EP1976862A2 - Neue peptide und deren biologische verwendung - Google Patents

Neue peptide und deren biologische verwendung

Info

Publication number
EP1976862A2
EP1976862A2 EP06841902A EP06841902A EP1976862A2 EP 1976862 A2 EP1976862 A2 EP 1976862A2 EP 06841902 A EP06841902 A EP 06841902A EP 06841902 A EP06841902 A EP 06841902A EP 1976862 A2 EP1976862 A2 EP 1976862A2
Authority
EP
European Patent Office
Prior art keywords
seq
nef
peptides
ahx
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP06841902A
Other languages
English (en)
French (fr)
Inventor
Daniel Baty
Yves Collette
Françoise GUERLESQUIN
Xavier Morelli
Isabelle Parrot
Stephan Arold
Serge Benichou
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Original Assignee
Centre National de la Recherche Scientifique CNRS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS filed Critical Centre National de la Recherche Scientifique CNRS
Publication of EP1976862A2 publication Critical patent/EP1976862A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/001—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof by chemical synthesis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the subject of the invention is new isolated, purified peptides which bind in particular the HIV-I protein Nef. It also targets their applications as inhibitors of Nef interactions with its partners in infected cells and, as such, as anti-retroviral drugs.
  • HIV acquired immunodeficiency syndrome
  • Nef constitutes a target of interest. Numerous cellular partners of Nef have been identified, including cellular proteins with an SH3 domain. Nef's involvement in the viral cycle and its important role therefore make it a prime target against which there is currently no known inhibitor. All of these arguments led the inventors to propose the protein Nef as a viral target of major importance, and to develop inhibitors capable of interfering with its biological functions, and by extension, with the replication and pathogenicity of the virus. HIV-I, on the one hand, and with the immunogenicity of infected cells, on the other.
  • the demonstration of a consensus sequence in peptides obtained by the phage-display technique and characterized makes it possible to have high value Nef inhibitor compounds and provides the means for developing a drug modeling approach targeting the complementary molecular surfaces between the Nef protein and the peptides.
  • the invention therefore aims to provide new peptides capable of specifically targeting regions of Nef involved in HIV-I infection.
  • the invention also aims to take advantage of the Nef inhibitory properties of these peptides and targets their therapeutic applications, more specifically for the treatment of HIV-I infections.
  • the isolated, purified peptides of the invention are characterized in that they contain an amino acid sequence corresponding to SEQ ID N 0 I:
  • a_ is chosen from W, A, S or D.
  • Peptides of the invention having this sequence respond to the sequence of amino acids SEQ ID No. 2:
  • Peptides of this group are decameric peptides and correspond to the following sequences SEQ ID No. 3 to SEQ ID No. 0 7: SEQ ID No. 3: NTWPWWLPTL
  • these peptides bind to Nef with an affinity of the order of a micromolar.
  • Other peptides correspond to the following sequences SEQ ID No. 8 to SEQ ID No. 13:
  • the peptides defined above can contain an amino acid sequence, comprising, where appropriate, amino acid derivatives facilitating their penetration into cells.
  • Peptides derived from this type contain, for example, at one of their ends, a sequence chosen from:
  • the invention relates in particular to peptides derived from the sequence ID N 0 II, corresponding to the following sequences SEQ ID No. 16 to SEQ ID No. 21:
  • the peptides of the invention which bind the Nef protein are easily obtained by implementing conventional techniques of peptide synthesis and constitute pure products.
  • the peptides of the invention bind to a molecular surface of Nef involved in the interaction of the latter with the SH3 domain of Hck and the kinase PAK, and required for the functions of modulation of the expression of surface area of MHC class I molecules and increased viral infectivity by Nef.
  • peptides are then the tools of choice to be used as inhibitors of the interaction between Nef and some of its cellular partners, including the SH3 domain proteins. They can also be used to develop chemical molecules from their amino acid sequences and / or their structural data and, in this application, said peptides are used directly or fused to elements facilitating their penetration into cells.
