270 mmol/l
Na2HPO4 x 2 H2O 106,6 mg 0,6 mmol/l
NaH2PO4 x 2 H2O 686,6 mg 4,4 mmol/l
MgCI2 x 6 H2O 2,04 g 10 mmol/l
H2O ad 1000 ml pH 6
ET-Puffer: entspricht ETM-Puffer ohne MgCI2
Die folgenden Schritte wurden in einer Anaerobenkammer vorgenommen: Die Zellen wurden durch Zentrifugation (5000 Upm, 10 min, 4 0C) geerntet, das Sediment in kaltem ETM-Puffer vorsichtig suspendiert und erneut zentrifugiert. Anschließend wurde das Zellsediment in 3 ml kaltem ET-Puffer aufgenommen und je 600 μl Zellsuspension in eine gekühlte Elektroporationsküvette (Elektrodenabstand 0,4 cm) überführt, in die zuvor die Plasmid-DNA (3-15 μl, 1- 10 μg) vorgelegt worden war. DNA und Zellen wurden durch vorsichtiges Aufziehen mit der Pipette gemischt und der Ansatz sofort elektroporiert. Zur Erzeugung des notwendigen Stromimpulses kam ein Gene Pulser-Il mit Pulse Controller Plus (Bio-Rad Laboratories GmbH) zum Einsatz, wobei folgende Einstellungen gewählt wurden: 1 ,8 kV; 50 μF; 600 Ω. Unter diesen Bedingungen lag die Zeitkonstante bei 5-16 ms. Die Zellen wurden anschließend in ein Hungate- Röhrchen mit 1 ,4 ml CGM-Medium überführt und mindestens 4 h bei 37 0C inkubiert. 200-300 μl wurden daraufhin auf CGM-Platten mit entsprechendem Antibiotikum ausplattiert und/oder zum Animpfen von entsprechendem Selektionsmedium verwandt. 2.1.2 Methylierung von Plasmid-DNA für die Transformation in C. acetobutylicum
C. acetobutylicum besitzt mit Cac824l eine Typ-Il- Restriktionsendonuclease, die das Sequenzmotiv 5'-GCNGC-3' er- kennt und schneidet. Die Methylierung des internen Cytosinrests in den Basenfolgen 5'-GCNGC-3' bzw. 5'-GGCC-3' durch die Me- thyltransferase Φ3TI des ß. subtilis Phagen Φ3T führt zu einer Verhinderung der Restriktion durch Cac824l. Da gezeigt werden konnte, dass derart methylierte Plasmid-DNA mit einer um zwei Größenor- düngen höheren Transformationseffizienz in C. acetobutylicum übertragen werden konnte als entsprechend nicht-methylierte Plasmid- DNA, wurden alle in dieser Arbeit konstruierten Plasmide, die in C. acetobutylicum übertragen werden sollten, einer solchen Methylierung unterzogen.
Die zur Elektroporation in C. acetobutylicum bestimmten Plasmide wurden bevorzugt mit der auf den Plasmiden pAN1 bzw. pANS1 kodierten Methyltransferase in vivo methyliert. Dafür wurden die E. co//-Stämme ER2275 oder XL1-Blue MRF1 verwendet, da sie keines der Restriktionssyteme McrA, McrBC und Mrr besitzen. Diese würden DNA schneiden, bei der das Cytosin der Sequenz 5'-CG-3' methyliert ist. Die Plasmide pAN1 bzw. pANS1 wurden zunächst in diesen Stämmen etabliert und diese dann mit dem zu methylieren- den Plasmid transformiert. Der p15A-Replikationsursprung von pAN1 bzw. pANS1 war dabei kompatibel mit dem CoIEI -Replikon. Alle zu Zwecken der Transformation von C. acetobutylicum konstruierten Plasmide dieser Arbeit trugen dieses Replikon.
Die so modifizierte Plasmid-DNA wurde durch Minipräparationen aus den E. co//-Stämmen isoliert. Dabei mussten die Plasmide pAN1 und pANS1 nicht separat aus den Plasmid-Präparationen entfernt werden, da sie nicht in C. acetobutylicum replizieren. Eine erfolgreiche Methylierung konnte durch Restriktion mit Fnu4HI bzw. Satl, me- thylierungssensiblen Isoschizomeren von Cac824l, überprüft werden.
2.1.3 Transformation von E. coli
Für die Transformation in E. coli wurden die Stämme E. coli XL1- Blue MRF' und XL2-Blue verwendet, da sie eine hohe Transfomati- onseffizienz besitzen.
2.1.3.1 Chemische Transformation von E. coli
