CN102408474B - Bt protein Cry69Aa1, and coding gene and application thereof - Google Patents

Abstract

The invention provides a new Bt protein Cry69Aa1, and a coding gene and application thereof. The protein has an amino acid sequence disclosed as SEQ ID NO.2, or amino acid sequence with equal activity, which is obtained by substitution, deletion and/or addition of one or more amino acids on the basis of the amino acid sequence disclosed as SEQ ID NO.2. The protein provided by the invention can be used for preparing Bt insecticide. The gene can transform cotton, corn, rice, vegetables and other crops, so that the cotton, corn, rice, vegetables and other crops have corresponding insect resistance activity, thereby lowering the consumption of the insecticide and reducing the environmental pollution. Thus, the invention has important economic value and application prospects.

Description

A kind of Bt PROTEIN C ry69Aa1, its encoding gene and application

Technical field

The present invention relates to biological technical field, be specifically related to a kind of Bt albumen and encoding gene and application.

Background technology

In the human being's production process, insect pest is the important factor that causes agriculture production loss and affect human health, and according to the FAO statistics, the financial loss that whole world agriculture production every year causes because of insect pest is up to 14%, and the disease loss reaches 12%, and crop smothering loss reaches 11%.The amount of loss is equivalent to half of the Chinese agriculture gross output value up to 1,260 hundred million dollars, more than 4 times of Britain.In addition, mosquito matchmaker disease is occupied critical positions in preventive medicine, wherein the sick transmissibility of the mosquito such as singapore hemorrhagic fever and yellow jack matchmaker strong, popular wide, sickness rate is high, hazardness is large.According to the WHO statistics, the annual singapore hemorrhagic fever number that infects in the whole world reached 8,000 ten thousand, and Hainan Province of China once broke out twice singapore hemorrhagic fever in 1980 and 1986, and morbidity reaches respectively 437469 example and 113589 examples.Singapore hemorrhagic fever and yellow jack are mainly propagated by Aedes aegypti.

In order to reduce these losses, for many years, generally adopt the chemical prevention means to prevent and treat to crop pests and mosquito, but because the long-term, a large amount of of chemical pesticide use, caused the pollution to environment, the agricultural byproducts Pesticide Residues increases, and has brought harm for human existence and health.In addition, chemical pesticide has has also killed and wounded natural enemy and other useful thing in kill pests, destroyed the eubiosis.Compare with chemical prevention, biological control has safe, effective, lasting characteristics.And the series of problems of having avoided chemical prevention to bring.Therefore, biological prevention has become the focus of people's researchs.In biotic pesticide, bacillus thuringiensis is the quasi-microorganism sterilant that purposes is the widest in the world, output is maximum at present.

Bacillus thuringiensis (Bacillus thuringiensis, be called for short Bt) be a kind of gram positive bacterium, its distribution is very extensive, in sporulation, can form the parasporal crystal that is formed by protein with insecticidal activity, have another name called insecticidal crystal protein (Insectididal crystal proteins is called for short ICPs), ICPs is by the cry genes encoding, sensitive insect there is strong toxicity, and to higher animal and people's nontoxicity.In recent decades, Bt has been widely used in controlling the insects such as multiple lepidopteran, Diptera, Coleoptera.In addition, Bt also has the effect of control evil to the various pests such as Hymenoptera, Homoptera, Orthoptera, Mallophaga and plant pathogeny line insect, mite class, protozoon.At present Bt has become the strong substitute of chemical synthetic pesticide, Bt or the important gene source of transgenic pest-resistant engineered plant in the control of agricultural pests, injurious forest-insect and sanitary insect pest.