  • the peptides of the invention are particularly suitable for constituting active principles of anti-viral drugs.
  • the invention therefore also relates to pharmaceutical compositions characterized in that they comprise a therapeutically effective amount of at least one peptide as defined above, associated with pharmacologically acceptable excipients.
  • compositions are in forms suitable for their administration for anti-HIV treatment.
  • injectable compositions containing said peptides in solution or in suspension.
  • Such compositions contain for example 10 ⁇ g to 50 mg of peptide.
  • FIGS. 1 to 7 representing, respectively: FIG. 1: the alignment of the peptides binding Nef ⁇ 1 _ 57 / .
  • FIG. 2 performing ELISA tests to measure the interaction between Nef and the different partners, the phage-SH3Hck or the phage-peptide from a peptide bank,
  • FIG. 3 the displacement of the phage-peptide by Nef ⁇ i-5 7 and GST-SH3,
  • FIG. 4 the displacement of phages by synthetic peptides
  • FIG. 5 the cellular activity of the peptides
  • FIG. 6 the 1 H- 15 N HSQC spectrum
  • Nef protein (Nef HIV-I LAI) used is a recombinant protein purified from a GST-Nef ⁇ i- 57 fusion protein after cleavage by thrombin (Arold et al., 1997).
  • the protein Nef ⁇ i- 57 has been deleted from residues 1 to 57 because this region is not structured in solution and had to be cleaved to allow crystals to be obtained in order to resolve the structure of the protein.
  • the Nef protein is enriched in 15N by producing it in E. coli cultivated on minimum medium M9 where the ammonium chloride is substituted with 15NH4C1 (Eurisotop).
  • the DNA region coding for residues 62 to 118 of the Hck SH3 domain was amplified, by PCR, from the plasmid pBindHckSH3 and cloned into the phagemid vector pHenl (Hoogenboom et al., 1991) between the restriction enzyme sites. PstI and EagI.
  • This phagemid allows, in the presence of a helper phage, to express the SH3 domain fused to the N-terminal of protein 3 (p3) at the head of phage M13.
  • the fragment coding for the Hck SH3 domain was amplified by PCR using 0.1 ⁇ l of the plasmid pBindHckSH3, with 0.5 U of Dynazyme Extend DNA polymerase (Finnzymes), 10 pmoles of the 5 'primer SH3 / PstI and 10 pmoles of 3 'primer
  • the 196 bp fragment was purified on 2% agarose gel (kit
  • Two ⁇ g of phaenoid pHenl are cut in a volume of 30 ⁇ l with 5 ⁇ of PstI and 5 ⁇ of EagI in the presence of BSA, 16 h at
  • the cut phagemid is purified on 0.7% agarose gel
  • One ⁇ l of pHenl cut with PstI and EagI is ligated with 1 ⁇ l of fragment cut with PstI and EagI in a volume of 10 ⁇ l with 200U of T4 DNA ligase (Biolabs) at 16 ° C., 17 h.
  • the ligase is inactivated at 65 ° C., 15 min, and the ligation product is cut with 5U of Xhol at 37 ° C. for 4 h to remove the residual non-ligated vector, then extracted with phenol / chloroform, precipitated in the presence of 1 ⁇ g of glycogen and taken up in 10 ⁇ l of ultrapure H 2 O.
  • One ⁇ l is used to transform E. coli TGl cells made competent by the CaCl 2 - technique
  • the presence of the fragment inserted into the pHen1 plasmid is verified from the colonies isolated after transformation of the TG1 cells by making mini DNA preparations.
  • the recombinant plasmid pHenlSH3Hck is cut with PstI and EagI to verify the size of the inserted fragment.
  • a few clones having the inserted fragment are sequenced on an ABI 310 sequencer using the oligonucleotide Fuse3p of sequence SEQ ID No. 24 (5 'CCCTCATAGTTAGCGTAACG) hybridizing in the region coding for the protein p3.
  • a clone having the correct sequence is selected to verify the production of the SH3-p3 fusion protein.
  • an isolated colony is inoculated in 3 ml of 2YT / ampicillin 100 ⁇ g / ml / 2% glucose 'and incubated at 30 ° C with shaking.
  • the culture reaches an OD ⁇ OOnm of 0.5, the cells are induced with 0.1 ⁇ M final of IPTG (isopropyl- ⁇ -D-thiogalactopyranoside) and the culture is continued at 30 ° C. for 16 h. An aliquot of the culture is removed and deposited on a 10% SDS / PAGE gel.
  • the presence of the SH3-p3 fusion protein is revealed by Western blotting with the 9E10 monoclonal antibody recognizing the c-myc label located between the SH3 domain and the p3 protein.