Zur Herstellung kaltkompetenter Zellen von E. coli wurde zunächst eine Stammkultur auf einer LB-Platte mit entsprechendem Antibiotikum zur Selektion ausgestrichen und Übernacht bei 37 0C inkubiert. Eine Einzelkolonie wurde anschließend in 5 ml LB-Medium mit Antibiotikum überführt und wiederum LIN bei 37 0C schüttelnd inkubiert. Diese Vorkultur wurde als Inokulum für die Hauptkultur, 250 ml SOB- Medium mit Antibiotikum, verwendet. Bei 18 0C wurde die Kultur so lange geschüttelt bis eine OD6oo von 0,5-0,6 (ca. 12-20 h) erreicht war. Die Zellen wurden 10 min auf Eis inkubiert und durch Zentrifu- gation (5000 Upm, 10 min, 4 0C) geerntet. Das Zellsediment wurde in 80 ml eiskaltem PIPES-Puffer gewaschen, 10 min auf Eis inkubiert und erneut wie beschrieben zentrifugiert. Anschließend wurde das Sediment in 20 ml PIPES-Puffer aufgenommen und langsam, während einer l Ominütigen Inkubation auf Eis, mit DMSO (1 ,5 ml, entspricht einer Endkonzentration von 7 %, v/v) versetzt. Aliquots von 200 μl wurden in vorgekühlte 1 ,5-ml-Reaktionsgefäße pipettiert und sofort in flüssigem Stickstoff schockgefroren. Bei -70 CC konnten die Zellen ohne offensichtliche Verschlechterung der Transformationseffizienz gelagert werden. Zur Transformation wurde die entsprechende Menge an Aliquots (200 μl/Transformation) auf Eis aufgetaut und Plasmid-DNA oder Ligationsansatz (bis 20 μl) hinzupipettiert. Nach einer Inkubation von 30-40 min auf Eis wurden die Zellen einem einminütigen Hitzeschock bei 42 0C ausgesetzt, kurz auf Eis gekühlt und mit 800 μl LB-Medium versetzt. Sofort im Anschluss erfolgte eine Inkubation bei 37 0C unter leichtem Schütteln für 45-60 min. Im Falle der Transformation von Plasmiden wurden 20-50 μl des Ansatzes auf entsprechendem Selektionsmedium ausplattiert. Erfolgte die Transformation mit Ligation- sansatz, so wurde der Ansatz zentrifugiert (1000 Upm, 30 sec, RT), 850 μl des Überstandes verworfen, die Zellen in den verbleibenden 150 μl Medium suspendiert und diese komplett auf Selektionsmedium ausplattiert.
2.1.3.2 Elektroporation von E. coli
Durch Elektroporation kann DNA im Vergleich zu künstlich induzierter Transformation mit höherer Effizienz übertragen werden. Zur Herstellung elektrokompetenter E. co//-Zellen wurden 250 ml LB-Medium mit der Übernacht-Vorkultur des ent-sprechenden Stammes beimpft und bis zu einer OD600 von 0,6-0,8 schüttelnd bei 37 0C inkubiert. Bei dem Erreichen der gewünschten OD6oo wurden die Kultur 15 min auf Eis gekühlt und die Zellen anschließend durch Zentrifugation (5000 Upm, 10 min, 4 0C) geerntet. Das Sediment wurde 2x mit 250 ml eiskaltem Wasser und zweimal in 10-30 ml eiskaltem Glycerin (10 %, v/v) gewaschen. Das Zellsediment wurde schließlich in 1 ml eis- kaltem Glycerin (10 %, v/v) aufgenommen und die Zellsuspension in 50-μl-Aliquots entweder sofort zur Elektroporation eingesetzt oder in flüssigem Stickstoff schockgefroren. Bei -70 0C konnten die Zellen bis zu drei Monate gelagert werden. Zur Elektroporation wurde die entsprechende Menge an Aliquots (50 μl pro Transformation) auf Eis aufgetaut und in eine geeignete, eisgekühlte, sterile Elektroporationsküvette (Elektrodenabstand: 0,2 cm) pipettiert. Um intakte Plasmide zu transformieren, wurden 100 pg Plasmid-DNA, bei der Elektroporation von E. coli ER2275 [pAN1]-Zellen 1 μg Plasmid-DNA eingesetzt. Ligationsansätze mussten vor der Transformation dialysiert werden, wenn mehr als 100 ng DNA pro Transformationsansatz verwandt wurden. Die DNA wurde auf Eis zu den Zellen gegeben und der Ansatz sofort elektroporiert. Zur Erzeugung des notwendigen Stromimpulses kam ein Gene PuI- ser-ll mit Pulse Controller Plus (Bio-Rad Laboratories GmbH) zum Einsatz, Einstellungen: 2,5 kV; 25 μF; 200 Ω. Die Zeitkonstante betrug von 4,6 bis 4,9 ms. Nach dem Puls wurde dem Ansatz sofort 1 ml LB-Medium zugegeben, die Zellsuspension in ein 1 ,5-ml- Reaktionsgefäß überführt und dieses für 1 h bei 370C unter Schütteln inkubiert. Aliquots von 100-250 μl wurden anschließend auf LB- Selektionsmedium ausplattiert.
