CN101503464A - Novel Bt protein Cry30Fa1, coding gene thereof and use - Google Patents

Abstract

The invention provides new Bt protein Cry 30 Fal and encoding gene sthereof. The protein has the amino acid sequences shown in the SEQ ID NO.2 or the protein has the amino acid sequences shown in the SEQ ID NO.2 which are substituted, lacked and/or added with one or a plurality of amino acids and have the same activity. The protein can be used for preparing Bt pesticide. The gene can be transformed into crops such as cotton, corn, rice, vegetables and the like which are caused to have corresponding anti-insect activity, thus reducing the usage volume of the pesticide, reducing environmental pollution and having important economic value and application prospect.

Description

A kind of new Bt PROTEIN C ry30Fa1, its encoding gene and application

Technical field

The present invention relates to biological technical field, be specifically related to a kind of new Bt albumen and encoding gene and application.

Background technology

In the human being's production process, insect pest is the important factor that causes agriculture production loss and influence human health, adds up according to FAO, and the financial loss that whole world agriculture production every year causes because of insect pest is up to 14%, and disease is with a toll of 12%, and crop smothering is with a toll of 11%.The amount of loss is equivalent to half of the Chinese agriculture gross output value up to 1,260 hundred million dollars, more than 4 times of Britain.In addition, mosquito matchmaker disease is occupied critical positions in preventive medicine, wherein the sick transmissibility of mosquito such as singapore hemorrhagic fever and yellow jack matchmaker strong, popular wide, sickness rate is high, hazardness is big.According to the WHO statistics, the annual singapore hemorrhagic fever number that infects in the whole world reached 8,000 ten thousand, and Hainan Province of China once broke out twice singapore hemorrhagic fever in 1980 and 1986, and morbidity reaches 437469 example and 113589 examples respectively.Singapore hemorrhagic fever and yellow jack are mainly propagated by Aedes aegypti.

In order to reduce these losses, for many years, generally adopt the chemical prevention means to prevent and treat to crop pests and mosquito, but because the long-term, a large amount of of chemical pesticide use, caused the pollution to environment, pesticide residue increases in the agricultural byproducts, has brought harm for human existence and health.In addition, chemical pesticide has has also killed and wounded natural enemy and other useful thing in kill pests, destroyed the eubiosis.Compare safe, effective, persistent characteristics that biological control has with chemical prevention.And a series of problems of having avoided chemical prevention to bring.Therefore, biological control technology has become the focus of people's researchs.In biotic pesticide, bacillus thuringiensis is the quasi-microorganism sterilant that purposes is the widest in the world, output is maximum at present.

Bacillus thuringiensis (Bacillus thuringiensis, be called for short Bt) be a kind of gram positive bacterium, its distribution is very extensive, when forming, gemma can form the parasporal crystal of forming by protein with insecticidal activity, have another name called insecticidal crystal protein (Insectididal crystalproteins is called for short ICPs), ICPs is by the cry genes encoding, sensitive insect there is strong toxicity, and to higher animal and people's nontoxicity.In recent decades, Bt has been widely used in controlling insects such as multiple lepidopteran, Diptera, Coleoptera.In addition, Bt also has the effect of control evil to various pests such as Hymenoptera, Homoptera, Orthoptera, Mallophaga and plant pathogeny line insect, mite class, protozoon.At present Bt has become the strong substitute of chemical synthetic pesticide in the control of agricultural pests, injurious forest-insect and sanitary insect pest, and Bt still be that transgenic pest-resistant engineered plant important function of gene is originated.

