EP1778714A2 - Methods for making and using recombinant bacillus thuringiensis spores - Google Patents

Methods for making and using recombinant bacillus thuringiensis spores

Info

Publication number
EP1778714A2
EP1778714A2 EP05795245A EP05795245A EP1778714A2 EP 1778714 A2 EP1778714 A2 EP 1778714A2 EP 05795245 A EP05795245 A EP 05795245A EP 05795245 A EP05795245 A EP 05795245A EP 1778714 A2 EP1778714 A2 EP 1778714A2
Authority
EP
European Patent Office
Prior art keywords
seq
protein
peptide
nucleic acid
spore
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP05795245A
Other languages
German (de)
French (fr)
Other versions
EP1778714A4 (en
Inventor
Stanley Goldman
John Libs
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Phyllom LLC
Original Assignee
Phyllom LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Phyllom LLC filed Critical Phyllom LLC
Publication of EP1778714A2 publication Critical patent/EP1778714A2/en
Publication of EP1778714A4 publication Critical patent/EP1778714A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
    • C07K14/325—Bacillus thuringiensis crystal peptides, i.e. delta-endotoxins
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/50—Isolated enzymes; Isolated proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/035—Fusion polypeptide containing a localisation/targetting motif containing a signal for targeting to the external surface of a cell, e.g. to the outer membrane of Gram negative bacteria, GPI- anchored eukaryote proteins