(Adang M.J et al from Schnepf in 1981 has cloned first gene that can express insecticidal activity from strain HD-1 since, Gene, 1985,36 (3): 289～300.), people separating clone the gene of 500 Multi-encoding insecticidal crystal proteins, according to the coding amino acid sequence homology they be defined as respectively different group, subgroup, class and subclass (Crickmore N, et al.Microbiol Mol Biol Rev, 1998,62:807-813.).Generally speaking, Cry1, the toxalbumin such as Cry2 and Cry9 are effective to lepidoptera pest; Wherein the maximum of research are Cry1 and Cry9 proteinoid, and the insecticidal crystal protein molecular weight of their codings is 130-140kD, and many genes have been widely used in the control (Kozie of the lepidoptera pest of plant at present, M.G., et al.Bio/Technology, 1993,11:194-200; Wang Fei, 2001, Master's thesis, Nankai University .).Bacillus thuringiensissubsp.israelensis (B.thuringiensis subsp.israelensis, abbreviation Bti) toxin protein that produces has fine insecticidal activity to mosquito, be widely used in control (the Goldberg L J of mosquito, et al.Mosqito News, 37:355-358.).Simultaneously, Cyt albumen has cytolytic, and some Cry albumen is had synergism and delays the resistance (Wu, D., et al.Mol.Microbiol.13:965-972.) of insect.

Find Tribactur from the beginning of this century history in existing more than 100 year so far is widely used aspect the preventing and treating of farm crop and gardening plant insect, injurious forest-insect and sanitary insect pest, and also plays good effect.But because extensive and Reusability Tribactur, many insect populations are producing resistance to insecticidal crystal protein in succession in varying degrees.The history in existing more than 50 year of Utilization of pesticides take the Bt insecticidal crystal protein as the basis, at first never detect insect to the resistance of Bt, but, begin mid-term 80 year last century, resistance problem (the McGaughey that constantly in laboratory and field test, is confirmed, W.H.1985.Science.229:193-195), reason mainly is continue to use single variety and inferiorly cause the Bt of dosage and the application of Bt transgenic anti-insect plants causes insect population to be subject to for a long time the selective pressure of sterilant.1985, McGaughey report warehouse grain pest Indian meal moth (Plodia interpunctella) under the selective pressure of Dipel (the commodity preparation of Bt subsp.kurstaik HD-1), bred for 15 generations after, resistance increases by 97 times; Under the high dosage selective pressure, resistance can increase by 250 times.Nineteen ninety, the small cabbage moth that confirms first large Tanaka in Hawaii has produced obvious resistance (Tabashnik to the Bt sterilant, B.E., et al.1994.Proc.Natl.Acad.Sci.USA.91:4120-4124), since the nineties in last century, used the ground such as long Shenzhen and Guangzhou of Bt sterilant time, Shanghai in China, find that the Bt sterilant obviously descends to the small cabbage moth prevention effect, mean that resistance forms (Feng Xia .1996. insect journal, 39 (3): 238-244; ).Find in the laboratory at present and the field has at least tens kinds of insects that Bt and insecticidal crystal protein thereof have been produced resistance, arrive with the selective pressure mathematical model prediction, under the condition of Bt transgenic anti-insect plants selective pressure, insect will produce resistance (Schnepf, E., et al.Mol.Biol.Rev.65 (3): 775-806).In addition, there are some researches prove that Bti not yet finds resistance problem (Regis L in the use in land for growing field crops, et al., 2000.Instituto Oswaldo Cruz, 95:207-210.), but mosquito constantly is confirmed in the laboratory to its resistance problem, this situation also may (Georghiou G P occur large Tanaka, and Wirth M C, 1997.Applied and Environmental Microbiology, 63:1095-1101.).

Be the loss of avoiding resistant insects to cause, seeking new high virulence gene resource is the effective way that addresses this problem, and this biological control to China has very important meaning.

Summary of the invention

First purpose of the present invention is to provide a kind of new Bt virulence protein resource for above-mentioned deficiency.

Another object of the present invention is to provide the gene of encoding said proteins.

A further object of the present invention is to provide the application of above-mentioned albumen and gene.