  • This control phage called phage-SH3, is used as a positive control in ELISAs where the biotinylated protein GST-Nef ⁇ 1 _ 57 or Nef ⁇ i_ 57 is adsorbed in wells of microplates.
  • a decameric library of a diversity of 10 8 clones was constructed by insertion of degenerate oligonucleotides into a phage vector. To this end, the vector fd-tet-dogl
  • the cloning site is located between the signal sequence of the p3 protein and the p3 protein of the phage.
  • the insert was chosen so as to conserve the nucleotide sequences coding for the amino acids located downstream of the signal sequence in order to optimize the enzymatic cleavage by the endogenous peptidase.
  • the randomized part (NNK) io was chosen so as to limit the presence of STOP codons.
  • the replicative form (RF) of the phage fd-tet-dog was purified on a cesium gradient according to the protocol described in Maniatis et al. (1982). Five hundred micrograms of RF were cleaved with 700U of restriction enzymes Apal and NotI (NE Biolabs, MA, USA) and purified by extraction with phenol then precipitation with ethanol.
  • ligase NE BioLabs, MA, USA
  • the ligation product is extracted with phenol, precipitated with ethanol and taken up with 300 ⁇ l of TE.
  • Forty ⁇ l of XLl-blue cells are electroported with 2 ⁇ l of the ligation product using a micropulser (Bio-Rad, CA, USA) at 1700 volts / cm, 200 ohms, 25 ⁇ F for 5 msec and tanks of 0.1 cm. The cells are then incubated for 1 h at 37 ° C.
  • the diversity of the library was verified by DNA sequencing of a hundred clones using the oligonucleotide primer Fuse-3p SEQ ID No. 24 (CCCTCATAGTTAGCGTAACG) using an ABI Prism sequencer (Applied Biosystems, CA , USA).
  • the bank obtained is approximately 10 8 different clones.
  • Nef ⁇ 1 _ 57 binding peptides by phage-display
  • the Nef ⁇ i- 57 binding peptides were selected by the "phage display" technique from the decameric peptide library constructed as indicated above.
  • Biotinylation of the protein Nef ⁇ 1 - 57 Five hundred ⁇ g of the protein Nef ⁇ i_ 57 are dialyzed against PBS for 16 h at 4 ° C. and biotinylated with biotin according to the manufacturer's recommendations (Biotin Protein
  • the culture supernatant containing the phage-peptide is precipitated with 1.5 vol of 16.7% (weight / volume) of PEG 8000 / 3.3 M NaCl for 16 h at 4 ° C., then centrifuged at 12000 g, 20 min at 4 ° C and the pellet is taken up in 50 ml of PBS (0.14 M NaCl; 0.01 M Phosphate buffer, pH 7.4). A second precipitation is carried out under the same conditions, but for 1 h. The base is taken up with •! ml of PBS. The solution is filtered on a 0.45 ⁇ m filter and stored at 4 ° C. It contains approximately 10 13 phage peptides.
  • Three or 4 rounds of selection and amplification are carried out to isolate the phage-peptide specific for Nef ⁇ i_ 57 .
  • the beads are washed 5 times with PBS / milk, 5 times with PBS / 0.1% Tween-20 and 5 times with PBS and finally resuspended with 100 ⁇ l of PBS.
  • Phages-peptide are amplified by infecting bacterial cells
  • the isolated colonies are cultured in microplate wells
  • the solid support used is a Rink-Amide 100-200 mesh resin allowing automatic synthesis by a conventional strategy of the fmoc type.
  • the first fmoc-amino acid aai is first attached to the solid support (100 to 200 mg of resin per well).
  • the robot distributes the following solutions in each well: (i) a solution of 0.5 M HBTU in DMF, (ii) a solution of N-methylmorpholine IM in DMF, and (iii) a solution of AA at 0.5M in NMP.
  • the reaction mixture is stirred for 90 minutes, then a series of washing (DMF, MeOH, DCM, DMF) is carried out automatically before proceeding to a double coupling with the same amino acid.
  • the side chain of the first amino acid as well as that of all the amino acids which will be incorporated during the synthesis are protected by various conventional acid-protecting protective groups permanently, and this until the final release of the peptide.
  • the first grafted amino acid is deprotected in the I ⁇ 7-terminal position of its fmoc function by a solution of piperidine 20% in dichloromethane. After various successive washings, the first amino acid is then coupled to the next amino acid, the terminal amino part of which is protected by an fmoc group.
  • the robot distributes in each well the following solutions: (i) a solution of HBTU 0.5 M in DMF, (ii) a solution of N-methylmorpholine IM in DMF, and (iii) a solution of I ' aa 2 to 0.5M in NMP.