Definitions

  • the present invention relates to spore coat genes and proteins and exosporium genes and proteins from Bacillus thuringiensis and particularly to methods for making and using recombinant Bacillus thuringiensis spores.
  • BacillusJhuringiensis was first discovered in Japan in 1901 by Ishawata and then in 1911 in Germany by Principle. A widely used biopesticide, it was first applied as a commercial insecticide in France in 1938, and then in the USA in the 1950s. These early products were replaced by more effective ones in the 1960s, when various highly pathogenic strains were discovered with specific activity against different types of insects. Thereafter, thousands of strains of B. thuringiensis were subsequently found to exist.
  • Bacillus thuringiensis is a sporulating soil bacterium that produces insecticidal proteins during sporulation.
  • the vegetative cells contain endospores and crystals of an insecticidal protein toxin (these crystal insecticidal toxins are also known as "delta-endotoxin") which usually have a bipyramidal shape.
  • delta-endotoxin crystal insecticidal toxins
  • Bt is grown in industrial fermentors, most cells lyse and release the endospores and toxin crystals. The material is then harvested and formulated into the biopesticide product.
  • These commercial Bt products are powders containing a mixture of dried spores and toxin crystals. They are applied to leaves, plants, shrubs or other environments in which the insect larvae feed.
  • Bt-based insecticides are formulated and marketed worldwide for control of many important plant pests - mainly caterpillars of the Lepidoptera family (i.e., butterflies and moths) but also mosquito larvae, and simuliid blackflies that vector river blindness in Africa.
  • Bt products represent about 1% of the total "agrochemical" market (i.e., fungicides, herbicides and insecticides) across the world.
  • the typical Bt insecticide product is composed of one strain of Bt, which is limited in its insecticidal activity because naturally-occurring Bt strains generally are active against a few insect species. Therefore, activity against a broad array of insecticidal pests cannot be achieved with current Bt-based insecticide products.
  • Bt insecticidal protein toxin called Cry ICa, which is a major component of a widely-used commercial Bt insecticide.
  • the Cryl Ca protein toxin has no activity against scarab beetles, which are common and destructive pests to a number of crops.
  • Bt insecticidal protein called Cry8Da has strong activity against scarab beetles but no activity against beet armyworm, Spodoptera exigua, another common and destructive crop pest. Therefore, in order to control multiple insect pests, current Bt-based technologies require the application of several strains of Bt, each specific to one, or at best a few, insect types. This is costly since considerable amounts of biopesticides are required to be applied to achieve the desired effect.
  • the present invention overcomes the limitations of currently-existing Bt-based insecticide products by providing recombinant Bt strains that have insecticidal activity against a variety of different insect pests.
  • the methods allow the skilled artisan to make Bt-based insecticides that control both scarab beetles, such as the Japanese beetle, and the beet armyworm. This would widely benefit producers and caretakers of crops and other plant-based products such as turf grass by providing more effective biopesticides than the currently available Bt formulations.
  • significant cost savings can be achieved.
  • a recombinant Bt strain that can be produced by the methods of the present invention is one containing the beet armyworm-active CrylCa protein gene, which can be expressed on the surface of the spore of a Bt strain called SDS-502, which contains an endogenous insecticide crystal protein toxin active against the Japanese beetle.
  • Another advantage the present invention provides is the rapidity of insectidal activity.
  • Current Bt products are formulated to contain a mixture of spores and isolated crystalline protein toxin. Although the crystalline protein toxin is effective, the spores themselves are slow to act as they must germinate in the gut of the insect, lyse the gut lining, and multiply in the blood to become effective at killing the insect.
  • the recombinant Bt spores of the present invention overcome this limitation by expressing an exogenous insecticide protein toxin on there surface, thereby producing a rapid and lethal response.
  • the present invention provides methods for making recombinant Bt strains having exogenous proteins attached to the outer coats of their spores or to their exosporia component found to be a part of the spore or exosporium, not non-spore or exosporium origin like Bt insecticidal protein.
  • recombinant spores have been constructed in Bacillus subtilis, the method of producing Bt spores having exogenous proteins linked to their outer coats or exosporia has not been reported in Bt. Until now, it was not possible to practice this method in Bt because none of the spore coat genes or exosporia genes were isolated and sequenced.
  • novel spore coat protein genes and one novel exosporium protein gene from a strain of B. thuringiensis subspecies gallariae are used to express exogenous proteins on the Bt spore.
  • the spore coat gene or exosporium gene fused to an exogenous gene produces a heterologous protein wherein the spore coat protein or the exosporium protein and the exogenous protein are functionally and operationally linked.
  • the heterologous protein is incorporated into the Bt spore coat or exosporium.
  • the invention also comprises methods for using compositions made from the resulting recombinant Bt strains expressing one or more exogenous genes on the Bt spore coat or exosporium.
  • the exogenous protein attached to the Bt spore or exosporium is an insecticidal protein toxin.
  • insecticidal protein toxin There may be more than one insecticidal protein toxins so attached.
  • Many Bt strains produce one or more endogenous insecticidal protein toxins. These often form heterogenous crystal structures within the cell.
  • the expression of one or more exogenous protein toxins on the outer coat or exosporium of the Bt spore confers significantly improved insecticidal activity than current Bt insecticides.
  • an additional insecticide incorporated onto the surface of the spore can provide a substantial increase in the amount of protein insecticide toxin produced by each Bt cell.
  • an exogenous insecticidal protein toxin on the outer coat or exosporium of Bt spores confers a broadening of the insecticidal range.
  • improved biopesticide efficiency can be achieved This is because the resulting recombinant Bt strain continues to produce endogenous insecticidal toxins that are contained within the spore, and additionally, produces one or more exogenous insecticidal proteins attached to the spore outer coat or exosporium.
  • Exogenous insecticidal proteins may be derived from one or more endogenous Bt insecticidal protein toxins or from insecticidal proteins found in other Bacillus strains, including those that are listed, infra.
  • the exogenous insecticidal protein however is not limited to those derived from Bacillui strains but also may be obtained from non-Bacillui sources, the important point being the ability of the exogenous protein to kill a desired insect.
  • the invention contemplates the use of any insecticidal protein toxin capable of being expressed on the outer coat or exosporium of Bt spores.
  • the methods of the present invention allow for the expression of one or more insecticidal protein toxins on the surface of the Bt spore, in which the one or more protein toxins may include an endogenous protein toxin from the host strain, an endogenous protein toxin from a non- host Bt strain, or a protein toxin from a non-Bacillus strain. Any combinations are contemplated and may be incorporated into the Bt host strain as needed to target specific insect pests.
  • Additional benefits may be realized from attachment of one or more insecticidal protein toxins to the surface of the Bt spore.
  • isolated insecticidal crystal protein toxins are inactivated by ultra violet light and therefore have a limited duration of activity when sprayed onto crops or other plant resources, spores are resistant to ultra violet light and may provide protection for the associated insecticidal protein toxin displayed on the surface. Assembly of the insecticidal toxin on the spore may also increase the toxin stability since immobilized proteins often have greater stability. The close association of the insecticidal protein toxin with the spore i.e., by its display on the surface of the spore, will also enhance the effectiveness of the product.
  • the exogenous protein attached to the surface of the Bt spore may be an enzyme. More than one enzyme may be so attached. Much like the advantages for insecticidal protein toxins described, supra, the surface of the Bt spore can provide physical protection for enzymes so they can persist longer in the environment. Enzymes attached to the surface of the spore may be used for a variety of applications including production of useful compounds by enzymatic reaction and environmental cleanup. Enzymes so attached can be useful in bioremediation including degradation of chemical pesticides, herbicides, or clean up of industrial pollutants such as PCB.
  • the recombinant Bt spores can act as antigen-delivery vehicles.
  • the exogenous protein attached to the surface of the Bt spore can be an antigen that produces immunity in higher animals, including but not limited to farm animals such as cattle, chicken, or fish.
  • nucleic acid constructs that include a copy of a first nucleic acid molecule encoding a first peptide derived from a Bacillus thuringiensis spore coat protein or an exosporium protein that when expressed targets to the Bacillus thuringiensis spore coat or exosporium which is operably linked to a second nucleic acid molecule encoding a second peptide.
  • the first peptide has substantial identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, and SEQ ID NO: 10, more preferably, at least 60% identity, more preferably at least 70% identity, more preferably at least 75% identity, more preferably at least 80% identity, more preferably at least 85% identity, more preferably at least 90% identity, more preferably at least 93% identity, more preferably at least 95% identity, more preferably at least 97% identity, more preferably at least 98% identity, and even more preferably at least 99% identity.
  • the operable linkage between the first and second peptide includes a linker peptide.
  • the second peptide is a therapeutic peptide, a diagnostic peptide, an insecticidal peptide, a vaccine peptide, or an industrial enzyme peptide.
  • the spore may respond as a receptor to the presence of the specific molecule or organism by germinating.
  • the actual detection would generally be accomplished by one of three ways. The first is direct observation of the spores after exposure to the sample. The exposure could be in either liquid or on a Petri dish. If the spores initiate germination the molecule or organism is present in the sample.
  • the second way is to mix the spores and the sample in question and then plate the mixture on a Petri dish containing LB agar and selective antibiotics. If colonies become visible on the plate in 8 to 10 hours then that sample contains the target of the detection system.
  • the third way would use the additional modification of the detector recombinant spore to contain any one of several enzymes glucoronidase, beta-galactosideas, thrombin, or naturally occurring GRP. These enzymes would be stored in the core of the spore by linking to Small Acid Soluble Proteins (SASPs) that are specifically delivered and bind the DNA that represents the bacterial genome.
  • SASPs Small Acid Soluble Proteins
  • SASPs Small Acid Soluble Proteins
  • the integrity of the spore is compromised as the nascent vegetative cells erupts from the spore.
  • beta-galactosidase and/or glucoronidase will be released and in the presence of the proper substrate generate a blue color.
  • Other fusion proteins can be considered for placement in different compartments of the spore to facilitate specific detector types. It should be possible to assemble the detector enzyme into the inner coat or the cortex of the spore as well as the core.
  • the first method had the benefit of being very rapid since germination is generally initiated in less than two minutes and the spore characteristics clearly change from phase bright to phase dark when viewed with a phase contrast microscope. This method generally requires use of a phase contrast microscope.
  • the benefit of the second method is that one needs only a Petri dish with Luria Broth and selective antibiotic to complete the assay. This is minimal technology and is generally cheaper and easier to maintain then a phase contrast microscope.
  • the selective antibiotics that will be used will not interfere with germination since the recombinant spore will have the needed resistance genes.
  • the antibiotics will ensure that only the Bacillus thuringiensis will be able to grow on the plate greatly reducing the likelihood of false positives.
  • the benefits of the third option are manifold. There is need for little else but a sample that needs testing, and a solution that is mixed with that sample that contains the recombinant detector spores and the substrate. Should the spores germinate in response to a specific signal, an enzyme can be released and a blue color or fluorescence is generated. If the signal and response is weak a spectrophotometer can be used to detect enzymatic reaction, if the response is strong than the change is easily seen by eye. The most significant difference between weak and strong responses is the amount of time before the color can be detected by eye. Such enzymes are generally stable and will react over a long period of time (24 hours) thus even a weak signal will become detectable by eye over a period of time.
  • the spectrophotometer is a simple, small and stable tool that can be reduced in size so that rapid assays determinations can be completed in the field with a small hand held unit.
  • GRP a specific endoprotease such as thrombin
  • GPR has a specific penta-residue binding site where cleavage of a protein would be made. When germination takes place these proteases would be activated and then released. The released protease would cleave a fusion protein to produce active green fluorescent protein or react with another substrate in the incubation media to produce a visible color.
  • the benefit of activating green fluorescent protein is in the sensitivity of the assay since this type of assay is typically 1000 times as sensitive as simple colorimetric assays.
  • the method of producing these detector spores generally occurs in three steps. First the native and natural germination receptors need to be mutated to inactivity. This will be accomplished by gene-replacement double recombination with active antibiotic resistance genes replacing the germination receptors. At this time continued gene replacement could be completed to place in the genome the specific enzymes required for either colorimetric or fluorescent assay activity. In some circumstance, fusion proteins of enzymes with the SASP gene sequences can be utilized to ensure that the reactive enzyme is sequestered in the core of the spore until germination. These are the basic strains that will generally not germinate naturally, have the capacity to produce a measurable response in the assay format and can be kept viable in vegetative cell form.
  • the second step is generally acquiring or producing specific receptor molecules that can be fused to the receptor region of the knock-out germination genes.
  • the signal that activates the signal transduction pathway that leads to germination should continue to be active in the fusion proteins.
  • a variety of molecular binding motifs including specific DNA sequences, proteins, viruses, bacteria and small molecules can be utilized.
  • the third step is generally a second round of double recombination that will insert the fusion receptor molecules back into the bacillus genome and insert the resulting fusion proteins into the recombinant spore. Since there are more germination genes than there are needed antibiotic markers, the second round of double recombination will generally replace inactivated germination receptors that do not contain antibiotic resistance genes.
  • insecticidal peptides include CrylAal, CrylAa2, CrylAa3, CrylAa4, CrylAa5, CrylAa ⁇ , CrylAa7, CrylAa ⁇ , CrylAa9, CrylAalO, CrylAal 1, CrylAal2, CrylAal3, CrylAal4, CrylAbl, CrylAb2, CrylAb3, CrylAb4, CrylAb5, CrylAb ⁇ , CrylAb7, CrylAb ⁇ , CrylAb9, CrylAblO, CrylAbl 1, CrylAbl2, CrylAbl3, CrylAbl4, CrylAbl5, CrylAbl ⁇ , OyI AcI, CrylAc2, CrylAc3, CrylAc4, CrylAc5, CrylAc ⁇ , CrylAc7, CrylAc8, CrylAc9, CrylAclO, CrylAcll, CrylAcl2, CrylAcl3, CrylAcl4, CrylAcl5, OyI
  • Preferred examples of industrial enzymes include glucose oxidase, galactosidase, glucosidase, nitrilase, alkene monooxygenase, hydroxylase, aldehyde reductase, alcohol dehydrogenase, D-hydantoinase, D-carbamoylase, L- hydantoinase, L-decarbamoylase, beta-tyrosinase, dioxygenase, serine hydroxy- methyltransferase, carbonyl reductase, nitrile hydratase, o-phthalyl amidase, halohydrin hydrogen-halide lyase, maltooligosyl trehalose synthase, maltooligosyl trehalose trehalohydrolase, lactonase, oxygenase, adenosylmethionine synthetase, cephal
  • vaccine peptides include antigenic peptides from the vectors for diseases including Marek disease, (MDV) Herpes Virus; Infectious bronchitis disease: (IBV); Infectious Larygotracheitis, (ILV) Herpes Virus; Infectious Bursal Disease, (IBV) Birna Virus; Newcastle Disease: (ND); Encephalomyelitis; Fowl Pox; Reovirus; Avian Flu, strain N5H1 flu; Mycoplasma; Cholera; and Coccidia, Eimeria and Isospora.
  • MDV Marek disease
  • IBV Infectious bronchitis disease
  • IBV Infectious Larygotracheitis
  • IBV Infectious Larygotracheitis
  • IBV Infectious Bursal Disease
  • Birna Virus Infectious Bursal Disease
  • Newcastle Disease Newcastle Disease: (ND); Encephalomyelitis
  • Fowl Pox Reovirus
  • Avian Flu strain N5H1 flu
  • cancer antigens which can include bullous pemphigoid antigen 2, prostate mucin antigen (PMA), tumor associated Thomsen- Friedenreich antigen, prostate-specific antigen (PSA), EpCam/KSA antigen, luminal epithelial antigen (LEA.135) of breast carcinoma and bladder transitional cell carcinoma (TCC), cancer-associated serum antigen (CASA) and cancer antigen 125 (CA 125), the epithelial glycoprotein 40 (EGP40), squamous cell carcinoma antigen (SCC), cathepsin E, tyrosinase in melanoma, cell nuclear antigen (PCNA) of cerebral cavernomas, DF3/MUC1 breast cancer antigen, carcinoembryonic antigen, tumor-associated antigen CA 19-9, human melanoma antigens MART-l/Melan-A27-35 and gplOO, the T and Tn pancarcinoma (CA) glycopeptide epi
  • PMA prostate mucin anti
  • the first and second nucleic acids are operably linked to a promoter operable in the target host cell.
  • promoters for Bacillis are bclA, dal, exsB, exsC, exsCL, exsD, exsE, exsF, exsG, exsH, exsl, exsJ, exsY, cotA, cotB, cotC, cotD, cotE, cotF, cotG, cotN, cotS, cotT, cotV, cotW, cotX, cotY, and cotZ.
  • Yet another aspect of the present invention includes a host cell comprising a nucleic acid construct in any of the above mentioned variations.
  • the host cell is an expression system for producing the fusion protein.
  • the host cell may be a bacterial, yeast, insect, fish or mammalian cell, which more preferably may be used as an expression system for the fusion protein.
  • Preferred examples of host cells include any subspecies of Bacillus thuringiensis including Bacillus thuringiensis subsp. aizawai, Bacillus thuringiensis subsp. galleriae, Bacillus thuringiensis subsp. entomocidus, Bacillus thuringiensis subsp.
  • Bacillus thuringiensis subsp. thuringiensis Bacillus thuringiensis subsp. alesti, Bacillus thuringiensis subsp. americansis, Bacillus thuringiensis subsp. darmstadiensis, Bacillus thuringiensis subsp. dendrolimus, Bacillus thuringiensis subsp. ⁇ nitimus, Bacillus thuringiensis subsp. kenyae, Bacillus thuringiensis subsp. morrisoni, Bacillus thuringiensis subsp. subtoxicus, Bacillus thuringiensis subsp. toumanoffi, Bacillus thuringiensis subsp.
  • Bacillus thuringiensis subsp. shandogiensis Bacillus thuringiensis subsp. sotto, Bacillus thuringiensis subsp. nigeriae, Bacillus thuringiensis subsp. yunnanensis, Bacillus thuringiensis subsp. dakota, Bacillus thuringiensis subsp. indiana, Bacillus thuringiensis subsp. tohokuensis, Bacillus thuringiensis subsp. kumamotoensis, Bacillus thuringiensis subsp. tochigiensis, Bacillus thuringiensis subsp.
  • Bacillus thuringiensis subsp. wuhanensis Bacillus thuringiensis subsp. kyushuensis, Bacillus thuringiensis subsp. ostriniae, Bacillus thuringiensis subsp. tolworthi, Bacillus thuringiensis subsp. pakistani, Bacillus thuringiensis subsp. japonensis, Bacillus thuringiensis subsp. colmeri, Bacillus thuringiensis subsp. pondicheriensis, Bacillus thuringiensis subsp. shandongiensis, Bacillus thuringiensis subsp.
  • Bacillus thuringiensis subsp. coreanensis Bacillus thuringiensis subsp. silo, Bacillus thuringiensis subsp. mexcanensis, Bacillus thuringiensis subsp. israelensis, Bacillus thuringiensis subsp. berliner, Bacillus thuringiensis subsp. cameroun, Bacillus thuringiensis subsp. ongbei, Bacillus thuringiensis subsp. fukuokaensis, Bacillus thuringiensis subsp. higo, Bacillus thuringiensis subsp.
  • the first nucleic acide is endogenous and the second nucleic acid is exogenous.
  • Yet another aspect of the present invention includes fusion proteins expressed from any of the above nucleic acid constructs in all the variations discussed.
  • the fusion protein is part of a pharmaceutical composition that includes a pharmaceutically acceptable carrier.
  • any of the fusion proteins and pharmaceutical compositions may be used in therapeutic methods whereby therapeutically effective doses of the fusion protein or pharmaceutical compositions may be administered to a subject in need of treatment or at risk of a disorder.
  • Preferred methods of administion includedy oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, or intranasal.
  • Still another embodiment of the present invention includes methods of screening the fusion proteins of the present invention for a desired activity.
  • An example of such a screening method is providing a nucleic acid constructs as described above where the second nucleic acid molecules is selected based upon likelihood of having the desired activity and determining whether of the fusion protein has the desired activity.
  • the desired activity is pesticidal for which preferred second peptides are insecticidal peptides.
  • the desired activity is vaccination for which the preferred second peptides are derived from the pathogen or cancer to be vaccinated against.
  • FIGURE 1 depicts the cotG promoter linked to the aprE upstream mRNA stabilizing region +1-59 of the aprE transcribed region which gives very high mRNA stability and very high levels of expression (from Bacillus subtilis).
  • cotG from Bt in upper case aprE leader sequence in lower case.
  • FIGURE 2 is the expression cassette sequence for Example 2.
  • FIGURE 3 depicts an expression cassette DNA and protein sequence showing a multifunctional linker.
  • the spore coat protein is cotYl and is fused to 628 amino acids of the N-terminal coding region of the insecticidal protein gene Cry ICa.
  • Amino acids 1 through 628 of the Cry 1 CaI protein comprise the active portion of the toxin after cleavage by insect midgut proteases.
  • the linker contains restriction sites for in-frame cloning, a nine amino acid epitope for antibody detection (bold), and a proteolytic cleavage site to ensure that the Cry 1 CaI protein is released from the spore after it is orally consumed by the insect.
  • FIGURE 4 is the expression cassette sequence for Example 2.
  • the expression cassette contains an exosporium gene promoter, the exsCL gene sequence, and the cry ICa gene sequence.
  • FIGURE 5 is the expression cassette DNA and protein sequence for Example 4 showing a multifunctional linker.
  • the exosporium gene, exsCL is fused to 628 amino acids of the N-terminal coding region of the insecticidal protein gene cry ICa.
  • Amino acids 1 through 628 of the CrylCal protein comprise the active portion of the toxin after cleavage by insect midgut proteases.
  • the linker contains restriction sites for in-frame cloning, a nine- amino acid epitope for antibody detection (bold typeface), and a proteolytic cleavage site to ensure that the insecticidal CrylCal protein is released from the spore after it is orally consumed by the insect.
  • FIGURE 6 depicts nucleotide and peptide sequences showing the junction between CotYl and Cry ICa including the HA epitope and proteolytic cleavage site. This figure shows nucleotides 481 through 660 of SEQ ID NO:26 and amino acids 161 through 220 of SEQ ID NO:27.
  • FIGURE 7 depicts nucleotide and peptide sequences showing the junction between ExsCL and Cry ICa including the HA epitope and proteolytic cleavage site. This figure shows nucleotides 661 through 840 of SEQ ID NO:32 and amino acids 112 through 171 of SEQ ID NO:33.
  • FIGURE 8 (A)-(E) depicts the sequence alignment of CotG (SEQ ID NO:4), CotYl(SEQ ID NO:4),
  • exosporium protein [Bacillus thuringiensis serovar konkukian str.
  • exosporium protein [Bacillus thuringiensis serovar konkukian str.
  • Bacillus thuringiensis (“Bt”) is a widely used biopesticide effective against insects of the lepidopteran family (i.e., moths and butterflies) and also other insects such as the larvae of mosquitoes. Over the years it has proven to be safe, as evidenced from the lack of reported or observed toxicological effects in humans from exposures in the field. However, despite its record, Bt use as a biopesticide suffers from several drawbacks including the necessity to apply significant amounts of formulated material onto crops and other plant-based resources (such as turf grass). A large amount is required for application because of the relative lack of efficacy of the Bt spores in the formulated pesticides. Current Bt products are mixtures of spores and isolated crystalline protein toxins.
  • the spores although contributing to insecticidal activity, are relatively slow in onset of action because the spores, after ingestion by the target insect, must germinate in the midgut of the target insect before they exert their insecticidal activity. Once the spores germinate into vegetative cells and become metabolically active, a phenomenon elicited by the favorable environment of the insect's gut, they replicate and colonize in the insect. It is this process of colonization that confers insecticidal activity since many of the viable cells are lysed, which enables the release of endogenous insecticidal protein toxins, previously contained within the vegetative cell (or the predecessor endospore).
  • the endogenous toxins act in the same manner as ingested isolated protein toxins, in effect, killing the target insect.
  • the methods of the present invention allow for the expression of endogenous protein toxin on the surface of the spore making the protein toxin immediately accessible to receptors in the gut of the target insect (the mechanism of action of the toxin's toxicity), thereby conferring rapidity of insecticidal activity, since the spores essentially will act as if they were isolated protein toxins.
  • the longer-term benefits of the germination process will be retained by the methods of the present invention.
  • Bt insecticide formulations Another drawback of current Bt insecticide formulations is their relatively narrow range of insecticidal activity. Most Bt insecticide formulations target a few insect species. To overcome this limitation, one would have to apply several different Bt formulations containing several different Bt strains known to target different insects to achieve a broad range of insecticidal activity. This, of course, would be a time-consuming and costly approach.
  • the methods of the present invention overcome these drawbacks by allowing for the expression of one or more insecticidal protein toxins on the surface of the Bt spore.
  • the methods allow for the expression of endogenous Bt insecticidal protein toxins, including those of the host Bt strain (as described, supra), and/or the expression of non-host strain Bt endogenous insecticidal protein toxins, and/or the expression of non-Bt endogenous insecticidal protein toxins, and/or the expression of non-bacillus insecticidal protein toxins on the surface of Bt spores.
  • endogenous Bt insecticidal protein toxins including those of the host Bt strain (as described, supra), and/or the expression of non-host strain Bt endogenous insecticidal protein toxins, and/or the expression of non-Bt endogenous insecticidal protein toxins, and/or the expression of non-bacillus insecticidal protein toxins on the surface of Bt spores.
  • the methods of the present invention allow for the insecticidal protein toxins to be expressed on the surface of Bt spores during the process of sporulation.
  • Genes encoding such insecticidal protein toxins are operably linked, with or without a linker, to an outer core protein gene or an exosporium gene, which is operably linked to a sporulation promoter sequence, such as an outer coat protein gene promoter sequence or an exosporium protein gene promoter sequence, which is then cloned into a suitable expression vector such as any of a number of commercially-available plasmids.
  • the expression vector is then introduced into one or more cells of a suitable host Bt strain (i.e., the host Bt strain is transformed or transfected) by any suitable method known in the art such as electroporation.
  • a suitable host Bt strain i.e., the host Bt strain is transformed or transfected
  • electroporation any suitable method known in the art such as electroporation.
  • the one or more Bt cells are induced to sporulate causing the expression cassettes to express the outer coat protein gene or the exosporium gene operably linked to the one or more insecticidal protein genes.
  • endogenous insecticidal protein toxins form aggregates or crystals, which are comprised of one or more types of proteins, typically of the size of about 130-140 kDa.
  • the insecticidal protein toxin is actually a protoxin — that is, it must be activated before it has any effect.
  • the crystal form of the insecticidal protein toxin is highly insoluble under normal conditions, so it is safe to humans, higher animals and most insects. However, the crystal toxin is solubilized in reducing conditions of high pH (above about pH 9.5) - the conditions commonly found in the midgut of lepidopteran larvae. For this reason, Bt is a highly specific insecticidal agent. Current Bt products are formulated with crystal toxins since this structure stabilizes the insecticidal protein once applied to the environment.
  • the protoxin is cleaved by a gut protease to produce an active toxin of about 60 kDa.
  • the toxin binds to the midgut epithelial cells, creating pores in the cell membranes and leading to equilibration of ions.
  • the gut is rapidly immobilized, the epithelial cells lyse, the larva stops feeding, and the gut pH is lowered by equilibration with the blood pH.
  • the Bt spores play a contributing role in insect control.
  • the gut pH is lowered, the spores can germinate, allowing the bacterium to invade the host, and causing a lethal bacterial infection or septicemia.
  • the Bt recombinant spores of the present invention have additional applications such as industrial enzymes and vaccines.
  • One or more exogenous enzyme genes can be expressed in a Bt spore during sporulation in the same manner as an exogenous insecticidal protein toxin is. That is, an entire enzyme gene or a portion of it (i.e., a portion that codes for the active form of the enzyme) can be operably linked to an outer coat protein gene or exosporium gene and a suitable promoter thereby creating an expression cassette.
  • the expression cassette can then be cloned into a suitable expression vector and introduced into one or more cells of a host Bt strain.
  • the one or more cells can then be induced to sporulate, which triggers expression of the exogenous enzyme (or component thereof) on the surface of the Bt spore.
  • the resulting recombinant spores function as immobilized enzymes, which can be produced inexpensively by bacillus fermentation and can be easily isolated from the enzyme reaction mixture by simple sedimentation or centrifugation. Since the enzyme attached on the spore surface is more stable than a corresponding free enzyme, the spore-bound enzyme can be used repeatedly.
  • the methods of the present invention allow for the creation of one or more recombinant Bt spores expressing one or more antigens on their surface. In this manner, the present invention allows for the creation of one or more vaccines.
  • the present invention includes the use of Bt spores as an immobilized enzyme matrix and vaccine.
  • the spore structure of Bacillus subtilis has been characterized using various techniques including microscopy, staining, genetics, and sequence analysis.
  • the spores are encased in a complex protein coat comprised of three spore coat layers; an amorphous undercoat, a lightly staining inner structure, and an electron-dense outer coat.
  • B. subtilis spore coat proteins have been cloned and sequenced and the sequence information has been used to express exogenous genes (those derived from non Bacillus hosts for example) on the surface of the spore.
  • exogenous genes such as derived from non Bacillus hosts for example
  • the present invention utilizes a Bt spore structural protein, such as spore coat protein or an exosporium protein to anchor a heterologous protein that is desirable to have expressed on the spore surface.
  • Bt spore structural protein such as spore coat protein or an exosporium protein
  • a large number of Bt isolates have been reported and these isolates are highly diversified.
  • the technology only describes the non- covalent association of these proteins and does not describe display on the exosporium (Du C, Chan WC, McKeithan TW, Nickerson KW. Appl Environ Microbiol. 2005,71(6):3337-41).
  • the present invention is not limited to Bt spore structural proteins but contemplates the use of other Bacillus spore structural proteins including, but not limited to, the spore outer coat protein genes of B. subtilis and B. cereus, and the exosporium protein genes of B. cereus.
  • Bt spores In addition to their outer coat, Bt spores contain an exosporium, which is a loose balloon-like structure, a structure which appears to be absent from the spores of B. subtilis. Since the exosporium is the outermost layer of the spore, it is the portion of the spore that makes the initial contact with a host organism (such as an insect including a target insect) or the environment. The exosporium is composed primarily of protein, but also contains lipid and carbohydrate. Exosporium proteins from related Bacilli have been identified, but to the Applicants' knowledge, none of the corresponding proteins from Bt have been cloned or sequenced.
  • Bacillus thuringiensis refers to a gram positive soil bacterium characterized by its ability to produce crystalline inclusions during sporulation.
  • a "subspecies” is defined as a taxonomic group that is a division of a species which is genetically distinguishable from other such populations of the same species.
  • exogenous as used herein means derived from outside the Bt host strain and the term “exogenous proteins” includes proteins, peptides, and polypeptides. Conversely, the term “endogenous” means derived from within the Bt host strain.
  • endogenous means derived from within the Bt host strain.
  • heterologous as used herein means derived from a different genetic source.
  • homologous as used herein means similar in structure and evolutionary origin.
  • a “host cell” or “host strain” is defined herein as a cell, which is a specific Bt strain, that is used in lab techniques such as DNA cloning to receive, maintain, and allow the reproduction of cloning vectors, for example, the expression vectors or plasmids of the present invention.
  • a “strain” is defined as a population of cells all descended from a single cell.
  • spore structural gene is meant any gene encoding a spore outer coat protein or an exosporium protein, or any functional derivatives or equivalents thereof.
  • Polynucleotide and “nucleic acid” refer to a polymer composed of nucleotide units (ribonucleotides, deoxyribonucleotides, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof) linked via phosphodiester bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof.
  • nucleotide polymers in which the nucleotides and the linkages between them include non-naturally occurring synthetic analogs.
  • nucleotide sequence when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T.”
  • upstream refers to the region or DNA extending in a 5' direction and the term “downstream” refers to an area on the same strand of DNA, that is located past the gene if one moves along the strand in a 5'-3' direction (the normal direction of transcription and leading strand replication).
  • a “gene” is a defined hereditary unit that occupies a specific location on a chromosome, determines a particular characteristic in an organism by directing the formation of a specific protein, and is capable of replicating itself at each cell division.
  • the term “reading frame” refers to a contiguous, non-overlapping set of triplet codons in RNA or DNA that begin from a specific nucleotide.
  • a “codon” is defined as the basic unit of the genetic code, comprising three-nucleotide sequences of messenger ribonucleic acid (mRNA), each of which is translated into one amino acid in protein synthesis.
  • recombinant refers to polynucleotides synthesized or otherwise manipulated in vitro ("recombinant polynucleotides”) and to methods of using recombinant polynucleotides to produce gene products encoded by those polynucleotides in cells or other biological systems.
  • a cloned polynucleotide may be inserted into a suitable expression vector, such as a bacterial plasmid, and the plasmid can be used to transform a suitable host cell.
  • a host cell that comprises the recombinant polynucleotide is referred to as a "recombinant host cell” or a “recombinant bacterium.”
  • the gene is then expressed in the recombinant host cell to produce, e.g., a "recombinant protein.”
  • a recombinant polynucleotide may serve a non-coding function (e.g., promoter, origin of replication, ribo some-binding site, etc.) as well.
  • a "cloning vector” is defined as a DNA molecule originating from a virus, a plasmid, or the cell of a higher organism into which another DNA fragment of appropriate size can be integrated without loss of the vector's capacity for self-replication.
  • Vectors introduce foreign DNA into host cells, where it can be reproduced.
  • Vectors are often recombinant molecules containing DNA sequences from several sources. The DNA introduced with the vector is replicated whenever the cell divides.
  • a “promoter” is an array of nucleic acid control sequences that direct transcription of an associated polynucleotide, which may be a heterologous or a native polynucleotide.
  • a promoter includes nucleic acid sequences near the start site of transcription, such as an RNA polymerase binding site.
  • an "expression cassette” refers to a series of polynucleotide elements that permit transcription of a gene in a host cell.
  • the expression cassette includes a promoter and a heterologous or native polynucleotide sequence that is transcribed.
  • a “linker” is a double-stranded oligonucleotide containing a number of restriction endonuclease recognition sites.
  • a “restriction endonuclease recognition site” or a “restriction site” is a specific nucleotide sequence at which a particular restriction enzyme cleaves the DNA.
  • a “restriction enzyme” or “restriction endonuclease” is a protein that recognizes specific, short nucleotide sequences and cleaves DNA at those sites.
  • operably linked refers to a functional relationship between two parts in which the activity of one part (e.g., the ability to regulate transcription) results in an action on the other part (e.g., transcription of the sequence).
  • a polynucleotide is "operably linked to a promoter" when there is a functional linkage between a polynucleotide expression control sequence (such as a promoter or other transcription regulation sequences) and a second polynucleotide sequence (e.g., a native or a heterologous polynucleotide), where the expression control sequence directs transcription of the polynucleotide.
  • PCR polymerase chain reaction
  • PCR is method for amplifying a DNA base sequence using a heat-stable polymerase and two primers, one complementary to the plus strand at one end of the sequence to be amplified and the other complementary to the minus strand at the other end. Because the newly synthesized DNA strands can subsequently serve as additional templates for the same primer sequences, successive rounds of primer annealing, strand elongation, and dissociation produce rapid and highly specific amplification of the desired sequence. PCR also can be used to detect the existence of the defined sequence in a DNA sample.
  • oligonucleotide and oligonucleotide primer
  • Polymerase is defined as an enzyme that catalyzes the synthesis of nucleic acids on preexisting nucleic acid templates.
  • the term "surface of the spore” or “the spore surface” means both the outer coat of the Bt spore and the exosporium of the Bt spore.
  • the term is used in its generic sense so, for example, when a heterologous protein is expressed on the surface of the spore (or the spore surface), the protein may be found on the outer coat or on the exosporium such that said heterologous protein is displayed in such a way that it is oriented to the outer environment such as the lumen of an insect's gut.
  • the term "attached” when used in the context of proteins "attached” the surface of the spore means a heterologous protein, fused with an outer coat protein or an exosporium protein, so that the heterologous protein is covalently linked to the surface of the spore by means of its fusion with an outer coat protein or an exosporium protein.
  • polypeptide polypeptide
  • peptide protein
  • amino acid polymers in which one or more amino acid residues is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
  • Amino acids may be referred to herein by either their commonly known three letter symbols or by Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes, i.e., the one-letter symbols recommended by the IUPAC-IUB.
  • High stringency conditions may be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.015 M sodium citrate/0.1% sodium dodecyl sulfate at 50-68 °C; (2) employ during hybridization a denaturing agent such as formamide, for example, 50% (v/v) formamide with 0.1 % bovine serum albumin/0.1 % Ficoll/0.1 % polyvinylpyrrolidone/50niM sodium phosphate buffer at pH 6.5 with 750 mM sodium , chloride, 75 mM sodium citrate at 42 0 C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 Dg/ml), 0.1% SDS, and 10% dextran sulfate at 42
  • Preferred hybridization conditions for very high stringency hybridization include at least one wash at 0.1 x SSC, 0.1 % SDS, at 6O 0 C for 15 minutes.
  • Preferred hybridization conditions for high stringency hybridization include at least one wash at 0.2 x SSC, 0.1 % SDS, at 60 0 C for 15 minutes.
  • Preferred hybridization conditions for moderate stringency hybridization include at least one wash at 0.5 x SSC, 0.1 % SDS, at 60 0 C for 15 minutes.
  • Preferred hybridization conditions for low stringency hybridization include at least one wash at 1.0 x SSC, 0.1 % SDS, at 60°C for 15 minutes.
  • hybridizing specifically to refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA.
  • Stringent conditions are sequence-dependent and will be different in different circumstances. As is well known in the art, longer sequences hybridize specifically at higher temperatures.
  • stringent conditions are selected to be about 5 0 C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
  • Tm is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium.
  • stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.05 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 0 C for short probes (e.g., 10 to 50 nucleotides) and at least about 60 °C for long probes (e.g., greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of DNA duplex destabilizing agents such as formamide.
  • nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence over a comparison window, as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
  • the percent identity exists over a region of the sequence that is at least about 25 amino acids in length, more preferably over a region that is 50 or 100 amino acids in length.
  • This definition also refers to the complement of a test sequence, provided that the test sequence has a designated or substantial identity to a reference sequence.
  • the percent identity exists over a region of the sequence that is at least about 25 nucleotides in length, more preferably over a region that is 50 or 100 nucleotides in length.
  • substantially identical in the context of two nucleic acids or polypeptides, refers to two or more sequences or subsequences that have at least 60%, preferably 70%, more preferably 80%, preferably 85%, more preferably 90%, more preferably 93%, more preferably 95%, more preferably 97%, preferably 98%, and most preferably 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection.
  • the substantial identity exists over a region of the sequences that is at least about 50 residues in length, more preferably over a region of at least about 100 residues, and most preferably the sequences are substantially identical over at least about 150 residues. In a most preferred embodiment, the sequences are substantially identical over the entire length of the coding regions.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. MoI. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection.
  • BLAST algorithm One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. MoI. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information website at http://www.ncbi.nlm.nih.gov. In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul (1993) Proc. Nat'l. Acad Sci. USA 90:5873-5787).
  • BLAST algorithm One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
  • sequence identity When percentage of sequence identity is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Alternatively, when one includes such conservative substitutions in the comparison, a percent "similarity" can be noted, as opposed to a percent “identity”. Means for making this adjustment are well known to those of skill in the art. The scoring of conservative substitutions can be calculated according to, e.g., the algorithm of Meyers & Millers, Computer Applic. Biol. ScL 4:11- 17 (1988), e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif.).
  • Target proteins may include insecticidal protein toxins, enzymes, and antigenic proteins. Such proteins may be expressed on the surface of one or more Bt spores in their entirety (i.e., the entire gene is introduced into the host cell and expressed as described more fully above and below) or as active components or subunits. Included in the target proteins of the present invention are amino acid sequence variants of the wild-type target proteins. These variants fall into one or more of three classes: substitution, insertion or deletion variants.
  • variants ordinarily are prepared by site-specific mutagenesis of nucleotides in the DNA encoding the target protein, using cassette or PCR mutagenesis or other techniques well known in the art, to produce DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture.
  • Variant target protein fragments having up to about 100-150 amino acid residues may be prepared by in vitro synthesis using established techniques.
  • Amino acid sequence variants are characterized by the predetermined nature of the variation, a feature that sets them apart from naturally occurring allelic or interspecies variation of the target protein amino acid sequence.
  • the variants typically exhibit the same qualitative biological activity as the naturally occurring analogue, although variants can also be selected that have modified characteristics.
  • Amino acid substitutions are typically of single residues; insertions usually will be on the order of from about 1 to about 20 amino acids, although considerably longer insertions may be tolerated. Deletions range from about 1 to about 20 residues, although in some cases, deletions may be much longer.
  • an “antigen” refers generally to a substance capable of eliciting the formation of antibodies in a host or generating a specific population of lymphocytes reactive with that substance.
  • Antigens may comprise macromolecules (e.g., polypeptides, proteins, and polysaccharides) that are foreign to the host.
  • the present invention provides methods for making and using recombinant Bacillus thuringiensis strains that have exogenous proteins attached to their spores.
  • Bacillus spores contain a protein coat which, in B. subtilis, is known to contain at least 20 polypeptides.
  • B. thuringiensis spores have an exosporium surrounding the mature spore which is comprised of protein, lipid, and carbohydrate.
  • Applicants cloned and sequenced four homologous spore outer coat protein genes from Bt, a spore outer coat protein gene promoter sequence, and an exosporium protein gene from Bt.
  • an expression cassette is placed in a Bt host to produce a recombinant Bt strain having an exogenous protein attached to its spore.
  • the expression cassette is comprised of a suitable sporulation promoter such as an outer coat protein gene promoter or an exosporium protein gene promoter, followed by a portion of a Bt spore coat protein gene or a Bt exosporium protein gene fused, in frame, to the exogenous gene of interest.
  • a suitable sporulation promoter such as an outer coat protein gene promoter or an exosporium protein gene promoter, followed by a portion of a Bt spore coat protein gene or a Bt exosporium protein gene fused, in frame, to the exogenous gene of interest.
  • the terms "fuse”, “fusion”, and “fusing” refer to the blending together of nucleic acid molecules, genes or proteins.
  • Suitable promoters include those found in Bacillus strains such as the cotG promoter from B. cereus (GenBank Accession
  • Applicants designed oligonucleotide primers based on B. cereus spore coat genes and on the B. cereus exosporium gene sequence and used the polymerase chain reaction to clone four Bt spore coat genes and a Bt exosporium gene. Based on their similarity to the B. cereus spore coat genes and B. cereus exosporium gene, Applicants designated the cloned Bt genes as cotE, cotG, cotYl, cotY2, and exsCL. Sequences upstream of the cotG gene were isolated that comprise the Bt cotG promoter.
  • sporulation-specific promoter preferably a spore coat protein gene promoter or an exosporium protein gene promoter. Use of a spore coat protein gene promoter or an exosporium protein gene promoter ensures expression at the appropriate time during the Bt life cycle.
  • the novel Bt cotG promoter from the present invention can be placed in the expression cassette, or another sporulation-specific promoter can be used.
  • Promoters used in the expression cassette may include any Bacillus sporulation-specific promoter, but preferably an exosporium protein gene promoter or spore coat protein gene promoter including, but not limited to, the specific promoters of bclA, dal, exsB, exsC, exsCL, exsD, exsE, exsF, exsG, exsH, exsl, exsJ, exsY, cotA, cotB, cotC, cotD, cotE, cotF, cotG, cotN, cotS, cotT, cotV, cotW, cotX, cotY, and cotZ.
  • the sequences of such promoters are readily obtainable from public nucleotide databases or can be identified using standard molecular biology techniques well within the skill of the ordinary artisan.
  • the portion of the spore outer coat protein gene or exosporium protein gene present in the expression cassette can be relatively small or it may include almost the entire spore coat or exosporium protein.
  • the number of spore coat protein gene or exosporium protein gene codons present in the expression cassette can be at least five, and preferably, at least twenty-seven. For example the entire Bt cotG gene excluding the stop codon can be placed in the expression cassette.
  • cotE SEQ ID NO:7
  • cotG SEQ ID NO:3
  • cotYl SEQ ID NO:1
  • cotY2 SEQ ID NO:5
  • the newly- identified spore genes cotE, cotG, cotYl, and cotY2 of the present invention or portions thereof may be used in the expression cassette.
  • spore outer coat protein genes for use in the present invention may be isolated from any Bacillus strain including, but not limited to, cotA, cotB, cotC, cotD, cotE, cotF, cotG, cotN, cotS, cotT, cotV, cotW, cotX, cotY, and cotZ among others.
  • Gene sequences for the above-mentioned genes may be found in any public source including public databases such as those maintained by the National Center for Biotechnology Information, university databases, publications including various those from various scientific journals and others well known to those of skill in the art.
  • exosporium protein gene exsCL (SEQ ID NO: 10) from the Bt galleriae strain SDS-502.
  • the newly-identified exsCL gene of the present invention or portions thereof may be used in the expression cassette.
  • exosporium proteins genes for use in the present invention may be isolated from any Bacillus strain including, but not limited to, bclA, dal, exsB, exsC, exsCL, exsD, exsE, exsF, exsG, exsH, exsl, exsJ, exsY among others. Gene sequences for the above-mentioned genes may be found in any public source including public databases such as those maintained by the National Center for Biotechnology Information, university databases, publications including various those from various scientific journals and others well known to those of skill in the art.
  • sequences of the present invention can be identified and defined in terms of their similarity or identity to the sequences of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO:10.
  • the sequences of the present invention comprise sequences which have greater than 55 or 60% sequence identity with SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO: 10, preferably greater than 70%, more preferably greater than 80%, more preferably greater than 90 or 95% or, in another embodiment, have 98 to 100% sequence identity with SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO:10.
  • the nucleic acid hybridizes under stringent conditions to nucleic acids having a sequence or complementary sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO: 10.
  • hybridize means to form base pairs between complementary regions of two strands of DNA.
  • spore coat protein gene sequences and their modified variations as both polynucleotides and polypeptides can be used to direct expression of a heterologous protein to the surface of a spore.
  • the genes and proteins of the present invention can also be defined in terms of the ability to hybridize with, or be amplified by, certain nucleic acid sequences.
  • the polynucleotides of the present invention include those that hybridize under stringent conditions to each of the above-mentioned polynucleotides or a probe that can be prepared from the above-mentioned polynucleotide, as far as they encode polypeptides having a functional effect allowing the assembly of heterologous proteins into the spores.
  • CotE SEQ ID NO: 8
  • CotG SEQ ID NO:4
  • CotYl SEQ ID NO:2
  • CotY2 SEQ ID NO: 6
  • Equivalent proteins will have amino acid similarity (and/or homology) with the exemplified proteins.
  • the amino acid identity will typically be greater than 60%, preferably greater than 75%, more preferably greater than 80%, even more preferably greater than 90%, and can be greater than 95%.
  • the classes of spore outer coat proteins provided herein can also be identified based on their immunoreactivity with certain antibodies.
  • the proteins further specifically bind to polyclonal antibodies raised against SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8, or portions of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8.
  • exosporium protein gene sequences and their modified variations as both polynucleotides and polypeptides can be used to direct expression of a heterologous protein to the exosporium.
  • the genes and proteins of the subject invention can also be defined in terms of the ability to hybridize with, or be amplified by, certain nucleic acid sequences.
  • the polynucleotides of the present invention include those that hybridize under stringent conditions to each of the above-mentioned polynucleotides or a probe that can be prepared from the above-mentioned polynucleotide as far as they encode polypeptides having a functional effect allowing the assembly of heterologous proteins into the spores.
  • ExsCL protein of the present invention has been specifically provided in SEQ ID NO:11. Since this protein is merely exemplary of the proteins of the subject invention, it should be readily apparent that the subject invention comprises modified variations or equivalent proteins (and nucleotide sequences coding for equivalent proteins) having the same or similar activity as the exemplified proteins.
  • Equivalent proteins will have amino acid similarity (and/or homology) with the exemplified proteins. The amino acid identity will typically be greater than 60%, preferably greater than 75%, more preferably greater than 80%, even more preferably greater than 90%, and can be greater than 95%.
  • exosporium proteins can also be identified based on their immuno-reactivity with certain antibodies.
  • the proteins further specifically bind to polyclonal antibodies raised against SEQ ID NO:11.
  • the exogenous gene placed in the expression cassette can encode a protein from a variety of classes depending on the desired application.
  • the exogenous gene encodes an insecticidal protein toxin isolated from a Bacillus species.