2.1.4 Plasmidpräparation aus E. coli
Der „peqGOLD Plasmid Miniprep" wurde angewendet, um saubere Plasmid-DNA in kurzer Zeit zu isolieren. Hierfür wurden ca. 4 ml E. co//-übernacht Kultur eingesetzt (ergab ca. 10 μg Plasmid-DNA, abhängig vom verwendeten E. co//-Stamm). Die genaue Durchführung der einzelnen Arbeitsschritte erfolgte entsprechend den Angaben des Herstellers.
2.1.5 Reinigung von DNA
Für die Reinigung von DNA wurde der „UltraClean™15 Kit" verwendet. Die Vorgehensweise erfolgte nach Herstellerangaben. 2.1.6 Restriktionsspaltunq von DNA
Der Restriktionsverdau von DNA für analytische und präparative Zwecke erfolgte entsprechend den Empfehlungen der Hersteller in einem Volumen von 10-200 μl bei 37 0C für meist 1 h.
Die Reaktion konnte durch Hitzeinaktivierung (enzymabhängig, nach Angaben des Herstellers), Phenol-Chloroform-Extraktion oder Aufreinigung mit dem „UltraClean15 Kit" (Firma Fermentas) gestoppt werden. Bei Mehrfachrestriktion wurde ein Puffersystem benutzt, in dem alle Enzyme mindestens 50-100 % Aktivität zeigten. Stand solch ein Puffersystem nicht zur Verfügung, wurde der Ansatz zwischen den einzelnen Restriktionsverdauen umgepuffert. Zusätzlich ist beim Verdau von PCR-Fragmenten die Tatsache zu berücksichtigen, dass Restriktions-enzyme in der Regel einen bestimmten Nukleotid- überhang benötigen, um effizient schneiden zu können. Deshalb wurde bei der Herstellung solcher PCR-Fragmente, die Schnittstellen am Ende des DNA-Strangs trugen, darauf geachtet, einen Nukleotid- Überhang von 5-8 Basen zu generieren. Pro 1 μg DNA wurden ca. 10 U bzw. mindestens 10 U des Restriktionsenzyms eingesetzt. 1 U ist als diejenige Enzymmenge definiert, die notwendig ist, um 1 μg λ-DNA bei 37 0C in 60 min vollständig zu spalten. Der Restriktionsverdau wurde durch eine Agarose-Gelelektrophorese überprüft.
2.1.7 Dephosphorylierung von DNA-Fragmenten
Um bei einer Ligation die Religation des Vektors zu verhindern, wurden nach einem Restriktionsverdau die Phosphatreste an den 5'- Enden hydrolysiert. Dabei kam die "Shrimp Alkaline Phosphatase" (SAP; Firma Fermentas) zum Einsatz. Die Dephosphorylierung wurde nach Angaben des Herstellers in der Regel direkt im Restriktionsansatz durchgeführt. Dafür wurde der 20-100-μl-Restriktionsansatz mit 2 U SAP versetzt, für 30 min bei 37 0C inkubiert und anschließend für 15 min bei 65 0C inaktiviert.
2.1.8 Ligation von DNA-Fragmenten (nach Weiss et al. 1968)
Ligationen wurden in 20-μl-Ansätzen durchgeführt. Dabei wurde in der Regel ein molares Verhältnis von Vektor zu Insert von 1 :3 bis 1 :5 angestrebt.
Wasser und DNA wurden zuerst für 5 min bei 55 0C präinkubiert und erst nach dem Abkühlen auf die letztendliche Inkubationstemperatur mit 2 μl 10x Ligase-Puffer und 1-2 U T4-DNA-Ligase (Firma Fermen- tas) komplementiert. Der Ansatz wurde dann entweder für 1 h bei 22 °C oder 12 h bei 16 0C inkubiert. Der Ligationsansatz wurde anschließend direkt in E. coli transformiert.
2.1.9 Isolierung von Gesamt-DNA
Dazu wurden zuerst 5 ml CGM Übernachtkultur zentrifugiert (5000 Upm, 10 min 4 0C). Nach dem Waschen mit 1 ml KP-Puffer (10 mmol/l, pH 7,5) wurde das Zellsediment in 500 μl KP-Puffer aufgenommen und in ein Reaktionsgefäß überführt. Es erfolgte der ZeII- aufschluss und der gleichzeitige Verdau unerwünschter RNA durch die Zugabe von 10 mg Lysozym (~100.000 U/mg), 5 μl RNase A 10 mg/ml (Firma Fermentas) und einer Inkubation von 1 h bei 37 0C. Danach erfolgte nacheinander die Zugabe von 50 μl einer 10%igen (w/v) SDS und 30 μl einer Proteinase K-Lösung mit einer anschließenden Inkubation von 1 h bei 55 0C. Es folgte eine Phenol- Chloroform-Extraktion und eine Ethanolfällung. Die getrocknete DNA wurde in ca. 300 μl H2O aufgenommen und bei 4 0C gelagert. Proteinase K-Lösung: 20 mg/ml Proteinase K (Roche Diagnostics GmbH) in 50 % Glyzerin (v/v)