  • reaction mixture is stirred for 90 minutes, then a new series of washing is carried out before carrying out a double coupling with the same amino acid.
  • the cycles of deprotection of the fmoc group, of coupling of the next amino acid are then repeated automatically until the coupling and deprotection of the last amino acid aa n .
  • the cleavage is carried out semi-automatically with a TFA / H 2 0 / TIS 95 / 2.5 / 2.5 solution. with stirring for 2 hours.
  • the peptides are then precipitated with ether, centrifuged, and the supernatant is then removed. The operation is repeated 3 times, then the ether is evaporated.
  • the peptide is then dissolved in a solution of H2 ⁇ / Acetonitrile 50/50 before being lyophilized.
  • biotinylated peptides which can then be detected by an appropriate probe (for example streptavidin-FITC) have been synthesized. These peptides are first of all synthesized semi-automatically on solid phase by the fmoc strategy previously described.
  • N-terminal is deprotected and a conventional manual coupling of peptide type is carried out with biotin (Sigma-Aldrich ® , ref. 86,164-2).
  • biotin Sigma-Aldrich ® , ref. 86,164-2.
  • the cleavage of the resin corresponds to the final step, making it possible to unhook the labeled peptide from the solid support.
  • the purity of the biotinylated peptide is analyzed by HPLC,
  • Nef ⁇ i- 57 protein cleaved from the GST protein by thrombin is biotinylated, then adsorbed in microplate wells coated with streptavidin ( Figure 2).
  • a first positive control consisted of incubating the well with an anti-Nef monoclonal antibody (MATG0020) and revealing the interaction Nef ⁇ l-57 / anti-Nef with a secondary anti-mouse antibody labeled with peroxidase.
  • a second positive control uses phage-SH3.
  • the phage-SH3 was incubated with an anti-phage mAb (phage p8 protein), then the interaction revealed with a secondary anti-mouse antibody labeled with alkaline phosphatase .
  • the competitors Nef ⁇ i_ 57 , GST-SH3 or the synthetic peptides are added at different concentrations to the phages.
  • the phage-peptide 07B2S3 (") and 08B2S3 ( ⁇ ) from the decameric library and the control phage SH3-Hck (•) linked on Nef ⁇ i- 57 are similarly characterized by a competitive ELISA ( Figure 3) .
  • the wells adsorbed with biotinylated Nef ⁇ i_ 57 (Fig. 3A) or GST-Nef ⁇ i- 57 (Fig. 3B) are incubated with 10 11 unit phages, then with different quantities of Nef ⁇ i_ 57 or the SH3 domain of Hck fused to the GST protein, used as a competitor.
  • Nef ⁇ i_ 57 Very small amounts of Nef ⁇ i_ 57 are sufficient to displace the Nef ⁇ i_ 57 / phage-peptide interaction and reveals IC50s of the order of a micromolar. Equivalent results are obtained with the other phage-peptide.
  • the affinity and specificity of the phage-peptide were also determined by a competitive ELISA using synthetic peptides ( Figure 4).
  • the phage-peptide 08B2S3 ( ⁇ ) from the decameric library and the control phage SH3-Hck (•) linked on Nef ⁇ 1 _ 57 are displaced in an ELISA by competition with the synthetic peptide 2.
  • Equivalent results are obtained with the other phage-peptide and the other peptides.
  • the other peptides described in FIG. 1 have a curve entirely equivalent to that obtained with peptide 2.
  • IC50s of the order of a micromolar have indeed been measured.
  • the specificity of the peptides can also be determined directly from cell extracts.
  • COS-7 cell lysates expressing Nef are incubated with the GST-SH3 Hck fusion protein in the presence of increasing amounts of the peptide. The mixture is then deposited on a specific affinity column of the GST. The column is then washed and the eluted extract is analyzed by SDS-PAGE and anti-Nef immunoblotting. We thus deduce an IC50 value for the peptides inhibiting the interaction Nef-SH3 in a cellular context of native Nef protein.
  • a cell test based on the principle of the double hybrid adapted to mammalian cells has been developed, making it possible to evaluate the cellular activity of peptides capable of penetrating the plasma membrane. This test makes it possible to integrate the parameters of cellular toxicity and bioavailability thanks to a quantitative and functional reading of the interaction between two protein partners.
  • the CheckMate TM commercial system (Promega) was adapted to the Nef HIV-I (Lai) / SH3-Hck pair in culture of COS-7 cells (FIG. 5).