  • genes or nucleic acid sequences placed in the expression cassette can encode proteins, peptides, or polypeptides useful for vaccinations, particularly wildlife vaccinations. Target diseases include rabies, Lyme disease, and other diseases that are preventable by the administration of a vaccine.
  • genes placed in the expression cassette can encode enzymes or proteins useful in bio-remediation and other industrial applications.
  • any exogenous or endogenous gene can be placed in the expression cassette. The gene choice depends on the desired application of the resulting protein attached to the Bt spore.
  • the expression cassette may further include a linker to operably link, or join the spore outer coat protein or exosporium protein gene with the desired exogenous gene.
  • the linker restriction sites also called the “multiple cloning site" allow rapid and easy placement of a spore coat protein gene or exosporium protein gene upstream of the linker and the desired exogenous gene downstream of the linker.
  • the linker sequence can preferably encode as few as 10 and as many as 100 amino acids, although it is also possible for the linker to encode more than 100 amino acids.
  • the linker sequence must be designed in such a way that the reading frame is continued from the spore coat protein gene into the desired exogenous gene.
  • the linker maybe further comprised of an epitope that can be recognized by an antibody. This reactivity allows for tracking of the exogenous protein during product development and use.
  • the linker sequence allows the secondary and tertiary structures of the spore outer coat or exosporium protein to form correctly to ensure the heterologous protein fusion is directed to the spore outer coat or exosporium.
  • the linker structure permits the attached exogenous protein to be in an active form or precursor form such that it is functional, or can be correctly processed post-translationally.
  • the gene placed in the expression cassette will encode an insecticidal protein.
  • Insecticidal protein genes occur naturally in Bt as well as some other Bacillus species, such as Bacillus popilliae.
  • Insecticidal proteins, also called delta- endotoxins, or crystal protein, form crystals visible by phase contrast microscopy.
  • Insecticidal protein genes used in the present invention may include, but are not limited to, the following list (see also at the website biols.susx.ac.uk/home/Neil_C/rickmore/Bt/toxins2.html where sequences to the following proteins can be obtained either directly or via links to other websites): CrylAal, CrylAa2, CrylAa3, CrylAa4, CrylAa5, CrylAa ⁇ , CrylAa7, CrylAa8, CrylAa9, CrylAalO, CrylAal 1, CrylAal2, CrylAal3, CrylAal4, CrylAbl, CrylAb2, CrylAb3, CrylAb4, CrylAb5, CrylAb ⁇ , CrylAb7, CrylAb8, CrylAb9, CrylAblO, CrylAbl 1, CrylAbl2, CrylAbl3, CrylAbH, CrylAbl5, CrylAbl ⁇ , CrylAcl, CrylAc2, CrylAc3,
  • Recombinant or engineered insecticidal protein genes can also be used in the methods of the present invention.
  • a hybrid insecticidal protein gene made by fusing the N-terminal coding region of one insecticidal protein gene with the C- terminal coding region of another insecticidal protein gene can be used, hi another example, the insecticidal protein gene is engineered to encode a number of amino acid changes.
  • Bt insecticidal proteins are large protein protoxins (approximately 130 — 140 kDa). When larval insects ingest the crystal protoxin, it is solubilized in the insect midgut, and then cleaved by insect gut proteases to produce an active protein toxin of approximately 60 kDa from the N-terminal portion of the protein. In one embodiment of the present invention, only the portion of the crystal toxin gene or genes that encode the active toxin is placed in the expression cassette. In this embodiment, the proteolytic cleavage site can be placed in the linker sequence between the outer coat protein gene sequence and the active toxin sequence.
  • the active toxin is cleaved from the spore surface thereby inhibiting feeding on the crop or other plant treated with recombinant Bt spores.
  • the expression cassette can be placed in an expression vector such as a plasmid.
  • a plasmid expression vector can be further comprised of a gram positive origin of replication, a selectable marker, such as an antibiotic resistance gene, and optionally, a gram negative origin of replication.
  • selectable marker is a gene whose expression allows identification of cells that have been transformed or transfected with a vector containing the marker gene.
  • Plasmid expression vectors suitable for use in Bt include pUBl 10, pBC16-l, pC194, pE194, pUSHl, pUSH2, and pGVDl, among others ⁇ Bacillus genetic stock center catalog of strains, seventh edition, volume 2), which are readily available from well known commercial sources.
  • the expression cassette can be incorporated into the Bt genome, either on the chromosome or into a native Bt plasmid. Incorporation into the Bt genome can be accomplished using standard molecular biology techniques known to those skilled in the art, using for example transposons, bacteriophage, or homologous recombination with linear or circular DNA.
  • the expression vector can be introduced into Bt by electroporation or another method of nucleic acid transfer used by those skilled in the art.
  • Electroporation is the exposure of cells to rapid pulses of high- voltage current which renders the membrane of the cells permeable, thus allowing uptake, incorporation, and expression of DNA.
  • the host for the expression vector can be any Bacillus ihuringiensis strain including those Bt strains used to make commercial insecticides.
  • the Bt host strain can be selected from any subspecies including Bacillus thuringiensis subsp. aizawai, Bacillus thuringiensis subsp. galleriae, Bacillus thuringiensis subsp. entomocidus, Bacillus thuringiensis subsp. tenebrionis, Bacillus thuringiensis subsp. thuringiensis, Bacillus thuringiensis subsp. alesti, Bacillus thuringiensis subsp. americansis, Bacillus thuringiensis subsp.
  • darmstadiensis Bacillus thuringiensis subsp. dendrolimus, Bacillus thuringiensis subsp.finitimus, Bacillus thuringiensis subsp. kenyae, Bacillus thuringiensis subsp. monisoni, Bacillus thuringiensis subsp. subtoxicus, Bacillus thuringiensis subsp. toumanoffi, Bacillus thuringiensis subsp. pondicheriensis, Bacillus thuringiensis subsp. shandogiensis, Bacillus thuringiensis subsp. sotto, Bacillus thuringiensis subsp. nigeriae, Bacillus thuringiensis subsp.
  • Bacillus thuringiensis subsp. pakistani Bacillus thuringiensis subsp. japonensis, Bacillus thuringiensis subsp. colmeri, Bacillus thuringiensis subsp. pondicheriensis, Bacillus thuringiensis subsp. shandongiensis, Bacillus thuringiensis subsp. neoleonensis, Bacillus thuringiensis subsp. coreanensis, Bacillus thuringiensis subsp. silo, Bacillus thuringiensis subsp. mexcanensis, Bacillus thuringiensis subsp.
  • Bacillus thuringiensis subsp. berliner Bacillus thuringiensis subsp. cameroun, Bacillus thuringiensis subsp. ongbei, Bacillus thuringiensis subsp. fukuokaensis, Bacillus thuringiensis subsp. higo, Bacillus thuringiensis subsp. israelensis, Bacillus thuringiensis subsp. japonensis Buibui, Bacillus thuringiensis subsp. jegathesan, Bacillus thuringiensis subsp. kenyae, Bacillus thuringiensis subsp.
  • Bacillus thuringiensis subsp. medellin Bacillus thuringiensis subsp. roskildiensis, Bacillus thuringiensis subsp. san diego, Bacillus thuringiensis subsp. shanghai, Bacillus thuringiensis subsp. sotto, Bacillus thuringiensis subsp. tenebrionis, and Bacillus thuringiensis subsp. thompsoni.
  • Many of the above- listed strains may be obtained from commercial sources including the American Type Culture Collection, the U.S. Department of Agriculture, the Ohio State University Bacillus Genetic Stock Center and others that are well known to those of skill in the art.
  • Bacillus thuringiensis strains expressing fusion proteins may be constructed by homologous recombination of the second peptide coding into the endogenous spore coat gene such that the second peptide coding region is in frame with the spore coat gene reading frame to produce a single polypeptide.
  • the sequences of the present invention may be used as regions of homology to allow recombination into any desired Bacillus thuringiensis strain.
  • the present invention provides a means of controlling insects comprising delivering to the insects an effective amount of an insecticidal product according to the present invention.
  • the insecticidal protein and recombinant spore mixture is delivered to the insects orally.
  • Recombinant Bt strains can be fermented industrially and formulated into a composition suitable for the desired use.
  • Insecticidal Bt strains can be formulated into granules, droplets, wettable granules, powder, wettable powder, and aqueous-based formulation, or other appropriate formulations known to those of skill in the art.
  • the formulated Bt is delivered to the target insect pests on their locations, including the appropriate crop, turf, or body of water among others.
  • the formulated insecticide is applied using a suitable procedure and application rate.
  • the "application rate” is defined as the total pounds of the pesticide active ingredient applied to the selected crop or site. Preferred application rates can be between 0.01 and 10 pounds per acre depending on the insect pest and the insecticide.
  • the target insects of the present invention are lepidopteran and coleopteran insect pests, and particularly lamellicorn beetles (Scarabaeidae), although other insects can be targeted.
  • Bacillus species other than Bt
  • Bacillus israelensis commonly used to control mosquitoes
  • Bacillus sphaericus complements the weakness of B. israelensis.
  • B. sphaericus produces a number of mosquitocidal proteins.
  • the methods of the present invention allow for the expression of one or more B. sphaericus mosquitocidal proteins on the surface of B. israelensis spores.
  • the resulting recombinant spores will have an improved spectrum of mosquitocidal activity to control a wide variety of human disease mosquito vectors.
  • Bt spores are also useful for the production and immobilization of enzymes or proteins for industrial use. That is, the Bt spores find use as an industrial delivery platform for enzymes, binding and capture molecules, and detector reagents. In industrial biocatalysis, the spore may be decorated with a required enzymatic activity. In some instances, production synthesis can be performed that may be otherwise impossible in single organism fermentation runs. Enzymes of industrial relevance may be assembled into the spore outer and inner coat layers as fusion proteins. The modified or recombinant spores can be assayed for expression, stability, and activity. Immobilization of the spore can be accomplished by attachment of modified or recombinant spores to any type of solid support.
  • Appropriate solid supports include, but are not limited to, beads, glass beads, metal beads, membranes, gels, microtiter plates, vessels, containers, pellets, and polymers. Immobilization of the spore system allows repeated uses of the immobilized spore system, although mobile spores may also be reused.
  • Spore display systems of the present invention can be used as the source of a wide variety of enzymes and non-enzyme polypeptides having industrial, biomedical, and biotechnological uses.
  • the polypeptides to be displayed, incorporated, or expressed may originate in any species and can be either mononieric or multimeric.
  • Such polypeptides may be enzymes that are useful in detergent formulations, such as lipases, proteases, amylases, and the like.
  • such polypeptides may be enzymes that are useful for a variety of industrial or biosynthetic processes.
  • Such enzymes include, but are not limited to, glucose oxidase, galactosidase, glucosidase, nitrilase, alkene monooxygenase, hydroxylase, aldehyde reductase, alcohol dehydrogenase, D-hydantoinase, D- carbamoylase, L-hydantoinase, L-decarbamoylase, beta-tyrosinase, dioxygenase, serine hydroxy-methyltransferase, carbonyl reductase, nitrile hydratase, o-phthalyl amidase, halohydrin hydrogen-halide lyase, maltooligosyl trehalose synthase, maltooligosyl trehalose trehalohydrolase, lactonase, oxygenase, adenosylmethionine synthetase, cephal
  • Enzymes that may be used in spore systems of the present invention include proteins that interfere with mammalian cell viability or protein assembly in mammalian cell expression systems, such as retinoblastoma protein and leptin.
  • Other examples of enzymes suitable for use in the present invention are listed in Table 1 below.
  • the transformation of a substrate to a desired product in biocatalytic pathway is often a multi-step process requiring multiple enzymes.
  • One of the limiting factors in this kind of enzymatic transformation is the substrate concentration for the intermediate steps.
  • Individual intermediate substrates for transformation into the product each represent a potential limiting component of the entire chemical transformation.
  • the recombinant spores can be used to locally increase the substrate concentrations and thereby greatly increase the reaction rates of each of the intermediate steps increasing yields.
  • the different enzymes needed for a particular biocatalytic transformation can all be displayed on a single spore.
  • the proximity of catalytic centers acts to increase substrate concentration and enhance the completion rate of multi-step enzymatic transformations.
  • the topology of the spore surface is highly structured and provides a highly ordered three-dimensional lattice structure. That is, the different coat proteins occupy a specific predetermined and assembled location with respect to each other. This lattice structure defines a certain degree of proximity or distance from coat protein to coat protein.
  • This lattice structure defines a certain degree of proximity or distance from coat protein to coat protein.
  • An enzyme expressed on the surface of the spore is easily removed from the enzyme reaction mixture by simple sedimentation or centrifugation, washed and re-used. AU of these usages are made possible by immobilizing the enzyme on the surface of the Bt spores, such immobilization occurring by means of the enzyme's covalent linkage to a spore outer coat protein or exosporium protein. No special formulation of the spore enzyme is needed. The enzyme attached on the surface of the Bt spore is very stable. Often no refrigeration is needed for long-term storage. Once the recombinant Bt that is capable of expressing an enzyme on the surface is made, it can be produced in an industrial fermentor tank (bioreactor).
  • a simple fermentation media like nutrient broth or a complex medium like soybean flour with starch with or without a proper sporulation- supporting ingredient consisting of magnesium, manganese, iron, calcium salts can be used.
  • the spores may be harvested by centrifuging the fermentation broth and washing the pellet in a proper solution like 50 mM potassium phosphate buffer, pH 7.
  • Enzyme Utility i.e., Reaction Catalyzed
  • the methods of the present invention confer several advantages in the use of enzymes including: enabling simple process design using enzymes, low initial investment and operational costs; robustness in presence of organic solvents; stable in storage, under mechanical stress and/or high temperatures; high rate of recovery of the enzyme(s) following the industrial process for re-use; one vessel process with mixes of different spore-enzyme products; reducing part of customer's operational costs (less inventory and enzyme waste, higher enzyme recovery rate, stable input products); higher process yields (higher enzyme stability and better control of optimal process conditions e.g., enzyme concentration etc.); improvement of overall product quality (e.g.
  • the recombinant spores of the invention can be used in many industrial settings including, industrial fermentation reactions, industrial column reactors, cleanups, bioremediation of organic solvents and heavy metals, as delivery systems in agricultural applications, and the like.
  • the enzyme will vary depending upon the application.
  • Yet another application of the present invention is the use of the recombinant Bt spores as a vaccine.
  • One or more proteins that have one or more desired antigenic qualities may be expressed on the surface of Bt spores.
  • the recombinant Bt spores expressing the one or more antigens can be produced in a fermentor tank as described above.
  • the recombinant spores are harvested from the fermentation broth, washed and suspended in water or phosphate buffered saline.
  • Such a suspension may be formulated using suitable pharmaceutical excipients, adjuvants, and other materials well known to those of skill in the art and injected in animals or humans to immunize them.
  • the recombinant Bt spores expressing an antigen on the surface are dried by spray drying or freeze drying.
  • Animals or humans can inhale such a dry spore formulation and absorb the spore vaccine through the respiratory system.
  • diseases in which the methods of the present invention are directed to include: Marek disease, (MDV) Herpes Virus; Infectious bronchitis disease: (IBV); Infectious Larygotracheitis, (ILV) Herpes Virus; Infectious Bursal Disease, (IBV) Birna Virus; Newcastle Disease: (ND); Encephalomyelitis; Fowl Pox; Reovirus; Avian Flu, strain N5H1 flu; Mycoplasma; Cholera; Anthrax, Bubonic Plague; and Coccidia, Eimeria and Isospora.
  • MDV Herpes Virus
  • IBV Infectious Larygotracheitis
  • IBV Infectious Larygotracheitis
  • IBV Infectious Burs
  • the methods confer several advantages including: the recombinant Bt spores may be administered in food or via mucosal surfaces (nose, gills, etc.) by spray, that is, no injection with a syringe is needed; versatile system allowing the presentation of several antigens in one vaccine preparation therefore, conferring protection against multiple pathogens via one vaccine treatment; low development costs; and the recombinant Bt spores themselves may be used as adjuvants and/or enhancers of innate immunity, in conjunction with expressed antigens on their surface.
  • the disease-associated antigens include, but are not limited to, toxins, virulence factors, cancer antigens, such as tumor-associated antigens expressed on cancer cells, antigens associated with autoimmunity disorders, antigens associated with inflammatory conditions, antigens associated with allergic reactions, antigens associated with infectious agents, and autoantigens that play a role in induction of autoimmune diseases.
  • cancer antigens that can be used with spore systems and methods of the invention include, but are not limited to, Among the tumor-specific antigens that can be used in the antigen shuffling methods of the invention are: bullous pemphigoid antigen 2, prostate mucin antigen (PMA) (Beckett and Wright (1995) Int. J. Cancer 62: 703-710), tumor associated Thomsen-Friedenreich antigen (Dahlenborg et al. (1997) Int. J. Cancer 70: 63-71), prostate-specific antigen (PSA) (Dannull and Belldegrun (1997) Br. J. Urol.
  • PMA prostate mucin antigen
  • PSA prostate-specific antigen
  • EpCam/KSA antigen EpCam/KSA antigen
  • luminal epithelial antigen LEA.135
  • TCC breast carcinoma and bladder transitional cell carcinoma
  • CA 125 cancer-associated serum antigen
  • ECP40 epithelial glycoprotein 40
  • SCC squamous cell carcinoma antigen
  • the invention provides spore systems displaying at least one rotavirus capsid protein VP4, VP6, or VP7. Such spore systems are useful in methods for inducing an immune response against a VP4, VP6, or VP7 rotavirus, respectively.
  • Additional viral antigens that can be used with spore systems of the invention, methods for modulating immune responses against diseases and disorders associated with such antigens, and vaccines comprising spore systems, include, but are not limited to, hepatitis B capsid protein, hepatitis C capsid protein, hepatitis A capsid protein, Norwalk diarrheal virus capsid protein, influenza A virus N2 neuraminidase (Kilbourne et al. (1995) Vaccine 13: 1799-1803); Dengue virus envelope (E) and premembrane (prM) antigens (Feighny et al. (1994) Am. J. Trop. Med. Hyg. 50: 322-328; Putnak et al.
  • HIV antigens Gag, Pol, Vif andNef HIV antigens Gag, Pol, Vif andNef (Vogt et al. (1995) Vaccine 13: 202-208); HIV antigens gpl20 and gpl60 (Achour et al. (1995) Cell. MoI. Biol. 41:395-400; Hone et al. (1994) Dev. Biol. Stand. 82: 159-162); gp41 epitope of human immunodeficiency virus (Eckhart et al. (1996) J. Gen. Virol. 77:2001-2008); rotavirus antigen VP4 (Mattion et al. (1995) J. Virol.
  • rotavirus protein VP7 or VP7sc the rotavirus protein VP7 or VP7sc (Emslie et al. (1995) J. Virol. 69: 1747-1754; Xu et al. (1995) J. Gen. Virol. 76: 1971-1980; Chen et al. (1998) Journal of Virology VoI 72:7; pp 5757-5761); herpes simplex virus (HSV) glycoproteins gB, gC, gD, gE, gG, gH, and gl (Fleck et al. (1994) Med. Microbiol. Immunol.
  • HSV herpes simplex virus
  • influenza virus nucleoprotein and hemagglutinin (Deck et al. (1997) Vaccine 15: 71-78; Fu et al. (1997) J. Virol. 71: 2715-2721); B19 parvovirus capsid proteins VPl (Kawase et al. (1995) Virology 211: 359-366) or VP2 (Brown et al. (1994) Virology 198: 477-488); Hepatitis B virus core and e antigen (Schodel et al. (1996) Intervirology 39: 104-106); hepatitis B surface antigen (Shiau and Murray (1997) J. Med. Virol.
  • hepatitis B surface antigen fused to the core antigen of the virus Id.
  • Hepatitis B virus core-preS2 particles Nemeckova et al. (1996) Acta Virol. 40: 273-279
  • HBV preS2-S protein Kutinova et al. (1996) Vaccine 14: 1045-1052
  • VZV glycoprotein I Kutinova et al. (1996) Vaccine 14: 1045-1052
  • rabies virus glycoproteins Xiang et al. (1994) Virology 199: 132-140; Xuan et al. (1995) Virus Res.
  • HCV hepatitis C virus
  • Epstein-Barr virus (EBV) gp340 Mackett et al. (1996) J. Med. Virol. 50:263-271
  • Epstein-Barr virus (EBV) latent membrane protein LMP2 Lee et al. (1996) Eur. J. Immunol. 26: 1875-1883
  • Epstein-Barr virus nuclear antigens 1 and 2 Choen and Cooper (1996) J. Virol. 70: 4849-4853; Khanna et al. (1995) Virology 214: 633-637
  • the measles virus nucleoprotein (N) (Fooks et al.
  • Examples of medical conditions and/or diseases where down-regulation or decreased immune response is desirable include, but are not limited to, allergy, asthma, autoimmune diseases (e.g., rheumatoid arthritis, SLE, diabetes mellitus, myasthenia gravis, reactive arthritis, ankylosing spondylitis, and multiple sclerosis), septic shock, organ transplantation, and inflammatory conditions, including IBD, psoriasis, pancreatitis, and various immunodeficiencies.
  • autoimmune diseases e.g., rheumatoid arthritis, SLE, diabetes mellitus, myasthenia gravis, reactive arthritis, ankylosing spondylitis, and multiple sclerosis
  • septic shock e.g., rheumatoid arthritis, SLE, diabetes mellitus, myasthenia gravis, reactive arthritis, ankylosing spondylitis, and multiple sclerosis
  • septic shock e.g., rheum
  • autoimmune diseases including diabetes and rheumatoid arthritis
  • Other autoimmune-type disorders such as reactive arthritis
  • antigens for use in spore systems and methods of the invention to treat autoimmune diseases, inflammatory conditions, and other immunodeficiency-associated conditions are provided in Punnonen et al. (1999) WO 99/41369; Punnonen et al. (1999) WO 99/41383; Punnonen et al. (1999) WO 99/41368; and Punnonen et al. (1999) WO 99/41402), each of which is incorporated herein by reference for all purposes.
  • spore systems comprising one or more polypeptides, proteins, peptides, or nucleic acids capable of reducing or suppressing an immune response (e.g., antigens specific for or associated with a disease), such as T cell proliferation or activation, can be administered according to the methods described herein.
  • an immune response e.g., antigens specific for or associated with a disease
  • T cell proliferation or activation can be administered according to the methods described herein.
  • the invention provides spore systems and vaccines for treating allergies, and prophylactic and therapeutic treatment methods utilizing such spore systems and vaccines.
  • Antigens of allergens can be incorporated into spore systems as, e.g., using one of the display, presentation, or attachment formats described above so as to display, present, bind or express the antigen on the surface of a spore.
  • the antigen can also be expressed on the spore surface by, e.g., incorporating a DNA plasmid vector comprising a nucleotide sequence encoding the antigen into the spore and facilitating expression of the antigen on the spore surface.
  • allergies examples include, but are not limited to, allergies against house dust mite, grass pollen, birch pollen, ragweed pollen, hazel pollen, cockroach, rice, olive tree pollen, fungi, mustard, bee venom.
  • Antigens of interest include those of animals, including the mite (e.g., Dermatophagoides pteronyssinus, Dermatophagoides farinae, Blomia tropicalis), such as the allergens der pi (Scobie et al. (1994) Biochem. Soc. Trans. 22: 448S; Yssel et al. (1992) J. Immunol.
  • apple allergens such as the major allergen MaI d 1 (Vanek-Krebitz et al. (1995) Biochem. Biophys. Res. Commun. 214: 538-551); and peanut allergens, such as Ara h I (Burks et al. (1995) J. Clin. Invest. 96: 1715-1721).
  • a Bt spore is engineered to express a binding molecule, such as avidin or streptavidin, on its surface.
  • a binding molecule such as avidin or streptavidin
  • biotinylated molecules including, e.g., polypeptides, proteins, peptides, nucleic acids, polysaccharides, bacteria, viruses, small chemical or biological molecules, and other molecules as described herein, can be bound.
  • the spore serves as a carrier or delivery device.
  • the invention provides protein-based vaccine and immunomodulatory compositions comprising spores and spore systems expressing such binding molecules with immunomodulatory molecules or protein-based vaccines bound thereto for use in therapeutic or prophylactic applications.
  • the spores themselves can be used as an adjuvant for immunomodulatory molecules or vaccines (e.g., genetic vaccines, DNA vaccines, protein vaccines, attenuated or killed viral vaccines).
  • the spores can be modified or recombinant spores, non-modified or non-recombinant spores.
  • any such spores can be viable or non-viable.
  • an “adjuvant” is a compound that acts in a non-specific manner to augment specific immunity (e.g., an immune response) to an immunomodulatory molecule, such as, e.g., an immunogenic polypeptide or peptide or antigen, by stimulating an earlier, stronger or more prolonged response to an immunomodulatory molecule.
  • an immunomodulatory molecule such as, e.g., an immunogenic polypeptide or peptide or antigen
  • the Bt spore serves as an adjuvant, acting in a non ⁇ specific manner to enhance specific immunity to the immunomodulatory molecule or vaccine by stimulating an earlier, stronger or more prolonged response to the immunomodulatory molecule or vaccine.
  • the spores may comprise viable spores or non ⁇ viable or non-germinating spores.
  • the immunomodulatory molecule may comprise, e.g., an immunogenic protein, polypeptide, or peptide; or antigen or fragment thereof; a nucleic acid having immunomodulatory properties; or a nucleotide sequence encoding an immunomodulatory molecule; or the like.
  • the vaccine may comprise, e.g., a genetic vaccine, DNA vaccine, protein-vaccine, or attenuated or killed viral vaccine.
  • the enhanced immune response comprises an increased production of antibodies specific to the immunomodulatory protein, polypeptide, peptide or antigen that is readily measured by known assays, including those described herein (e.g., ELISA, etc.).
  • spores can be prepared that express other immunostimulatory molecules or other molecules involved in determining vaccine effectiveness, such as, e.g., cytokines (e.g., interleukins (IL), interferons (IFN), chemokines, hematopoietic growth factors, tumor necrosis factors and transforming growth factors), which are small molecular weight proteins that regulate maturation, activation, proliferation and differentiation of the cells of the immune system.
  • cytokines e.g., interleukins (IL), interferons (IFN), chemokines, hematopoietic growth factors, tumor necrosis factors and transforming growth factors
  • IL interleukins
  • IFN interferons
  • chemokines e.g., hematop
  • Cytokines suitable for use in the invention include IL-I, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-IO, IL-I l, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, GM-CSF, G-CSF, TNF-O, IFN-D, IFN-65 , and IL-20 (MDA-7). Antagonists of such cytokines can also be expressed on spores for use as therapeutic and/or prophylactic agents in immunomodulatory methods described herein.
  • Bt spores can be prepared that express co-stimulatory molecules that play a fundamental role in the regulation of immune responses.
  • a co-stimulatory molecule refers to a molecule that acts in association or conjunction with, or is involved with, a second molecule or with respect to an immune response in a co-stimulatory pathway.
  • a co-stimulatory molecule may be an immunomodulatory molecule that acts in association or conjunction with, or is involved with, another molecule to stimulate or enhance an immune response, hi another aspect, a co-stimulatory molecule is immunomodulatory molecule that acts in association or conjunction with, or is involved with, another molecule to inhibit or suppress an immune response.
  • a co-stimulatory molecule need not act simultaneously with or by the same mechanism as the second molecule.
  • Some such co-stimulatory molecules comprise co- stimulatory polypeptides that have positive co-stimulatory properties, such as the ability to stimulate or augment T cell activation and/or proliferation.
  • Membrane-bound co- stimulatory molecules include CDl, CD40, CD 154 (ligand for CD40), CD40 ligand, CD27, CD80 (B7-1), CD86 (B7-2) and CD150 (SLAM), and variants or mutants thereof. May such co-stimulatory molecules are typically expressed on lymphoid cells after activation via antigen recognition or through cell-cell interactions.
  • heterologous antigens, polypeptides, proteins, and peptides can be attached to the spore outer-coat by creating genetic fusions between outer-coat proteins and target antigens, polypeptides, proteins, or peptides.
  • target antigens polypeptides, proteins, or peptides.
  • coat proteins to attach and display proteins, polypeptides, or peptides, it is recognized that such proteins, polypeptides, or peptides may be displayed in a manner to stretch or torque such sequences, e.g., to expose internal domain surfaces or to change enzyme or antigenic activities.
  • the protein, polypeptide, or peptide of interest can be fused to one coat protein at the amino terminal, may be fused to a coat protein at the carboxyl terminal, may be fused to one coat protein at the amino terminal and a second coat protein at the carboxyl terminal, or may be internally fused to a coat protein.
  • the central protein, polypeptide, or peptide of interest will be stretched.
  • the invention also provides a spore system comprising one or more combinations of any one of the following components: nucleic acids, polypeptides, proteins, peptides, antigens, co-stimulatory agents, immunomodulatory molecules, adjuvants, cytokines, any of the biotinylated molecules bound to the spore surface via streptavidin or avidin as described above, or other molecules of interest.
  • Such components can be, e.g., displayed on, presented on, bound or attached to the spore surface, encapsulated or contained with the spore, associated with the spore, carried or held by the spore, or coated onto the spore surface.
  • Such combinations of multiple components and different components are especially useful in methods of modulating immune responses.
  • an antigen and co-stimulatory molecule or cytokine in conjunction with one another can augment the immunostimulatory response, since both types of molecules are integral to responses.
  • an adjuvant with an antigen and adjuvant can dramatically increase the immunostimulatory effectiveness of the antigen.
  • Spore systems can be made to comprise selected combinations of such molecules dependent upon the specific application and treatment protocol. Methods of modulating immune response in a subject by administering such spore systems or compositions thereof in an amount sufficient to modulate the response are also included.
  • proteins or polypeptides or peptides suitable for use in the present invention include full-length native proteins, partial proteins or protein fragments, or peptides or polypeptides or polypeptide fragments.
  • Proteins and polypeptides include suitable biologically active variants of native or naturally occurring proteins and can be fragments, analogues, and derivatives of such proteins.
  • Such biological activity may be any biological activity.
  • such biological activity may be insecticidal activity, or enzymatic activity, or it may be the ability to alter or modulate an immune response in a subject.
  • a polypeptide, protein, or peptide of the present invention may be an enzyme, such as, for example, lactase.
  • a polypeptide, protein, or peptide of the present invention is molecule capable of augmenting an immune response, such as, e.g., an antigen or an adjuvant.
  • polypeptide, protein, or peptide may be an insecticide.
  • Polypeptides, proteins, and peptides of interest include, but are not limited to, insecticidal protein toxins, cytokines, antigens, antibodies, binding receptors, defensive agents, anti-microbial agents, immunomodulatory molecules, co- stimulatory molecules, enzymes, and epitopes.
  • Suitable routes of administration or "delivery systems” include parenteral delivery and enteral delivery, such as, for example, oral, transdermal, transmucosal, intravenous, subcutaneous, intramuscular, intradermal, intraperitoneal, intracapsular, intraspinal, intrasternal, intrapulmonary, intranasal, vaginal, rectal, intraocular, and intrathecal, buccal (e.g., sublingual), respiratory, topical, ingestion, and local delivery, such as by aerosol or transdermally, and the like.
  • parenteral delivery and enteral delivery such as, for example, oral, transdermal, transmucosal, intravenous, subcutaneous, intramuscular, intradermal, intraperitoneal, intracapsular, intraspinal, intrasternal, intrapulmonary, intranasal, vaginal, rectal, intraocular, and intrathecal, buccal (e.g., sublingual), respiratory, topical, ingestion, and local delivery, such as by aerosol or transdermally
  • the methods comprise preparing and administering to a subject a composition comprising a spore system of the present invention.
  • a composition comprising a spore system of the present invention.
  • Such composition may include a carrier or excipient.
  • a polypeptide, protein, peptide, nucleic acid, or other molecule of interest is displayed on the surface of the spore.
  • the polypeptide, protein, or peptide of interest is expressed by the vegetative cells resulting from the germination and/or vegetative reproduction of a spore.
  • the spore displays a polypeptide, protein, or peptide with DNA binding capabilities that is bound to a DNA molecule encoding an antigen or immunomodulatory molecule or that is an antigen or immunomodulatory molecule.
  • Subject animals can also include wild animals.
  • subjects include American buffalo (bison), which often carry the disease brucellosis, which can infect humans and causes spontaneous abortions in cattle.
  • rabies vaccinations or therapeutic or prophylactic agents comprising spore systems of the invention are administered to a variety of wild animal populations in a particular area by distributing spores from an overflying plane.
  • the present invention provides a relatively inexpensive means for vaccinating or treating wild populations against a variety of illnesses and diseases.
  • Diseases and illnesses that are potential targets of this vaccination approach include all those described above, including, e.g., those caused by cholera (e.g., enterotoxins from V. cholerae), Japanese encephalitis, tick-borne encephalitis, Venezuelan Equine encephalitis, enterotoxins produced by Staphylococcus and Streptococcus species, and enterotoxigenic strains of E. coli (e.g., heat-labile toxin from E. coli), and salmonella toxin, shigella toxin and Campylobacter toxin, dengue fever, and hantavirus.
  • cholera e.g., enterotoxins from V. cholerae
  • Japanese encephalitis tick-borne encephalitis
  • Venezuelan Equine encephalitis enterotoxins produced by Staphylococcus and Streptococcus species
  • enterotoxigenic strains of E. coli e.g., heat-labile toxin from E.
  • Distribution of the vaccine or other prophylactic or therapeutic agent comprising a spore system of the invention to fish in the aquaculture or aquarium trades can be accomplished by injection or immersion techniques.
  • Immersion, or dipping is an inoculation or vaccination method well known to one of skill in the art (see e.g., Vinitnantharat et al. (1999) Adv. Vet. Med. 41:539-550).
  • a dip treatment involves dipping whole fish in a dilution of the inoculant or vaccine whereupon the inoculant or vaccine is absorbed by the gills.
  • Intraperitoneal injection is another vaccination method well known to one of skill in the art.
  • Injection involves anesthetizing and injecting the fish intraperitoneally (Vinitnantharat et al. (1999) Adv. Vet. Med. 41:539-550).
  • Diseases of cultivated fish that may be treated using a spore system of the invention include, but are not limited to, infectious pancreatic necrosis (IPN), infectious hematopoietic necrosis (IHN), Vibriosis (Vibrio anguillaruni), cold-water vibriosis (Vibrio salmonicida), Vibrio ordalii, winter ulcer (Vibrio viscosus), Vibrio wodanis, yersiniosis (Yersinia ruckeri) or Enteric Red Mouth, Bacterial Kidney Disease, Furunculosis (Aeromonas salmonicida subsp.
  • Fish species of interest include, but are not limited to, salmonids, including Rainbow Trout (Onchorhycus mykiss), salmon (Salmo salar), Coho salmon (Oncorhynchus kisutch), Steelhed (Oncorhynchus mykiss), rockfish (Sebastis schlegeli), catfish (Ictalurus punctatus), yellowtail, Pseudobagrus fulvidraco, Gilt-head Sea Bream, Red Drum, European Sea Bass fish, striped bass, white bass, yellow perch, whitefish, sturgeon, largemouth bass, Northern pike, walleye, black crappie, fathead minnows, and Golden Shiner minnows.
  • Invertebrates of interest include, but are not limited to, oysters, shrimp, crab, and lobsters.
  • pulmonary inhalation Delivery by pulmonary inhalation, nasal delivery, gill delivery, or respiratory delivery provides a promising route for absorption of polypeptides and other molecules of interest having poor oral bioavailability due to inefficient transport across the gastrointestinal epithelium or high levels of first-pass hepatic clearance.
  • nasal delivery is intended that the polypeptide is administered to the subject through the nose.
  • pulmonary inhalation is intended that the polypeptide or other substance of interest is administered to the subject through the airways in the nose or mouth so as to result in delivery of the polypeptide or other substance to the lung tissues and into the interior of the lung.
  • Both nasal delivery and pulmonary inhalation can result in delivery of the polypeptide or other substance to the lung tissues and into the interior of the lung, also referred to herein as "pulmonary delivery.”
  • pulmonary delivery is intended that the polypeptide or other substance is administered to the subject through the respiratory system of the subject so as to result in delivery of the polypeptide or other substance to the organs and tissues of the respiratory system of the subject organism.
  • the organs and tissues of the respiratory system of a subject organism include, but are not limited to, the lungs, nose, or gills.
  • compositions including those comprising spore systems, as an aqueous liquid aerosol, a nonaqueous suspension aerosol, or dry powder aerosol for pulmonary administration using these respective delivery devices can influence polypeptide stability, and hence bioavailability as well as biological activity following delivery. See Wall (1995) Drug Delivery 2:1-20; Krishnamurthy (March 1999) BioPharm., pp. 34-38).
  • the enhanced stability of the spore systems of the present invention is therefore of value in administration by respiratory delivery.
  • the Bt spore is between 1 and 1.5 uM in size which is the optimal size range for deep lung delivery, further enhancing its efficacy as a respiratory delivery vehicle.
  • nucleic acids sizes are given in either kilobases (kb) or base pairs (bp). These are estimates derived from agarose or acrylamide gel electrophoresis, from sequenced nucleic acids, or from published DNA sequences.
  • kb kilobases
  • bp base pairs
  • proteins sizes are given in kilodaltons (kDa) or amino acid residue numbers. Proteins sizes are estimated from gel electrophoresis, from mass spectroscopy, from sequenced proteins, from derived amino acid sequences, or from published protein sequences.
  • Oligonucleotides that are not commercially available can be chemically synthesized according to the solid phase phosphoramidite triester method first described by Beaucage & Caruthers, Tetrahedron Letts. 22:1859-1862 (1981), using an automated synthesizer, as described in Van Devanter et al., Nucleic Acids Res. 12:6159-6168 (1984).
  • sequence of the cloned genes and synthetic oligonucleotides can be verified after cloning using, e.g., the chain termination method for sequencing double-stranded templates of Wallace et al., Gene 16:21-26 (1981).
  • spore outer coat protein genes were isolated from Bt strain SDS-502 using the polymerase chain reaction (PCR). Primers were designed based on gene sequences published for Bacillus anthracis and Bacillus cereus. All primer pairs were used with genomic DNA as a template.
  • the primer pairs are shown as follows: cotYl-F: 5"- AGTTGTAACGAAAATAAACACC ⁇ SEQ ID NO:12> cotYl-R: 5'- TTAGATAGTAACGTCGCGTTAAGC ⁇ SEQ ID NO:13> amplified the spore coat protein Yl gene (cotYl), cotG-F: 5'- ATGAAACGTGATATTAGAAAAGC ⁇ SEQ ID NO:14> cotG-R: 5'- CTAGCAGTTACGTTTTTTATACC ⁇ SEQ ID NO:15> amplified the spore coat protein G gene (cotG), cotY2-F: 5'- ATGAGCTGCAATTGTAACGAAGACC ⁇ SEQ ID NO:16> cotY2-R: TTAAATAGAAACATCGCGTAAGC ⁇ SEQ ID NO:17> amplified the spore coat protein Y2 gene (cotYl), and cotE-F: 5' ATGTCCGAATTTAGAGAG
  • the polymerase chain reaction mixture contained: 10 ⁇ l 1OX buffer, 2 ⁇ l d-NTP, 2.5 ⁇ l Primer 1 (20 ⁇ M), 2.5 ⁇ l Primer 2 (20 ⁇ M), 2 ⁇ l Taq Polymerase, 1 ⁇ l template DNA (a genomic DNA preparation of Bt SDS-502) and 80 ⁇ l water.
  • the temperature cycling in the PCR was 96°C (30 sec.) 45°C (45 sec.) 72°C (1 min. 30 sec), for 30 cycles, with the exception of cotE, which was amplified using 40 cycles.
  • exsCL The exosporium gene, exsCL, was isolated from Bt strain SDS-502 using the polymerase chain reaction (PCR). Primers were designed based on a gene sequence published for Bacillus cereus. Primer pairs are as follows: PHN007 5'-TGTATGCATTTAACTCCGCTGG ⁇ SEQ ID NO:21> PHN008 5'- TTAAGCGATTTTTTCAATAATAATAG ⁇ SEQ ID NO:22>
  • the primer pairs were used with genomic DNA as a template to amplify the exosporium gene, exsCL.
  • the polymerase chain reaction mixture contained: 10 ⁇ l 1OX buffer, 2 ⁇ l d-NTP, 2.5 ⁇ l Primer 1 (20 ⁇ M), 2.5 ⁇ l Primer 2 (20 ⁇ M), 2 ⁇ l Taq Polymerase, 1 ⁇ l template DNA (a genomic DNA preparation of Bt SDS-502) and 80 ⁇ l water.
  • the temperature cycling in the PCR was 96°C (30 sec.) 45°C (45 sec.) 72°C (1 min. 30 sec), for 30 cycles.
  • a band of the anticipated size (approximately 387 bp) was identified by agarose gel electrophoresis and cloning was done with the TA Topo cloning kit (Clontech Inc.). DNA sequencing was performed on an ABI 3700 with the M13 forward and reverse universal primers. Sequence discrepancies were resolved by aligning complimentary sequences and viewing the chromatographs.
  • the cotG gene under the control of its own promoter is fused to a Bt insecticidal protein gene and expressed on the surface of Bt spores (see FIG. 2).
  • the host Bt strain is B. kurstaki, HD-I, a naturally occurring Bt strain used in commercial insecticides active against lepidopteran crop pests such as tomato horn worms.
  • the insecticidal protein gene, cry ICa is obtained from B. thuringiensis subspecies aizawai.
  • the Cry ICa protein is also active against lepidopteran pests, but is more active against beet armyworm, Spodoptera exigua, than any insecticidal proteins found in Bt strain HD- 1. Addition of the Cry ICa protein to Bt strain HD-I broadens the insecticidal range of the strain.
  • the expression cassette used in this example is shown in SEQ ID NO:23 (nucleotide) and SEQ ID NO:24 (peptide).
  • the expression cassette contains the cotG promoter, the spore outer coat protein gene cotG, and the cry ICa gene sequence. Translation of the sequence, SEQ ID NO:23, produces one large heterologous protein which is an in-frame fusion of CotG and Cry ICa. Use of the cotG promoter ensures expression of the heterologous protein during sporulation.
  • the expression cassette is cloned into an appropriate expression vector such as one reported by Sasaki et al., ⁇ Current Microbiol.
  • the recombinant strain is industrially fermented, formulated, and applied to vegetable crops to control a variety of lepidopteran pests.
  • the expression cassette that is cloned in the Sasaki expression vector is also introduced into the cry-minus (plasmid cured to eliminate insecticidal protein genes) Bt HD-I derivative called BT51, which is obtained from Dr. Shin-ichiro Asano, Hokkaido University ⁇ Current Microbiol. 1996, 32 195-200). While the spores ofBT51 show no insecticidal activity against S. exigua by diet-mixing assay, the recombinant spores containing this expression cassette exert insecticidal activity against S. exigua.
  • the Cry ⁇ Da protein gene from B. thuringiensis subsp. galleriae strain SDS-502 is toxic to scarabaeid insects (beetles).
  • the expression cassette contains a sporulation-specific promoter, and the cotE gene fused in frame to the cry8Da gene (FIG. 4 depicts the nucleotide and protein sequences of the expression cassette).
  • the expression cassette is cloned in an appropriate expression vector such as one reported by Sasaki et al., (Current Microbiol. 1996, 32 195-200) and transformed into Bt kurstaki HDl, a Bt strain with insecticidal activity against lepidopteran pests (such as moth larvae).
  • the resulting recombinant Bt strain is fermented industrially and formulated into an insecticidal product.
  • the cotYl Gene Fused to the N-Terminal Coding Region of the cry ICa Gene The naturally-occurring cry ICa gene is 3570 bp and encodes a 135 kDa Cry ICa protoxin (Nucleic Acids Res. 1988 July 11; 16 (13): 6240).
  • the CrylCa protein When the CrylCa protein is ingested by the insect, it is cleaved to an approximately 66 kDa toxin by proteases present in the insect midgut.
  • the cleavage site is comprised of the amino acids 621 through 638 which have the sequence 621-AESDLER-AQKAVNALFTS-638 ⁇ SEQ ID NO:25>.
  • the C-terminal sequence of the 66-kDa active toxin is 621 -AESDLER- 627 ⁇ SEQ ID NO:26>.
  • the expression cassette contains a Bt sporulation-specific promoter, the Bt cotYl gene, a linker sequence, and a portion of the cry ICa gene encoding only the active portion of the CrylCa protein.
  • a truncated cry ICa gene encoding only amino acids 1 though 627 is inserted into the expression cassette.
  • the cassette sequences are SEQ ID NO:26 (nucleotide) and SEQ ID NO:27 (peptide).
  • Figure 3 depicts the nucleotide and protein sequences of the expression cassette.
  • the linker design in this example includes several important features. First, it includes two restriction sites Ncol and Ndel that provide convenient cloning sites for insertion of the cry ICa gene and contain the ATG translation start sequence (FIG 6). Second, the linker is designed to encode the CrylCa proteolytic cleavage site, 624- DLER-AQKAV ⁇ ALFTS-638 ⁇ SEQ ID NO:28>. When spores with attached CrylCa heterologous proteins on their surface are ingested by a susceptible insect, the linker sequence ensures that the midgut proteases release the activated CrylCa from the spore effectively.
  • the nucleic acid sequence of the linker encoding the proteolytic cleavage site is carefully designed so it is not identical to the coding region at the cry ICa C-terminal encoding the last four amino acids DLER. This important feature prevents a recombination event between two identical DNA sequences that could remove the cry 1 CaI gene from the expression cassette.
  • the linker is further comprised of an epitope which has the amino acid sequence YPYDVPDYA ⁇ SEQ ID NO:29>. Commercial monoclonal antibodies are available that bind the epitope to allow tracking of the fusion protein.
  • the fusion protein produced is substantially smaller because the 65-kDa carboxyl end of the CrylCa protoxin is not included in the expression cassette.
  • the linker sequence serves as a flexible tether allowing proper folding of both the spore outer coat protein CotYl and the active portion of the CrylCa insecticidal protein. By acting as a tether there is also a reduction of the possibility of functional hindrance of the proteolytic cleavage site.
  • the immobilization of proteins (tethering) also adds stability to the proteins increasing the half life of the insecticide.
  • This expression cassette is cloned into an expression vector which is then transformed into B. kurstaki strain HD-I.
  • the resulting recombinant Bt strain is fermented industrially, formulated into a wettable powder insecticide, and sprayed onto the appropriate vegetable crops.
  • the recombinant Bt strain produces the Cry ICa protein attached to the spore during sporulation.
  • the recombinant Bt strain has two different crystal proteins attached to the surface of the spore. Both proteins attached to the spore have insecticidal activity against scarabaeidae larvae (beetles).
  • the cotG sporulation-specific promoter drives expression of the cotG gene operably linked to the cry 8Da gene from B. thuringiensis subsp. galleriae SDS-502, and the cotYl gene is operably linked to the cryhimel gene, a cry43Aa-like gene isolated by Dr. Shin-ichiro Asano, Hokkaido University, from Bacillus popilliae strain Hime.
  • Bacterial promoters often drive the expression of several genes at one time. In this example, a single promoter is used to direct the expression of two different insecticidal protein genes with the resulting gene products attached to the surface of the spore.
  • the expression cassette is cloned into the appropriate expression vector which is then transformed into Bt HD-73.
  • the Bt strain selected as the host strain for this plasmid is also capable of producing at least one endogenous insecticidal protein so that the resulting recombinant strain of Bt can produce at least three insecticidal toxins (one endogenous, two exogenous), each having a distinct insecticidal activity.
  • One strategy for design of the expression cassette utilizes the first 53 amino acids of the CotG protein (SEQ ID NO:4).
  • a linker is inserted between amino acid proline 53 and amino acid arginine 54, and the insecticidal protein is added to the 3' end of the linker.
  • the expression cassette encodes the first 53 amino acids of the Bt CotG protein, followed by the amino acids comprising the linker sequence including an insecticidal proteolytic site, the insecticidal protein, or the active portion of the insecticidal protein, and finally the remaining amino acids of the CotG protein, starting from the arginine at amino acid 54.
  • the heterologous protein produced from the expression cassette contains two proteolytic cleavage sites; one encoded by the linker, while the other is the naturally-occurring proteolytic cleavage site present in the insecticidal protein.
  • the heterologous protein produced from the expression cassette undergoes two cleavage events to release the active insecticidal toxin from the spore.
  • the exsCL gene under the control of a Bt exosporium gene promoter is fused to the insecticidal cry ICa gene from B. thuringiensis subsp. aizawai.
  • the host strain is Bt kurstaki, HD-I, a naturally occurring Bt strain used in commercial insecticides active against lepidopteran crop pests such as tomato horn worms.
  • the Cry ICa protein is also active against lepidopteran pests, but is more active against Spodoptera exigua than the toxins found in Bt strain HD-I. Addition of the Cry ICa protein to Bt strain HD-I broadens the insecticidal range of the strain.
  • the expression cassette used in this example is shown in SEQ ID NO: 16 (nucleotide).
  • the expression cassette contains a Bt promoter (which can be a sporulation- specific promoter), the exosporium gene exsCL, a DNA linker sequence, and the cry ICa gene sequence.
  • the sequence used in the expression cassette contains an exosporium gene promoter, the exsCL gene sequence, and the crylCa gene sequence (SEQ ID NO:30). Translation of the sequence SEQ ID NO:30 produces one large heterologous protein as shown in SEQ ID NO:31 which is an in-frame fusion of ExsCL and CrylCa. Use of a Bt exosporium gene promoter ensures expression of the heterologous protein during sporulation.
  • the Cry8Da protein gene from B. thuringiensis subsp. galleriae strain SDS-502 is toxic to scarabaeid insects (beetles).
  • the expression cassette contains a sporulation-specific promoter, and the exsCL gene fused in frame to the c?y8Da gene.
  • the expression cassette is cloned in an appropriate expression vector and transformed into Bt kurstaki HDl, a Bt stain with insecticidal activity against lepidopteran pests (such as moth larvae).
  • the resulting recombinant Bt strain is fermented industrially and formulated into an insecticidal product.
  • Example 5 showed the toxic region of Cry ICa fused to CotG protein with certain linkers that allow easy processing in the insect gut to liberate the toxic protein (see FIG. 5 for the nucleotide and protein sequences of the cassette).
  • a similar construct is made with ExsCL as shown in SEQ ID NO:32 (nucleotide) and SEQ ID NO:33 (peptide). The junction sequence is shown in FIG 7.
  • the recombinant Bt strain has two different crystal proteins attached to the exosporium. Both of the attached proteins have insecticidal activity against scarabaeidae larvae (beetles).
  • Bacterial promoters often drive the expression of several genes at one time. In this example, a single promoter is used to direct the expression of two different insecticidal proteins to the exosporium.
  • the sporulation- specific promoter drives expression of the exsCL gene operably linked to the cr ⁇ 8Dal gene from Bacillus thuringiensis subsp. galleriae SDS-502, and cryhimel, a gene isolated from Bacillus popilliae var. popilliae Hime, cry 43 A.
  • a fungal lipase of Penicillium expanswn (GenBank Accession No. AAK07480) is fused to the first 53 amino acid residues of the N-terminal end of CotG via a flexible linker and expressed on the surface of Bt spores.
  • the lipase protein sequence is back- translated using a Bt codon usage table provided by Vector NTI.
  • the back-translated lipase nucleotide sequence is linked to the N-terminal portion of the native cotG protein gene via a linker that provides the protein structural flexibility.
  • the nucleotide sequence coding for the entire CotG-Lipase fusion protein is synthesized with Apal and Ban ⁇ Rl cloning sites at the 5' and 3' ends as shown in SEQ ID NO:34. This nucleotide is then cloned in the Sasaki vector as described in Example 3, supra, between Apal and Bam ⁇ I.
  • the synthesized nucleotide contains the cotG promoter and the vector provides the transcription terminator between BamR ⁇ and Notl.
  • the vector containing the fusion gene is introduced to Bt cry-minus strain BT51 by electroporation.
  • the BT51 spore expresses the fusion protein as shown in SEQ ID NO:35.
  • Recombinant spore lipase activity on soybean lipid is detected by Rhodamine B.
  • the lipase on the spore hydrolyzes triacylglycerol in soybean oil to release free fatty acids which produce fluorescence with Rhodamine B. No fluorescence is observed with the native spores.
  • the recombinant Bt (BT51) spores expressing the cry ICa gene described in Example 3, supra, are injected into rabbits without any adjuvant. About 0.5 ml spore-in- water suspension containing about 10 billion spores are injected subcutaneously on the shoulder of each rabbit every one week for 4 weeks. One week after the final injection, serum is collected and the immuno-reactivity against Cry ICa is tested by Western Blot. One ng of Cry ICa band on the blot is detectable with 1/1000 diluted serum. No immuno- reaction is found with the serum collected from rabbits treated with non-recombinant BT51 spores.
  • Example 14 Affinity Purification:
  • the antibody is purified from the antiserum produced against the Bt spore expressing the Bt cry ICa gene as described in Example 13, supra, using the spores as immobilized affinity purification matrix.
  • 20 ml antiserum that has been prepared by centrifuging approx. 40 ml blood collected from an immunized rabbit 20 ml of the Bt spores suspended in water at the concentration of 10 billion spores per 1 ml are added. The mixture is incubated at room temperature for 30 min with gentle shaking and the spores are removed by centrifugation.
  • the spores precipitated as a pellet are washed with 40 ml 0.5 M NaCl + 10 mM Tris-HCl, buffer, pH 8, by repeating centrifugation three times and with water once.
  • the washed spores are then suspended in 20 ml of water and chilled on ice, and NaOH is added to a final concentration of 0.05N.
  • the resulting high pH releases the antibody bound to the spores.
  • the spores are removed by centrifugation at 2 0 C and the pH of the supernatant that contains the antibody is lowered to pH 7.5 with 20 mM Tris-HCl buffer, pH 7.5 and HCl.
  • the affinity purified antibody is diluted to 1/1000 with PBS and is shown to be functional by Western blot as described in Example 13, supra. Purity of the affinity purified antibody is tested by SDS-PAGE which shows a single band at the size of immunoglobulin.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Pest Control & Pesticides (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Agronomy & Crop Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Dentistry (AREA)
  • Wood Science & Technology (AREA)
  • Environmental Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