(Adang M.J et al from Schnepf in 1981 has cloned first gene that can express insecticidal activity from strain HD-1Dipel since, Characterized full-length andtruncated plasmid clones of the crystal protein of Bacillus thuringiensissubsp.kurstaki HD-73 and their toxicity to Manduca sexta, Gene, 1985,36 (3): 289～300.), people separating clone the gene of more than 390 kind of coded insect-killing crystallin, they are defined as different groups respectively according to the amino acid sequence coded homology, subgroup, class and subclass (Crickmore N, Zeigler D R, Feitelson J, et al.Revision of the nomenclature for the Bacillus thuringiensis pesticidalcrystal proteins.Microbiol Mol Biol Rev, 1998,62:807-813; Http:// www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/).Generally speaking, Cry1, toxalbumin such as Cry2 and Cry9 are effective to lepidoptera pest; Wherein the maximum of research are Cry1 and Cry9 proteinoid, the insecticidal crystal protein molecular weight of their codings is 130-140kD, many genes have been widely used in the control (Kozie of the lepidoptera pest of plant at present, M.G., Beland, G.L., Bowman, C., et al.Field performance of elite transgenicmaize plants expressing an insecticidal protein derived from Bacillusthuringiensis.Bio/Technology, 1993,11:194-200; Perlak, F.J., Deaton, R.W., Armstrong, T.A., et al.Insect resistant cotton plants.bio/technology, 1990; 8:939-943; Van Frankenhuyzen, K., Gringorten, L., and Gauhier, D.1997.Cry9Cal toxin, a Bacillus thuringiens isinsecticidal crystalprotein with high activity against the spruce bud worm (Choristoneurafnniferana) .Appl.Environ, Microbviol.63:4132-4134; Wang Fei, 2001, the research of bacillus thuringiensis specific strain biological characteristics and the new gene of cry9, Master's thesis, Nankai University).Tribactur Israel subclass (B.thuringiensis subsp.israelensis, abbreviation Bti) toxin protein that produces has fine insecticidal activity to mosquito, extensively applied to control (the Goldberg L J of mosquito, and Margalit J, 1977.A bacterialspore demonstrating rapid larvicidal activity against Anopheles sergentii, Uranotaenia unguiculata, Culex univitattus, Aedes aegypti, and Culexpipiens.Mosqito News, 37:355-358; ).Simultaneously, Cyt albumen has cytolytic, some Cry albumen is had synergism and delays the resistance (Wu of insect, D., Johnson, J.J., and Federici, B.A.1994.Synergism of mosquitocidal toxicity betweenCytA and CryIVD Proteins using inclusion sproduced from clonedgenes of Bacillus thuringiensis.Mol.Microbiol.13:965-972; Wirth, M.C., Georghiou, G.P, and Federeci, B.A.1997.CytA enables CryIVendotoxins of Bacillus thuringiensis to overcome high levels of CryIVresistance in the mosquito, Culex quinquefasciatus.Proc.Natl.Acad.Sci.94:10536-10540)