  • This system combines the expression of firefly luciferase under the dependence of the interaction between • Nef and the SH3 domain of Hck, and that, independent, of renilla luciferase, witnessing cell viability.
  • the intensity ratio of these two luciferases makes it possible to quantify the activity of a competitor of the Nef-SH3 interaction capable of penetrating inside the cell and whose half-life is sufficient in the time interval. of the analysis.
  • the cells are transfected using Fugene ⁇ (Roche), according to the distributor's protocol. Briefly, the plasmids PG5 (300 ng), pAct or pActNef (400 ng), pBindHckmuté or pBindHck (100 ng) and pbcks (200 ng) are mixed, then Fugene 6 (3 ⁇ l diluted in 100 ⁇ l of DMEM culture medium ) is added. The plasmids mixture / Fugene ⁇ is left 'in the reaction for a period of 15 min at room temperature and then was introduced dropwise into the cell culture well.
  • Fugene ⁇ Fugene ⁇
  • the cells are harvested by treatment with trypsin (Gibco, ref 25300-054), washed, then distributed in 96-well plates (reference 353072, Beckton Dickinson). 50 ⁇ l of DMEM culture medium are then added to each well.
  • the activity of a candidate inhibitor compound is tested by adding 25 ⁇ l of this diluted compound to the well already containing 50 ⁇ l of the cell culture, and the luciferase activity is determined 24 hours later in each well using the assay kit. DualGlo according to the supplier's recommendations (Promega).
  • the peptide of sequence ID N 0 Il does not exhibit any significant biological activity at low concentration by comparison with a control molecule and this for concentrations varying from 10 to 50 ⁇ M of the peptide (FIG. 5B), and under different experimental conditions, notably alternating the time and duration of addition of the peptide.
  • This peptide synthesized in a biotinylated form did not allow visualization of cell penetration in a test using secondary labeling using a probe coupled to a fluorochrome, followed by an analysis by confocal microscopy, suggesting that the peptide does not penetrate spontaneously the plasma membrane and / or is rapidly degraded or exported to the extra-cellular medium.
  • New peptides have been synthesized by incorporating in the N-terminal position of the sequence ID N 0 II various peptide sequences or sequences of amino acid derivatives
  • 15 N- 1 H HSQC spectra of the 15 N-Nef protein were recorded on a 500 MHz NMR spectrometer (DRX 500 Bruker) at 308K.
  • the conditions for sample preparation are identical to those used by Grzesiek et al. in 1997, for the allocation of heteronuclear NMR spectra.
  • the concentration of Nef in the samples is 0, ImM ( Figure 6), tris 5mM pH 8.0, 5mM DTT.
  • the soaking method is used to determine the structure of peptides in complex with Nef. For this, crystals of Nef ⁇ i- 56 and Nef ⁇ i_ 57 were produced as previously described (Arold et al., 1997). After reaching a sufficient size for a crystallographic analysis
  • Nef The study of the positive influence of Nef on viral replication is carried out by standard techniques for measuring the infectious capacities of HIV-I (Craig et al., 1998; Madrid et al., 2005). Initial analyzes are • performed using a prototype laboratory provirus, HIV-I pNL4-3. Briefly, the effect of the Nef inhibitor peptides will be evaluated on the virions produced by transient transfection of 293T cells by the wild provirus and used to infect HeLa-CD4 target cells (clone P4) containing an integrated copy of the LacZ gene dependent on the HIV-I LTR. 48 h after infection, the infectious power of the viruses is evaluated by counting the cells expressing ⁇ -galactosidase activity.
  • Nef-induced alteration of the early / recycling endosomal compartment correlates with enhancement of HIV-I infectivity. J. Biol. Chem. , 280: 5032- 5044.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oncology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Communicable Diseases (AREA)
  • AIDS & HIV (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
EP06841902A 2005-12-09 2006-12-11 Neue peptide und deren biologische verwendung Withdrawn EP1976862A2 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR0512524A FR2894584A1 (fr) 2005-12-09 2005-12-09 Nouveaux peptides et leurs applications biologiques
PCT/FR2006/002697 WO2007066018A2 (fr) 2005-12-09 2006-12-11 Peptides qui peuvent se lier a la proteine nef et leurs applications pharmaceutiques