2.2 Kultivierung und Produktspektrum
Anaerobes Wachstum von C. acetobutylicum wurde bei Volumina bis 5 ml in Hungate-Röhrchen (Bellco Glass Inc.; Vineland; USA) mit Butylstopfen und Schraubdeckeln durchgeführt. Größere Volumina wurden in 125-ml-, 500-ml und 1000-ml-Müller-Krempel-Flaschen (Müller & Krempel, Bülach, Schweiz) mit Naturgummistopfen und Edelstahldeckel angezogen. Aufgrund der starken Gasentwicklung durch C. acetobutylicum (H2 und CO2) wurden die Gefäße nur bis zur Hälfte befüllt und beim Eintritt in die logarithmische Wachstumsphase mit einer Kanüle versehen, durch die überschüssiges Gas entweichen konnte.
2.2.1 Trübungsmessung
Der Wachstumsverlauf einer Bakterienkultur wurde anhand der Zunahme der Optischen Dichte (OD) mit Hilfe eines Spektralphotometers bei einer Wellenlänge von 600 nm verfolgt. Die Messung erfolgte in einer 1 ml-Halbmikroküvette (Schichtdicke 1 cm) mit entsprechendem Medium als Referenzwert. Um eine Linearität zwischen der Zu- nähme der Extinktion und der Zellzahl zu gewährleisten, wurden die Proben ab Absorptionsmesswerten von 0,4 mit Medium verdünnt.
2.2.2 Messung des externen pH-Wertes
Für die Bestimmung des pH-Wertes von Kulturüberständen wurde ein Präzisions-pH-Meter verwendet. Um eine Verunreinigung der Messelektrode zu vermeiden wurde die Kultur zentrifugiert (10.000 Upm, 10 min, Raumtemperatur) und der Überstand in ein Reagenzglas überführt.
2.2.3 Gaschromatographische Analyse der Syntheseprodukte
Um das Produktspektrum der Stämme in Kultur zu protokollieren, wurden jeweils 2 ml Kulturüberstand zentrifugiert (10.000 Upm, 10 min, RT) und davon 1 ml in ein Rollrandgefäß überführt. Als interner Standard wurde jeder Probe 100 μl einer 110 mmol/l Isobutanol- lösung, gelöst in 2 N (2 mol/l) Salzsäure zugegeben und mit einem Septum gasdicht verschlossen. So aufgearbeitet wurden die Proben im Gaschromatographen unter folgenden Bedingungen analysiert:
Parameter der GC-Messung:
Säule: Glas, gepackt, ID 2 mm
Säulenmaterial: Chromosorb 101 mit 80 bis 100 mesh
Injektortemperatur: 195 °C Detektor: FID, 230 0C
Trägergas: N2 (15 ml/min)
FID-Gase: H2 (30 ml/min)
„Make-Up"-Gas: N2 (15 ml/min)
Synthetische Luft (80 % N2, 20 % O2): 250 ml/min
Probevolumen: 1 μl; „Hot-Needle"-Injektion
Temperaturprofil:
1300C für 1 min; 1300C bis 150°C mit 4°C/min; 15O0C bis 160°C mit
5°C/min; 160°C bis 180°C mit 7°C/min; 180°C bis 200°C mit 10°C/min; 2000C für 3 min
Die Auswertung erfolgte mittels Maestro Sampler Il Version 2.5 (Firma Chrompack). Um eine Quantifizierung der Proben zu ermögli- chen, wurden Kalibrierläufe mit Acetat, Acetoin, Aceton, Butanol, Bu- tyrat und Ethanol in der Konzentration 5 mmol/l durchgeführt. Die automatische Auswertung beruhte auf der Peakflächenberechnung von Kalibrierung und internem Standard.
Beispiel 3: Separate Synthese des SolB-Transkripts und Einbringen dieses Transkripts in Clostridien
Über eine chemische Synthese wurde ein RNA-Fragment des SolB- Transkripts (SolB-mRNA) künstlich hergestellt. Dieses RNA-Molekül wurde mittels Elektoporation (siehe Beispiel 2) in die Clostridien- Wildtypen eingebracht. Die so behandelten Clostridien wurden gemäß Beispiel 2 kultiviert, und es wurde das Produktspektrum analysiert.
Beispiel 4: Produktspektren der Stämme C. acetobutylicum plMP1 und C. acetobutylicum solB sense