The present invention separates the new bacterial strain MC28 of the bacillus thuringiensis (Bacillus thuringiensis) that obtains from the virgin forest Soils In The Region of Muchuan, Sichuan Province.This bacterial strain on October 21st, 2008 at China Committee for Culture Collection of Microorganisms common micro-organisms center (address: No. 3, A, DaTun Road, Chaoyang District, BeiJing City, Institute of Microorganism, Academia Sinica, postcode 100101) preservation, Classification And Nomenclature is bacillus thuringiensis (Bacillus thuringiensis), and preserving number is CGMCC No.2719.(the preservation proof of this bacterial strain and preserving number thereof have been that 200910078894.5 patents are open in the patent No.)

Show by the virulence test to MC28, MC28 all has high virulence to lepidoptera pest, Diptera pest etc.Find that from MC28 genome and plasmid sequencing result there is a new cry gene in this bacterial strain, further design its full-length gene primer, the clone obtains the cry69Aa1 gene, its nucleotide sequence is shown in sequence table SEQ ID No.1, total length is 3651bp, the analysis showed that, GC content is 38.07%, the albumen that 1216 amino acid of encoding form.After measured, its aminoacid sequence is shown in SEQ ID No.2.Adopt bacterial sigma 7.0promoter program that complete sequence is predicted in the softberry website and show, contain the sequence in RNA polymerase activation site in the gene coding region upstream, with its called after cry69Aa1.The amino acid of Cry69Aa1 albumen forms such as table 1.

The amino acid of table 1 Cry69Aa1 albumen forms

Amino acid	Per-cent %	Amino acid	Per-cent %
				Ala(A)：	5.84	Met(M)：	1.64
Cys(C)：	1.15	Asn(N)：	8.55
				Asp(D)：	4.93	Pro(P)：	4.77
Glu(E)：	6.00	Gln(Q)：	4.03
				Phe(F)：	4.19	Arg(R)：	5.35
Gly(G)：	6.41	Ser(S)：	7.40
				His(H)：	2.80	Thr(T)：	6.66
Ile(I)：	6.58	Val(V)：	6.09
				Lys(K)：	4.03	Trp(W)：	1.48
Leu(L)：	8.06	Tyr(Y)：	4.03

Should be appreciated that those skilled in the art can not affect under its active prerequisite according to aminoacid sequence disclosed by the invention, replace, lack and/or increase one or several amino acid, obtain the mutant nucleotide sequence of described albumen.At nonactive section, be other amino acid with certain amino acid substitution for example.For example at nonactive section, the 1180th Thr is replaced with Ser, the 1197th Gly is replaced with Ala, with the 1201st Gly disappearance, with Ala of the 1107th increase or increase Gly, do not affect its activity.Therefore, Bt albumen of the present invention comprises that also aminoacid sequence shown in the SEQ ID No.2 is substituted, replaces and/or increases one or several amino acid, have Cry69Aa1 albumen with isoreactivity by the derivative protein that obtains of Cry69Aa1.

The invention provides the gene of the above-mentioned Bt PROTEIN C ry69Aa1 of coding, its nucleotide sequence is shown in SEQ ID NO.1.

In addition, should be understood that the degeneracy of considering codon and the preferences of different plant species codon, those skilled in the art can use as required and be fit to the codon that specific species are expressed.

Gene of the present invention can be cloned or separate from bacterial strain MC28 with protein and be obtained, and perhaps obtains by DNA or the synthetic method of peptide.

Gene of the present invention can be operably connected with expression vector, obtain to express the recombinant expression vector of albumen of the present invention, and then can pass through transgenic methods such as agrobacterium-mediated transformation, particle bombardment, pollen tube passage method, described expression vector is imported the host, obtain turning the transformant of cry69Aa1 gene, plants such as farm crop or fruit tree makes it possess anti-insect activity.

In addition, can also obtain containing the fermented liquid of Cry69Aa1 albumen by fermentation bacterial strain MC28 of the present invention, it is prepared into sterilant, be used for the control of crop pests.Those skilled in the art can also be with said gene transform bacteria or fungi, by large scale fermentation production Bt albumen of the present invention.

The present invention also provides the application of Bt PROTEIN C ry69Aa1 in plant breeding.

The invention provides the application of Bt PROTEIN C ry69Aa1 in cultivating transgenic plant.