The invention provides isolated nucleic acid and amino acid sequences for Bacillus thuringiensis (Bt) spore outer coat protein and exosporium protein genes fusion proteins containing such proteins. The invention further includes methods for using the genes to construct expression cassettes, expression vectors, and recombinant Bt strains that have exogenous proteins attached to their spores. The exogenous proteins attached to the surface of recombinant Bt spores may provide insecticidal, enzymatic, or antigenic activity. The invention also provides for compositions made from the recombinant Bt strains and methods for fermenting and using the recombinant Bt strains produced by the invention.

Description

METHODS FOR MAKING AND USING RECOMBINANT BACILLUS THURINGIENSIS SPORES
CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. provisional application no. 60/588,982 filed on July 20, 2004 and U.S. provisional application no. 60/591,142 filed on July 27, 2004, which are hereby incorporated by reference in their entirety.
FIELD OF THE INVENTION
The present invention relates to spore coat genes and proteins and exosporium genes and proteins from Bacillus thuringiensis and particularly to methods for making and using recombinant Bacillus thuringiensis spores.
BACKGROUND OF THE INVENTION
BacillusJhuringiensis was first discovered in Japan in 1901 by Ishawata and then in 1911 in Germany by Berliner. A widely used biopesticide, it was first applied as a commercial insecticide in France in 1938, and then in the USA in the 1950s. These early products were replaced by more effective ones in the 1960s, when various highly pathogenic strains were discovered with specific activity against different types of insects. Thereafter, thousands of strains of B. thuringiensis were subsequently found to exist.
Bacillus thuringiensis (or "Bt") is a sporulating soil bacterium that produces insecticidal proteins during sporulation. The vegetative cells contain endospores and crystals of an insecticidal protein toxin (these crystal insecticidal toxins are also known as "delta-endotoxin") which usually have a bipyramidal shape. When Bt is grown in industrial fermentors, most cells lyse and release the endospores and toxin crystals. The material is then harvested and formulated into the biopesticide product. These commercial Bt products are powders containing a mixture of dried spores and toxin crystals. They are applied to leaves, plants, shrubs or other environments in which the insect larvae feed. Bt-based insecticides are formulated and marketed worldwide for control of many important plant pests - mainly caterpillars of the Lepidoptera family (i.e., butterflies and moths) but also mosquito larvae, and simuliid blackflies that vector river blindness in Africa. Currently, Bt products represent about 1% of the total "agrochemical" market (i.e., fungicides, herbicides and insecticides) across the world.
Although insecticide formulations based on Bt are widely used, these products have a number of problems. For example, the typical Bt insecticide product is composed of one strain of Bt, which is limited in its insecticidal activity because naturally-occurring Bt strains generally are active against a few insect species. Therefore, activity against a broad array of insecticidal pests cannot be achieved with current Bt-based insecticide products. This is exemplified by the Bt insecticidal protein toxin called Cry ICa, which is a major component of a widely-used commercial Bt insecticide. The Cryl Ca protein toxin has no activity against scarab beetles, which are common and destructive pests to a number of crops. On the other hand, another Bt insecticidal protein called Cry8Da has strong activity against scarab beetles but no activity against beet armyworm, Spodoptera exigua, another common and destructive crop pest. Therefore, in order to control multiple insect pests, current Bt-based technologies require the application of several strains of Bt, each specific to one, or at best a few, insect types. This is costly since considerable amounts of biopesticides are required to be applied to achieve the desired effect.
The present invention overcomes the limitations of currently-existing Bt-based insecticide products by providing recombinant Bt strains that have insecticidal activity against a variety of different insect pests. The methods, for example, allow the skilled artisan to make Bt-based insecticides that control both scarab beetles, such as the Japanese beetle, and the beet armyworm. This would widely benefit producers and caretakers of crops and other plant-based products such as turf grass by providing more effective biopesticides than the currently available Bt formulations. Moreover, by having the ability to apply just one Bt strain having insecticidal activity on multiple insect pests, significant cost savings can be achieved. This would also benefit the environment as less quantities of biopesticide would be applied to crops or other plant-based resources such as turf grass. One example of a recombinant Bt strain that can be produced by the methods of the present invention is one containing the beet armyworm-active CrylCa protein gene, which can be expressed on the surface of the spore of a Bt strain called SDS-502, which contains an endogenous insecticide crystal protein toxin active against the Japanese beetle.
Another advantage the present invention provides is the rapidity of insectidal activity. Current Bt products are formulated to contain a mixture of spores and isolated crystalline protein toxin. Although the crystalline protein toxin is effective, the spores themselves are slow to act as they must germinate in the gut of the insect, lyse the gut lining, and multiply in the blood to become effective at killing the insect. The recombinant Bt spores of the present invention overcome this limitation by expressing an exogenous insecticide protein toxin on there surface, thereby producing a rapid and lethal response.
SUMMARY OF THE INVENTION
The present invention provides methods for making recombinant Bt strains having exogenous proteins attached to the outer coats of their spores or to their exosporia component found to be a part of the spore or exosporium, not non-spore or exosporium origin like Bt insecticidal protein. Although recombinant spores have been constructed in Bacillus subtilis, the method of producing Bt spores having exogenous proteins linked to their outer coats or exosporia has not been reported in Bt. Until now, it was not possible to practice this method in Bt because none of the spore coat genes or exosporia genes were isolated and sequenced. In the present invention, we cloned and sequenced four novel spore coat protein genes and one novel exosporium protein gene from a strain of B. thuringiensis subspecies gallariae. These genes are used to express exogenous proteins on the Bt spore. The spore coat gene or exosporium gene fused to an exogenous gene produces a heterologous protein wherein the spore coat protein or the exosporium protein and the exogenous protein are functionally and operationally linked. When the Bt strain sporulates, the heterologous protein is incorporated into the Bt spore coat or exosporium. The invention also comprises methods for using compositions made from the resulting recombinant Bt strains expressing one or more exogenous genes on the Bt spore coat or exosporium.
In one embodiment, the exogenous protein attached to the Bt spore or exosporium is an insecticidal protein toxin. There may be more than one insecticidal protein toxins so attached. Many Bt strains produce one or more endogenous insecticidal protein toxins. These often form heterogenous crystal structures within the cell. However, the expression of one or more exogenous protein toxins on the outer coat or exosporium of the Bt spore confers significantly improved insecticidal activity than current Bt insecticides. For example, an additional insecticide incorporated onto the surface of the spore can provide a substantial increase in the amount of protein insecticide toxin produced by each Bt cell. Additionally, the expression of an exogenous insecticidal protein toxin on the outer coat or exosporium of Bt spores confers a broadening of the insecticidal range. By producing more endogenous insecticidal protein toxin, for example, by expressing endogenous Bt protein toxin on the outer coat or exosporium of the Bt spore, improved biopesticide efficiency can be achieved This is because the resulting recombinant Bt strain continues to produce endogenous insecticidal toxins that are contained within the spore, and additionally, produces one or more exogenous insecticidal proteins attached to the spore outer coat or exosporium. Exogenous insecticidal proteins may be derived from one or more endogenous Bt insecticidal protein toxins or from insecticidal proteins found in other Bacillus strains, including those that are listed, infra. The exogenous insecticidal protein however is not limited to those derived from Bacillui strains but also may be obtained from non-Bacillui sources, the important point being the ability of the exogenous protein to kill a desired insect. Thus, the invention contemplates the use of any insecticidal protein toxin capable of being expressed on the outer coat or exosporium of Bt spores. So, for example, the methods of the present invention allow for the expression of one or more insecticidal protein toxins on the surface of the Bt spore, in which the one or more protein toxins may include an endogenous protein toxin from the host strain, an endogenous protein toxin from a non- host Bt strain, or a protein toxin from a non-Bacillus strain. Any combinations are contemplated and may be incorporated into the Bt host strain as needed to target specific insect pests.
Additional benefits may be realized from attachment of one or more insecticidal protein toxins to the surface of the Bt spore. Although isolated insecticidal crystal protein toxins are inactivated by ultra violet light and therefore have a limited duration of activity when sprayed onto crops or other plant resources, spores are resistant to ultra violet light and may provide protection for the associated insecticidal protein toxin displayed on the surface. Assembly of the insecticidal toxin on the spore may also increase the toxin stability since immobilized proteins often have greater stability. The close association of the insecticidal protein toxin with the spore i.e., by its display on the surface of the spore, will also enhance the effectiveness of the product. The toxin will inhibit insect feeding and the associated spore, when ingested by the target insect, will germinate, causing insect death. In another embodiment of the present invention, the exogenous protein attached to the surface of the Bt spore may be an enzyme. More than one enzyme may be so attached. Much like the advantages for insecticidal protein toxins described, supra, the surface of the Bt spore can provide physical protection for enzymes so they can persist longer in the environment. Enzymes attached to the surface of the spore may be used for a variety of applications including production of useful compounds by enzymatic reaction and environmental cleanup. Enzymes so attached can be useful in bioremediation including degradation of chemical pesticides, herbicides, or clean up of industrial pollutants such as PCB.
In yet another embodiment of the present invention, the recombinant Bt spores can act as antigen-delivery vehicles. The exogenous protein attached to the surface of the Bt spore can be an antigen that produces immunity in higher animals, including but not limited to farm animals such as cattle, chicken, or fish.
Another embodiement of the present invention includes nucleic acid constructs that include a copy of a first nucleic acid molecule encoding a first peptide derived from a Bacillus thuringiensis spore coat protein or an exosporium protein that when expressed targets to the Bacillus thuringiensis spore coat or exosporium which is operably linked to a second nucleic acid molecule encoding a second peptide. In preferred embodiments, the first peptide has substantial identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, and SEQ ID NO: 10, more preferably, at least 60% identity, more preferably at least 70% identity, more preferably at least 75% identity, more preferably at least 80% identity, more preferably at least 85% identity, more preferably at least 90% identity, more preferably at least 93% identity, more preferably at least 95% identity, more preferably at least 97% identity, more preferably at least 98% identity, and even more preferably at least 99% identity. In certain variations, the operable linkage between the first and second peptide includes a linker peptide.
Preferrably, the second peptide is a therapeutic peptide, a diagnostic peptide, an insecticidal peptide, a vaccine peptide, or an industrial enzyme peptide.
In regards to diagnostic peptides, by fusing specific binding domains such as antibody variable domains to the anchor and signal transduction domains of germination receptors in Bacillus thuringiensis the spore may respond as a receptor to the presence of the specific molecule or organism by germinating. The actual detection would generally be accomplished by one of three ways. The first is direct observation of the spores after exposure to the sample. The exposure could be in either liquid or on a Petri dish. If the spores initiate germination the molecule or organism is present in the sample.
The second way is to mix the spores and the sample in question and then plate the mixture on a Petri dish containing LB agar and selective antibiotics. If colonies become visible on the plate in 8 to 10 hours then that sample contains the target of the detection system.
The third way would use the additional modification of the detector recombinant spore to contain any one of several enzymes glucoronidase, beta-galactosideas, thrombin, or naturally occurring GRP. These enzymes would be stored in the core of the spore by linking to Small Acid Soluble Proteins (SASPs) that are specifically delivered and bind the DNA that represents the bacterial genome. During the germination process the integrity of the spore is compromised as the nascent vegetative cells erupts from the spore. During this process the beta-galactosidase and/or glucoronidase will be released and in the presence of the proper substrate generate a blue color. Other fusion proteins can be considered for placement in different compartments of the spore to facilitate specific detector types. It should be possible to assemble the detector enzyme into the inner coat or the cortex of the spore as well as the core.
The first method had the benefit of being very rapid since germination is generally initiated in less than two minutes and the spore characteristics clearly change from phase bright to phase dark when viewed with a phase contrast microscope. This method generally requires use of a phase contrast microscope.
The benefit of the second method is that one needs only a Petri dish with Luria Broth and selective antibiotic to complete the assay. This is minimal technology and is generally cheaper and easier to maintain then a phase contrast microscope. The selective antibiotics that will be used will not interfere with germination since the recombinant spore will have the needed resistance genes. The antibiotics will ensure that only the Bacillus thuringiensis will be able to grow on the plate greatly reducing the likelihood of false positives.
The benefits of the third option are manifold. There is need for little else but a sample that needs testing, and a solution that is mixed with that sample that contains the recombinant detector spores and the substrate. Should the spores germinate in response to a specific signal, an enzyme can be released and a blue color or fluorescence is generated. If the signal and response is weak a spectrophotometer can be used to detect enzymatic reaction, if the response is strong than the change is easily seen by eye. The most significant difference between weak and strong responses is the amount of time before the color can be detected by eye. Such enzymes are generally stable and will react over a long period of time (24 hours) thus even a weak signal will become detectable by eye over a period of time. The spectrophotometer is a simple, small and stable tool that can be reduced in size so that rapid assays determinations can be completed in the field with a small hand held unit.
Another approach to colorimetric detection is envisioned where a specific endoprotease such as thrombin is stored in the core of the spore similar in method to beta- galactosidase or the use of a specific endopetidase that is naturally present in the spore called GRP. GPR has a specific penta-residue binding site where cleavage of a protein would be made. When germination takes place these proteases would be activated and then released. The released protease would cleave a fusion protein to produce active green fluorescent protein or react with another substrate in the incubation media to produce a visible color. The benefit of activating green fluorescent protein is in the sensitivity of the assay since this type of assay is typically 1000 times as sensitive as simple colorimetric assays.
The method of producing these detector spores generally occurs in three steps. First the native and natural germination receptors need to be mutated to inactivity. This will be accomplished by gene-replacement double recombination with active antibiotic resistance genes replacing the germination receptors. At this time continued gene replacement could be completed to place in the genome the specific enzymes required for either colorimetric or fluorescent assay activity. In some circumstance, fusion proteins of enzymes with the SASP gene sequences can be utilized to ensure that the reactive enzyme is sequestered in the core of the spore until germination. These are the basic strains that will generally not germinate naturally, have the capacity to produce a measurable response in the assay format and can be kept viable in vegetative cell form.
The second step is generally acquiring or producing specific receptor molecules that can be fused to the receptor region of the knock-out germination genes. The signal that activates the signal transduction pathway that leads to germination should continue to be active in the fusion proteins. A variety of molecular binding motifs including specific DNA sequences, proteins, viruses, bacteria and small molecules can be utilized. The third step is generally a second round of double recombination that will insert the fusion receptor molecules back into the bacillus genome and insert the resulting fusion proteins into the recombinant spore. Since there are more germination genes than there are needed antibiotic markers, the second round of double recombination will generally replace inactivated germination receptors that do not contain antibiotic resistance genes.
Preferred examples of insecticidal peptides include CrylAal, CrylAa2, CrylAa3, CrylAa4, CrylAa5, CrylAaβ, CrylAa7, CrylAaδ, CrylAa9, CrylAalO, CrylAal 1, CrylAal2, CrylAal3, CrylAal4, CrylAbl, CrylAb2, CrylAb3, CrylAb4, CrylAb5, CrylAbό, CrylAb7, CrylAbδ, CrylAb9, CrylAblO, CrylAbl 1, CrylAbl2, CrylAbl3, CrylAbl4, CrylAbl5, CrylAblό, OyI AcI, CrylAc2, CrylAc3, CrylAc4, CrylAc5, CrylAcβ, CrylAc7, CrylAc8, CrylAc9, CrylAclO, CrylAcll, CrylAcl2, CrylAcl3, CrylAcl4, CrylAcl5, OyI AdI, CrylAd2, OyI AeI, OyI AfI, OyIAgI, CrylAhl, CrylAil, CrylBal, CrylBa2, CrylBa3, CrylBa4, CrylBbl, CrylBcl, CrylBdl, CrylBd2, CrylBel, CrylBe2, CrylBfl, CrylBf2, CrylBgl, OylCal, CrylCa2, CrylCa3, CrylCa4, CrylCa5, CrylCaβ, CrylCa7, CrylCa8, CrylCa9, CrylCalO, CrylCbl, CrylCb2, CrylDal, CrylDa2, CrylDbl, CrylDb2, OyIEaI, CrylEa2, CrylEa3, CrylEa4, CrylEa5, CrylEaβ, OyIEbI, CrylFal, CrylFa2, CrylFbl, CrylFb2, CrylFb3, CrylFb4, CrylFb5, OyIGaI, CrylGa2, CrylGbl, CrylGb2, CrylGc, CrylHal, OyIHbI, Cryllal, Crylla2, Crylla3, Crylla4, Crylla5, Cryllaβ, Crylla7, Cryllaδ, Crylla9, OyllalO, OyIIaIl, Cryllbl, Cryllcl, Cryllc2, Crylldl, Cryllel, Cryllfl, OyI JaI, CrylJbl, OyI JcI, CrylJc2, OyUdI, CrylKal, Oy2Aal, Cry2Aa2, Cry2Aa3, Cry2Aa4, Cry2Aa5, Cry2Aa6, Cry2Aa7, Cry2Aa8, Cry2Aa9, Cry2AalO, Oy2Aall, Cry2Abl, Cry2Ab2, Cry2Ab3, Cry2Ab4, Cry2Ab5, Cry2Ab6, Cry2Acl, Cry2Ac2, Cry2Ac3, Cry2Adl, Oy2Ael, Cry3Aal, Cry3Aa2, Cry3Aa3, Cry3Aa4, Cry3Aa5, Cry3Aa6, Cry3Aa7, Oy3Bal, Cry3Ba25 Cry3Bbl, Cry3Bb2, Cry3Bb3, Cry3Cal, Cry4Aal, Cry4Aa2, Cry4Aa3, Cry4Bal, Cry4Ba2, Cry4Ba3, Cry4Ba4, Cry4Ba5, Cry5Aal, Cry5Abl, Cry5Acl, Cry5Bal, CryβAal, Cry6Aa2, CryόBal, Cry7Aal, Cry7Abl, Cry7Ab2, Cry8Aal, OyβBal, OyδBbl, Oy8Bcl, Cry8Cal, Cry8Ca2, CryδDal, Cry8Da2, Cry8Da3, CryδEal, Cry9Aal, Cry9Aa2, Oy9Bal, Cry9Cal, Cry9Ca2, Cry9Dal, Cry9Da2, Cry9Eal, Cry9Ea2, Oy9Ebl, Cry9Ecl, OylOAal, CrylOAa2, CrylOAa3, OyI IAaI, Cryl lAa2, CryllAa3, CryllBal, CryllBbl, Cryl2Aal, Oyl3Aal, Oyl4Aal, Cryl5Aal, CrylβAal, Cryl7Aal, CrylδAal, Cryl8Bal, CrylδCal, Cry 19AaI, Cryl9Bal, Cry20Aal, Cry21Aal, Cry21Aa2, Cry21Bal, Cry22Aal, Cry22Aa2, Cry22Abl, Cry22Ab2, Cry22Bal, Cry23Aal, Cry24Aal, Cry25Aal, Cry26Aal, Cry27Aal, Cry28Aal, Cry28Aa2, Cry29Aal, Cry30Aal, Cry30Bal, , Cry31Aal, Cry31Aa2, Cry32Aal, Cry32Bal, Cry32Cal, Cry32Dal, Cry33Aal, Cry34Aal, Cry34Aa2, Cry34Abl, Cry34Acl, Cry34Ac2, Cry34Bal, Cry35Aal, Cry35Aa2, Cry35Abl, Cry35Ab2, Cry35Acl, Cry35Bal, Cry36Aal, Cry37Aal, Cry38Aal, Cry39Aal, Cry40Aal, Cry40Bal, Cry41Aal, Cry41Abl, Cry42Aal, Cry43Aal, Cry43Bal, Cry44Aa, Cry45Aa, Cry46Aa, Cry47Aa, CytlAal, CytlAa2, CytlAa3, CytlAa4, CytlAa5, CytlAbl, CytlBal, Cyt2Aal, Cyt2Aa2, Cyt2Bal, Cyt2Ba2, Cyt2Ba3, Cyt2Ba4, Cyt2Ba5, Cyt2Ba6, Cyt2Ba7, Cyt2Ba8, Cyt2Ba9, Cyt2Bbl, Cyt2Bcl, Cyt2Cal, Vip3A(a) and Vip3A(b). Preferred examples of industrial enzymes include glucose oxidase, galactosidase, glucosidase, nitrilase, alkene monooxygenase, hydroxylase, aldehyde reductase, alcohol dehydrogenase, D-hydantoinase, D-carbamoylase, L- hydantoinase, L-decarbamoylase, beta-tyrosinase, dioxygenase, serine hydroxy- methyltransferase, carbonyl reductase, nitrile hydratase, o-phthalyl amidase, halohydrin hydrogen-halide lyase, maltooligosyl trehalose synthase, maltooligosyl trehalose trehalohydrolase, lactonase, oxygenase, adenosylmethionine synthetase, cephalosporinase, fucosidase, adenosylhomocysteine hydrolase, peroxidase, nucleoside phosphorylase, hemicellulase, cyclodextrin glycosyltransferase, oxidase, endoglucanase, polygalacturonase, amylase, glutamyl endopeptidase, xylanase, laccase, phenol oxidase, cellulase, lactate oxidase, neuraminidase, ribonuclease, lipase, esterase, aldolase, oxynitrilase, lyase, protease, acylase, glucose isomerase, amidase, phosphotransferase, kinase, dephosphorylase, phosphatase, epoxide hydrolase, P450 monooxygenase, toluene monooxygenase, methane monooxygenase, and other enzymes. Preferred examples of vaccine peptides include antigenic peptides from the vectors for diseases including Marek disease, (MDV) Herpes Virus; Infectious bronchitis disease: (IBV); Infectious Larygotracheitis, (ILV) Herpes Virus; Infectious Bursal Disease, (IBV) Birna Virus; Newcastle Disease: (ND); Encephalomyelitis; Fowl Pox; Reovirus; Avian Flu, strain N5H1 flu; Mycoplasma; Cholera; and Coccidia, Eimeria and Isospora. Preferred examples of therapeutic peptides include cancer antigens which can include bullous pemphigoid antigen 2, prostate mucin antigen (PMA), tumor associated Thomsen- Friedenreich antigen, prostate-specific antigen (PSA), EpCam/KSA antigen, luminal epithelial antigen (LEA.135) of breast carcinoma and bladder transitional cell carcinoma (TCC), cancer-associated serum antigen (CASA) and cancer antigen 125 (CA 125), the epithelial glycoprotein 40 (EGP40), squamous cell carcinoma antigen (SCC), cathepsin E, tyrosinase in melanoma, cell nuclear antigen (PCNA) of cerebral cavernomas, DF3/MUC1 breast cancer antigen, carcinoembryonic antigen, tumor-associated antigen CA 19-9, human melanoma antigens MART-l/Melan-A27-35 and gplOO, the T and Tn pancarcinoma (CA) glycopeptide epitopes, a 35 kD tumor-associated autoantigen in papillary thyroid carcinoma, KH-I adenocarcinoma antigen, the A60 mycobacterial antigen, heat shock proteins (HSPs), MAGE, tyrosinase, melan-A and gp75 and mutant oncogene products such as p53, ras, and HER-2/neu. Additional examples of peptides may be found in the detailed description of the preferred embodiments.
In certain variations, the first and second nucleic acids are operably linked to a promoter operable in the target host cell. Preferred examples of promoters for Bacillis are bclA, dal, exsB, exsC, exsCL, exsD, exsE, exsF, exsG, exsH, exsl, exsJ, exsY, cotA, cotB, cotC, cotD, cotE, cotF, cotG, cotN, cotS, cotT, cotV, cotW, cotX, cotY, and cotZ.
Yet another aspect of the present invention includes a host cell comprising a nucleic acid construct in any of the above mentioned variations. In some variations, the host cell is an expression system for producing the fusion protein. In certain variations, the host cell may be a bacterial, yeast, insect, fish or mammalian cell, which more preferably may be used as an expression system for the fusion protein. Preferred examples of host cells include any subspecies of Bacillus thuringiensis including Bacillus thuringiensis subsp. aizawai, Bacillus thuringiensis subsp. galleriae, Bacillus thuringiensis subsp. entomocidus, Bacillus thuringiensis subsp. tenebrionis, Bacillus thuringiensis subsp. thuringiensis, Bacillus thuringiensis subsp. alesti, Bacillus thuringiensis subsp. canadiensis, Bacillus thuringiensis subsp. darmstadiensis, Bacillus thuringiensis subsp. dendrolimus, Bacillus thuringiensis subsp. βnitimus, Bacillus thuringiensis subsp. kenyae, Bacillus thuringiensis subsp. morrisoni, Bacillus thuringiensis subsp. subtoxicus, Bacillus thuringiensis subsp. toumanoffi, Bacillus thuringiensis subsp. pondicheriensis, Bacillus thuringiensis subsp. shandogiensis, Bacillus thuringiensis subsp. sotto, Bacillus thuringiensis subsp. nigeriae, Bacillus thuringiensis subsp. yunnanensis, Bacillus thuringiensis subsp. dakota, Bacillus thuringiensis subsp. indiana, Bacillus thuringiensis subsp. tohokuensis, Bacillus thuringiensis subsp. kumamotoensis, Bacillus thuringiensis subsp. tochigiensis, Bacillus thuringiensis subsp. thompsoni, Bacillus thuringiensis subsp. wuhanensis, Bacillus thuringiensis subsp. kyushuensis, Bacillus thuringiensis subsp. ostriniae, Bacillus thuringiensis subsp. tolworthi, Bacillus thuringiensis subsp. pakistani, Bacillus thuringiensis subsp. japonensis, Bacillus thuringiensis subsp. colmeri, Bacillus thuringiensis subsp. pondicheriensis, Bacillus thuringiensis subsp. shandongiensis, Bacillus thuringiensis subsp. neoleonensis, Bacillus thuringiensis subsp. coreanensis, Bacillus thuringiensis subsp. silo, Bacillus thuringiensis subsp. mexcanensis, Bacillus thuringiensis subsp. israelensis, Bacillus thuringiensis subsp. berliner, Bacillus thuringiensis subsp. cameroun, Bacillus thuringiensis subsp. ongbei, Bacillus thuringiensis subsp. fukuokaensis, Bacillus thuringiensis subsp. higo, Bacillus thuringiensis subsp. israelensis, Bacillus thuringiensis subsp. japonensis Buibui, Bacillus thuringiensis subsp. jegathesan, Bacillus thuringiensis subsp. kenyae, Bacillus thuringiensis subsp. kunthala, Bacillus thuringiensis subsp. medellin, Bacillus thuringiensis subsp. roskildiensis, Bacillus thuringiensis subsp. san diego, Bacillus thuringiensis subsp. shanghai, Bacillus thuringiensis subsp. sotto, Bacillus thuringiensis subsp. tenebrionis, and Bacillus thuringiensis subsp. thompsoni. In certain variations, the first nucleic acide is endogenous and the second nucleic acid is exogenous.
Yet another aspect of the present invention includes fusion proteins expressed from any of the above nucleic acid constructs in all the variations discussed. In preferred embodiments, the fusion protein is part of a pharmaceutical composition that includes a pharmaceutically acceptable carrier.
In another aspect of the present invention, any of the fusion proteins and pharmaceutical compositions may be used in therapeutic methods whereby therapeutically effective doses of the fusion protein or pharmaceutical compositions may be administered to a subject in need of treatment or at risk of a disorder. Preferred methods of administion includy oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, or intranasal.
Still another embodiment of the present invention includes methods of screening the fusion proteins of the present invention for a desired activity. An example of such a screening method is providing a nucleic acid constructs as described above where the second nucleic acid molecules is selected based upon likelihood of having the desired activity and determining whether of the fusion protein has the desired activity. In certain embodiments, the desired activity is pesticidal for which preferred second peptides are insecticidal peptides. In other embodiments, the desired activity is vaccination for which the preferred second peptides are derived from the pathogen or cancer to be vaccinated against.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1 depicts the cotG promoter linked to the aprE upstream mRNA stabilizing region +1-59 of the aprE transcribed region which gives very high mRNA stability and very high levels of expression (from Bacillus subtilis). cotG from Bt in upper case, aprE leader sequence in lower case.
FIGURE 2 is the expression cassette sequence for Example 2.
FIGURE 3 depicts an expression cassette DNA and protein sequence showing a multifunctional linker. The spore coat protein is cotYl and is fused to 628 amino acids of the N-terminal coding region of the insecticidal protein gene Cry ICa. Amino acids 1 through 628 of the Cry 1 CaI protein comprise the active portion of the toxin after cleavage by insect midgut proteases. The linker contains restriction sites for in-frame cloning, a nine amino acid epitope for antibody detection (bold), and a proteolytic cleavage site to ensure that the Cry 1 CaI protein is released from the spore after it is orally consumed by the insect.
FIGURE 4 is the expression cassette sequence for Example 2. The expression cassette contains an exosporium gene promoter, the exsCL gene sequence, and the cry ICa gene sequence.
FIGURE 5 is the expression cassette DNA and protein sequence for Example 4 showing a multifunctional linker. The exosporium gene, exsCL, is fused to 628 amino acids of the N-terminal coding region of the insecticidal protein gene cry ICa. Amino acids 1 through 628 of the CrylCal protein comprise the active portion of the toxin after cleavage by insect midgut proteases. The linker contains restriction sites for in-frame cloning, a nine- amino acid epitope for antibody detection (bold typeface), and a proteolytic cleavage site to ensure that the insecticidal CrylCal protein is released from the spore after it is orally consumed by the insect.
FIGURE 6 depicts nucleotide and peptide sequences showing the junction between CotYl and Cry ICa including the HA epitope and proteolytic cleavage site. This figure shows nucleotides 481 through 660 of SEQ ID NO:26 and amino acids 161 through 220 of SEQ ID NO:27.
FIGURE 7 depicts nucleotide and peptide sequences showing the junction between ExsCL and Cry ICa including the HA epitope and proteolytic cleavage site. This figure shows nucleotides 661 through 840 of SEQ ID NO:32 and amino acids 112 through 171 of SEQ ID NO:33.
FIGURE 8 (A)-(E) depicts the sequence alignment of CotG (SEQ ID NO:4), CotYl(SEQ
ID NO:2), CotY2 (SEQ ID NO:6), CotE (SEQ ID NO:8), and exsCL (SEQ ID NO:11), respectively.
The sequences in Figure 8A are as follows:
>1 Bacillus thuringiensis CotG (SEQ ID NO: 4)
>2 exosporium protein B [Bacillus cereus] AAM76781.1 [AY121972] (SEQ ID NO: 49)
>3 spore coat protein G [Bacillus cereus G9241] ZP_00237530.1 [NZ_AAEK01000011]
(SEQ ID NO: 50)
>4 Spore coat protein G [Bacillus cereus ATCC 14579] NP_831798.1 [NC_004722]
(SEQ ID NO: 51)
>5 hypothetical protein [Bacillus anthracis str. 'Ames Ancestor'] YP_018684.1
[NC_007530] (SEQ ID NO: 52)
>6 exosporium protein B [Bacillus thuringiensis serovar konkukian str. 97-27]
YP_036192.1 [NC_005957] (SEQ ID NO: 53)
>7 hypothetical protein [Bacillus cereus ATCC 10987] NP_978427.1 [NC_003909]
(SEQ ID NO: 54)
>8 hypothetical protein [Bacillus anthracis str. A2012] ZP_00392313.1
[NZ_AAAC02000001] (SEQ ID NO: 55)
The sequences in Figure 8B are as follows: >1 Bacillus thuringiensis CotYl (SEQ ID NO: 2)
>2 exosporium protein Y [Bacillus cereus] AAM76782.1[AY121973] (SEQ ID NO: 56)
>3 hypothetical protein [Bacillus anthracis str. A2012] ZP_00391556.1
[NZ_AAAC02000001] (SEQ ID NO: 57)
>4 spore coat protein Z [Bacillus anthracis str. Ames] NP_843706.1 [NC_003997] (SEQ
IDNO: 58)
>5 Spore coat protein Y [Bacillus cereus ATCC 14579] NP_831002.1 [NC_004722]
(SEQ ID NO: 59)
>6 spore coat protein Y [Bacillus cereus G9241] ZP_00239128.1 [NZ_AAEK01000028]
(SEQ ID NO: 60)
>7 spore coat protein; exosporium protein [Bacillus thuringiensis serovar konkukian str.
97-27] YP_035458.1 [NC_005957] (SEQ ID NO: 61)
>8 spore coat protein Z [Bacillus cereus ATCC 10987] NP_977662.1 [NC_003909]
(SEQ ID NO: 62)
>9 spore coat protein [Bacillus cereus} AAN85823.1 [AY186996] (SEQ ID NO: 63)
>10 spore coat protein [Bacillus thuringiensis serovar konkukian str. 97-27]
YP_035462.1 [NC_005957] (SEQ IDNO: 64)
>11 spore coat protein z [Bacillus anthracis str. 'Ames Ancestor'] YP_017852.1
[NC_007530] (SEQ ID NO: 65)
>12 Spore coat protein Y [Bacillus cereus ATCC 14579] NP_831006.1 [NC_004722]
(SEQ ID NO: 66)
>13 spore coat protein Y [Bacillus cereus G9241] ZP_00239843.1
[NZ_AAEK01000042] (SEQ ID NO: 67)
>14 spore coat protein [Bacillus cereus E33L] YP_082720.1 [NC_006274] (SEQ ID NO:
68)
>15 spore coat protein Z [Bacillus cereus ATCC 10987] NP_977666.1 [NC_003909]
(SEQ ID NO: 69)
The sequences in Figure 8C are as follows:
>1 Bacillus thuringiensis CotY2 (SEQ ID NO: 6)
>2 spore coat protein [Bacillus cereus] AAN85823.1 [AYl 86996] (SEQ ID NO: 70)
>3 Spore coat protein Y [Bacillus cereus ATCC 14579] NP_831006.1 [NC_004722]
(SEQ ID NO: 71) >4 spore coat protein Z [Bacillus cereus ATCC 10987] NP_977666.1 [NC_003909]
(SEQ ID NO: 72)
>5 spore coat protein [Bacillus cereus E33L] YP_082720.1 [NC_006274] (SEQ ID NO:
73)
>6 spore coat protein [Bacillus thuringiensis serovar konkukian str. 97-27] YP_035462.1
[NC_005957] (SEQ ID NO: 74)
>7 spore coat protein z [Bacillus anthracis str. 'Ames Ancestor'] YP_017852.1
[NC_007530] (SEQ ID NO: 75)
>8 spore coat protein Y [Bacillus cereus G9241] ZP_00239843.1 [NZ_AAEK01000042]
(SEQ ID NO: 76)
>9 exosporium protein Y [Bacillus cereus] AAM76782.1 [AYl 21973] (SEQ ID NO: 77)
>10 spore coat protein Y [Bacillus cereus G9241] ZP_00239128.1 [NZ_AAEK01000028]
(SEQ ID NO: 78)
>11 hypothetical protein [Bacillus anthracis str. A2012] ZP_00391556.1
[NZ_AAAC02000001] (SEQ ID NO: 79)
>12 spore coat protein Z [Bacillus anthracis str. Ames] NP_843706.1 [NC_003997]
(SEQ ID NO: 80)
>13 spore coat protein Z [Bacillus cereus ATCC 10987] NP_977662.1 [NC_003909]
(SEQ ID NO: 81)
>14 Spore coat protein Y [Bacillus cereus ATCC 14579] NP_831002.1 [NC_004722]
(SEQ ID NO: 82)
>15 spore coat protein; exosporium protein [Bacillus thuringiensis serovar konkukian str.
97-27] YP_035458.1 [NC_005957] (SEQ ID NO: 83)
The sequences in Figure 8D are as follows:
>1 Bacillus Thuringiensis CotE (SEQ IDNO: 8)
>2 Spore coat protein E [Bacillus cereus ATCC 14579] NP_833493.1 [NC_004722]
(SEQ ID NO: 84)
>3 spore coat protein E [Bacillus cereus G9241] ZP_00238978.1 [NZ_AAEK01000026]
(SEQ ID NO: 85)
>4 spore coat protein E [Bacillus cereus ATCC 10987] NP_980101.1 [NC_003909]
(SEQ ID NO: 86) >5 outer spore coat protein [Geobacillus kaustophilus HTA426] YP_147158.1
[NC_006510] (SEQ ID NO: 87)
>6 morphogenic protein [Bacillus licheniformis ATCC 14580] YP_079100.1
[NC_006270] (SEQ ID NO: 88)
>7 morphogenic protein [Bacillus subtilis subsp. subtilis str. 168] NP_389585.1
[NC_000964] (SEQ ID NO: 89)
The sequences in Figure 8E are as follows:
>1 Bacillus thuringiensis ExsCL (SEQ ID NO: 11)
>2 BcIA protein [Bacillus cereus G9241] ZP_00239117.1 [NZ_AAEK01000028] (SEQ
ID NO: 90)
>3 hypothetical protein [Bacillus cereus ATCC 10987] NP_977650.1 [NC_003909]
(SEQ ID NO: 91)
>4 Collagen-like exosporium surface protein [Bacillus cereus ATCC 14579]
NP_830991.1 [NC_004722] (SEQ ID NO: 92)
>5 BcIA protein [Bacillus anthracis] CAD56870.1 [AJ516937] (SEQ ID NO: 93)
>6 hypothetical protein [Bacillus anthracis str. Sterne] YP_027402.1 [NC_005945] (SEQ
ID NO: 94)
>7(Q83WA9) BcIA protein [Bacillus anthracis] (SEQ ID NO: 95)
>8 BcIA [Bacillus anthracis] AAY15450.1 [AY995120] (SEQ IDNO: 96)
>9 hypothetical protein [Bacillus anthracis str. A2012] ZP_00391545.1
[NZ_AAAC02000001] (SEQ ID NO: 97)
>10 BcIA protein [Bacillus anthracis] CAD56872.1 [AJ516939] (SEQ ID NO: 98)
>11 BcIA [Bacillus anthracis] AAY15452.1 [AY995122] (SEQ ID NO: 99)
>12 bclA protein [Bacillus thuringiensis serovar konkukian str. 97-27] YP_035447.1
[NC_005957] (SEQ ID NO: 100)
>13 BcIA protein [Bacillus anthracis] CAD56874.1 [AJ516941] (SEQ ID NO: 101)
>14 BcIA protein [Bacillus anthracis] CAD56877.1 [AJ516944] (SEQ ID NO: 102)
>15 BcIA protein [Bacillus anthracis] CAD56879.1 [AJ516946] (SEQ ID NO: 103)
>16 BcIA protein [Bacillus anthracis] CAD56880.1 [AJ516947] (SEQ ID NO: 104)
>17 bclA protein [Bacillus cereus E33L] YP_082705.1 [NC_006274] (SEQ ID NO: 105)
>18 (Q83WA7) BclA protein [Bacillus anthracis] (SEQ ID NO: 106) The sequence alignments provide an indication of which residues are highly conserved and therefore more likely to be functionally important and which are less conserved and therefore less likely to be functionally important. One of skill in the art can use these sequence alignments along with other sequence alignments to guide the creation of derivatives of the genes and proteins of the present invention.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
Introduction