Mit dem Typstamm C. acetobutylicum ATCC 824 (Wildtyp), der C. acetobutylicum plMP1 -Mutante und der erfindungsgemäßen C. acetobutylicum solB sense-Mutante wurden Wachstumsversuche in 50 ml phosphatlimitiertem Minimalmedium durchgeführt.
4J Ansätze
Die Mutante C. acetobutylicum plMP1 trägt den Vektor plMP1 ohne so/ß-Konstrukt. Dieser Stamm dient als Kontrolle.
Die Mutante C. acetobutylicum solB sense trägt das Plasmid pBS1. Das Plasmid wurde auf der Basis des plMP1 -Vektors konstruiert. Dieser Vektor wurde mit dem konstitutiven ptö-bu/c-Promotor verse- hen (Promotor des Phosphotransbutyrylase-Butyratkinase-Operons). Hinter den Promotor wurde in seπse-Orientierung das promotorlose so/ß-Gen kloniert. Die Vektorkarte ist in Figur 3 dargestellt.
4.2 Ergebnisse
Alle drei Stämme wuchsen gleich. Die Figuren 8A bis 8C zeigen die Produktspektren der Wachstumsversuche des Typstamms C. aceto- butylicum ATCC 824 (Wildtyp), Figur 8A, einer C. acetobυtylicum plMP1 -Mutante, Figur 8B, und der C. acetobutylicum solB sense- Mutante (erfindungsgemäß), Figur 8C, in phosphatlimitiertem Mini- malmedium; Konzentrationen in mmol/l (mM). Die Figuren 9A und 9B zeigen die Acetonproduktion, Figur 9A, und Butanolproduktion, Figur 9B, des Typstamms C. acetobutylicum ATCC 824 (Wildtyp), Figur 9A, und der C. acetobutylicum solB sense-Mutante (erfindungsgemäß), Figur 9B, auf phosphatlimitiertem Minimalmedium; Konzentra- tionen in mmol/l (mM).
Der Typstamm C. acetobutylicum ATCC 824 (Wildtyp) und die C. acetobutylicum plMP1 -Mutante (Kontrolle) produzierten durchschnittlich max. ca. 15 mmol/l Aceton und ca. 70 mmol/l Butanol: Das Plasmid-Konstrukt plMP1 hat keinen erkennbaren Einfluss auf das Produktspektrum der Wirtszelle.
Die C. acetobutylicum solB seπse-Mutante produziert ca. 2 mmol/l Aceton sowie ca. 2 bis 15 mmol/l Butanol. Sie produziert ca. 90 % weniger Aceton und Butanol als der Typtamm C. acetobutylicum ATCC 824 (Wildtyp). Beispiel 5: Produktsprektren von C. acetobutylicum synth. solB sense Mutanten
Mit den Typstamm C. acetobutylicum ATCC 824 (Wildtyp) und erfindungsgemäßen C. acetobutylicum synth. solB sense-Mutante wur- den Wachstumsversuche in 50 ml phosphatlimitiertem Minimalmedium durchgeführt.
5.1 Ansätze
Die Mutante C. acetobutylicum synth. solB sense trägt das Plasmid pBS7. Das Plasmid wurde auf der Basis des plMP1 -Vektors kon- struiert. Das solB Gen wurde mit eigenem Promotor in die multiple cloning site des Vektors (ßamHI und EcoRI) Moniert. Die Vektorkarte ist in Figur 4 dargestellt.
5.2 Ergebnisse
Beide Stämme wachsen gleich.
Die Figuren 10A bis 10C zeigen Produktspektren der Wachstumsversuche des Typstamms C. acetobutylicum ATCC 824 (Wildtyp), Figur 10A, einer ersten C. acetobutylicum synth. solB sense-Mutante (erfindungsgemäß), Figur 10B, einer weiteren C. acetobutylicum synth. solB sense-Mutante (erfindungsgemäß), Figur 10C, und noch einer weiteren C. acetobutylicum synth. solB sense-Mutante (erfindungsgemäß), Figur 10D, in phosphatlimitiertem Minimalmedium; Konzentrationen in mmol/l (mM).
Die Figuren 11A und 11 B zeigen die Acetonproduktion, Figur 11A, und Butanolproduktion, Figur 11 B, des Typstamms C. acetobutyli- cum ATCC 824 (Wildtyp), einer ersten C. acetobutylicum synth. solB sense-Mutante (erfindungsgemäß), einer weiteren C. acetobutylicum synth. solB sense-Mutante (erfindungsgemäß) und noch einer weiteren C. acetobutylicum synth. solB seπse-Mutante (erfindungsgemäß) auf phosphatlimitiertem Minimalmedium; Konzentrationen in mmol/l (mM).
Der Typstamm C. acetobutylicum ATCC 824 (Wildtyp) produziert durchschnittlich ca. 15 mmol/l Aceton und ca. 70 mmol/l Butanol. Alle C. acetobutylicum synth. solB sense Mutanten produzieren nahezu kein Aceton und Butanol mehr.
Beispiel 6: Produktspektren von C. acetobutylicum svnth. solB an- tisense Mutanten