Those skilled in the art can also be transformed into them in various farm crop according to gene disclosed by the invention, such as cotton, corn, paddy rice, rape, capsicum, make it possess corresponding anti-insect activity.Thereby reduce the usage quantity of agricultural chemicals, environmental contamination reduction has important economic worth and application prospect.For example: the degeneracy of utilizing codon, the gene order that the cry69Aa1 gene design is had paddy rice preference codon, again synthetic cry69Aa1 gene order is connected with carrier pCAMBIA1300, be transferred in the rice genome by agriculture bacillus mediated, thus the Transgenic Rice that obtains having anti-insect activity.

The invention provides Cry69Aa1 albumen is a kind of new Bt albumen, has preferably insecticidal activity, uses it for the preparation transgenic plant, can the specific killing insect, and reduce the usage quantity of agricultural chemicals, reduce cost, environmental contamination reduction.Also do not have at present insect or insect this albumen to be produced the report of resistance, therefore, Bt PROTEIN C ry69Aa1 of the present invention has important economic worth and application prospect, is fit to large-scale application in the insect-resistance that improves plant.

Description of drawings

Fig. 1 is the gel electrophoresis figure that the present invention clones the cry69Aa1 total length base that obtains, M wherein, DNA marker; 1, cry69Aa1 gene.

Fig. 2 shows is that the enzyme of recombinant plasmid pET-69Aa is cut the evaluation collection of illustrative plates, wherein 1, and recombinant plasmid pET-69Aa; 2, the EcoR I+Sal I double digestion product of recombinant plasmid pET-69Aa; 3, the DNA of insertion; M, DNAmarker.

What Fig. 3 showed is that the SDS-PAGE of cry69Aa1 gene in E.coli BL21 (DE3) detects figure; M wherein, albumen marker; 1, contain E.coliBL21 (DE3) cellular lysate liquid after IPTG induces of recombinant plasmid pET-69Aa; 2, contain recombinant plasmid pET-69AaE.coli BL21 (DE3) and induce cellular lysate liquid without IPTG; 3, contain E.coli BL21 (DE3) expressing protein of pET-28a.

Embodiment

Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.

If do not specialize, the conventional means that used technique means is well known to those skilled in the art among the embodiment.

Embodiment 1 cry69Aa1 gene cloning

The present invention separates the new bacterial strain of the bacillus thuringiensis (Bacillus thuringiensis) that obtains from the virgin forest Soils In The Region of Muchuan, Sichuan Province, this bacterial strain on October 21st, 2008 at China Committee for Culture Collection of Microorganisms common micro-organisms center (address: No. 3, A, DaTun Road, Chaoyang District, BeiJing City, Institute of Microorganism, Academia Sinica, postcode 100101) preservation, Classification And Nomenclature is bacillus thuringiensis (Bacillus thuringiensis), and preserving number is CGMCC No.2719.

This example is cloned the full length sequence that obtains the cry69Aa1 gene by the following method.

Adopt genomic dna purification kit (available from match Parkson company) to extract total DNA of bacterial strain BtMC28.The design primer sequence is as follows:

P1：5’ATGAATGGAGGAGAGAAGATGAAT 3’

P2：5’TTATTGGCTCTTCATACAAATC 3’

The PCR reaction system:

Thermal cycle reaction: 94 ℃ of denaturation 5min; 94 ℃ of sex change 50s, 54 ℃ of annealing 50s, 72 ℃ are extended 2min, 30 circulations; 72 ℃ are extended 10min.The amplified reaction product is electrophoresis on 1% sepharose, puts and observes the pcr amplification result in the gel imaging system.The result has obtained being about the sequence of 3600bp as shown in Figure 1 by amplification, this sequence is checked order, and its nucleotide sequence is shown in SEQ ID No.1, and is consistent with aim sequence.