Bacillus thuringiensis ("Bt") is a widely used biopesticide effective against insects of the lepidopteran family (i.e., moths and butterflies) and also other insects such as the larvae of mosquitoes. Over the years it has proven to be safe, as evidenced from the lack of reported or observed toxicological effects in humans from exposures in the field. However, despite its record, Bt use as a biopesticide suffers from several drawbacks including the necessity to apply significant amounts of formulated material onto crops and other plant-based resources (such as turf grass). A large amount is required for application because of the relative lack of efficacy of the Bt spores in the formulated pesticides. Current Bt products are mixtures of spores and isolated crystalline protein toxins. It is commonly understood that the spores, although contributing to insecticidal activity, are relatively slow in onset of action because the spores, after ingestion by the target insect, must germinate in the midgut of the target insect before they exert their insecticidal activity. Once the spores germinate into vegetative cells and become metabolically active, a phenomenon elicited by the favorable environment of the insect's gut, they replicate and colonize in the insect. It is this process of colonization that confers insecticidal activity since many of the viable cells are lysed, which enables the release of endogenous insecticidal protein toxins, previously contained within the vegetative cell (or the predecessor endospore). Once released, the endogenous toxins act in the same manner as ingested isolated protein toxins, in effect, killing the target insect. The methods of the present invention allow for the expression of endogenous protein toxin on the surface of the spore making the protein toxin immediately accessible to receptors in the gut of the target insect (the mechanism of action of the toxin's toxicity), thereby conferring rapidity of insecticidal activity, since the spores essentially will act as if they were isolated protein toxins. Of course, the longer-term benefits of the germination process will be retained by the methods of the present invention.
Another drawback of current Bt insecticide formulations is their relatively narrow range of insecticidal activity. Most Bt insecticide formulations target a few insect species. To overcome this limitation, one would have to apply several different Bt formulations containing several different Bt strains known to target different insects to achieve a broad range of insecticidal activity. This, of course, would be a time-consuming and costly approach. The methods of the present invention, described more fully below, overcome these drawbacks by allowing for the expression of one or more insecticidal protein toxins on the surface of the Bt spore. For example, the methods allow for the expression of endogenous Bt insecticidal protein toxins, including those of the host Bt strain (as described, supra), and/or the expression of non-host strain Bt endogenous insecticidal protein toxins, and/or the expression of non-Bt endogenous insecticidal protein toxins, and/or the expression of non-bacillus insecticidal protein toxins on the surface of Bt spores. By expressing more than one exogenous insecticidal protein toxin on the host Bt strain, one can create a recombinant Bt spore having insecticidal activity against a wide array of insect pests. This would allow for more complete control of insect pest populations while reducing the quantity of Bt spore applied to a particular crop or other plant-based resource such as turf grass, which would have the added benefit of reducing costs and reducing potential adverse effects to the environment.
The methods of the present invention allow for the insecticidal protein toxins to be expressed on the surface of Bt spores during the process of sporulation. Genes encoding such insecticidal protein toxins (i.e., exogenous insecticidal protein genes) are operably linked, with or without a linker, to an outer core protein gene or an exosporium gene, which is operably linked to a sporulation promoter sequence, such as an outer coat protein gene promoter sequence or an exosporium protein gene promoter sequence, which is then cloned into a suitable expression vector such as any of a number of commercially-available plasmids. Once constructed, the expression vector is then introduced into one or more cells of a suitable host Bt strain (i.e., the host Bt strain is transformed or transfected) by any suitable method known in the art such as electroporation. Once transformed with the expression vector, the one or more Bt cells are induced to sporulate causing the expression cassettes to express the outer coat protein gene or the exosporium gene operably linked to the one or more insecticidal protein genes.
In certain strains of naturally-occurring Bt, endogenous insecticidal protein toxins form aggregates or crystals, which are comprised of one or more types of proteins, typically of the size of about 130-140 kDa. In this form, the insecticidal protein toxin is actually a protoxin — that is, it must be activated before it has any effect. The crystal form of the insecticidal protein toxin is highly insoluble under normal conditions, so it is safe to humans, higher animals and most insects. However, the crystal toxin is solubilized in reducing conditions of high pH (above about pH 9.5) - the conditions commonly found in the midgut of lepidopteran larvae. For this reason, Bt is a highly specific insecticidal agent. Current Bt products are formulated with crystal toxins since this structure stabilizes the insecticidal protein once applied to the environment.
Once it has been solubilized in the insect gut, the protoxin is cleaved by a gut protease to produce an active toxin of about 60 kDa. The toxin binds to the midgut epithelial cells, creating pores in the cell membranes and leading to equilibration of ions. As a result, the gut is rapidly immobilized, the epithelial cells lyse, the larva stops feeding, and the gut pH is lowered by equilibration with the blood pH. At this stage, the Bt spores play a contributing role in insect control. When the gut pH is lowered, the spores can germinate, allowing the bacterium to invade the host, and causing a lethal bacterial infection or septicemia.
The Bt recombinant spores of the present invention have additional applications such as industrial enzymes and vaccines. One or more exogenous enzyme genes can be expressed in a Bt spore during sporulation in the same manner as an exogenous insecticidal protein toxin is. That is, an entire enzyme gene or a portion of it (i.e., a portion that codes for the active form of the enzyme) can be operably linked to an outer coat protein gene or exosporium gene and a suitable promoter thereby creating an expression cassette. The expression cassette can then be cloned into a suitable expression vector and introduced into one or more cells of a host Bt strain. The one or more cells can then be induced to sporulate, which triggers expression of the exogenous enzyme (or component thereof) on the surface of the Bt spore. The resulting recombinant spores function as immobilized enzymes, which can be produced inexpensively by bacillus fermentation and can be easily isolated from the enzyme reaction mixture by simple sedimentation or centrifugation. Since the enzyme attached on the spore surface is more stable than a corresponding free enzyme, the spore-bound enzyme can be used repeatedly.
Analogous to the insecticidal protein toxin and enzyme applications for recombinant Bt spores, the methods of the present invention allow for the creation of one or more recombinant Bt spores expressing one or more antigens on their surface. In this manner, the present invention allows for the creation of one or more vaccines. The present invention includes the use of Bt spores as an immobilized enzyme matrix and vaccine.
The spore structure of Bacillus subtilis has been characterized using various techniques including microscopy, staining, genetics, and sequence analysis. The spores are encased in a complex protein coat comprised of three spore coat layers; an amorphous undercoat, a lightly staining inner structure, and an electron-dense outer coat. B. subtilis spore coat proteins have been cloned and sequenced and the sequence information has been used to express exogenous genes (those derived from non Bacillus hosts for example) on the surface of the spore. Until now, however, there have been no reports demonstrating exogenous genes, operably linked to spore outer coat protein genes or exosporium protein genes, expressed on the surface of the Bt spore.
The present invention utilizes a Bt spore structural protein, such as spore coat protein or an exosporium protein to anchor a heterologous protein that is desirable to have expressed on the spore surface. A large number of Bt isolates have been reported and these isolates are highly diversified. Although there has been one report describing the expression of heterologous proteins in Bt cells, the technology only describes the non- covalent association of these proteins and does not describe display on the exosporium (Du C, Chan WC, McKeithan TW, Nickerson KW. Appl Environ Microbiol. 2005,71(6):3337-41). The present invention is not limited to Bt spore structural proteins but contemplates the use of other Bacillus spore structural proteins including, but not limited to, the spore outer coat protein genes of B. subtilis and B. cereus, and the exosporium protein genes of B. cereus.
In addition to their outer coat, Bt spores contain an exosporium, which is a loose balloon-like structure, a structure which appears to be absent from the spores of B. subtilis. Since the exosporium is the outermost layer of the spore, it is the portion of the spore that makes the initial contact with a host organism (such as an insect including a target insect) or the environment. The exosporium is composed primarily of protein, but also contains lipid and carbohydrate. Exosporium proteins from related Bacilli have been identified, but to the Applicants' knowledge, none of the corresponding proteins from Bt have been cloned or sequenced.
Definitions
Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention pertains. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2d ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them unless specified otherwise.
"Bacillus thuringiensis," "B. thuringiensis " and "Bt" refer to a gram positive soil bacterium characterized by its ability to produce crystalline inclusions during sporulation. A "subspecies" is defined as a taxonomic group that is a division of a species which is genetically distinguishable from other such populations of the same species.
The term "exogenous" as used herein means derived from outside the Bt host strain and the term "exogenous proteins" includes proteins, peptides, and polypeptides. Conversely, the term "endogenous" means derived from within the Bt host strain. The term "heterologous" as used herein means derived from a different genetic source. The term "homologous" as used herein means similar in structure and evolutionary origin.
A "host cell" or "host strain" is defined herein as a cell, which is a specific Bt strain, that is used in lab techniques such as DNA cloning to receive, maintain, and allow the reproduction of cloning vectors, for example, the expression vectors or plasmids of the present invention. A "strain" is defined as a population of cells all descended from a single cell.
By "spore structural gene" is meant any gene encoding a spore outer coat protein or an exosporium protein, or any functional derivatives or equivalents thereof.
"Polynucleotide" and "nucleic acid" refer to a polymer composed of nucleotide units (ribonucleotides, deoxyribonucleotides, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof) linked via phosphodiester bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof. Thus, the term includes nucleotide polymers in which the nucleotides and the linkages between them include non-naturally occurring synthetic analogs. It will be understood that, where required by context, when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T."
The term "upstream" refers to the region or DNA extending in a 5' direction and the term "downstream" refers to an area on the same strand of DNA, that is located past the gene if one moves along the strand in a 5'-3' direction (the normal direction of transcription and leading strand replication).
A "gene" is a defined hereditary unit that occupies a specific location on a chromosome, determines a particular characteristic in an organism by directing the formation of a specific protein, and is capable of replicating itself at each cell division. The term "reading frame" refers to a contiguous, non-overlapping set of triplet codons in RNA or DNA that begin from a specific nucleotide. A "codon" is defined as the basic unit of the genetic code, comprising three-nucleotide sequences of messenger ribonucleic acid (mRNA), each of which is translated into one amino acid in protein synthesis.
The term "recombinant" refers to polynucleotides synthesized or otherwise manipulated in vitro ("recombinant polynucleotides") and to methods of using recombinant polynucleotides to produce gene products encoded by those polynucleotides in cells or other biological systems. For example, a cloned polynucleotide may be inserted into a suitable expression vector, such as a bacterial plasmid, and the plasmid can be used to transform a suitable host cell. A host cell that comprises the recombinant polynucleotide is referred to as a "recombinant host cell" or a "recombinant bacterium." The gene is then expressed in the recombinant host cell to produce, e.g., a "recombinant protein." A recombinant polynucleotide may serve a non-coding function (e.g., promoter, origin of replication, ribo some-binding site, etc.) as well.
A "cloning vector" is defined as a DNA molecule originating from a virus, a plasmid, or the cell of a higher organism into which another DNA fragment of appropriate size can be integrated without loss of the vector's capacity for self-replication. Vectors introduce foreign DNA into host cells, where it can be reproduced. Vectors are often recombinant molecules containing DNA sequences from several sources. The DNA introduced with the vector is replicated whenever the cell divides. A "promoter" is an array of nucleic acid control sequences that direct transcription of an associated polynucleotide, which may be a heterologous or a native polynucleotide. A promoter includes nucleic acid sequences near the start site of transcription, such as an RNA polymerase binding site. An "expression cassette" refers to a series of polynucleotide elements that permit transcription of a gene in a host cell. Typically, the expression cassette includes a promoter and a heterologous or native polynucleotide sequence that is transcribed.
A "linker" is a double-stranded oligonucleotide containing a number of restriction endonuclease recognition sites. A "restriction endonuclease recognition site" or a "restriction site" is a specific nucleotide sequence at which a particular restriction enzyme cleaves the DNA. A "restriction enzyme" or "restriction endonuclease" is a protein that recognizes specific, short nucleotide sequences and cleaves DNA at those sites.
The term "operably linked" refers to a functional relationship between two parts in which the activity of one part (e.g., the ability to regulate transcription) results in an action on the other part (e.g., transcription of the sequence). Thus, a polynucleotide is "operably linked to a promoter" when there is a functional linkage between a polynucleotide expression control sequence (such as a promoter or other transcription regulation sequences) and a second polynucleotide sequence (e.g., a native or a heterologous polynucleotide), where the expression control sequence directs transcription of the polynucleotide.
The "polymerase chain reaction" or "PCR" is method for amplifying a DNA base sequence using a heat-stable polymerase and two primers, one complementary to the plus strand at one end of the sequence to be amplified and the other complementary to the minus strand at the other end. Because the newly synthesized DNA strands can subsequently serve as additional templates for the same primer sequences, successive rounds of primer annealing, strand elongation, and dissociation produce rapid and highly specific amplification of the desired sequence. PCR also can be used to detect the existence of the defined sequence in a DNA sample. The terms "primer", "oligonucleotide", and "oligonucleotide primer" can be used interchangeably and are defined as a short polynucleotide chain. "Polymerase" is defined as an enzyme that catalyzes the synthesis of nucleic acids on preexisting nucleic acid templates.
As used herein, the term "surface of the spore" or "the spore surface" means both the outer coat of the Bt spore and the exosporium of the Bt spore. The term is used in its generic sense so, for example, when a heterologous protein is expressed on the surface of the spore (or the spore surface), the protein may be found on the outer coat or on the exosporium such that said heterologous protein is displayed in such a way that it is oriented to the outer environment such as the lumen of an insect's gut.
As used herein, the term "attached" when used in the context of proteins "attached" the surface of the spore, means a heterologous protein, fused with an outer coat protein or an exosporium protein, so that the heterologous protein is covalently linked to the surface of the spore by means of its fusion with an outer coat protein or an exosporium protein.
The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. Amino acids may be referred to herein by either their commonly known three letter symbols or by Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes, i.e., the one-letter symbols recommended by the IUPAC-IUB.
"High stringency conditions" may be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.015 M sodium citrate/0.1% sodium dodecyl sulfate at 50-68 °C; (2) employ during hybridization a denaturing agent such as formamide, for example, 50% (v/v) formamide with 0.1 % bovine serum albumin/0.1 % Ficoll/0.1 % polyvinylpyrrolidone/50niM sodium phosphate buffer at pH 6.5 with 750 mM sodium , chloride, 75 mM sodium citrate at 42 0C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 Dg/ml), 0.1% SDS, and 10% dextran sulfate at 42 °C, with washes at 42 0C in 0.2 x SSC (sodium chloride/sodium citrate) and 50% formamide at 55 0C, followed by a high-stringency wash consisting of 0.1 x SSC containing EDTA at 55 °C.
Preferred hybridization conditions for very high stringency hybridization include at least one wash at 0.1 x SSC, 0.1 % SDS, at 6O0C for 15 minutes. Preferred hybridization conditions for high stringency hybridization include at least one wash at 0.2 x SSC, 0.1 % SDS, at 600C for 15 minutes. Preferred hybridization conditions for moderate stringency hybridization include at least one wash at 0.5 x SSC, 0.1 % SDS, at 600C for 15 minutes. Preferred hybridization conditions for low stringency hybridization include at least one wash at 1.0 x SSC, 0.1 % SDS, at 60°C for 15 minutes.
The phrase "hybridizing specifically to" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA. Stringent conditions are sequence-dependent and will be different in different circumstances. As is well known in the art, longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5 0C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium. Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.05 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 0C for short probes (e.g., 10 to 50 nucleotides) and at least about 60 °C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of DNA duplex destabilizing agents such as formamide.
The terms "identical" or percent "identity", in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence over a comparison window, as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. Preferably, the percent identity exists over a region of the sequence that is at least about 25 amino acids in length, more preferably over a region that is 50 or 100 amino acids in length. This definition also refers to the complement of a test sequence, provided that the test sequence has a designated or substantial identity to a reference sequence. Preferably, the percent identity exists over a region of the sequence that is at least about 25 nucleotides in length, more preferably over a region that is 50 or 100 nucleotides in length.
The phrase "substantially identical," in the context of two nucleic acids or polypeptides, refers to two or more sequences or subsequences that have at least 60%, preferably 70%, more preferably 80%, preferably 85%, more preferably 90%, more preferably 93%, more preferably 95%, more preferably 97%, preferably 98%, and most preferably 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. Preferably, the substantial identity exists over a region of the sequences that is at least about 50 residues in length, more preferably over a region of at least about 100 residues, and most preferably the sequences are substantially identical over at least about 150 residues. In a most preferred embodiment, the sequences are substantially identical over the entire length of the coding regions.
Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. MoI. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection. One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. MoI. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information website at http://www.ncbi.nlm.nih.gov. In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul (1993) Proc. Nat'l. Acad Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
When percentage of sequence identity is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Alternatively, when one includes such conservative substitutions in the comparison, a percent "similarity" can be noted, as opposed to a percent "identity". Means for making this adjustment are well known to those of skill in the art. The scoring of conservative substitutions can be calculated according to, e.g., the algorithm of Meyers & Millers, Computer Applic. Biol. ScL 4:11- 17 (1988), e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif.).
Proteins of interest in the present invention ("target proteins") may include insecticidal protein toxins, enzymes, and antigenic proteins. Such proteins may be expressed on the surface of one or more Bt spores in their entirety (i.e., the entire gene is introduced into the host cell and expressed as described more fully above and below) or as active components or subunits. Included in the target proteins of the present invention are amino acid sequence variants of the wild-type target proteins. These variants fall into one or more of three classes: substitution, insertion or deletion variants. These variants ordinarily are prepared by site-specific mutagenesis of nucleotides in the DNA encoding the target protein, using cassette or PCR mutagenesis or other techniques well known in the art, to produce DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture. Variant target protein fragments having up to about 100-150 amino acid residues may be prepared by in vitro synthesis using established techniques. Amino acid sequence variants are characterized by the predetermined nature of the variation, a feature that sets them apart from naturally occurring allelic or interspecies variation of the target protein amino acid sequence. The variants typically exhibit the same qualitative biological activity as the naturally occurring analogue, although variants can also be selected that have modified characteristics.
Amino acid substitutions are typically of single residues; insertions usually will be on the order of from about 1 to about 20 amino acids, although considerably longer insertions may be tolerated. Deletions range from about 1 to about 20 residues, although in some cases, deletions may be much longer.
Substitutions, deletions, and insertions or any combinations thereof may be used to arrive at a final derivative. Generally, these changes are done on a few amino acids to minimize the alteration of the molecule. However, larger characteristics may be tolerated in certain circumstances. Such circumstances are readily identified to those of skill in the art.
The following six groups each contain amino acids that are conservative substitutions for one another (see, e.g., Creighton, Proteins (1984)):
1) Alanine (A), Serine (S), Threonine (T);
2) Aspartic acid (D), Glutamic acid (E);
3) Asparagine (N), Glutamine (Q);
4) Arginine (R), Lysine (K);
5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and
6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
An "antigen" refers generally to a substance capable of eliciting the formation of antibodies in a host or generating a specific population of lymphocytes reactive with that substance. Antigens may comprise macromolecules (e.g., polypeptides, proteins, and polysaccharides) that are foreign to the host.
Methods and Uses of the Invention
The present invention provides methods for making and using recombinant Bacillus thuringiensis strains that have exogenous proteins attached to their spores. Bacillus spores contain a protein coat which, in B. subtilis, is known to contain at least 20 polypeptides. B. thuringiensis spores have an exosporium surrounding the mature spore which is comprised of protein, lipid, and carbohydrate. In the present invention, Applicants cloned and sequenced four homologous spore outer coat protein genes from Bt, a spore outer coat protein gene promoter sequence, and an exosporium protein gene from Bt.
Using the methods of the present invention, an expression cassette is placed in a Bt host to produce a recombinant Bt strain having an exogenous protein attached to its spore. The expression cassette is comprised of a suitable sporulation promoter such as an outer coat protein gene promoter or an exosporium protein gene promoter, followed by a portion of a Bt spore coat protein gene or a Bt exosporium protein gene fused, in frame, to the exogenous gene of interest. The terms "fuse", "fusion", and "fusing" refer to the blending together of nucleic acid molecules, genes or proteins. Suitable promoters include those found in Bacillus strains such as the cotG promoter from B. cereus (GenBank Accession No. AEO 16877), and the cotC promoter from B. subtilis (GenBank Accession No. BG 10492). Identifying promoters suitable for the present invention is within the skill of the art. Synthetic promoters are also contemplated for use in the present invention such as the synthetic promoter of SEQ ID NO:36 and depicted in FIG. 1.
In the present invention, Applicants designed oligonucleotide primers based on B. cereus spore coat genes and on the B. cereus exosporium gene sequence and used the polymerase chain reaction to clone four Bt spore coat genes and a Bt exosporium gene. Based on their similarity to the B. cereus spore coat genes and B. cereus exosporium gene, Applicants designated the cloned Bt genes as cotE, cotG, cotYl, cotY2, and exsCL. Sequences upstream of the cotG gene were isolated that comprise the Bt cotG promoter.
As Bt cells grow and exhaust the available nutrients, they go through a differentiation process to produce a spore. As Bt cells enter the sporulation process, the pattern of gene expression changes to produce specific proteins necessary for sporulation. Some of the sporulation-specifϊc proteins are the structural proteins that make up the spore coat. To get efficient expression of the exogenous protein in the expression cassette, it is desirable to use a sporulation-specific promoter, preferably a spore coat protein gene promoter or an exosporium protein gene promoter. Use of a spore coat protein gene promoter or an exosporium protein gene promoter ensures expression at the appropriate time during the Bt life cycle. The novel Bt cotG promoter from the present invention can be placed in the expression cassette, or another sporulation-specific promoter can be used. Promoters used in the expression cassette may include any Bacillus sporulation-specific promoter, but preferably an exosporium protein gene promoter or spore coat protein gene promoter including, but not limited to, the specific promoters of bclA, dal, exsB, exsC, exsCL, exsD, exsE, exsF, exsG, exsH, exsl, exsJ, exsY, cotA, cotB, cotC, cotD, cotE, cotF, cotG, cotN, cotS, cotT, cotV, cotW, cotX, cotY, and cotZ. The sequences of such promoters are readily obtainable from public nucleotide databases or can be identified using standard molecular biology techniques well within the skill of the ordinary artisan.
The portion of the spore outer coat protein gene or exosporium protein gene present in the expression cassette can be relatively small or it may include almost the entire spore coat or exosporium protein. The number of spore coat protein gene or exosporium protein gene codons present in the expression cassette can be at least five, and preferably, at least twenty-seven. For example the entire Bt cotG gene excluding the stop codon can be placed in the expression cassette. In the present invention, we cloned and sequenced spore outer coat protein genes cotE (SEQ ID NO:7), cotG (SEQ ID NO:3 ), cotYl (SEQ ID NO:1 ), and cotY2 (SEQ ID NO:5) from the Bt galleriae strain SDS-502. In a preferred embodiment, the newly- identified spore genes cotE, cotG, cotYl, and cotY2 of the present invention or portions thereof may be used in the expression cassette. However, spore outer coat protein genes for use in the present invention may be isolated from any Bacillus strain including, but not limited to, cotA, cotB, cotC, cotD, cotE, cotF, cotG, cotN, cotS, cotT, cotV, cotW, cotX, cotY, and cotZ among others. Gene sequences for the above-mentioned genes may be found in any public source including public databases such as those maintained by the National Center for Biotechnology Information, university databases, publications including various those from various scientific journals and others well known to those of skill in the art.
In the exosporium case, we cloned and sequenced the Bt exosporium protein gene exsCL (SEQ ID NO: 10) from the Bt galleriae strain SDS-502. In a preferred embodiment, the newly-identified exsCL gene of the present invention or portions thereof may be used in the expression cassette. However, exosporium proteins genes for use in the present invention may be isolated from any Bacillus strain including, but not limited to, bclA, dal, exsB, exsC, exsCL, exsD, exsE, exsF, exsG, exsH, exsl, exsJ, exsY among others. Gene sequences for the above-mentioned genes may be found in any public source including public databases such as those maintained by the National Center for Biotechnology Information, university databases, publications including various those from various scientific journals and others well known to those of skill in the art.
Additional polynucleotides of the present invention can be identified and defined in terms of their similarity or identity to the sequences of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO:10. In one embodiment, the sequences of the present invention comprise sequences which have greater than 55 or 60% sequence identity with SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO: 10, preferably greater than 70%, more preferably greater than 80%, more preferably greater than 90 or 95% or, in another embodiment, have 98 to 100% sequence identity with SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO:10. In another embodiment, the nucleic acid hybridizes under stringent conditions to nucleic acids having a sequence or complementary sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO: 10. The term "hybridize" means to form base pairs between complementary regions of two strands of DNA.
These spore coat protein gene sequences and their modified variations as both polynucleotides and polypeptides can be used to direct expression of a heterologous protein to the surface of a spore. The genes and proteins of the present invention can also be defined in terms of the ability to hybridize with, or be amplified by, certain nucleic acid sequences. The polynucleotides of the present invention include those that hybridize under stringent conditions to each of the above-mentioned polynucleotides or a probe that can be prepared from the above-mentioned polynucleotide, as far as they encode polypeptides having a functional effect allowing the assembly of heterologous proteins into the spores.
Four proteins of the present invention have been sequenced and are provided: CotE (SEQ ID NO: 8), CotG (SEQ ID NO:4), CotYl(SEQ ID NO:2) and CotY2 (SEQ ID NO: 6). Since these proteins are merely exemplary of the proteins of the subject invention, it should be readily apparent that the subject invention comprises modified variations or equivalent proteins (and nucleotide sequences coding for equivalent proteins) having the same or similar activity as the exemplified proteins. Equivalent proteins will have amino acid similarity (and/or homology) with the exemplified proteins. The amino acid identity will typically be greater than 60%, preferably greater than 75%, more preferably greater than 80%, even more preferably greater than 90%, and can be greater than 95%.
The classes of spore outer coat proteins provided herein can also be identified based on their immunoreactivity with certain antibodies. In one embodiment, the proteins further specifically bind to polyclonal antibodies raised against SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8, or portions of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8.
These exosporium protein gene sequences and their modified variations as both polynucleotides and polypeptides can be used to direct expression of a heterologous protein to the exosporium. The genes and proteins of the subject invention can also be defined in terms of the ability to hybridize with, or be amplified by, certain nucleic acid sequences. The polynucleotides of the present invention include those that hybridize under stringent conditions to each of the above-mentioned polynucleotides or a probe that can be prepared from the above-mentioned polynucleotide as far as they encode polypeptides having a functional effect allowing the assembly of heterologous proteins into the spores.
The ExsCL protein of the present invention has been specifically provided in SEQ ID NO:11. Since this protein is merely exemplary of the proteins of the subject invention, it should be readily apparent that the subject invention comprises modified variations or equivalent proteins (and nucleotide sequences coding for equivalent proteins) having the same or similar activity as the exemplified proteins. Equivalent proteins will have amino acid similarity (and/or homology) with the exemplified proteins. The amino acid identity will typically be greater than 60%, preferably greater than 75%, more preferably greater than 80%, even more preferably greater than 90%, and can be greater than 95%.
The classes of exosporium proteins provided herein can also be identified based on their immuno-reactivity with certain antibodies. In one embodiment, the proteins further specifically bind to polyclonal antibodies raised against SEQ ID NO:11.
The exogenous gene placed in the expression cassette can encode a protein from a variety of classes depending on the desired application. In a preferred embodiment, the exogenous gene encodes an insecticidal protein toxin isolated from a Bacillus species. In an alternate embodiment, genes or nucleic acid sequences placed in the expression cassette can encode proteins, peptides, or polypeptides useful for vaccinations, particularly wildlife vaccinations. Target diseases include rabies, Lyme disease, and other diseases that are preventable by the administration of a vaccine. In yet another embodiment, genes placed in the expression cassette can encode enzymes or proteins useful in bio-remediation and other industrial applications. However, any exogenous or endogenous gene can be placed in the expression cassette. The gene choice depends on the desired application of the resulting protein attached to the Bt spore.
The expression cassette may further include a linker to operably link, or join the spore outer coat protein or exosporium protein gene with the desired exogenous gene. The linker restriction sites (also called the "multiple cloning site") allow rapid and easy placement of a spore coat protein gene or exosporium protein gene upstream of the linker and the desired exogenous gene downstream of the linker. The linker sequence can preferably encode as few as 10 and as many as 100 amino acids, although it is also possible for the linker to encode more than 100 amino acids.
The linker sequence must be designed in such a way that the reading frame is continued from the spore coat protein gene into the desired exogenous gene. The linker maybe further comprised of an epitope that can be recognized by an antibody. This reactivity allows for tracking of the exogenous protein during product development and use. Preferably, the linker sequence allows the secondary and tertiary structures of the spore outer coat or exosporium protein to form correctly to ensure the heterologous protein fusion is directed to the spore outer coat or exosporium. Additionally, it is preferable that the linker structure permits the attached exogenous protein to be in an active form or precursor form such that it is functional, or can be correctly processed post-translationally.