Mit dem Typstamm C. acetobutylicum ATCC 824 (Wildtyp) und den erfindungsgemäßen Mutanten C. acetobutylicum synth. solB anti- sense wurden Wachstumsversuche in 50 ml phosphatlimitiertem Minimalmedium durchgeführt.
6J Ansätze
Die Mutanten C. acetobutylicum synth. solB antisense tragen das Plasmid pBS13. Das Plasmid wurde auf der Basis des plMP1- Vektors konstruiert. Der Promotor und der Terminator des solB Gens wurden in seπse-Orientierung, der Rest des so/ß-Gens (137 Bp) so- wie in anderen Vektoren Fragmente des so/ß-Gens (3'so/ß 75 Bp (pBS14), 3'so/ß 115 Bp1 (pBS15), 5'so/ß 72 Bp (pBS16), 5'so/ß 102 Bp (pBS17), wurden in anfrsense-Orientierung dazwischen kloniert. Die Vektorkarten sind in den Figuren δsowie 6A bis 6D dargestellt.
6.2 Ergebnisse
Alle Stämme wuchsen gleich. Der Typstamm C. acetobutylicum ATCC 824 (Wildtyp) produziert ca. 15 mmol/l Aceton und ca. 70 mmol/l Butanol; die Mutante C. acetobutylicum synth. solB antisense und die Mutante C. acetobutylicum synth. solB antisense X Bp (X = 3'-so/8 75 Bp; 3'-so/ß 115 Bp; 5'- solB 72 Bp; 5' solB 102 Bp) produzierten etwa 30 % mehr Butanol als der Typstamm C. acetobutylicum ATCC 824 (Wildtyp).
Beispiel 7: Produktion von Acetat und Butyrat
Die Kultivierung der Zellen erfolgte gemäß der vorstehenden Beispiele. Die Figur 12A zeigt die Acetatproduktion und Figur 12B die Buty- ratproduktion des Typstamms C. acetobutylicum ATCC 824 (Wildtyp) und einer C. acetobutylicum solB sense-Mutante (erfindungsgemäß) auf phosphatlimitiertem Minimalmedium; Konzentrationen in mmol/l (mM). Die Kultivierung der Zellen erfolgte gemäß der vorstehenden Beispiele.
Der Typstamm C. acetobutylicum ATCC 824 (Wildtyp) produziert bis zu ca. 66 mmol/l Acetat, die erfindungsgemäße Mutante C. acetobutylicum solB sense produziert max. ca. 60 mmol/l Acetat. Der Typstamm C. acetobutylicum ATCC 824 (Wildtyp) produziert bis zu ca. 50 mmol/l Butyrat, eine erfindungsgemäße Mutante C. acetobutyli- cum solB sense produziert ca. 105 mmol/l Butyrat. Die erfindungsgemäße Mutante C. acetobutylicum solB sense, produziert ca. doppelt so viel Butyrat wie der Wildtyp.
Die Figur 13A zeigt die Acetatproduktion und Figur 13B die Buty- ratproduktion des Typstamms C. acetobutylicum ATCC 824 (Wildtyp) und dreier C. acetobutylicum synth. solB sense-Mutanten (erfindungsgemäß) auf phosphatlimitiertem Minimalmedium; Konzentrati- onen in mmol/l (mM). Die Kultivierung der Zellen erfolgte gemäß der vorstehenden Beispiele.
Der Typstamm C. acetobutylicum ATCC 824 (Wildtyp) produziert hier bis zu ca. 55 mmol/l Acetat, die erfindungsgemäßen Mutanten C. acetobutylicum synth. solB sense produzieren bis ca. 30 mmol/l Acetat. Der Typstamm C. acetobutylicum ATCC 824 (Wildtyp) produziert bis zu ca. 50 mmol/l Butyrat, die erfindungsgemäßen Mutanten von C. acetobutylicum synth. solB sense produzieren ca. 105 bis 110 mmol/l Butyrat. Die erfindungsgemäße Mutanten C. acetobutylicum synth. solB sense, produzieren ca. doppelt so viel Butyrat wie der Wildtyp.
Literatur
Fischer, R. -J., J. Helms und P. Dürre. 1993. Cloning, sequencing and molecular analysis of the sol Operon of Clostridium acetobutylicum, a chromosomal locus involved in solventogenesis. J. Bacteriol. 175: 6959-6969.
Nair, R.V, Green, E. M., Watson, D. E., Bennett, G. E. und Papout- sakis, E. T. 1999. Regulation of the sol locus genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824 by a pu- tative transcriptional repressor. J. Bacteriol. 181 : 319-330.
Thormann, K., L. Feustel, K. Lorenz, S. Nakotte und P. Dürre. 2002. Control of butanol formation in Clostridium acetobutylicum by transcriptional activation. J. Bacteriol. 184: 1966-1973.