Find the history in existing so far more than 100 year of Tribactur from the beginning of this century, aspect the preventing and treating of farm crop and gardening plant insect, injurious forest-insect and sanitary insect pest, be widely used, also play good effect.But owing to use Tribactur on a large scale and repeatedly, many insect populations are producing resistance to insecticidal crystal protein in succession in varying degrees.The history in existing more than 50 year of Utilization of pesticides based on the Bt insecticidal crystal protein, the initial resistance of insect that never detect to Bt, but, begin mid-term 80 year last century, resistance problem (the M cGaughey that constantly in laboratory and field test, is confirmed, W.H.1985.Insect resistance to the biological insecticide Bacillus thuringiensis.Science.229:193-195), reason mainly is continue to use single variety and inferiorly cause the Bt of dosage and the application of Bt transgenic anti-insect plants causes insect population to be subjected to the selective pressure of sterilant for a long time.1985, McGaughey report warehouse grain pest Indian meal moth (Plodia interpunctella) under the selective pressure of Dipel (the commodity preparation of Bt subsp.kurstaik HD-1), bred for 15 generations after, resistance increases by 97 times; Under the high dosage selective pressure, resistance can increase by 250 times.Nineteen ninety, the small cabbage moth that confirms big Tanaka in Hawaii has first produced tangible resistance (Tabashnik to the Bt sterilant, B.E., Finson, N., Groeters, F.R., et al.1994.Reversal of resistance to Bacillus thuringiensisin Plutella xylostella.Proc.Natl.Acad.Sci.USA.91:4120-4124), since the nineties in last century, use long Shenzhen of Bt sterilant time in China, Guangzhou, ground such as Shanghai, find that the Bt sterilant obviously descends to the small cabbage moth prevention effect, mean resistance form (Feng Xia .1996. Guangdong small cabbage moth is to the resistance research of Bacillus thuringiensis. insect journal, 39 (3): 238-244; Hofte, H., Van Rie, J., Jansens, S., Van Houtven, A., Vanderbruggen, H., and Vaeck, M., 1988.Monoclonal antibody analysis and insecticidal spectrum ofthree types of lepidopteran-specific insecticidal crystal proteins ofBacillus thuringiensis.Appl.Environ.Microbiol.54:2010-2017).Find at present in the laboratory and the field has at least tens kinds of insects that Bt and insecticidal crystal protein thereof have been produced resistance, arrive with the selective pressure mathematical model prediction, under the condition of Bt transgenic anti-insect plants selective pressure, insect will produce resistance (Schnepf, E., Crickmore, N., Van Pie, J., et al.1998.Bacillus thuringiensis and its pesticidal Crystalproteins.Microbiol.Mol.Biol.Rev.65 (3): 775-806).In addition, there are some researches prove that Bti does not find resistance problem (Regis L as yet in the use in land for growing field crops, et al., 2000.The useof bacterial larvicides in mosquito and black fly control programsinBrazil.Mem.Instituto Oswaldo Cruz, 95:207-210.), but mosquito constantly is confirmed in the laboratory to its resistance problem, this situation also may (Georghiou G P occur big Tanaka, and Wirth M C, 1997.Influence of exposure to singleversus multiple toxins of Bacillus thuringiensis subsp.israelensis ondevelopment of resistance in the mosquito Culex quinquefasciatus (Diptera:Culicidae) .Applied and Environmental Microbiology, 63:1095-1101.).

Be the loss of avoiding resistant insects to cause, seeking new high virulence gene resource is the effective way that addresses this problem, and this biological control to China has crucial meaning.

Summary of the invention

First purpose of the present invention is to provide a kind of new BT virulence protein resource at above-mentioned deficiency.

Second purpose of the present invention is to provide the gene of encoding said proteins.

The present invention also aims to provide the application of above-mentioned albumen and gene.

The present invention separates the new bacterial strain BtMC28 of the bacillus thuringiensis (Bacillus thuringiensis) that obtains from the soil of Muchuan, Sichuan Province virgin forest area.By the virulence test shows to BtMC28, BtMC28 all has high virulence to lepidoptera pest, Diptera pest or the like.According to 1 pair of special primer of cry30 genoid conserved sequence design, its genomic dna increases, the result shows that there is the cry30 genoid in this bacterial strain, further its full-length gene primer of design is cloned and is obtained the cry30Fa gene, and its nucleotide sequence is shown in sequence table SEQ IDNo.1, total length is 2064bp, analysis revealed, GC content are 33.87%, the albumen that 687 amino acid of encoding are formed.After measured, its aminoacid sequence is shown in SEQ ID No.2.Adopt bacterial sigma 7.0 promoter programs that complete sequence is predicted in the softberry website and show, contain the sequence in RNA polymerase activation site in the gene coding region upstream, its called after cry30Fa1.The proteic amino acid of Cry30Fal is formed as table 1.