In a preferred embodiment, the gene placed in the expression cassette will encode an insecticidal protein. Insecticidal protein genes occur naturally in Bt as well as some other Bacillus species, such as Bacillus popilliae. Insecticidal proteins, also called delta- endotoxins, or crystal protein, form crystals visible by phase contrast microscopy. Insecticidal protein genes (also called crystal protein genes) used in the present invention may include, but are not limited to, the following list (see also at the website biols.susx.ac.uk/home/Neil_C/rickmore/Bt/toxins2.html where sequences to the following proteins can be obtained either directly or via links to other websites): CrylAal, CrylAa2, CrylAa3, CrylAa4, CrylAa5, CrylAaδ, CrylAa7, CrylAa8, CrylAa9, CrylAalO, CrylAal 1, CrylAal2, CrylAal3, CrylAal4, CrylAbl, CrylAb2, CrylAb3, CrylAb4, CrylAb5, CrylAbό, CrylAb7, CrylAb8, CrylAb9, CrylAblO, CrylAbl 1, CrylAbl2, CrylAbl3, CrylAbH, CrylAbl5, CrylAblό, CrylAcl, CrylAc2, CrylAc3, CrylAc4, CrylAc5, CrylAcβ, CrylAc7, CrylAcδ, CrylAc9, CrylAclO, CrylAcl 1, CrylAcl2, CrylAcl3, CrylAcl4, CrylAcl5, CrylAdl, CrylAd2, CrylAel, CrylAfl, CrylAgl, CrylAhl, CrylAil, CrylBal, CrylBa2, CrylBa3, CrylBa4, CrylBbl, CrylBcl, CrylBdl, CrylBd2, CrylBel, CrylBe2, CrylBfl, CrylBf2, CrylBgl, CrylCal, CrylCa2, CrylCa3, CrylCa4, CrylCaS, CrylCaό, CrylCa7, CrylCa8, CrylCa9, CrylCalO, CrylCbl, CrylCb2, CrylDal, CrylDa2, CrylDbl, CrylDb2, CrylEal, CrylEa2, CrylEa3, CrylEa4, CrylEa5, CrylEaβ, CrylEbl, CrylFal, CrylFa2, CrylFbl, CrylFb2, CrylFb3, CrylFb4, CrylFb5, CrylGal, CrylGa2, CrylGbl, CrylGb2, CrylGc, CrylHal, CrylHbl, Cryllal, Crylla2, Crylla3, Crylla4, Crylla5, Cryllaό, Crylla7, Cryllaδ, Crylla9, CryllalO, Cryllal 1, Cryllbl, Cryllcl, Cryllc2, Crylldl, Cryllel, Cryllfl, CrylJal, CrylJbl, CrylJcl, CrylJc2, CrylJdl, CrylKal, Cry2Aal, Cry2Aa2, Cry2Aa3, Cry2Aa4, Cry2Aa5, Cry2Aa6, Cry2Aa7, Cry2Aa8, Cry2Aa9, Cry2AalO, Cry2Aall, Cry2Abl, Cry2Ab2, Cry2Ab3, Cry2Ab4, Cry2Ab5, Cry2Ab6, Cry2Acl, Cry2Ac2, Cry2Ac3, Cry2Adl, Cry2Ael, Cry3Aal, Cry3Aa2, Cry3Aa3, Cry3Aa4, Cry3Aa5, Cry3Aa6, Cry3Aa7, Cry3Bal, Cry3Ba2, Cry3Bbl, Cry3Bb2, Cry3Bb3, Cry3Cal, Cry4Aal, Cry4Aa2, Cry4Aa3, Cry4Bal, Cry4Ba2, Cry4Ba3, Cry4Ba4, Cry4Ba5, Cry5Aal, Cry5Abl, Cry5Acl, Cry5Bal, CryόAal, Cry6Aa2, CryβBal, Cry7Aal, Cry7Abl, Cry7Ab2, Cry8Aal, CryδBal, Cry8Bbl, CryδBcl, CryδCal, Cry8Ca2, Cry8Dal, Cry8Da2, Cry8Da3, Cry8Eal, Cry9Aal, Cry9Aa2, Cry9Bal, Cry9Cal, Cry9Ca2, Cry9Dal, Cry9Da2, Cry9Eal, Cry9Ea2, Cry9Ebl, Cry9Ecl, CrylOAal, CrylOAa2, CrylOAa3, CryllAal, CryllAa2, CryllAa3, CryllBal, CryllBbl, Cryl2Aal, Cryl3Aal, Cryl4Aal, Cryl5Aal, CrylόAal, CryHAal, CrylδAal, CrylδBal, Cryl8Cal, Cryl9Aal, Cryl9Bal, Cry20Aal, Cry21Aal, Cry21Aa2, Cry21Bal, Cry22Aal, Cry22Aa2, Cry22Abl, Cry22Ab2, Cry22Bal, Cry23Aal, Cry24Aal, Cry25Aal, Cry26Aal, Cry27Aal, Cry28Aal, Cry28Aa2, Cry29Aal, Cry30Aal, Cry30Bal, , Cry31Aal, Cry31Aa2, Cry32Aal, Cry32Bal, Cry32Cal, Cry32Dal, Cry33Aal, Cry34Aal, Cry34Aa2, Cry34Abl, Cry34Acl, Cry34Ac2, Cry34Bal, Cry35Aal, Cry35Aa2, Cry35Abl, Cry35Ab2, Cry35Acl, Cry35Bal, Cry36Aal, Cry37Aal, Cry38Aal, Cry39Aal, Cry40Aal, Cry40Bal, Cry41Aal, Cry41Abl, Cry42Aal, Cry43Aal, Cry43Bal, Cry44Aa, Cry45Aa, Cry46Aa, Cry47Aa, CytlAal, CytlAa2, CytlAa3, CytlAa4, CytlAa5, CytlAbl, CytlBal, Cyt2Aal, Cyt2Aa2, Cyt2Bal, Cyt2Ba2, Cyt2Ba3, Cyt2Ba4, Cyt2Ba5, Cyt2Ba6, Cyt2Ba7, Cyt2Ba8, Cyt2Ba9, Cyt2Bbl, Cyt2Bcl, Cyt2Cal, Vip3A(a) and Viρ3A(b). Gene sequences for the above- mentioned genes may be found in any public source including public databases such as those maintained by the National Center for Biotechnology Information, university databases, publications including various those from various scientific journals and others well known to those of skill in the art.
Recombinant or engineered insecticidal protein genes can also be used in the methods of the present invention. For example, a hybrid insecticidal protein gene made by fusing the N-terminal coding region of one insecticidal protein gene with the C- terminal coding region of another insecticidal protein gene can be used, hi another example, the insecticidal protein gene is engineered to encode a number of amino acid changes.
Many Bt insecticidal proteins are large protein protoxins (approximately 130 — 140 kDa). When larval insects ingest the crystal protoxin, it is solubilized in the insect midgut, and then cleaved by insect gut proteases to produce an active protein toxin of approximately 60 kDa from the N-terminal portion of the protein. In one embodiment of the present invention, only the portion of the crystal toxin gene or genes that encode the active toxin is placed in the expression cassette. In this embodiment, the proteolytic cleavage site can be placed in the linker sequence between the outer coat protein gene sequence and the active toxin sequence. When the insect comes in contact with the heterologous protein through ingestion of recombinant Bt spores, the active toxin is cleaved from the spore surface thereby inhibiting feeding on the crop or other plant treated with recombinant Bt spores.
To introduce the expression cassette into the Bt cell, the expression cassette can be placed in an expression vector such as a plasmid. A plasmid expression vector can be further comprised of a gram positive origin of replication, a selectable marker, such as an antibiotic resistance gene, and optionally, a gram negative origin of replication. A "selectable marker" is a gene whose expression allows identification of cells that have been transformed or transfected with a vector containing the marker gene. Plasmid expression vectors suitable for use in Bt include pUBl 10, pBC16-l, pC194, pE194, pUSHl, pUSH2, and pGVDl, among others {Bacillus genetic stock center catalog of strains, seventh edition, volume 2), which are readily available from well known commercial sources. Alternatively, the expression cassette can be incorporated into the Bt genome, either on the chromosome or into a native Bt plasmid. Incorporation into the Bt genome can be accomplished using standard molecular biology techniques known to those skilled in the art, using for example transposons, bacteriophage, or homologous recombination with linear or circular DNA.
The expression vector can be introduced into Bt by electroporation or another method of nucleic acid transfer used by those skilled in the art. "Electroporation" is the exposure of cells to rapid pulses of high- voltage current which renders the membrane of the cells permeable, thus allowing uptake, incorporation, and expression of DNA.
The host for the expression vector can be any Bacillus ihuringiensis strain including those Bt strains used to make commercial insecticides. The Bt host strain can be selected from any subspecies including Bacillus thuringiensis subsp. aizawai, Bacillus thuringiensis subsp. galleriae, Bacillus thuringiensis subsp. entomocidus, Bacillus thuringiensis subsp. tenebrionis, Bacillus thuringiensis subsp. thuringiensis, Bacillus thuringiensis subsp. alesti, Bacillus thuringiensis subsp. canadiensis, Bacillus thuringiensis subsp. darmstadiensis, Bacillus thuringiensis subsp. dendrolimus, Bacillus thuringiensis subsp.finitimus, Bacillus thuringiensis subsp. kenyae, Bacillus thuringiensis subsp. monisoni, Bacillus thuringiensis subsp. subtoxicus, Bacillus thuringiensis subsp. toumanoffi, Bacillus thuringiensis subsp. pondicheriensis, Bacillus thuringiensis subsp. shandogiensis, Bacillus thuringiensis subsp. sotto, Bacillus thuringiensis subsp. nigeriae, Bacillus thuringiensis subsp. yunnanensis, Bacillus thuringiensis subsp. dάkota, Bacillus thuringiensis subsp. indiana, Bacillus thuringiensis subsp. tohokuensis, Bacillus thuringiensis subsp. kumamotoensis, Bacillus thuringiensis subsp. tochigiensis, Bacillus thuringiensis subsp. thompsoni, Bacillus thuringiensis subsp. wuhanensis, Bacillus thuringiensis subsp. kyushuensis, Bacillus thuringiensis subsp. ostriniae, Bacillus thuringiensis subsp. tolworthi, Bacillus thuringiensis subsp. pakistani, Bacillus thuringiensis subsp. japonensis, Bacillus thuringiensis subsp. colmeri, Bacillus thuringiensis subsp. pondicheriensis, Bacillus thuringiensis subsp. shandongiensis, Bacillus thuringiensis subsp. neoleonensis, Bacillus thuringiensis subsp. coreanensis, Bacillus thuringiensis subsp. silo, Bacillus thuringiensis subsp. mexcanensis, Bacillus thuringiensis subsp. israelensis, Bacillus thuringiensis subsp. berliner, Bacillus thuringiensis subsp. cameroun, Bacillus thuringiensis subsp. ongbei, Bacillus thuringiensis subsp. fukuokaensis, Bacillus thuringiensis subsp. higo, Bacillus thuringiensis subsp. israelensis, Bacillus thuringiensis subsp. japonensis Buibui, Bacillus thuringiensis subsp. jegathesan, Bacillus thuringiensis subsp. kenyae, Bacillus thuringiensis subsp. kunthala, Bacillus thuringiensis subsp. medellin, Bacillus thuringiensis subsp. roskildiensis, Bacillus thuringiensis subsp. san diego, Bacillus thuringiensis subsp. shanghai, Bacillus thuringiensis subsp. sotto, Bacillus thuringiensis subsp. tenebrionis, and Bacillus thuringiensis subsp. thompsoni. Many of the above- listed strains may be obtained from commercial sources including the American Type Culture Collection, the U.S. Department of Agriculture, the Ohio State University Bacillus Genetic Stock Center and others that are well known to those of skill in the art.
In addition to introducing expression vectors of the present invention into any Bacillus thuringiensis strain, Bacillus thuringiensis strains expressing fusion proteins may be constructed by homologous recombination of the second peptide coding into the endogenous spore coat gene such that the second peptide coding region is in frame with the spore coat gene reading frame to produce a single polypeptide. The sequences of the present invention may be used as regions of homology to allow recombination into any desired Bacillus thuringiensis strain. In a further aspect, the present invention provides a means of controlling insects comprising delivering to the insects an effective amount of an insecticidal product according to the present invention. Preferably, the insecticidal protein and recombinant spore mixture is delivered to the insects orally. Recombinant Bt strains can be fermented industrially and formulated into a composition suitable for the desired use. Insecticidal Bt strains can be formulated into granules, droplets, wettable granules, powder, wettable powder, and aqueous-based formulation, or other appropriate formulations known to those of skill in the art.
The formulated Bt is delivered to the target insect pests on their locations, including the appropriate crop, turf, or body of water among others. The formulated insecticide is applied using a suitable procedure and application rate. The "application rate" is defined as the total pounds of the pesticide active ingredient applied to the selected crop or site. Preferred application rates can be between 0.01 and 10 pounds per acre depending on the insect pest and the insecticide.
Isolates of Bt have been identified that control larvae of lepidopteran, dipteran, and coleopteran insects. The term "control" as used herein, means to kill or inhibit feeding. According to preferred embodiments, the target insects of the present invention are lepidopteran and coleopteran insect pests, and particularly lamellicorn beetles (Scarabaeidae), although other insects can be targeted.
As discussed above, other Bacillus species, other than Bt, are contemplated for use in the present invention. For example, a Bt strain called Bacillus israelensis, commonly used to control mosquitoes, is not very active against certain mosquito species while the toxin produced by another mosquito pathogenic bacterium, Bacillus sphaericus, complements the weakness of B. israelensis. B. sphaericus produces a number of mosquitocidal proteins. The methods of the present invention allow for the expression of one or more B. sphaericus mosquitocidal proteins on the surface of B. israelensis spores. The resulting recombinant spores will have an improved spectrum of mosquitocidal activity to control a wide variety of human disease mosquito vectors.
Bt spores are also useful for the production and immobilization of enzymes or proteins for industrial use. That is, the Bt spores find use as an industrial delivery platform for enzymes, binding and capture molecules, and detector reagents. In industrial biocatalysis, the spore may be decorated with a required enzymatic activity. In some instances, production synthesis can be performed that may be otherwise impossible in single organism fermentation runs. Enzymes of industrial relevance may be assembled into the spore outer and inner coat layers as fusion proteins. The modified or recombinant spores can be assayed for expression, stability, and activity. Immobilization of the spore can be accomplished by attachment of modified or recombinant spores to any type of solid support. Appropriate solid supports include, but are not limited to, beads, glass beads, metal beads, membranes, gels, microtiter plates, vessels, containers, pellets, and polymers. Immobilization of the spore system allows repeated uses of the immobilized spore system, although mobile spores may also be reused.
Spore display systems of the present invention can be used as the source of a wide variety of enzymes and non-enzyme polypeptides having industrial, biomedical, and biotechnological uses. The polypeptides to be displayed, incorporated, or expressed may originate in any species and can be either mononieric or multimeric. Such polypeptides may be enzymes that are useful in detergent formulations, such as lipases, proteases, amylases, and the like. Alternatively, such polypeptides may be enzymes that are useful for a variety of industrial or biosynthetic processes. Such enzymes include, but are not limited to, glucose oxidase, galactosidase, glucosidase, nitrilase, alkene monooxygenase, hydroxylase, aldehyde reductase, alcohol dehydrogenase, D-hydantoinase, D- carbamoylase, L-hydantoinase, L-decarbamoylase, beta-tyrosinase, dioxygenase, serine hydroxy-methyltransferase, carbonyl reductase, nitrile hydratase, o-phthalyl amidase, halohydrin hydrogen-halide lyase, maltooligosyl trehalose synthase, maltooligosyl trehalose trehalohydrolase, lactonase, oxygenase, adenosylmethionine synthetase, cephalosporinase, fucosidase, adenosylhomocysteine hydrolase, peroxidase, nucleoside phosphorylase, hemicellulase, cyclodextrin glycosyltransferase, oxidase, endoglucanase, polygalacturonase, amylase, glutamyl endopeptidase, xylanase, laccase, phenol oxidase, cellulase, lactate oxidase, neuraminidase, ribonuclease, lipase, esterase, aldolase, oxynitrilase, lyase, protease, acylase, glucose isomerase, amidase, phosphotransferase, kinase, dephosphorylase, phosphatase, epoxide hydrolase, P450 monooxygenase, toluene monooxygenase, methane monooxygenase, and other enzymes. Such enzymes are known in the art; see, for example, Ogawa and Shimizu (1999), Trends in Biotechnology 17:13- 20; Singh et al. (2000), J. Appl. Microbiol. 88(6):975-982, and references cited therein. Enzymes that may be used in spore systems of the present invention include proteins that interfere with mammalian cell viability or protein assembly in mammalian cell expression systems, such as retinoblastoma protein and leptin. Other examples of enzymes suitable for use in the present invention are listed in Table 1 below.
The transformation of a substrate to a desired product in biocatalytic pathway is often a multi-step process requiring multiple enzymes. One of the limiting factors in this kind of enzymatic transformation is the substrate concentration for the intermediate steps. Individual intermediate substrates for transformation into the product each represent a potential limiting component of the entire chemical transformation. The recombinant spores can be used to locally increase the substrate concentrations and thereby greatly increase the reaction rates of each of the intermediate steps increasing yields. In this manner, the different enzymes needed for a particular biocatalytic transformation can all be displayed on a single spore. As discussed in more detail below, there are numerous sites on spores where enzymes can be displayed and many enzymes can be positioned on the same spore. The proximity of catalytic centers acts to increase substrate concentration and enhance the completion rate of multi-step enzymatic transformations.
The topology of the spore surface is highly structured and provides a highly ordered three-dimensional lattice structure. That is, the different coat proteins occupy a specific predetermined and assembled location with respect to each other. This lattice structure defines a certain degree of proximity or distance from coat protein to coat protein. Thus, by cloning the enzymes of a biocatalytic reaction of interest in different locations on the spore coat, the optimal degree of topological proximity for each enzyme leading to the most advantageous production level can be assessed. In this manner, spores can be assembled to maximize biocatalytic reactions.
An enzyme expressed on the surface of the spore is easily removed from the enzyme reaction mixture by simple sedimentation or centrifugation, washed and re-used. AU of these usages are made possible by immobilizing the enzyme on the surface of the Bt spores, such immobilization occurring by means of the enzyme's covalent linkage to a spore outer coat protein or exosporium protein. No special formulation of the spore enzyme is needed. The enzyme attached on the surface of the Bt spore is very stable. Often no refrigeration is needed for long-term storage. Once the recombinant Bt that is capable of expressing an enzyme on the surface is made, it can be produced in an industrial fermentor tank (bioreactor). A simple fermentation media like nutrient broth or a complex medium like soybean flour with starch with or without a proper sporulation- supporting ingredient consisting of magnesium, manganese, iron, calcium salts can be used. Once Bt sporulates, cells lyse, and free spores are released into the culture medium, the spores may be harvested by centrifuging the fermentation broth and washing the pellet in a proper solution like 50 mM potassium phosphate buffer, pH 7.
Table 1
Enzyme Utility (i.e., Reaction Catalyzed)
Lipase Ester hydrolysis, ester formation, ester aminolysis
Esterase Ester hydrolysis and formation
Protease Ester, amide hydrolysis, ester aminolysis, peptide synthesis
Nitrilase/ nitrile hydratase Nitrile hydrolysis
Epoxide hydrolase Hydrolysis of epoxides
Phosphatase/kinase Hydrolysis of phosphate esters
Haloalkane dehalogenase Hydrolysis of haloalkanes
Glycosidase Oligosaccharide formation
Dehydrogenase Reduction of aldehydes and ketones
Enolate reductase Reduction of enones, D, D- unsaturated esters
Mono-oxygenase Hydroxylation, Baeyer-Villiger reactions, epoxidation
Di-oxygenase Dihydroxylation of aromatics
Peroxidase Peroxidation, epoxidation
Aldolase Aldol reaction in water One of skill in the art can readily obtain the gene sequences of the above enzymes and other enzymes suitable for use in the present invention by referring to public sources including government and university databases and publications including various scientific journals and other sources well known to those of skill in the art.
The methods of the present invention confer several advantages in the use of enzymes including: enabling simple process design using enzymes, low initial investment and operational costs; robustness in presence of organic solvents; stable in storage, under mechanical stress and/or high temperatures; high rate of recovery of the enzyme(s) following the industrial process for re-use; one vessel process with mixes of different spore-enzyme products; reducing part of customer's operational costs (less inventory and enzyme waste, higher enzyme recovery rate, stable input products); higher process yields (higher enzyme stability and better control of optimal process conditions e.g., enzyme concentration etc.); improvement of overall product quality (e.g. easy removal of enzyme from the final product — competitive advantage for customer); co-factors could be part of the spore-enzyme design (multiple components display on spore); and multi-catalyst reaction center could be implemented in one spore design. Generally, the recombinant spores of the invention can be used in many industrial settings including, industrial fermentation reactions, industrial column reactors, cleanups, bioremediation of organic solvents and heavy metals, as delivery systems in agricultural applications, and the like. Thus, one of skill in the art recognizes that the enzyme will vary depending upon the application.
Yet another application of the present invention is the use of the recombinant Bt spores as a vaccine. One or more proteins that have one or more desired antigenic qualities may be expressed on the surface of Bt spores. The recombinant Bt spores expressing the one or more antigens can be produced in a fermentor tank as described above. The recombinant spores are harvested from the fermentation broth, washed and suspended in water or phosphate buffered saline. Such a suspension may be formulated using suitable pharmaceutical excipients, adjuvants, and other materials well known to those of skill in the art and injected in animals or humans to immunize them. Alternatively, the recombinant Bt spores expressing an antigen on the surface are dried by spray drying or freeze drying. Animals or humans can inhale such a dry spore formulation and absorb the spore vaccine through the respiratory system. Examples of diseases in which the methods of the present invention are directed to include: Marek disease, (MDV) Herpes Virus; Infectious bronchitis disease: (IBV); Infectious Larygotracheitis, (ILV) Herpes Virus; Infectious Bursal Disease, (IBV) Birna Virus; Newcastle Disease: (ND); Encephalomyelitis; Fowl Pox; Reovirus; Avian Flu, strain N5H1 flu; Mycoplasma; Cholera; Anthrax, Bubonic Plague; and Coccidia, Eimeria and Isospora. The methods confer several advantages including: the recombinant Bt spores may be administered in food or via mucosal surfaces (nose, gills, etc.) by spray, that is, no injection with a syringe is needed; versatile system allowing the presentation of several antigens in one vaccine preparation therefore, conferring protection against multiple pathogens via one vaccine treatment; low development costs; and the recombinant Bt spores themselves may be used as adjuvants and/or enhancers of innate immunity, in conjunction with expressed antigens on their surface.
The disease-associated antigens include, but are not limited to, toxins, virulence factors, cancer antigens, such as tumor-associated antigens expressed on cancer cells, antigens associated with autoimmunity disorders, antigens associated with inflammatory conditions, antigens associated with allergic reactions, antigens associated with infectious agents, and autoantigens that play a role in induction of autoimmune diseases.
Examples of cancer antigens that can be used with spore systems and methods of the invention include, but are not limited to, Among the tumor-specific antigens that can be used in the antigen shuffling methods of the invention are: bullous pemphigoid antigen 2, prostate mucin antigen (PMA) (Beckett and Wright (1995) Int. J. Cancer 62: 703-710), tumor associated Thomsen-Friedenreich antigen (Dahlenborg et al. (1997) Int. J. Cancer 70: 63-71), prostate-specific antigen (PSA) (Dannull and Belldegrun (1997) Br. J. Urol. 1: 97-103), EpCam/KSA antigen, luminal epithelial antigen (LEA.135) of breast carcinoma and bladder transitional cell carcinoma (TCC) (Jones et al. (1997) Anticancer Res. 17: 685-687), cancer-associated serum antigen (CASA) and cancer antigen 125 (CA 125) (Kierkegaard et al. (1995) Gynecol. Oncol. 59: 251-254), the epithelial glycoprotein 40 (EGP40) (Kievit et al. (1997) Int. J. Cancer 71: 237-245), squamous cell carcinoma antigen (SCC) (Lozza et al. (1997) Anticancer Res. 17: 525-529), cathepsin E (Mota et al. (1997) Am. J. Pathol. 150: 1223-1229), tyrosinase in melanoma (Fishman et al. (1997) Cancer 79: 1461-1464), cell nuclear antigen (PCNA) of cerebral cavernomas (Notelet et al. (1997) Surg Neurol. 47: 364-370), DF3/MUC1 breast cancer antigen (Apostolopoulos et al. (1996) Immunol. Cell. Biol. 74: 457-464; Pandey et al. (1995) Cancer Res. 55: 4000-4003), carcinoembryonic antigen (Paone et al. (1996) J. Cancer Res. Clin. Oncol. 122: 499-503; Schlom et al. (1996) Breast Cancer Res. Treat. 38: 27-39), tumor- associated antigen CA 19-9 (Tolliver and O'Brien (1997) South Med. J. 90: 89-90; Tsuruta et al. (1997) Urol. Int. 58: 20-24), human melanoma antigens MART-1/Melan- A27-35 and gplOO (Kawakami and Rosenberg (1997) Int. Rev. Immunol. 14: 173-192; Zajac et al. (1997) Int. J. Cancer 71 : 491-496), the T and Tn pancarcinoma (CA) glycopeptide epitopes (Springer (1995) Crit. Rev. Oncog. 6: 57-85), a 35 kD tumor- associated autoantigen in papillary thyroid carcinoma (Lucas et al. (1996) Anticancer Res. 16: 2493-2496), KH-I adenocarcinoma antigen (Deshpande and Danishefsky (1997) Nature 387: 164-166), the A60 mycobacterial antigen (Maes et al. (1996) J. Cancer Res. Clin. Oncol. 122: 296-300), heat shock proteins (HSPs) (Blachere and Srivastava (1995) Semin. Cancer Biol. 6: 349-355), and MAGE, tyrosinase, nielan-A and gp75 and mutant oncogene products (e.g., p53, ras, and HER-2/neu (Bueler and Mulligan (1996) MoI. Med. 2: 545-555; Lewis and Houghton (1995) Semin. Cancer Biol. 6: 321-327; Theobald et al. (1995) Proc. Nat'l. Acad. Sci. USA 92: 11993-11997).
In one aspect, the invention provides spore systems displaying at least one rotavirus capsid protein VP4, VP6, or VP7. Such spore systems are useful in methods for inducing an immune response against a VP4, VP6, or VP7 rotavirus, respectively.
Additional viral antigens that can be used with spore systems of the invention, methods for modulating immune responses against diseases and disorders associated with such antigens, and vaccines comprising spore systems, include, but are not limited to, hepatitis B capsid protein, hepatitis C capsid protein, hepatitis A capsid protein, Norwalk diarrheal virus capsid protein, influenza A virus N2 neuraminidase (Kilbourne et al. (1995) Vaccine 13: 1799-1803); Dengue virus envelope (E) and premembrane (prM) antigens (Feighny et al. (1994) Am. J. Trop. Med. Hyg. 50: 322-328; Putnak et al. (1996) Am. J. Trop. Med. Hyg. 55: 504-10); HIV antigens Gag, Pol, Vif andNef (Vogt et al. (1995) Vaccine 13: 202-208); HIV antigens gpl20 and gpl60 (Achour et al. (1995) Cell. MoI. Biol. 41:395-400; Hone et al. (1994) Dev. Biol. Stand. 82: 159-162); gp41 epitope of human immunodeficiency virus (Eckhart et al. (1996) J. Gen. Virol. 77:2001-2008); rotavirus antigen VP4 (Mattion et al. (1995) J. Virol. 69:5132-5137); the rotavirus protein VP7 or VP7sc (Emslie et al. (1995) J. Virol. 69: 1747-1754; Xu et al. (1995) J. Gen. Virol. 76: 1971-1980; Chen et al. (1998) Journal of Virology VoI 72:7; pp 5757-5761); herpes simplex virus (HSV) glycoproteins gB, gC, gD, gE, gG, gH, and gl (Fleck et al. (1994) Med. Microbiol. Immunol. (Berl) 183: 87-94 (Mattion, 1995); Ghiasi et al. (1995) Invest. Ophthalmol. Vis. Sci. 36: 1352-1360; McLean et al. (1994) J. Infect. Dis. 170: 1100-1109); immediate-early protein ICP47 of herpes simplex virus-type 1 (HSV-I) (Banks et al. (1994) Virology 200:236-245); immediate-early (IE) proteins ICP27, ICPO, and ICP4 of herpes simplex virus (Manickan et al. (1995) J. Virol. 69: 4711-4716); influenza virus nucleoprotein and hemagglutinin (Deck et al. (1997) Vaccine 15: 71-78; Fu et al. (1997) J. Virol. 71: 2715-2721); B19 parvovirus capsid proteins VPl (Kawase et al. (1995) Virology 211: 359-366) or VP2 (Brown et al. (1994) Virology 198: 477-488); Hepatitis B virus core and e antigen (Schodel et al. (1996) Intervirology 39: 104-106); hepatitis B surface antigen (Shiau and Murray (1997) J. Med. Virol. 51: 159-166); hepatitis B surface antigen fused to the core antigen of the virus (Id.); Hepatitis B virus core-preS2 particles (Nemeckova et al. (1996) Acta Virol. 40: 273-279); HBV preS2-S protein (Kutinova et al. (1996) Vaccine 14: 1045-1052); VZV glycoprotein I (Kutinova et al. (1996) Vaccine 14: 1045-1052); rabies virus glycoproteins (Xiang et al. (1994) Virology 199: 132-140; Xuan et al. (1995) Virus Res. 36: 151-161) or ribonucleocapsid (Hooper et al. (1994) Proc. Nat'l. Acad. Sci. USA 91: 10908-10912); human cytomegalovirus (HCMV) glycoprotein B (UL55) (Britt et al. (1995) J. Infect. Dis. 171: 18-25); the hepatitis C virus (HCV) nucleocapsid protein in a secreted or a nonsecreted form, or as a fusion protein with the middle (pre-S2 and S) or major (S) surface antigens of hepatitis B virus (HBV) (Inchauspe et al. (1997) DNA Cell Biol. 16: 185-195; Major et al. (1995) J. Virol. 69: 5798-5805); the hepatitis C virus antigens: the core protein (pC); El (pEl) and E2 (pE2) alone or as fusion proteins (Saito et al. (1997) Gastroenterology 112: 1321-1330); the gene encoding respiratory syncytial virus fusion protein (PFP-2) (Falsey and Walsh (1996) Vaccine 14: 1214-1218; Piedra et al. (1996) Pediatr. Infect. Dis. J. 15: 23-31); the VP6 and VP7 genes of rotaviruses (Choi et al. (1997) Virology 232: 129-138; Jin et al. (1996) Arch. Virol. 141: 2057-2076); the El, E2, E3, E4, E5, E6 and E7 proteins of human papillomavirus (Brown et al. (1994) Virology 201: 46-54; Dillner et al. (1995) Cancer Detect. Prev. 19:381-393; Krul et al. (1996) Cancer Immunol. Immunother. 43: 44-48; Nakagawa et al. (1997) J. Infect. Dis. 175: 927-931); a human T- lymphotropic virus type I gag protein (Porter et al. (1995) J. Med. Virol. 45: 469-474); Epstein-Barr virus (EBV) gp340 (Mackett et al. (1996) J. Med. Virol. 50:263-271); the Epstein-Barr virus (EBV) latent membrane protein LMP2 (Lee et al. (1996) Eur. J. Immunol. 26: 1875-1883); Epstein-Barr virus nuclear antigens 1 and 2 (Chen and Cooper (1996) J. Virol. 70: 4849-4853; Khanna et al. (1995) Virology 214: 633-637); the measles virus nucleoprotein (N) (Fooks et al. (1995) Virology 210: 456-465); and cytomegalovirus glycoprotein gB (Marshall et al. (1994) J. Med. Virol. 43: 77-83) or glycoprotein gH (Rasmussen et al. (1994) J. Infect. Dis. 170: 673-677).
Examples of medical conditions and/or diseases where down-regulation or decreased immune response is desirable include, but are not limited to, allergy, asthma, autoimmune diseases (e.g., rheumatoid arthritis, SLE, diabetes mellitus, myasthenia gravis, reactive arthritis, ankylosing spondylitis, and multiple sclerosis), septic shock, organ transplantation, and inflammatory conditions, including IBD, psoriasis, pancreatitis, and various immunodeficiencies. Autoimmune diseases and inflammatory conditions are often characterized by an accumulation of inflammatory cells, such as lymphocytes, macrophages, and neutrophils, at the sites of inflammation. Altered cytokine production levels are often observed, with increased levels of cytokine production. Several autoimmune diseases, including diabetes and rheumatoid arthritis, are linked to certain MHC haplotypes. Other autoimmune-type disorders, such as reactive arthritis, have been shown to be triggered by bacteria such as Yersinia and Shigella, and evidence suggests that several other autoimmune diseases, such as diabetes, multiple sclerosis, rheumatoid arthritis, may also be initiated by viral or bacterial infections in genetically susceptible individuals. Examples of antigens for use in spore systems and methods of the invention to treat autoimmune diseases, inflammatory conditions, and other immunodeficiency-associated conditions are provided in Punnonen et al. (1999) WO 99/41369; Punnonen et al. (1999) WO 99/41383; Punnonen et al. (1999) WO 99/41368; and Punnonen et al. (1999) WO 99/41402), each of which is incorporated herein by reference for all purposes.
For treatment or prevention of such diseases or conditions, spore systems comprising one or more polypeptides, proteins, peptides, or nucleic acids capable of reducing or suppressing an immune response (e.g., antigens specific for or associated with a disease), such as T cell proliferation or activation, can be administered according to the methods described herein.
For example, in another aspect, the invention provides spore systems and vaccines for treating allergies, and prophylactic and therapeutic treatment methods utilizing such spore systems and vaccines. Antigens of allergens can be incorporated into spore systems as, e.g., using one of the display, presentation, or attachment formats described above so as to display, present, bind or express the antigen on the surface of a spore. The antigen can also be expressed on the spore surface by, e.g., incorporating a DNA plasmid vector comprising a nucleotide sequence encoding the antigen into the spore and facilitating expression of the antigen on the spore surface.
Examples of allergies that can be treated using methods and spore systems of the invention include, but are not limited to, allergies against house dust mite, grass pollen, birch pollen, ragweed pollen, hazel pollen, cockroach, rice, olive tree pollen, fungi, mustard, bee venom. Antigens of interest include those of animals, including the mite (e.g., Dermatophagoides pteronyssinus, Dermatophagoides farinae, Blomia tropicalis), such as the allergens der pi (Scobie et al. (1994) Biochem. Soc. Trans. 22: 448S; Yssel et al. (1992) J. Immunol. 148: 738-745), der p2 (Chua et al. (1996) Clin. Exp. Allergy 26: 829-837), der p3 (Smith and Thomas (1996) Clin. Exp. Allergy 26: 571-579), der p5, der p V (Lin et al. (1994) J. Allergy Clin. Immunol. 94: 989-996), der ρ6 (Bennett and Thomas (1996) Clin. Exp. Allergy 26: 1150-1154), der p 7 (Shen et al. (1995) Clin. Exp. Allergy 25: 416-422), der f2 (Yuuki et al. (1997) Int. Arch. Allergy Immunol. 112: 44- 48), der β (Nishiyama et al. (1995) FEBS Lett. 377: 62-66), der f7 (Shen et al. (1995) Clin. Exp. Allergy 25: 1000-1006); Eur m 1 and Eur m 2; Mag 3 (Fujikawa et al. (1996) MoI. Immunol. 33: 311-319). Also of interest as antigens for use with the invention are the house dust mite allergens Tyr p2 (Eriksson et al. (1998) Eur. J. Biochem. 251: 443- 447), Lep dl (Schmidt et al. (1995) FEBS Lett. 370: 11-14), and glutathione S- transferase (O'Neill et al. (1995) Immunol Lett. 48: 103-107); the 25,589 Da, 219 amino acid polypeptide with homology with glutathione S-transferases (O'Neill et al. (1994) Biochim. Biophys. Acta. 1219: 521-528); BIo t 5 (Arruda et al. (1995) Int. Arch. Allergy Immunol. 107: 456-457); bee venom phospholipase A2 (Carballido et al. (1994) J. Allergy Clin. Immunol. 93: 758-767; Jutel et al. (1995) J. Immunol. 154: 4187-4194); bovine dermal/dander antigens BDA 11 (Rautiainen et al. (1995) J. Invest. Dermatol. 105: 660-663) and BDA20 (Mantyjarvi et al. (1996) J. Allergy Clin. Immunol. 97: 1297-1303); the major horse allergen Equ cl (Gregoire et al. (1996) J. Biol. Chem. 271: 32951-32959); Jumper ant M. pilosula allergen Myr p I and its homologous allergenic polypeptides Myr p2 (Donovan et al. (1996) Biochem. MoI. Biol. Int. 39: 877-885); 1-13, 14, 16 kD allergens of the mite Blomia tropicalis (Caraballo et al. (1996) J. Allergy Clin. Immunol. 98: 573-579); the cockroach allergens BIa g Bd90K (Helm et al. (1996) J. Allergy Clin. Immunol. 98: 172-80) and BIa g 2 (Arruda et al. (1995) J. Biol. Chem. 270: 19563- 19568); the cockroach Cr-PI allergens (Wu et al. (1996) J. Biol. Chem. 271: 17937- 17943); fire ant venom allergen, Sol i 2 (Schmidt et al. (1996) J. Allergy Clin. Immunol. 98: 82-88); the insect Chironomus thummi major allergen Chi 1 1-9 (Kipp et al. (1996) Int. Arch. Allergy Immunol. 110: 348-353); dog allergen Can f 1 or cat allergen FeI d 1 (Ingram et al. (1995) J. Allergy Clin. Immunol. 96: 449-456); albumin, derived, for example, from horse, dog or cat (Goubran Botros et al. (1996) Immunology 88: 340-347); deer allergens with the molecular mass of 22 kD, 25 kD or 60 kD (Spitzauer et al. (1997) Clin. Exp. Allergy 27: 196-200); and the 20 kd major allergen of cow (Ylonen et al. (1994) J. Allergy Clin. Immunol. 93: 851-858). Therapeutic and prophylactic agents and vaccines against food allergens and treatment methods for food allergies can also be developed using spore systems and the methods of the invention. Suitable antigens for development of such vaccines include, for example, profilin (Rihs et al. (1994) Int. Arch. Allergy Immunol. 105: 190-194); rice allergenic cDNAs belonging to the alpha-amylase/trypsin inhibitor gene family (Alvarez et al. (1995) Biochim Biophys Acta 1251: 201-204); the main olive allergen, Ole e I (Lombardero et al. (1994) Clin Exp Allergy 24: 765-770); Sin a 1, the major allergen from mustard (Gonzalez De La Pena et al. (1996) Eur J Biochem. 237: 827-832); parvalbumin, the major allergen of salmon (Lindstrom et al. (1996) Scand. J. Immunol. 44: 335-344); apple allergens, such as the major allergen MaI d 1 (Vanek-Krebitz et al. (1995) Biochem. Biophys. Res. Commun. 214: 538-551); and peanut allergens, such as Ara h I (Burks et al. (1995) J. Clin. Invest. 96: 1715-1721).
In another embodiment, a Bt spore is engineered to express a binding molecule, such as avidin or streptavidin, on its surface. With such spores, a wide variety of biotinylated molecules, including, e.g., polypeptides, proteins, peptides, nucleic acids, polysaccharides, bacteria, viruses, small chemical or biological molecules, and other molecules as described herein, can be bound. In such formats, the spore serves as a carrier or delivery device. Thus, in one aspect, the invention provides protein-based vaccine and immunomodulatory compositions comprising spores and spore systems expressing such binding molecules with immunomodulatory molecules or protein-based vaccines bound thereto for use in therapeutic or prophylactic applications.