Claims

Patentansprüche
1. Nucleinsäuremolekül, geeignet zur Modulation der Expression mindestens einer Enzymaktivität der Lösungsmittel- und/oder Säureproduktion in einer Wirtszelle, wobei das Molekül eine Nucleinsäure- sequenz aufweist, welche ausgewählt ist aus:
a) SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4,
SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 und SEQ ID NO: 10,
b) komplementären Sequenzen davon und
c) abgewandelten Sequenzen und Fragmenten, die mit Sequen- zen nach (a) oder (b) mindestens 80% Sequenzübereinstimmung besitzen und die Funktion eines Regulators zur Modulation der Expression dieser Enzymaktivität kodieren.
2. Nucleinsäuremolekül nach Anspruch 1 , das ein RNA-Molekül ist.
3. Nucleinsäuremolekül nach einem der Ansprüche 1 oder 2, wobei die Modulation der Enzymaktivität durch Regulation mindestens eines Vorgangs ausgewählt aus: Transkription eines die Enzymaktivität kodierenden Gens und Translation des Gen-Transkripts, erfolgt, wobei das Nucleinsäuremolekül an mindestens eine den Vor- gang vermittelnde Struktur bindet und deren Funktion moduliert.
4. Nucleinsäuremolekül, das eine genetische Mutante des Nuc- leinsäuremoleküls nach einem der Ansprüche 1 bis 4 ist, wobei die mindestens eine genetische Mutation ausgewählt ist aus: Inversion, Deletion und Insertion mindestens eines Nucleotids.
5. Vektor, enthaltend mindestens eine exprimierbare Kopie des Nucleinsäuremoleküls nach einem der Ansprüche 1 bis 4.
6. Vektor nach Anspruch 5, worin das Nucleinsäuremolekül in sense-Orientierung exprimierbar angeordnet ist.
7. Vektor nach Anspruch 6, worin das Nucleinsäuremolekül in antisense-Orientierung exprimierbar angeordnet ist.
8. RNA-Molekül zur Modulation der Expression mindestens einer Enzymaktivität der Säure- und/oder Lösungsmittelproduktion in einer Wirtszelle, wobei das Molekül ausgewählt ist aus:
a) RNA-Molekül, welches aus dem Nucleinsäuremolekül nach einem der Ansprüche 1 bis 4 transkribierbar ist, und
b) Fragmenten von (a), welche die Funktion eines Regulators zur Modulation der Expression dieser Enzymaktivität in der Wirtszelle haben.
9. Transgene Wirtszelle mit modifizierter Säure- und/oder Lö- sungsmittelproduktion, enthaltend das Nucleinsäuremolekül nach einem der Ansprüche 1 bis 4 als heterologes Gen.
10. Transgene Wirtszelle mit modifizierter Säure- und/oder Lösungsmittelproduktion, enthaltend den Vektor nach einem der Ansprüche 5 bis 7.
11. Wirtszelle mit modifizierter Säure- und/oder Lösungsmittelproduktion, worin ein RNA-Molekül nach Anspruch 8 eingeschleust ist.
12. Transgene Wirtszelle mit modifizierter Säure- und/oder Lösungsmittelproduktion, worin die Expression des Nucleinsäuremole- küls nach einem der Ansprüche 1 bis 4 gehemmt oder verhindert ist.
13. Transgene Wirtszelle nach Anspruch 10, die eine knock out- Mutante des Gens solB und/oder eines Homologs oder Orthologs davon ist.
14. Verfahren zur Herstellung einer transgenen Wirtszelle mit mo- difizierter Säure- und/oder Lösungsmittelproduktion, enthaltend den
Schritt:
- genetisches Modifizieren der Wirtszelle mit mindestens einer Struktur ausgewählt aus: Nucleinsäuremolekülen nach einem der Ansprüche 1 bis 4 und Vektoren nach einem der Ansprü- che 5 bis 7,
oder
- Einschleusen des RNA-Moleküls nach Anspruch 8 in die Wirtszelle.
15. Verfahren nach Anspruch 14, wobei die Wirtszelle genetisch modifiziert wird, so dass das Nucleinsäuremolekül nach einem der
Ansprüche 1 bis 4 in sense-Orientierung exprimiert wird.
16. Verfahren nach Anspruch 14, wobei die Wirtszelle genetisch modifiziert wird, so dass das Nucleinsäuremolekül nach einem der Ansprüche 1 bis 4 in antisense-Orientierung exprimiert wird.
17. Verfahren zur biotechnologischen Herstellung von Butanol, enthaltend die Schritte:
- Bereitstellen einer Wirtszelle nach einem der Ansprüche 9 bis 13, worin die effektive Konzentration des Transkripts des in einem der Ansprüche 1 bis 4 charakterisierten Nucleinsäu- remoleküls im Vergleich zum Wildtyp der Zelle vermindert ist;
- Kultivieren der Wirtszelle in Kulturmedium und in Gegenwart eines Substrats unter Bedingungen, welche die Bildung von Butanol aus dem Substrat ermöglichen; und
- Gewinnen des Butanols aus Kulturmedium und/oder Wirtszelle.
18. Verfahren nach Anspruch 17, wobei die Wirtszelle eine in den Ansprüchen 11 oder 12 charakterisierte Zelle ist.
19. Verfahren zur biotechnologischen Herstellung von kurzketti- gen Carbonsäuren, enthaltend die Schritte:
- Bereitstellen einer Wirtszelle, nach einem der Ansprüche 9 bis 13, worin die effektive Konzentration des Transkripts des in einem der Ansprüche 1 bis 4 charakterisierten Nucleinsäu- remoleküls im Vergleich zum Wildtyp der Zelle erhöht ist;
- Kultivieren der Wirtszelle in Kulturmedium und in Gegenwart eines Substrats unter Bedingungen, welche die Bildung von kurzkettigen Carbonsäuren aus dem Substrat ermöglichen; und - Gewinnen der kurzkettigen Carbonsäure aus Kulturmedium und/oder Wirtszelle.
20. Verfahren nach Anspruch 19, wobei die Wirtszelle eine in einem der Ansprüche 9 bis 11 charakterisierte Zelle ist.
21. Verfahren nach einem der Ansprüche 17 bis 19, wobei das Substrat ausgewählt ist aus: stärke-, lignocellulose-, cellulose- und zuckerhaltigem Material, daraus gewonnenem Fasermaterial, Ba- gasse, Stover, Extrakt, Melasse, Pulpe und Saft.
EP09778907A 2008-12-20 2009-12-15 Verbesserte säure- und lösungsmittelproduktion in mikroorganismen Withdrawn EP2379721A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102008064249A DE102008064249A1 (de) 2008-12-20 2008-12-20 Verbesserte Säure- und Lösungsmittelproduktion in Mikroorganismen
PCT/EP2009/008961 WO2010069542A1 (de) 2008-12-20 2009-12-15 Verbesserte säure- und lösungsmittelproduktion in mikroorganismen

Publications (1)

Publication Number Publication Date
EP2379721A1 true EP2379721A1 (de) 2011-10-26

Family

ID=41691714

Family Applications (1)

Application Number Title Priority Date Filing Date
EP09778907A Withdrawn EP2379721A1 (de) 2008-12-20 2009-12-15 Verbesserte säure- und lösungsmittelproduktion in mikroorganismen

Country Status (4)