Publications (1)

Publication Number Publication Date
EP1976862A2 true EP1976862A2 (de) 2008-10-08

Family

ID=36570518

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06841902A Withdrawn EP1976862A2 (de) 2005-12-09 2006-12-11 Neue peptide und deren biologische verwendung

Country Status (5)

Country Link
US (1) US20090163410A1 (de)
EP (1) EP1976862A2 (de)
CA (1) CA2632708A1 (de)
FR (1) FR2894584A1 (de)
WO (1) WO2007066018A2 (de)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2879605B1 (fr) * 2004-12-16 2008-10-17 Centre Nat Rech Scient Cnrse Production de formats d'anticorps et applications immunologiques de ces formats
EP2062578A1 (de) 2007-11-12 2009-05-27 Institut National De La Sante Et De La Recherche Medicale (Inserm) Verwendung von chemischen Verbindungen zur Behandlung von AIDS
AU2012358269B2 (en) * 2011-12-22 2017-11-02 Children's Medical Center Corporation Saposin-A derived peptides and uses thereof
CN105358708A (zh) 2013-03-14 2016-02-24 儿童医学中心公司 Cd36鉴定癌症对象以用于治疗的用途

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6551795B1 (en) * 1998-02-18 2003-04-22 Genome Therapeutics Corporation Nucleic acid and amino acid sequences relating to pseudomonas aeruginosa for diagnostics and therapeutics
DE19820224A1 (de) * 1998-05-06 1999-12-09 Markus Schott Bindungspartner und Verfahren zur kompetitiven Hemmung der Bindung zwischen NEF-Protein und Calmodulin, sowie Mittel und Verwendung bei HIV-Erkrankungen
JP2000000097A (ja) * 1998-06-15 2000-01-07 Nippon Zoki Pharmaceut Co Ltd Ｎｅｆ結合蛋白質、該蛋白質をコードするＤＮＡ並びに該蛋白質に対するモノクローナル抗体
US20090087878A9 (en) * 1999-05-06 2009-04-02 La Rosa Thomas J Nucleic acid molecules associated with plants
US20110131679A2 (en) * 2000-04-19 2011-06-02 Thomas La Rosa Rice Nucleic Acid Molecules and Other Molecules Associated with Plants and Uses Thereof for Plant Improvement
US7834146B2 (en) * 2000-05-08 2010-11-16 Monsanto Technology Llc Recombinant polypeptides associated with plants
US20030229906A1 (en) * 2002-04-15 2003-12-11 Gelman Irwin H. Methods and compositions for the treatment of disorders of HIV infection
US20060252922A1 (en) * 2002-12-04 2006-11-09 Macina Roberto A Compositions, splice variants and methods relating to colon specific genes and proteins