The spores themselves can be used as an adjuvant for immunomodulatory molecules or vaccines (e.g., genetic vaccines, DNA vaccines, protein vaccines, attenuated or killed viral vaccines). For use as adjuvants, the spores can be modified or recombinant spores, non-modified or non-recombinant spores. Furthermore, for use as adjuvants, any such spores can be viable or non-viable. As used herein, an "adjuvant" is a compound that acts in a non-specific manner to augment specific immunity (e.g., an immune response) to an immunomodulatory molecule, such as, e.g., an immunogenic polypeptide or peptide or antigen, by stimulating an earlier, stronger or more prolonged response to an immunomodulatory molecule. By "adjuvant effect" is intended an augmentation or increase in immunity to an immunomodulatory molecule (e.g., an antigen). See Warren (1992) Roitt et al. eds. Encyclopedia of Immunology 1:28-30. In certain embodiments, the Bt spore serves as an adjuvant, acting in a non¬ specific manner to enhance specific immunity to the immunomodulatory molecule or vaccine by stimulating an earlier, stronger or more prolonged response to the immunomodulatory molecule or vaccine. The spores may comprise viable spores or non¬ viable or non-germinating spores. The immunomodulatory molecule may comprise, e.g., an immunogenic protein, polypeptide, or peptide; or antigen or fragment thereof; a nucleic acid having immunomodulatory properties; or a nucleotide sequence encoding an immunomodulatory molecule; or the like. The vaccine may comprise, e.g., a genetic vaccine, DNA vaccine, protein-vaccine, or attenuated or killed viral vaccine. hi other embodiments, the enhanced immune response comprises an increased production of antibodies specific to the immunomodulatory protein, polypeptide, peptide or antigen that is readily measured by known assays, including those described herein (e.g., ELISA, etc.). Additionally, spores can be prepared that express other immunostimulatory molecules or other molecules involved in determining vaccine effectiveness, such as, e.g., cytokines (e.g., interleukins (IL), interferons (IFN), chemokines, hematopoietic growth factors, tumor necrosis factors and transforming growth factors), which are small molecular weight proteins that regulate maturation, activation, proliferation and differentiation of the cells of the immune system. Such molecules serve as additional immunostimulators for the administered immunomodulatory molecule, protein-based vaccine, DNA vaccine, or viral vaccine.
Cytokines suitable for use in the invention include IL-I, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-IO, IL-I l, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, GM-CSF, G-CSF, TNF-O, IFN-D, IFN-65 , and IL-20 (MDA-7). Antagonists of such cytokines can also be expressed on spores for use as therapeutic and/or prophylactic agents in immunomodulatory methods described herein.
Furthermore, Bt spores can be prepared that express co-stimulatory molecules that play a fundamental role in the regulation of immune responses. Generally speaking, a "co-stimulatory molecule" refers to a molecule that acts in association or conjunction with, or is involved with, a second molecule or with respect to an immune response in a co-stimulatory pathway. In one aspect, a co-stimulatory molecule may be an immunomodulatory molecule that acts in association or conjunction with, or is involved with, another molecule to stimulate or enhance an immune response, hi another aspect, a co-stimulatory molecule is immunomodulatory molecule that acts in association or conjunction with, or is involved with, another molecule to inhibit or suppress an immune response. A co-stimulatory molecule need not act simultaneously with or by the same mechanism as the second molecule. Some such co-stimulatory molecules comprise co- stimulatory polypeptides that have positive co-stimulatory properties, such as the ability to stimulate or augment T cell activation and/or proliferation. Membrane-bound co- stimulatory molecules include CDl, CD40, CD 154 (ligand for CD40), CD40 ligand, CD27, CD80 (B7-1), CD86 (B7-2) and CD150 (SLAM), and variants or mutants thereof. May such co-stimulatory molecules are typically expressed on lymphoid cells after activation via antigen recognition or through cell-cell interactions.
As indicated above, heterologous antigens, polypeptides, proteins, and peptides can be attached to the spore outer-coat by creating genetic fusions between outer-coat proteins and target antigens, polypeptides, proteins, or peptides. With the various different coat proteins to attach and display proteins, polypeptides, or peptides, it is recognized that such proteins, polypeptides, or peptides may be displayed in a manner to stretch or torque such sequences, e.g., to expose internal domain surfaces or to change enzyme or antigenic activities. The protein, polypeptide, or peptide of interest can be fused to one coat protein at the amino terminal, may be fused to a coat protein at the carboxyl terminal, may be fused to one coat protein at the amino terminal and a second coat protein at the carboxyl terminal, or may be internally fused to a coat protein. When attached at both ends, as the two coat proteins are assembled into the spore coat, the central protein, polypeptide, or peptide of interest will be stretched.
The invention also provides a spore system comprising one or more combinations of any one of the following components: nucleic acids, polypeptides, proteins, peptides, antigens, co-stimulatory agents, immunomodulatory molecules, adjuvants, cytokines, any of the biotinylated molecules bound to the spore surface via streptavidin or avidin as described above, or other molecules of interest. Such components can be, e.g., displayed on, presented on, bound or attached to the spore surface, encapsulated or contained with the spore, associated with the spore, carried or held by the spore, or coated onto the spore surface. Such combinations of multiple components and different components are especially useful in methods of modulating immune responses. For example, the use of an antigen and co-stimulatory molecule or cytokine in conjunction with one another can augment the immunostimulatory response, since both types of molecules are integral to responses. Similarly, the use of an adjuvant with an antigen and adjuvant can dramatically increase the immunostimulatory effectiveness of the antigen. Spore systems can be made to comprise selected combinations of such molecules dependent upon the specific application and treatment protocol. Methods of modulating immune response in a subject by administering such spore systems or compositions thereof in an amount sufficient to modulate the response are also included.
Generally, proteins or polypeptides or peptides suitable for use in the present invention include full-length native proteins, partial proteins or protein fragments, or peptides or polypeptides or polypeptide fragments. Proteins and polypeptides include suitable biologically active variants of native or naturally occurring proteins and can be fragments, analogues, and derivatives of such proteins. Such biological activity may be any biological activity. For example, such biological activity may be insecticidal activity, or enzymatic activity, or it may be the ability to alter or modulate an immune response in a subject. Thus, a polypeptide, protein, or peptide of the present invention may be an enzyme, such as, for example, lactase. In another embodiment, a polypeptide, protein, or peptide of the present invention is molecule capable of augmenting an immune response, such as, e.g., an antigen or an adjuvant. In yet another embodiment, polypeptide, protein, or peptide may be an insecticide. Polypeptides, proteins, and peptides of interest include, but are not limited to, insecticidal protein toxins, cytokines, antigens, antibodies, binding receptors, defensive agents, anti-microbial agents, immunomodulatory molecules, co- stimulatory molecules, enzymes, and epitopes.
Methods for administering spore systems, spore display systems, and spore encapsulate systems of the present invention include those known to those having ordinary skill in the art. Suitable routes of administration or "delivery systems" include parenteral delivery and enteral delivery, such as, for example, oral, transdermal, transmucosal, intravenous, subcutaneous, intramuscular, intradermal, intraperitoneal, intracapsular, intraspinal, intrasternal, intrapulmonary, intranasal, vaginal, rectal, intraocular, and intrathecal, buccal (e.g., sublingual), respiratory, topical, ingestion, and local delivery, such as by aerosol or transdermally, and the like. Methods for administering proteins, polypeptides, peptides, nucleic acids, and other molecules of interest to mucosal tissue via pulmonary inhalation, nasal, oral, vaginal, and/or rectal delivery are provided. The methods comprise preparing and administering to a subject a composition comprising a spore system of the present invention. Such composition may include a carrier or excipient. In one embodiment of the invention, a polypeptide, protein, peptide, nucleic acid, or other molecule of interest is displayed on the surface of the spore. In another embodiment, the polypeptide, protein, or peptide of interest is expressed by the vegetative cells resulting from the germination and/or vegetative reproduction of a spore. In yet another embodiment, the spore displays a polypeptide, protein, or peptide with DNA binding capabilities that is bound to a DNA molecule encoding an antigen or immunomodulatory molecule or that is an antigen or immunomodulatory molecule.
These methods of inoculation and/or immunization can also be utilized for herd animals in a field, such as cattle grazing over an extended area, or for fish in their native aquatic habitats. Subject animals also include wild animals. For example, subjects include American buffalo (bison), which often carry the disease brucellosis, which can infect humans and causes spontaneous abortions in cattle. In another embodiment, rabies vaccinations or therapeutic or prophylactic agents comprising spore systems of the invention are administered to a variety of wild animal populations in a particular area by distributing spores from an overflying plane. Thus, the present invention provides a relatively inexpensive means for vaccinating or treating wild populations against a variety of illnesses and diseases. Diseases and illnesses that are potential targets of this vaccination approach include all those described above, including, e.g., those caused by cholera (e.g., enterotoxins from V. cholerae), Japanese encephalitis, tick-borne encephalitis, Venezuelan Equine encephalitis, enterotoxins produced by Staphylococcus and Streptococcus species, and enterotoxigenic strains of E. coli (e.g., heat-labile toxin from E. coli), and salmonella toxin, shigella toxin and Campylobacter toxin, dengue fever, and hantavirus.
Distribution of the vaccine or other prophylactic or therapeutic agent comprising a spore system of the invention to fish in the aquaculture or aquarium trades can be accomplished by injection or immersion techniques. Immersion, or dipping, is an inoculation or vaccination method well known to one of skill in the art (see e.g., Vinitnantharat et al. (1999) Adv. Vet. Med. 41:539-550). A dip treatment involves dipping whole fish in a dilution of the inoculant or vaccine whereupon the inoculant or vaccine is absorbed by the gills. Intraperitoneal injection is another vaccination method well known to one of skill in the art. Injection involves anesthetizing and injecting the fish intraperitoneally (Vinitnantharat et al. (1999) Adv. Vet. Med. 41:539-550). Diseases of cultivated fish that may be treated using a spore system of the invention include, but are not limited to, infectious pancreatic necrosis (IPN), infectious hematopoietic necrosis (IHN), Vibriosis (Vibrio anguillaruni), cold-water vibriosis (Vibrio salmonicida), Vibrio ordalii, winter ulcer (Vibrio viscosus), Vibrio wodanis, yersiniosis (Yersinia ruckeri) or Enteric Red Mouth, Bacterial Kidney Disease, Furunculosis (Aeromonas salmonicida subsp. salmonicida), Saddleback, Gafkemia, Dollfustrema vaneyi, Cryptobia bullocki, Cryptobia salmositica, Listeria monocytogenes, Photobacterium damsela subsp. piscicida, Microcotyl sebastis. Fish species of interest include, but are not limited to, salmonids, including Rainbow Trout (Onchorhycus mykiss), salmon (Salmo salar), Coho salmon (Oncorhynchus kisutch), Steelhed (Oncorhynchus mykiss), rockfish (Sebastis schlegeli), catfish (Ictalurus punctatus), yellowtail, Pseudobagrus fulvidraco, Gilt-head Sea Bream, Red Drum, European Sea Bass fish, striped bass, white bass, yellow perch, whitefish, sturgeon, largemouth bass, Northern pike, walleye, black crappie, fathead minnows, and Golden Shiner minnows. Invertebrates of interest include, but are not limited to, oysters, shrimp, crab, and lobsters.
Delivery by pulmonary inhalation, nasal delivery, gill delivery, or respiratory delivery provides a promising route for absorption of polypeptides and other molecules of interest having poor oral bioavailability due to inefficient transport across the gastrointestinal epithelium or high levels of first-pass hepatic clearance. By "nasal delivery" is intended that the polypeptide is administered to the subject through the nose. By "pulmonary inhalation" is intended that the polypeptide or other substance of interest is administered to the subject through the airways in the nose or mouth so as to result in delivery of the polypeptide or other substance to the lung tissues and into the interior of the lung. Both nasal delivery and pulmonary inhalation can result in delivery of the polypeptide or other substance to the lung tissues and into the interior of the lung, also referred to herein as "pulmonary delivery." By "respiratory delivery" is intended that the polypeptide or other substance is administered to the subject through the respiratory system of the subject so as to result in delivery of the polypeptide or other substance to the organs and tissues of the respiratory system of the subject organism. The organs and tissues of the respiratory system of a subject organism include, but are not limited to, the lungs, nose, or gills. Potential advantages of these delivery routes for polypeptides and other molecules of interest include a greater extent of absorption due to an absorptive surface area of approximately 140 m.sup.2 and high volume of blood flowing through the lungs (5000 ml/min in the human lung) (Hollinger (1985), pp. 1-20, in Respiratory Pharmacology and Toxicology (Saunders, Pa.)). Further potential benefits of administration via pulmonary inhalation include lack of some forms of peptidase and/or protease activity when compared with the gastrointestinal tract and lack of first-pass hepatic metabolism of absorbed compounds. Interest in this delivery route has increased in recent years since a number of potential peptide-, polypeptide-, or protein-containing pharmaceuticals or drugs are absorbed more efficiently from the lung than from the gastrointestinal tract (Patton and Platz (1992) Adv. Drug Del. Rev. 8: 179-196; Niven (1993) Pharm. Technol. 17:72-82). In fish, respiratory delivery of vaccines is the primary mode of vaccination due to the technical difficulties associated with injection of each fish and the destruction of most vaccines in the digestive tract of the fish.
Successful respiratory delivery of peptides, polypeptides, or proteins is dependent upon a number of factors but delivery can be readily optimized by varying such factors in routine experimentation by one of skill in the art. The extent of absorption within the respiratory tissues varies with size and structure of the polypeptide, peptide, or protein and the delivery device used. Spore systems, alone or in combination with other suitable components, can be made into aerosol formulations (e.g., they can be "nebulized") to be administered via inhalation. Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like. Delivery devices include nebulizers, metered-dose inhalers; powder inhalers, and dipping bags. Preparation of compositions, including those comprising spore systems, as an aqueous liquid aerosol, a nonaqueous suspension aerosol, or dry powder aerosol for pulmonary administration using these respective delivery devices can influence polypeptide stability, and hence bioavailability as well as biological activity following delivery. See Wall (1995) Drug Delivery 2:1-20; Krishnamurthy (March 1999) BioPharm., pp. 34-38). The enhanced stability of the spore systems of the present invention is therefore of value in administration by respiratory delivery. In addition, the Bt spore is between 1 and 1.5 uM in size which is the optimal size range for deep lung delivery, further enhancing its efficacy as a respiratory delivery vehicle.
The following examples are provided to show that the methods of the present invention may be used to produce recombinant spores having a variety of uses. Those skilled in the art will recognize that while specific embodiments have been illustrated and described, they are not intended to limit the invention. EXAMPLES General Recombinant DNA Methods
This invention relies on routine techniques in the field of recombinant genetics. Basic texts disclosing the general methods of use in this invention include Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd ed. 1989); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); and Current Protocols in Molecular Biology (Ausubel et al., eds., 1994)).
For nucleic acids, sizes are given in either kilobases (kb) or base pairs (bp). These are estimates derived from agarose or acrylamide gel electrophoresis, from sequenced nucleic acids, or from published DNA sequences. For proteins, sizes are given in kilodaltons (kDa) or amino acid residue numbers. Proteins sizes are estimated from gel electrophoresis, from mass spectroscopy, from sequenced proteins, from derived amino acid sequences, or from published protein sequences.
Oligonucleotides that are not commercially available can be chemically synthesized according to the solid phase phosphoramidite triester method first described by Beaucage & Caruthers, Tetrahedron Letts. 22:1859-1862 (1981), using an automated synthesizer, as described in Van Devanter et al., Nucleic Acids Res. 12:6159-6168 (1984).
The sequence of the cloned genes and synthetic oligonucleotides can be verified after cloning using, e.g., the chain termination method for sequencing double-stranded templates of Wallace et al., Gene 16:21-26 (1981).
Example 1
Cloning and Sequencing of Bacillus thuringiensis Spore Outer Coat Protein Genes:
Four spore outer coat protein genes were isolated from Bt strain SDS-502 using the polymerase chain reaction (PCR). Primers were designed based on gene sequences published for Bacillus anthracis and Bacillus cereus. All primer pairs were used with genomic DNA as a template. The primer pairs are shown as follows: cotYl-F: 5"- AGTTGTAACGAAAATAAACACC <SEQ ID NO:12> cotYl-R: 5'- TTAGATAGTAACGTCGCGTTAAGC <SEQ ID NO:13> amplified the spore coat protein Yl gene (cotYl), cotG-F: 5'- ATGAAACGTGATATTAGAAAAGC <SEQ ID NO:14> cotG-R: 5'- CTAGCAGTTACGTTTTTTATACC <SEQ ID NO:15> amplified the spore coat protein G gene (cotG), cotY2-F: 5'- ATGAGCTGCAATTGTAACGAAGACC <SEQ ID NO:16> cotY2-R: TTAAATAGAAACATCGCGTAAGC <SEQ ID NO:17> amplified the spore coat protein Y2 gene (cotYl), and cotE-F: 5' ATGTCCGAATTTAGAGAGATTATTAC <SEQ ID NO:18> cotE-R: 5'- TTACTCTTCTTCTGCATCAACG <SEQ ID NO:19> amplified the spore coat protein E gene (cotE). An additional primer cotGprom-F: 5' ATCAATATCATACTTCTTTTTTCC <SEQ ID NO:20> was used in combination with the cotG-R primer to isolate and sequence the promoter of the spore coat protein G gene.
The polymerase chain reaction mixture contained: 10 μl 1OX buffer, 2 μl d-NTP, 2.5 μl Primer 1 (20 μM), 2.5 μl Primer 2 (20 μM), 2 μl Taq Polymerase, 1 μl template DNA (a genomic DNA preparation of Bt SDS-502) and 80 μl water. The temperature cycling in the PCR was 96°C (30 sec.) 45°C (45 sec.) 72°C (1 min. 30 sec), for 30 cycles, with the exception of cotE, which was amplified using 40 cycles.
Bands of the anticipated size were identified by agarose gel electrophoresis and cloning was done with the TA Topo cloning kit (Clontech Inc.). DNA sequencing was performed on an ABI 3700 with the M13 forward and reverse universal primers. Sequence discrepancies were resolved by aligning complimentary sequences and viewing the chrόmatographs.
Cloning and sequencing produced the following sequences:
SEQ ID NO:1, gene sequence of spore outer coat protein gene Yl (cotYl) SEQ ID NO:2, protein sequence of spore outer coat protein Yl (CotYl) SEQ ID NO:3, gene sequence of spore outer coat protein gene G (cotG) SEQ ID NO:4, protein sequence of spore outer coat protein G (CotG) SEQ ID NO:5, gene sequence of spore outer coat protein gene Y2 (cotY2) SEQ ID NO: 6, protein sequence of spore outer coat protein Y2 (CotY2) SEQ ID NO:7, gene sequence of spore outer coat protein gene E (cotE) SEQ ID NO: 8, protein sequence of spore outer coat protein E (CotE) SEQ ID NO:9, cotG promoter sequence
Example 2
Cloning and Sequencing of Bacillus thuringiensis Exosporium Gene exsCL:
The exosporium gene, exsCL, was isolated from Bt strain SDS-502 using the polymerase chain reaction (PCR). Primers were designed based on a gene sequence published for Bacillus cereus. Primer pairs are as follows: PHN007 5'-TGTATGCATTTAACTCCGCTGG <SEQ ID NO:21> PHN008 5'- TTAAGCGATTTTTTCAATAATAATAG <SEQ ID NO:22>
The primer pairs were used with genomic DNA as a template to amplify the exosporium gene, exsCL.
The polymerase chain reaction mixture contained: 10 μl 1OX buffer, 2 μl d-NTP, 2.5 μl Primer 1 (20 μM), 2.5 μl Primer 2 (20 μM), 2 μl Taq Polymerase, 1 μl template DNA (a genomic DNA preparation of Bt SDS-502) and 80 μl water. The temperature cycling in the PCR was 96°C (30 sec.) 45°C (45 sec.) 72°C (1 min. 30 sec), for 30 cycles.
A band of the anticipated size (approximately 387 bp) was identified by agarose gel electrophoresis and cloning was done with the TA Topo cloning kit (Clontech Inc.). DNA sequencing was performed on an ABI 3700 with the M13 forward and reverse universal primers. Sequence discrepancies were resolved by aligning complimentary sequences and viewing the chromatographs.
Cloning and sequencing produced the following sequences:
SEQ ID NO: 10, sequence of exosporium gene exsCL SEQ ID NO:11, protein sequence of the ExsCL protein
Example 3
Fusion of Spore Outer Coat Protein Gene cotG with Bt Insecticidal (Crystal) Protein
Gene cry 1 Ca:
In this example the cotG gene, under the control of its own promoter is fused to a Bt insecticidal protein gene and expressed on the surface of Bt spores (see FIG. 2). The host Bt strain is B. kurstaki, HD-I, a naturally occurring Bt strain used in commercial insecticides active against lepidopteran crop pests such as tomato horn worms. The insecticidal protein gene, cry ICa, is obtained from B. thuringiensis subspecies aizawai. The Cry ICa protein is also active against lepidopteran pests, but is more active against beet armyworm, Spodoptera exigua, than any insecticidal proteins found in Bt strain HD- 1. Addition of the Cry ICa protein to Bt strain HD-I broadens the insecticidal range of the strain.
The expression cassette used in this example is shown in SEQ ID NO:23 (nucleotide) and SEQ ID NO:24 (peptide). The expression cassette contains the cotG promoter, the spore outer coat protein gene cotG, and the cry ICa gene sequence. Translation of the sequence, SEQ ID NO:23, produces one large heterologous protein which is an in-frame fusion of CotG and Cry ICa. Use of the cotG promoter ensures expression of the heterologous protein during sporulation. The expression cassette is cloned into an appropriate expression vector such as one reported by Sasaki et al., {Current Microbiol. 1996, 32 195-200 and known as the "Sasaki expression vector") or another suitable expression vector known in the art, and electroporation is used to introduce the expression vector into a Bt strain such as HD-I. The resulting heterologous protein is assembled into the spore matrix with the Cry ICa protein on the surface of the spore. The recombinant strain is industrially fermented, formulated, and applied to vegetable crops to control a variety of lepidopteran pests.
The expression cassette that is cloned in the Sasaki expression vector is also introduced into the cry-minus (plasmid cured to eliminate insecticidal protein genes) Bt HD-I derivative called BT51, which is obtained from Dr. Shin-ichiro Asano, Hokkaido University {Current Microbiol. 1996, 32 195-200). While the spores ofBT51 show no insecticidal activity against S. exigua by diet-mixing assay, the recombinant spores containing this expression cassette exert insecticidal activity against S. exigua.
Example 4
Fusion of Spore Outer Coat Protein Gene cotE with Crystal Protein Gene ciγ8Da:
The CryδDa protein gene from B. thuringiensis subsp. galleriae strain SDS-502 is toxic to scarabaeid insects (beetles). In this example, the expression cassette contains a sporulation-specific promoter, and the cotE gene fused in frame to the cry8Da gene (FIG. 4 depicts the nucleotide and protein sequences of the expression cassette). The expression cassette is cloned in an appropriate expression vector such as one reported by Sasaki et al., (Current Microbiol. 1996, 32 195-200) and transformed into Bt kurstaki HDl, a Bt strain with insecticidal activity against lepidopteran pests (such as moth larvae). The resulting recombinant Bt strain is fermented industrially and formulated into an insecticidal product.
Two distinct insecticidal activities are found in different locations in the product; the crystal proteins are active against lepidopteran insects and the spores have the beetle- active CryδDa attached. This is an insecticidal combination that has not been found in nature.
Example 5
The cotYl Gene Fused to the N-Terminal Coding Region of the cry ICa Gene: The naturally-occurring cry ICa gene is 3570 bp and encodes a 135 kDa Cry ICa protoxin (Nucleic Acids Res. 1988 July 11; 16 (13): 6240). When the CrylCa protein is ingested by the insect, it is cleaved to an approximately 66 kDa toxin by proteases present in the insect midgut. The cleavage site is comprised of the amino acids 621 through 638 which have the sequence 621-AESDLER-AQKAVNALFTS-638 <SEQ ID NO:25>. After cleavage, the C-terminal sequence of the 66-kDa active toxin is 621 -AESDLER- 627 <SEQ ID NO:26>. In this example, the expression cassette contains a Bt sporulation-specific promoter, the Bt cotYl gene, a linker sequence, and a portion of the cry ICa gene encoding only the active portion of the CrylCa protein. A truncated cry ICa gene encoding only amino acids 1 though 627 is inserted into the expression cassette. The cassette sequences are SEQ ID NO:26 (nucleotide) and SEQ ID NO:27 (peptide). Figure 3 depicts the nucleotide and protein sequences of the expression cassette.
The linker design in this example includes several important features. First, it includes two restriction sites Ncol and Ndel that provide convenient cloning sites for insertion of the cry ICa gene and contain the ATG translation start sequence (FIG 6). Second, the linker is designed to encode the CrylCa proteolytic cleavage site, 624- DLER-AQKAVΝALFTS-638 <SEQ ID NO:28>. When spores with attached CrylCa heterologous proteins on their surface are ingested by a susceptible insect, the linker sequence ensures that the midgut proteases release the activated CrylCa from the spore effectively. In addition, the nucleic acid sequence of the linker encoding the proteolytic cleavage site is carefully designed so it is not identical to the coding region at the cry ICa C-terminal encoding the last four amino acids DLER. This important feature prevents a recombination event between two identical DNA sequences that could remove the cry 1 CaI gene from the expression cassette. The linker is further comprised of an epitope which has the amino acid sequence YPYDVPDYA <SEQ ID NO:29>. Commercial monoclonal antibodies are available that bind the epitope to allow tracking of the fusion protein.
There are several advantages to the expression cassette cloning format used in this example. First, the fusion protein produced is substantially smaller because the 65-kDa carboxyl end of the CrylCa protoxin is not included in the expression cassette. The linker sequence serves as a flexible tether allowing proper folding of both the spore outer coat protein CotYl and the active portion of the CrylCa insecticidal protein. By acting as a tether there is also a reduction of the possibility of functional hindrance of the proteolytic cleavage site. The immobilization of proteins (tethering) also adds stability to the proteins increasing the half life of the insecticide.
This expression cassette is cloned into an expression vector which is then transformed into B. kurstaki strain HD-I. The resulting recombinant Bt strain is fermented industrially, formulated into a wettable powder insecticide, and sprayed onto the appropriate vegetable crops. In addition to the endogenous HDl crystal toxins, the recombinant Bt strain produces the Cry ICa protein attached to the spore during sporulation.
Example 6
Two Different Spore Outer Coat Protein Genes Fused to Two Different Crystal Toxin
Genes:
In this example, the recombinant Bt strain has two different crystal proteins attached to the surface of the spore. Both proteins attached to the spore have insecticidal activity against scarabaeidae larvae (beetles). The cotG sporulation-specific promoter drives expression of the cotG gene operably linked to the cry 8Da gene from B. thuringiensis subsp. galleriae SDS-502, and the cotYl gene is operably linked to the cryhimel gene, a cry43Aa-like gene isolated by Dr. Shin-ichiro Asano, Hokkaido University, from Bacillus popilliae strain Hime. Bacterial promoters often drive the expression of several genes at one time. In this example, a single promoter is used to direct the expression of two different insecticidal protein genes with the resulting gene products attached to the surface of the spore.
The expression cassette is cloned into the appropriate expression vector which is then transformed into Bt HD-73. The Bt strain selected as the host strain for this plasmid is also capable of producing at least one endogenous insecticidal protein so that the resulting recombinant strain of Bt can produce at least three insecticidal toxins (one endogenous, two exogenous), each having a distinct insecticidal activity.
Example 7
In-Frame Fusion at Amino Acid 53 of CotG:
One strategy for design of the expression cassette utilizes the first 53 amino acids of the CotG protein (SEQ ID NO:4). A linker is inserted between amino acid proline 53 and amino acid arginine 54, and the insecticidal protein is added to the 3' end of the linker. The expression cassette encodes the first 53 amino acids of the Bt CotG protein, followed by the amino acids comprising the linker sequence including an insecticidal proteolytic site, the insecticidal protein, or the active portion of the insecticidal protein, and finally the remaining amino acids of the CotG protein, starting from the arginine at amino acid 54.
In this example, the heterologous protein produced from the expression cassette contains two proteolytic cleavage sites; one encoded by the linker, while the other is the naturally-occurring proteolytic cleavage site present in the insecticidal protein. Upon ingestion by susceptible insect larvae, the heterologous protein produced from the expression cassette undergoes two cleavage events to release the active insecticidal toxin from the spore.
Example 8
Fusion of Exosporium Protein Gene exsCL with Crystal Protein Gene cry ICa:
In this example the exsCL gene, under the control of a Bt exosporium gene promoter is fused to the insecticidal cry ICa gene from B. thuringiensis subsp. aizawai. The host strain is Bt kurstaki, HD-I, a naturally occurring Bt strain used in commercial insecticides active against lepidopteran crop pests such as tomato horn worms. The Cry ICa protein is also active against lepidopteran pests, but is more active against Spodoptera exigua than the toxins found in Bt strain HD-I. Addition of the Cry ICa protein to Bt strain HD-I broadens the insecticidal range of the strain.
The expression cassette used in this example is shown in SEQ ID NO: 16 (nucleotide). The expression cassette contains a Bt promoter (which can be a sporulation- specific promoter), the exosporium gene exsCL, a DNA linker sequence, and the cry ICa gene sequence.
The sequence used in the expression cassette contains an exosporium gene promoter, the exsCL gene sequence, and the crylCa gene sequence (SEQ ID NO:30). Translation of the sequence SEQ ID NO:30 produces one large heterologous protein as shown in SEQ ID NO:31 which is an in-frame fusion of ExsCL and CrylCa. Use of a Bt exosporium gene promoter ensures expression of the heterologous protein during sporulation. Example 9
Fusion of Exosporium Gene exsCL with Crystal Protein Gene cry 8Da:
The Cry8Da protein gene from B. thuringiensis subsp. galleriae strain SDS-502 is toxic to scarabaeid insects (beetles). In this example, the expression cassette contains a sporulation-specific promoter, and the exsCL gene fused in frame to the c?y8Da gene. The expression cassette is cloned in an appropriate expression vector and transformed into Bt kurstaki HDl, a Bt stain with insecticidal activity against lepidopteran pests (such as moth larvae). The resulting recombinant Bt strain is fermented industrially and formulated into an insecticidal product.
Two distinct insecticidal activities are found in different locations in the product; the crystal proteins are active against lepidopteran insects and the spores have the beetle- active Cry8Da attached. This is an insecticidal combination that has not been found in nature.
Example 10
The exsCL Gene Fused to the N-terminal Coding Region of the cry 1 CaI Gene:
Example 5 showed the toxic region of Cry ICa fused to CotG protein with certain linkers that allow easy processing in the insect gut to liberate the toxic protein (see FIG. 5 for the nucleotide and protein sequences of the cassette). A similar construct is made with ExsCL as shown in SEQ ID NO:32 (nucleotide) and SEQ ID NO:33 (peptide). The junction sequence is shown in FIG 7.
Example 11
Two Different Insecticidal Genes Fused to One Exosporium Gene:
In this example, the recombinant Bt strain has two different crystal proteins attached to the exosporium. Both of the attached proteins have insecticidal activity against scarabaeidae larvae (beetles). Bacterial promoters often drive the expression of several genes at one time. In this example, a single promoter is used to direct the expression of two different insecticidal proteins to the exosporium. The sporulation- specific promoter drives expression of the exsCL gene operably linked to the crγ8Dal gene from Bacillus thuringiensis subsp. galleriae SDS-502, and cryhimel, a gene isolated from Bacillus popilliae var. popilliae Hime, cry 43 A. Example 12
Expressing Non Bt Genes on the Surface of Bt Spores:
A fungal lipase of Penicillium expanswn (GenBank Accession No. AAK07480) is fused to the first 53 amino acid residues of the N-terminal end of CotG via a flexible linker and expressed on the surface of Bt spores. The lipase protein sequence is back- translated using a Bt codon usage table provided by Vector NTI. The back-translated lipase nucleotide sequence is linked to the N-terminal portion of the native cotG protein gene via a linker that provides the protein structural flexibility. The nucleotide sequence coding for the entire CotG-Lipase fusion protein is synthesized with Apal and BanϊRl cloning sites at the 5' and 3' ends as shown in SEQ ID NO:34. This nucleotide is then cloned in the Sasaki vector as described in Example 3, supra, between Apal and BamΗI. The synthesized nucleotide contains the cotG promoter and the vector provides the transcription terminator between BamRΪ and Notl. The vector containing the fusion gene is introduced to Bt cry-minus strain BT51 by electroporation. The BT51 spore expresses the fusion protein as shown in SEQ ID NO:35.
Recombinant spore lipase activity on soybean lipid is detected by Rhodamine B. The lipase on the spore hydrolyzes triacylglycerol in soybean oil to release free fatty acids which produce fluorescence with Rhodamine B. No fluorescence is observed with the native spores.
Example 13
Production of Antibody with the Recombinant Spores:
The recombinant Bt (BT51) spores expressing the cry ICa gene described in Example 3, supra, are injected into rabbits without any adjuvant. About 0.5 ml spore-in- water suspension containing about 10 billion spores are injected subcutaneously on the shoulder of each rabbit every one week for 4 weeks. One week after the final injection, serum is collected and the immuno-reactivity against Cry ICa is tested by Western Blot. One ng of Cry ICa band on the blot is detectable with 1/1000 diluted serum. No immuno- reaction is found with the serum collected from rabbits treated with non-recombinant BT51 spores. Example 14 Affinity Purification:
The antibody is purified from the antiserum produced against the Bt spore expressing the Bt cry ICa gene as described in Example 13, supra, using the spores as immobilized affinity purification matrix. To 20 ml antiserum that has been prepared by centrifuging approx. 40 ml blood collected from an immunized rabbit, 20 ml of the Bt spores suspended in water at the concentration of 10 billion spores per 1 ml are added. The mixture is incubated at room temperature for 30 min with gentle shaking and the spores are removed by centrifugation. The spores precipitated as a pellet are washed with 40 ml 0.5 M NaCl + 10 mM Tris-HCl, buffer, pH 8, by repeating centrifugation three times and with water once. The washed spores are then suspended in 20 ml of water and chilled on ice, and NaOH is added to a final concentration of 0.05N. The resulting high pH releases the antibody bound to the spores. The spores are removed by centrifugation at 2 0C and the pH of the supernatant that contains the antibody is lowered to pH 7.5 with 20 mM Tris-HCl buffer, pH 7.5 and HCl. The affinity purified antibody is diluted to 1/1000 with PBS and is shown to be functional by Western blot as described in Example 13, supra. Purity of the affinity purified antibody is tested by SDS-PAGE which shows a single band at the size of immunoglobulin.