Expression and the insecticidal activity assay of embodiment 2 cry69Aa1 genes

According to cry69Aa1 gene open reading frame two terminal sequences, design and synthesize a pair of special primer cry69F:5 '-CG GAATTCATGAATGGAGGAGAGAAGAT-3 ' cry69R:5 '-CGC GTCGACTTATTGGCTCTTCATACAAA-3 ' adds EcoR I and Sal I restriction enzyme site at 5 ' end primer respectively, and EcoR I and Sal I restriction enzyme site mark with underscore.Increase take the total DNA of MC28 as template, response procedures and amplification condition are with embodiment 1, the product of amplification adopts EcoR I and Sal I to carry out double digestion, carrier pET-28a (+) after enzyme is cut product and carried out equally double digestion is connected, Transformed E .coli DH5 α competent cell, extract its plasmid enzyme restriction electrophoresis verified insertion segment size meet the expection purpose after (Fig. 2), change again recipient bacterium E.coli.BL21 (DE3) over to.With recombinant plasmid called after pET-69Aa, contain the recon called after E.coli.BL21 (69Aa) of recombinant plasmid.With positive transformant in the LB substratum, in 200r/min, 37 ℃ of incubated overnight, again the ratio of nutrient solution according to 1: 100 is transferred in the 1L triangular flask that contains the 400mLLB nutrient solution, 200r/min, 37 ℃ of cultivations when the OD of nutrient solution value reaches 0.6-0.8, add 0.6mmol/L IPTG and carry out abduction delivering 20h, centrifugation medium is collected thalline, abandon supernatant, add 30mL 10mmol/L Tris-HCl (pH 8.0) ultrasonic disruption, with SDS-PAGE expressing protein is detected.

SDS-PAGE the analysis showed that molecular weight is about about 130kDa in the precipitation of expression product after the thalline ultrasonication of cry69Aa1 gene (Fig. 3), conforms to the molecular weight of albumen of prediction.

Embodiment 3 insecticidal activity assays

The Cry69Aa1 gene expression product is respectively to beet armyworm, bollworm and yellow-fever mosquito carry out insecticidal activity assay.At first the Cry69Aa1 albumen that obtains is mixed with from 1 μ g/ml to 6 different concns of 100 μ g/ml, the old tender moderate Caulis et Folium Brassicae capitatae blade of choosing is cleaned, and dries; Shine 15min under the ultraviolet lamp, be cut into 2 * 2cm ²Size divides to be placed in the different concns Cry69Aa1 protein liquid, soaks 5min; Taking-up drains unnecessary liquid, be placed in the culture dish of sterilization to dry, the blade that soaks with the LB liquid nutrient medium in contrast, each culture dish is put 4 blades; 30 of healthy 2-3 bollworms in age (or beet armyworm) are put in each culture dish choosing; Every processing repeats 3 times, puts indoorly, observes the larva death condition behind 3d, with SPSS 10.0 computed in software LC50.

The result shows (table 1): expression product all has preferably insecticidal activity to these two kinds of worms.To bollworm toxic limit medium dose LC ₅₀Be 25.77 μ g/mL; LC to beet armyworm ₅₀Be 22.07 μ g/mL.E.coli.BL21 (DE3) is as negative control, gives birth to survey the result and show, E.coli.BL21 (DE3) is not had an insecticidal activity to above three kinds of insects.

Table 1 Cry69Aa1 is to the insecticidal activity of three kinds of insects

Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements all belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.

Claims (10)

1. Bt PROTEIN C ry69Aa1, its aminoacid sequence is shown in SEQ ID No.2.

2. the gene of coding claim 1 described albumen.

3. gene as claimed in claim 2, its nucleotide sequence is shown in SEQ ID No.1.

4. the expression vector that contains claim 2 or 3 described genes.

5. the host cell that is transformed by the described expression vector of claim 4.

6. host cell as claimed in claim 5, it is plant host cell.

7. the sterilant that contains the described albumen of claim 1, described sterilant has insecticidal activity to beet armyworm and bollworm.

8. the application of the described albumen of claim 1 in plant breeding.

9. the application of the described albumen of claim 1 in cultivating transgenic plant.

10. application as claimed in claim 9 is characterized in that, described transgenic plant are farm crop.

Images