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2007066018A2 *

Also Published As

Publication number Publication date
WO2007066018A3 (fr) 2007-07-26
FR2894584A1 (fr) 2007-06-15
CA2632708A1 (fr) 2007-06-14
US20090163410A1 (en) 2009-06-25
WO2007066018A2 (fr) 2007-06-14

Similar Documents

Publication Publication Date Title
EP1497467B1 (de) Oligonukleotide von für die oberflächenkomponente des ptlv-hüllproteins codierenden sequenzen und verwendungen davon
Waheed et al. HIV type 1 Gag as a target for antiviral therapy
US20150359843A1 (en) P53 activating peptides
JP7060216B2 (ja) 多様な選択された臓器又は組織をターゲティングするための物質
Zhang et al. Targeting folded RNA: a branched peptide boronic acid that binds to a large surface area of HIV-1 RRE RNA
JP2023546561A (ja) ウイルスタンパク質および宿主タンパク質の分解のためのキメラコンジュゲートならびに使用方法
EP1976862A2 (de) Neue peptide und deren biologische verwendung
Dai et al. Molecular recognition of a branched peptide with HIV-1 Rev Response Element (RRE) RNA
FR2780069A1 (fr) Famille de sequences nucleiques et de sequences proteiques deduites presentant des motifs retroviraux endogenes humains et leurs applications
Sharma et al. T7 phage display as a method of peptide ligand discovery for PDZ domain proteins
Pal et al. RNA-Binding Macrocyclic Peptides
FR2968663A1 (fr) Peptides et medicament antiviral
Shvadchak et al. Rationally designed peptides as efficient inhibitors of nucleic acid chaperone activity of HIV-1 nucleocapsid protein
CA2540520A1 (fr) Polypeptide d'interaction comprenant un motif heptapeptidique et un domaine de penetration cellulaire
Bonnard et al. Polyamide amino acids trimers as TAR RNA ligands and anti-HIV agents
Wang Developing Functional Peptides as Synthetic Receptors, Binders of Protein and Probes for Bacteria Detection
Wynn Functionalizing Branched Peptides with Unnatural Amino Acids Toward Targeting HIV-1 RRE RNA and Microbials
Pestova et al. Coupled folding during translation initiation
Passioura et al. Biological Synthesis and Affinity-based Selection of Small Macrocyclic Peptide Ligands
Haberman Discovery of Protein-Protein Interaction Inhibitors Using mRNA Display
JPWO2005007686A1 (ja) Ｒｎａ結合ペプチド
Qi Unnatural amino acid incorporation to rewrite the genetic code and RNA-peptide interactions
WO2014155022A1 (fr) Proteine kinase aurora a mutee sensible a un inhibiteur
KR100498912B1 (ko) 인간의 면역결핍 바이러스의 ｐｓｉ ＲＮＡ 염기서열에특이적으로 결합하는 펩티드
Knejzlík et al. Conformational changes of the N-terminal part of Mason-Pfizer monkey virus p12 protein during multimerization

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20080718

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

17Q First examination report despatched

Effective date: 20090119

RIN1 Information on inventor provided before grant (corrected)

Inventor name: BATY, DANIEL

Inventor name: BENICHOU, SERGE

Inventor name: MORELLI, XAVIER

Inventor name: AROLD, STEPHAN

Inventor name: GUERLESQUIN, FRANCOISE

Inventor name: COLLETTE, YVES

Inventor name: PARROT, ISABELLE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20090901