Claims

CLAIMS We claim:
1. A nucleic acid construct comprising: at least one copy of a first nucleic acid molecule encoding a first peptide comprising a peptide derived from a Bacillus thuringiensis spore coat protein or an exosporium protein that when expressed targets to the Bacillus thuringiensis spore coat or exosporium, and a second nucleic acid molecule encoding a second peptide, said second nucleic acid molecule being operatively coupled to said first nucleic acid molecule, wherein expression of the nucleic acid construct produces a fusion protein comprising said first peptide coupled to said second peptide.
2. The nucleic acid construct of claim 1 , wherein the first peptide has substantial identity to an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, and SEQ ID NO:11.
3. The nucleic acid construct according to claim 1, wherein said first peptide has substantial identity to the amino acid sequence of SEQ ID NO:6.
4. The nucleic acid construct according to claim 1, wherein said first nucleic acid comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 7, and SEQ ID NO: 9.
5. The nucleic acid construct according to claim 5, wherein said nucleic acid comprises the nucleotide sequence of SEQ ID NO: 5.
6. The nucleic acid construct according to claim 1, further comprising a nucleic acid sequence encoding a linker peptide positioned between said first and second nucleic acid molecules.
7. The nucleic acid construct according to claim I5 wherein said second peptide is selected from the group consisting of a therapeutic peptide, a diagnostic peptide, an insecticidal peptide, a vaccine peptide, and an industrial enzyme peptide.
8. The nucleic acid construct according to claim 7 wherein the insecticidal peptide is selected from the group consisting of CrylAal, CrylAa2, CrylAa3, CrylAa4, CrylAa5, CrylAaβ, CrylAa7, CrylAa8, CrylAa9, CrylAalO, CrylAal 1, CrylAal2, CrylAal3, CrylAal4, CrylAbl, CrylAb2, CrylAb3, CrylAb4, CrylAb5, CrylAbβ, CrylAb7, CrylAb8, CrylAb9, CrylAblO, CrylAbl 1, CrylAbl2, CrylAbB, CrylAbl4, CrylAbl5, CrylAblό, CrylAcl, CrylAc2, CrylAc3, CrylAc4, CrylAcS, CrylAcβ, CrylAc7, CrylAcδ, CrylAc9, CrylAclO, CrylAcl 1, CrylAcl2, CrylAcl3, CrylAcH, CrylAcl5, CrylAdl, CrylAd2, CrylAel, CrylAfl, CrylAgl, CrylAhl, CrylAil, CrylBal, CrylBa2, CrylBa3, CrylBa4, CrylBbl, CrylBcl, CrylBdl, CrylBd2, CrylBel, CrylBe2, CrylBfl, CrylBf2, CrylBgl, CrylCal, CrylCa2, CrylCa3, CrylCa4, CrylCa5, CrylCaβ, CrylCa7, CrylCaδ, CrylCa9, CrylCalO, CrylCbl, CrylCb2, CrylDal, CrylDa2, CrylDbl, CrylDb2, CrylEal, CrylEa2, CrylEa3, CrylEa4, CrylEa5, CrylEaό, CrylEbl, CrylFal, CrylFa2, CrylFbl, CrylFb2, CrylFb3, CrylFb4, CrylFb5, CrylGal, CrylGa2, CrylGbl, CrylGb2, CrylGc, CrylHal, CrylHbl, Cryllal, Crylla2, Crylla3, Crylla4, Crylla5, Cryllaβ, Crylla7, Crylla8, Crylla9, CryllalO, Cryllal 1, Cryllbl, Cryllcl, Cryllc2, Crylldl, Cryllel, Cryllfl, CrylJal, CrylJbl, CrylJcl, CrylJc2, CrylJdl, CrylKal, Cry2Aal, Cry2Aa2, Cry2Aa3, Cry2Aa4, Cry2Aa5, Cry2Aa6, Cry2Aa7, Cry2Aa8, Cry2Aa9, Cry2AalO, Cry2Aall, Cry2Abl, Cry2Ab2, Cry2Ab3, Cry2Ab4, Cry2Ab5, Cry2Ab6, Cry2Acl, Cry2Ac2, Cry2Ac3, Cry2Adl, Cry2Ael, Cry3Aal, Cry3Aa2, Cry3Aa3, Cry3Aa4, Cry3Aa5, Cry3Aa6, Cry3Aa7, Cry3Bal, Cry3Ba2, Cry3Bbl, Cry3Bb2, Cry3Bb3, Cry3Cal, Cry4Aal, Cry4Aa2, Cry4Aa3, Cry4Bal, Cry4Ba2, Cry4Ba3, Cry4Ba4, Cry4Ba5, Cry5Aal, Cry5Abl, Cry5Acl, Cry5Bal, CryόAal, Cry6Aa2, CryβBal, Cry7Aal, Cry7Abl, Cry7Ab2, Cry8Aal, Cry8Bal, Cry8Bbl, Cry8Bcl, CryδCal, Cry8Ca2, Cry8Dal, Cry8Da2, Cry8Da3, CryδEal, Cry9Aal, Cry9Aa2, Cry9Bal, Cry9Cal, Cry9Ca2, Cry9Dal, Cry9Da2, Cry9Eal, Cry9Ea2, Cry9Ebl, Cry9Ecl, CrylOAal, CrylOAa2, CrylOAa3, Cryl lAal, Cryl lAa2, Cryl lAa3, CryllBal, Cryl lBbl, Cryl2Aal, Cryl3Aal, CryHAal, Cryl5Aal, CrylβAal, Cryl7Aal, Cryl8Aal, CrylδBal, Cryl8Cal, Cryl9Aal, Cryl9Bal, Cry20Aal, Cry21Aal, Cry21Aa2, Cry21Bal, Cry22Aal, Cry22Aa2, Cry22Abl, Cry22Ab2, Cry22Bal, Cry23Aal, Cry24Aal, Cry25Aal, Cry26Aal, Cry27Aal, Cry28Aal, Cry28Aa2, Cry29Aal, Cry30Aal, Cry30Bal, , Cry31Aal, Cry31Aa2, Cry32Aal, Cry32Bal, Cry32Cal, Cry32Dal, Cry33Aal, Cry34Aal, Cry34Aa2, Cry34Abl, Cry34Acl, Cry34Ac2, Cry34Bal, Cry35Aal, Cry35Aa2, Cry35Abl, Cry35Ab2, Cry35Acl, Cry35Bal, Cry36Aal, Cry37Aal, Cry38Aal, Cry39Aal, Cry4QAal, Cry40Bal, Cry41Aal, Cry41Abl, Cry42Aal, Cry43Aal, Cry43Bal, Cry44Aa, Cry45Aa, Cry46Aa, Cry47Aa, CytlAal, CytlAa2, CytlAa3, CytlAa4, CytlAa5, CytlAbl, CytlBal, Cyt2Aal, Cyt2Aa2, Cyt2Bal, Cyt2Ba2, Cyt2Ba3, Cyt2Ba4, Cyt2Ba5, Cyt2Ba6, Cyt2Ba7, Cyt2Ba8, Cyt2Ba9, Cyt2Bbl, Cyt2Bcl, Cyt2Cal, Vip3A(a) and Vip3A(b).
9. An expression system transformed with the nucleic acid construct according to claim 1.
10. An expression system according to claim 9, wherein said expression system is selected from the group consisting of bacterial, yeast, insect, fish and mammalian cell expression systems.
11. An expression system according to claim 9, wherein said first peptide has substantial identity to the amino acid sequence of SEQ IP NO: 6.
12. An expression system according to claim 11 , wherein said first nucleic acid comprises the nucleotide sequence of SEQ ID NO: 5.
13. An expression system according to claim 9, wherein said second peptide is selected from the group consisting of a therapeutic peptide, a diagnostic peptide, an insecticidal peptide, a vaccine peptide, and an industrial enzyme peptide.
14. A host cell comprising a nucleic acid construct comprising at least one copy of a first nucleic acid molecule encoding a first peptide comprising a peptide derived from a Bacillus thuringiensis spore coat protein or an exosporium protein that when expressed targets to the Bacillus thuringiensis spore coat or exosporium, and a second nucleic acid molecule encoding a second peptide, said second nucleic acid molecule being operatively coupled to said first nucleic acid molecule, wherein expression of the nucleic acid construct produces a fusion protein comprising said first peptide coupled to said second peptide.
15. The host cell of claim 14, wherein the first nucleic acid is endogenous and the second nucleic acid is exogenous.
16. The host cell of claim 14, wherein the first peptide has substantial identity to an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, and SEQ ID NO: 11.
17. The host cell of claim 14, wherein said first peptide has substantial identity to the amino acid sequence of SEQ ID NO:6.
18. The host cell of claim 14, wherein said first nucleic acid comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 7, and SEQ ID NO: 9.
19. The host cell of claim 18, wherein said nucleic acid comprises the nucleotide sequence of SEQ ID NO: 5.
20. The host cell of claim 14 wherein said host cell is a Bacillus thuringiensis cell.
21. The host cell of claim 14, wherein said second peptide is selected from the group consisting of a therapeutic peptide, a diagnostic peptide, an insecticidal peptide, a vaccine peptide, and an industrial enzyme peptide.
22. The host cell of claim 21 wherein the insecticidal peptide is selected from the group consisting of CrylAal, CrylAa2, CrylAa3, CrylAa4, CrylAa5, CrylAaβ, CrylAa7, CrylAaδ, CrylAa9, CrylAalO, CrylAal 1, CrylAal2, CrylAal3, QyIAaH, CrylAbl, CrylAb2, CrylAb3, CrylAb4, CrylAb5, CrylAbό, CrylAb7, CrylAbδ, CrylAb9, CrylAblO, CrylAbl 1, CrylAbl2, CrylAbl3, CrylAbl4, CrylAbl5, CrylAblβ, CrylAcl, CrylAc2, CrylAc3, CrylAc4, CrylAc5, CrylAcβ, CrylAc7, CrylAcδ, CrylAc9, CrylAclO, CrylAcl 1, CrylAcl2, CrylAcl3, CrylAcl4, CrylAcl5, CrylAdl, CrylAd2, CrylAel, Cry IAfI, CrylAgl, Cry IAhI, CrylAil, CrylBal, CrylBa2, CrylBa3, CrylBa4, CrylBbl, CrylBcl, CiylBdl, CrylBd2, Cry IBeI, CrylBe2, CrylBfl, CrylBf2, CrylBgl, CrylCal, CrylCa2, CrylCaS, CrylCa4, CrylCa5, CrylCaδ, CrylCa7, CrylCaδ, CrylCa9, CrylCalO, CrylCbl, CrylCb2, CrylDal, CrylDa2, CrylDbl, CrylDb2, CrylEal, CrylEa2, CrylEa3, CrylEa4, CrylEa5, CrylEaό, CrylEbl, CrylFal, CrylFa2, CrylFbl, CrylFb2, CrylFb3, CrylFb4, CrylFbS, CrylGal, CrylGa2, CrylGbl, CrylGb2, CrylGc, CrylHal, CrylHbl, Cryllal, Crylla2, CryllaS, Crylla4, Crylla5, Cryllaβ, Crylla7, Crylla8, Crylla9, CryllalO, Cryllal 1, Cryllbl, Cryllcl, Cryllc2, Crylldl, Cryllel, Cryllfl, CrylJal, CrylJbl, Cry UcI, CrylJc2, CrylJdl, CrylKal, Cry2Aal, Cry2Aa2, Cry2Aa3, Cry2Aa4, Cry2Aa5, Cry2Aa6, Cry2Aa7, Cry2Aa8, Cry2Aa9, Cry2AalO, Cry2Aal l, Cry2Abl, Cry2Ab2, Cry2Ab3, Cry2Ab4, Cry2Ab5, Cry2Ab6, Cry2Acl, Cry2Ac2, Cry2Ac3, Cry2Adl, CrylAel, Cry3Aal, Cry3Aa2, Cry3Aa3, Cry3Aa4, Cry3Aa5, Cry3Aa6, Cry3Aa7, Cry3Bal, Cry3Ba2, Cry3Bbl, Cry3Bb2, Cry3Bb3, Cry3Cal, Cry4Aal, Cry4Aa2, Cry4Aa3, Cry4Bal, Cry4Ba2, Cry4Ba3, Cry4Ba4, Cry4Ba5, Cry5Aal, Cry5Abl, CrySAcl, Cry5Bal, CryβAal, Cry6Aa2, CryβBal, Cry7Aal, Cry7Abl, Cry7Ab2, CryδAal, Cry8Bal, CryδBbl, CryδBcl, Cry8Cal, Cry8Ca2, CryβDal, Cry8Da2, Cry8Da3, CryδEal, Cry9Aal, Cry9Aa2, Cry9Bal, Cry9Cal, Cry9Ca2, Cry9Dal, Cry9Da2, Cry9Eal, Cry9Ea2, Cry9Ebl, Cry9Ecl, CrylOAal, CrylOAa2, CrylOAa3, Cryl lAal, CryllAa2, Cryl lAa3, Cryl lBal, CryllBbl, Cryl2Aal, Cry 13AaI, Cry 14AaI, Cry 15AaI, Cry 16AaI, Cry 17AaI, Cry 18AaI, Cry 18BaI, CrylδCal, Cryl9Aal, Cryl9Bal, Cry20Aal, Cry21Aal, Cry21Aa2, Cry21Bal, Cry22Aal, Cry22Aa2, Cry22Abl, Cry22Ab2, Cry22Bal, Cry23Aal, Cry24Aal, Cry25Aal, Cry26Aal, Cry27Aal, Cry28Aal, Cry28Aa2, Cry29Aal, Cry30Aal, Cry30Bal, , Cry31Aal, Cry31Aa2, Cry32Aal, Cry32Bal, Cry32Cal, Cry32Dal, Cry33Aal, Cry34Aal, Cry34Aa2, Cry34Abl, Cry34Acl, Cry34Ac2, Cry34Bal, Cry35Aal, Cry35Aa2, Cry35Abl, Cry35Ab2, Cry35Acl, Cry35Bal, Cry36Aal, Cry37Aal, Cry38Aal, Cry39Aal, Cry40Aal, Cry40Bal, Cry41Aal, Cry41Abl, Cry42Aal, Cry43Aal, Cry43Bal, Cry44Aa, Cry45Aa, Cry46Aa, Cry47Aa, CytlAal, CytlAa2, CytlAa3, CytlAa4, CytlAa5, CytlAbl, CytlBal, Cyt2Aal, Cyt2Aa2, Cyt2Bal, Cyt2Ba2, Cyt2Ba3, Cyt2Ba4, Cyt2Ba5, Cyt2Ba6, Cyt2Ba7, Cyt2Ba8, Cyt2Ba9, Cyt2Bbl, Cyt2Bcl, Cyt2Cal, Vip3A(a) and Vip3A(b).
23. A fusion protein comprising a first peptide comprising a peptide derived from a Bacillus thuringiensis spore coat protein or an exosporium protein that when expressed targets to the Bacillus thuringiensis spore coat or exosporium covalently linked to a second peptide.
24. The fusion protein of claim 23, wherein the first peptide has substantial identity to an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4,SEQ ID NO:6, SEQ ID NO:8, and SEQ ID NO: 11.
25. The fusion protein of claim 24, wherein said first peptide has substantial identity to the amino acid sequence of SEQ ID NO:6.
26. The fusion protein of claim 23, wherein said second peptide is selected from the group consisting of a therapeutic peptide, a diagnostic peptide, an insecticidal peptide, a vaccine peptide, and an industrial enzyme peptide.
27. The fusion protein according to claim 23, further comprising a linker peptide positioned between said first and second nucleic acid molecules.
28. A pharmaceutical composition comprising: the fusion protein according to claim 23 and a pharmaceutically acceptable carrier.
29. A therapeutic method comprising: administering a therapeutically effective dose of the fusion protein according to claim 23 to a subject.
30. A therapeutic method according to claim 29, wherein said administering is oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, or intranasal.
31. A therapeutic method comprising: administering to a subject the pharmaceutical composition according to claim 28.
32. A therapeutic method according to claim 31, wherein said administering is oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, or intranasal.
33. A screening method for identifying fusion proteins having anti-pathogen activity, said method comprising: providing a plurality of first different nucleic acid constructs comprising a first nucleic acid molecule encoding a first peptide having substantial identity to the amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4,SEQ ID NO:6, SEQ ID NO: 8, and SEQ ID NO: 11 , and a plurality of different second nucleic acid molecules each encoding a second protein, each of said different pathogenic second nucleic acid molecules being operatively coupled to said first nucleic acid molecule, wherein expression of each of the plurality of the first nucleic acid constructs produces a first different fusion protein comprising the first protein coupled to one of the different pathogenic second proteins; and determining which of the different first fusion proteins have an anti-pathogenic activity against said pathogen.
34. A method according to claim 33 further comprising: subdividing said second nucleic acid molecules used to produce the first fusion proteins which have anti-pathogenic activity to form second nucleic acid molecule fragments; providing a plurality of second different nucleic acid constructs comprising a first nucleic acid molecule encoding a first peptide having substantial identity to the amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4,SEQ ID NO:6, SEQ ID NO: 8, and SEQ ID NO: 11, and a plurality of different second nucleic acid molecule fragments each encoding protein fragments, each of said second nucleic acid molecule fragments individually being operatively coupled to said first nucleic acid molecule; and determining which of said second fusion proteins haveanti-pathogenic activity against the pathogen.
EP05795245A 2004-07-20 2005-07-20 Methods for making and using recombinant bacillus thuringiensis spores Withdrawn EP1778714A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US58898204P 2004-07-20 2004-07-20
US59114204P 2004-07-27 2004-07-27
PCT/US2005/025788 WO2006012366A2 (en) 2004-07-20 2005-07-20 Methods for making and using recombinant bacillus thuringiensis spores

Publications (2)

Publication Number Publication Date
EP1778714A2 true EP1778714A2 (en) 2007-05-02
EP1778714A4 EP1778714A4 (en) 2008-05-21

Family

ID=35786687

Family Applications (1)

Application Number Title Priority Date Filing Date
EP05795245A Withdrawn EP1778714A4 (en) 2004-07-20 2005-07-20 Methods for making and using recombinant bacillus thuringiensis spores

Country Status (2)

Country Link
EP (1) EP1778714A4 (en)
WO (1) WO2006012366A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116514936A (en) * 2023-06-29 2023-08-01 莱肯生物科技(海南)有限公司 Insect-resistant protein and preparation method and application thereof

Families Citing this family (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0504940D0 (en) * 2005-03-10 2005-04-20 Secr Defence Vaccine formulation
US9133251B2 (en) 2008-02-22 2015-09-15 The Curators Of The University Of Missouri Bacillus based delivery system and methods of use
JP6048932B2 (en) * 2010-12-28 2016-12-21 国立大学法人広島大学 Polypeptide for distinguishing between silicon oxide and silicon nitride and use thereof
CN102408473B (en) * 2011-11-29 2013-06-12 四川农业大学 Bt (Bacillus Thuringiensis) protein Cyt3Aa1 and coding gene as well as application thereof
CN102408472B (en) * 2011-11-29 2013-04-10 四川农业大学 Bt (Bacillus Thuringiensis) protein Cry62Aa1 and coding gene as well as application thereof
CN102408475B (en) * 2011-12-07 2013-06-12 四川农业大学 Bt protein Cryt1Da1, and coding gene and application thereof
CN102417538B (en) * 2011-12-07 2013-06-19 四川农业大学 Bt protein Cry68Aa1 and encoding gene and application thereof
CN102408474B (en) * 2011-12-07 2013-04-10 四川农业大学 Bt protein Cry69Aa1, and coding gene and application thereof
WO2014071275A1 (en) * 2012-11-02 2014-05-08 Genesys Research Institute Compositions and methods for auditory therapy
US9403881B2 (en) * 2013-03-14 2016-08-02 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods of use
US9573980B2 (en) 2013-03-15 2017-02-21 Spogen Biotech Inc. Fusion proteins and methods for stimulating plant growth, protecting plants from pathogens, and immobilizing Bacillus spores on plant roots
US20170295798A1 (en) * 2014-09-17 2017-10-19 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and a fungicide
AR101961A1 (en) 2014-09-17 2017-01-25 Bayer Cropscience Lp COMPOSITIONS THAT INCLUDE BACILLUS RECOMBINATING CELLS AND ANOTHER BIOLOGICAL CONTROL AGENT
BR112017005504A2 (en) * 2014-09-17 2018-08-14 Bayer Cropscience Lp compositions comprising recombinant bacillus cells and an insecticide.
EP3194425A1 (en) 2014-09-17 2017-07-26 Spogen Biotech Inc. Fusion proteins, recombinant bacteria, and methods for using recombinant bacteria
UA122776C2 (en) * 2014-09-17 2021-01-06 Байєр Кропсайєнс Лп Compositions comprising recombinant bacillus cells and an insecticide
EP3203842A1 (en) * 2014-09-17 2017-08-16 Bayer CropScience LP Compositions comprising recombinant bacillus cells and a fungicide
MX2017003452A (en) * 2014-09-17 2017-07-28 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and another biological control agent.
EA034764B9 (en) * 2014-10-16 2020-05-21 Монсанто Текнолоджи Ллс LEPIDOPTERAN-ACTIVE Cry1Da1 AMINO ACID SEQUENCE VARIANT PROTEINS
IL261698B (en) 2016-03-16 2022-09-01 Spogen Biotech Inc Methods for promoting plant health using free enzymes and microorganisms that overexpress enzymes
CN117442711A (en) * 2016-03-16 2024-01-26 斯波根生物技术公司 Fusion proteins, recombinant bacteria and exosporium fragments for animal health and aquaculture
BR112019007180A2 (en) * 2016-10-10 2019-07-02 Monsanto Technology Llc insecticide inhibitor proteins
NZ763625A (en) 2017-09-20 2024-07-26 Spogen Biotech Inc Fusion proteins, recombinant bacteria, and exosporium fragments for plant health
WO2019099635A1 (en) 2017-11-16 2019-05-23 Bayer Cropscience Lp Paenibacillus-based endospore display platform, products and methods
TWI728264B (en) * 2018-09-10 2021-05-21 高雄醫學大學 A microbial agent for controlling transmission of mosquito-borne diseases
CN111440814A (en) * 2020-02-26 2020-07-24 中国农业科学院作物科学研究所 Insect-resistant fusion gene mCry1AbVip3A, expression vector and application thereof
WO2023137458A1 (en) * 2022-01-14 2023-07-20 Syngenta Crop Protection Ag Compositions and methods for screening insecticidal proteins

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996023063A1 (en) * 1995-01-26 1996-08-01 Michigan State University Method of producing and purifying enzymes
US5800821A (en) * 1995-03-10 1998-09-01 New England Medical Center Hospitals, Inc. Bacterial spores as a heat stable vaccine delivery system

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020150594A1 (en) * 2000-06-26 2002-10-17 Maxygen, Inc. Methods and compositions for developing spore display systems for medicinal and industrial applications
WO2002000232A2 (en) * 2000-06-26 2002-01-03 Maxygen, Inc. Methods and compositions for developing spore display systems for medicinal and industrial applications

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996023063A1 (en) * 1995-01-26 1996-08-01 Michigan State University Method of producing and purifying enzymes
US5800821A (en) * 1995-03-10 1998-09-01 New England Medical Center Hospitals, Inc. Bacterial spores as a heat stable vaccine delivery system

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
JOHNSON DONOVAN E ET AL: "Spore coat protein synergizes Bacillus thuringiensis crystal toxicity for the Indianmeal moth (Plodia interpunctella)" CURRENT MICROBIOLOGY, vol. 36, no. 5, May 1998 (1998-05), pages 278-282, XP002475744 ISSN: 0343-8651 *
KAUR SARVJEET: "Molecular approaches towards development of novel Bacillus thuringiensis biopesticides" WORLD JOURNAL OF MICROBIOLOGY AND BIOTECHNOLOGY, vol. 16, no. 8-9, 2000, pages 781-793, XP002475745 ISSN: 0959-3993 *
See also references of WO2006012366A2 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116514936A (en) * 2023-06-29 2023-08-01 莱肯生物科技(海南)有限公司 Insect-resistant protein and preparation method and application thereof
CN116514936B (en) * 2023-06-29 2023-09-29 莱肯生物科技(海南)有限公司 Insect-resistant protein and preparation method and application thereof

Also Published As

Publication number Publication date
EP1778714A4 (en) 2008-05-21
WO2006012366A2 (en) 2006-02-02
WO2006012366A3 (en) 2006-09-28

Similar Documents

Publication Publication Date Title
EP1778714A2 (en) Methods for making and using recombinant bacillus thuringiensis spores
US20030165538A1 (en) Methods and compositions for developing spore display systems for medicinal and industrial applications
US8129166B2 (en) Immunogenic minicells and methods of use
US10513542B2 (en) Minicircle DNA vector vaccine platform for foot-and-mouth disease and methods thereof
CA2339355A1 (en) Anthrax vaccine
US20090004744A1 (en) Minicells as vaccines
US20020150594A1 (en) Methods and compositions for developing spore display systems for medicinal and industrial applications
Pilehchian et al. Fusion of Clostridium perfringens type D and B epsilon and beta toxin genes and it’s cloning in E. coli
CN101843899B (en) Methicillin-resistant staphylococcus aureus (MRSA) recombinant multivalent subunit genetic engineering vaccine and method for preparing same
KR101765394B1 (en) Epitope protein of PEDV, Recombinant vector contaning genes encoding thereof, Transformnant expressing thereof, and Composition for preventing or treating PEDV comprising thereof
CN109929015B (en) Bacillus thuringiensis insecticidal gene cry79Aa1, expression protein and application thereof
CN110229234B (en) Haemophilus parasuis fusion protein CdtB-OppA with immune protection
CN1083527A (en) Recombinant entomopoxvirus
WO2007050103A2 (en) Recombinant bacteria without selection marker
WO2010064861A2 (en) Promoter variant and method for protein production using same
CN109825530B (en) Method for removing pXO1 plasmid in Bacillus anthracis
Wang et al. Presenting a foreign antigen on live attenuated Edwardsiella tarda using twin-arginine translocation signal peptide as a multivalent vaccine
US20240148859A1 (en) MICROORGANISM DISPLAYING ANTIGENIC PROTEIN OF THE SARS-CoV2 CORONAVIRUS
CN112342159B (en) Bacillus new strain HSY204 and insecticidal gene and application thereof
CN116589539B (en) Nine-component antigen African swine fever subunit vaccine
LU501420B1 (en) Bacillus sj110 strain, insecticidal protein, vip3-like insecticidal gene, and use thereof
Pattanayak et al. Characterization of genetic diversity of some serovars of Bacillus thuringiensis by RAPD
WO2008150150A2 (en) Suppression of resistance in insects to bacillus thuringiensis cry toxins, using toxins that do not require the cadherin receptor
Jonker Evaluation of DNA vaccines against Mycoplasma nasistruthionis sp. nov. str. Ms03 infections in ostriches and the production of IgA heavy chain proteins
CN117298261A (en) Preparation method and application of aeromonas hydrophila OmpTS and Aha1 subunit vaccine

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20070219

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

RIN1 Information on inventor provided before grant (corrected)

Inventor name: GOLDMAN, STANLEY

Inventor name: LIBS, JOHN

DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20080421

17Q First examination report despatched

Effective date: 20080820

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20091020