Country Link
US (1) US8679799B2 (de)
EP (1) EP2379721A1 (de)
DE (1) DE102008064249A1 (de)
WO (1) WO2010069542A1 (de)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9267106B2 (en) 2011-02-14 2016-02-23 Eastman Renewable Materials, Llc Method for incorporation of recombinant DNA
US8692024B2 (en) 2011-02-14 2014-04-08 Eastman Renewable Materials, Llc Method of producing n-butyraldehyde
WO2022190004A1 (en) * 2021-03-10 2022-09-15 Superbrewed Food, Inc. Antibiotic-resistant probiotics and uses thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US1315585A (en) 1919-09-09 Charles weizmann
KR101076042B1 (ko) 2007-12-20 2011-10-21 한국과학기술원 에탄올 및 부탄올 생성능이 증가된 재조합 미생물 및 이를이용한 에탄올과 부탄올의 제조방법

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SCOTCHER MILES C ET AL: "Expression of abrB310 and SinR, and effects of decreased abrB310 expression on the transition from acidogenesis to solventogenesis, in Clostridium acetobutylicum ATCC 824", vol. 71, no. 4, 1 April 2005 (2005-04-01), pages 1987 - 1995, XP002698023, ISSN: 0099-2240, Retrieved from the Internet <URL:http://aem.asm.org/content/71/4/1987> DOI: 10.1128/AEM.71.4.1987-1995.2005 *

Also Published As

Publication number Publication date
US20110281313A1 (en) 2011-11-17
WO2010069542A8 (de) 2010-11-04
US8679799B2 (en) 2014-03-25
WO2010069542A1 (de) 2010-06-24
DE102008064249A1 (de) 2010-07-01

Similar Documents

Publication Publication Date Title
EP2181195B1 (de) Fermentative Gewinnung von Aceton aus erneuerbaren Rohstoffen mittels neuen Stoffwechselweges
EP0334841B1 (de) Microorganismen and plasmide für die 2,4-dichlorphenoxyessigsäure (2,4-d)-monooxigenase - bildung und verfahren zur herstellung dieser plasmide und stämme
DE60132498T2 (de) Isoprenoidproduktion
EP1941047A1 (de) Pflanzen mit gesteigerter produktion von hyaluronan ii
DE60028777T2 (de) Verfahren zur herstellung von 1,3-propanediol durch einen rekombinanten microorganismus in abwesenheit von coenzym b12
EP0796914A2 (de) Alkohol-Dehydrogenase und deren Verwendung zur enzymatischen Herstellung chiraler Hydroxy-verbindungen
JP2000509988A (ja) キシロースをエタノールに発酵するための安定な組換え酵母
EP2267007B1 (de) Neue, Polyaminosäuren bildende oder abbauende Genprodukte von Bacillus licheniformis und darauf aufbauende verbesserte biotechnologische Produktionsverfahren
DE4220759A1 (de) DNA-Sequenzen für Oligosaccharid-Transporter, Plasmide, Bakterien und Pflanzen enthaltend einen Transporter sowie Verfahren zur Herstellung und Transformation von Hefestämmen zur Identifikation des Transporteers
EP2379721A1 (de) Verbesserte säure- und lösungsmittelproduktion in mikroorganismen
DE102008063234B4 (de) Biotechnologische Herstellung von Riboflavin mit hoher Ausbeute
CH640268A5 (en) Process for the preparation of filamentous hybrid phages, novel hybrid phages and their use
JP2009034036A (ja) 形質転換用酵母、形質転換方法及び物質生産方法
EP0722500A1 (de) Gene für den butyrobetain/crotonobetain-l-carnitin-stoffwechsel und ihre verwendung zur mikrobiologischen herstellung von l-carnitin
EP0469523B1 (de) Klonierung und Überexpression von Glucose-6-Phosphat-Dehydrogenase aus Leuconostoc dextranicus
DE19523269C2 (de) Verfahren zur Gewinnung von Acyloinen, dafür geeignete Pyruvat-decarboxylase sowie deren Herstellung und DNA-Sequenz des für diese kodierenden PDC-Gens
WO2003077642A2 (de) Population transgener pflanzen, davon abgeleitetes biologisches material, entsprechende plasmidkollektion und population transformierter wirtsorganismen, sowie deren verwendung und verfahren zu deren erzeugung
EP2499253B1 (de) Mikroorganismen mit gesteigerter sucrosemutaseaktivität
EP2036983A1 (de) Pflanzen, die erhöhte Mengen an Glucosaminglycanen synthetisieren
EP1918379A1 (de) Expressionsvektoren zur multiplen Gen-Integration und Überexpression von homologen und heterologen Proteinen in Hefen der Gattung Arxula
DE10204798A1 (de) Verfahren zur Überexpression von Dehydrogenasen
DE4417169A1 (de) Rekombinante Herstellung von Polyhydroxyalkanoaten in glucosefreiem Medium
WO2023006995A1 (de) Collinolacton-biosynthese und herstellung
WO2001011052A2 (de) Ein- oder mehrzellige organismen zur herstellung von riboflavin
CN112094791A (zh) 一种生产2,3-丁二醇的重组微生物及其制造方法

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20110720

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK SM TR

RIN1 Information on inventor provided before grant (corrected)

Inventor name: HARMS, KARSTEN

Inventor name: SCHIEL, BETTINA

Inventor name: NOLD, NIKLAS

Inventor name: DUERRE, PETER

Inventor name: KLINGEBERG, MICHAEL

Inventor name: WACH, WOLFGANG

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20131204

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

INTG Intention to grant announced

Effective date: 20150929

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20160210