The proteic amino acid of table 1 Cry30Fal is formed

Amino acid	Per-cent %	Amino acid	Per-cent %
				Ala(A)：	6.7	Met(M)：	1.60
Cys(C)：	1.02	Asn(N)：	9.46
				Asp(D)：	4.95	Pro(P)：	6.11
Glu(E)：	3.06	Gln(Q)：	5.39
				Phe(F)：	4.22	Arg(R)：	3.64
Gly(G)：	5.53	Ser(S)：	6.70
				His(H)：	1.02	Thr(T)：	8.01
Ile(I)：	9.46	Val(V)：	3.64
				Lys(K)：	4.51	Trp(W)：	1.16
Leu(L)：	8.30	Tyr(Y)：	5.53

Should be appreciated that those skilled in the art can not influence under its active prerequisite according to aminoacid sequence disclosed by the invention, replace, lack and/or increase one or several amino acid, obtain described proteic mutant nucleotide sequence.For example, (1) (Ala) replaced with (Cys) at nonactive section.Therefore, Bt albumen of the present invention comprises that also aminoacid sequence shown in the SEQ ID No.2 is substituted, replaces and/or increases one or several amino acid, has the equal active protein of being derived and being obtained by Cry30Fa1 of Cry30Fa1 albumen.Gene of the present invention comprises the nucleic acids encoding said proteins sequence.

In addition, should be understood that the degeneracy of considering codon and the preferences of different plant species codon, those skilled in the art can use as required and be fit to the codon that specific species are expressed.

Gene of the present invention can be cloned or separate from bacterial strain BtMC28 with protein and be obtained, and perhaps obtains by DNA or peptide synthetic method.

Gene of the present invention can be operably connected with expression vector, obtain to express the proteic recombinant expression vector of the present invention, and then can pass through such as transgenic methods such as agrobacterium-mediated transformation, particle bombardment, pollen tube passage methods, described expression vector is imported the host, obtain changeing the transformant of cry30Fa1 gene, for example plant such as farm crop or fruit tree makes it possess anti-insect activity.

In addition, can also obtain containing the proteic fermented liquid of Cry30Fa1, it is prepared into sterilant, be used for the control of crop pests by fermentation bacterial strain BtMC28 of the present invention.Those skilled in the art can also be with said gene transform bacteria or fungi, by large scale fermentation production Bt albumen of the present invention.

Those skilled in the art can also with farm crop such as its converting cotton, corn, paddy rice, vegetables, make it possess corresponding anti-insect activity according to gene disclosed by the invention.Thereby reduce the usage quantity of agricultural chemicals, reduce environmental pollution, have important economic value and application prospect.

Description of drawings

Fig. 1 shows is the gel electrophoresis figure of the cry30Fa1 full-length gene that obtains of clone, M wherein, marker; 1, the cry30Fa1 gene.

Fig. 2 shows is that the enzyme of recombinant plasmid pET-30Fa is cut the evaluation collection of illustrative plates, wherein 1, and the pET-30Fa plasmid; 2, the Nde I+EcoR I double digestion product of pET-30a; 3, the Ndde I+EcoR I double digestion product of pET-30Fa; 4, the dna sequence dna of insertion; M1, λ-Hind III enzyme is cut product; M2, the DL2000 molecular weight standard.

What Fig. 3 showed is that the SDS-PAGE of cry30Fa1 gene in E.coli BL21 (DE3) detects figure, wherein M. albumen marker; 1. negative control E.coii BL21 (DE3) (pET-30a); 2.E.coii BL21 (DE3) is the lysate supernatant (pET-Fal); 3. the Cry30Fal albumen in the inclusion body.

Embodiment

Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.

If do not specialize the conventional means that used technique means is well known to those skilled in the art among the embodiment.

The clone of embodiment 1 cry30Fa1 gene

The present invention separates the new bacterial strain of the bacillus thuringiensis (Bacillus thuringiensis) that obtains from the soil of Muchuan, Sichuan Province virgin forest area, this bacterial strain on October 21st, 2008 at China Committee for Culture Collection of Microorganisms common micro-organisms center (address: No. 3, A, DaTun Road, Chaoyang District, BeiJing City, Institute of Microorganism, Academia Sinica, postcode 100101) preservation, classification called after bacillus thuringiensis (Bacillus thuringiensis), preserving number is CGMCC No.2719.

This example is cloned the full length sequence that obtains the cry30Fa1 gene by the following method.

Adopt genomic dna purification kit (available from match Parkson company) to extract total DNA of bacterial strain BtMC28.The design primer sequence is as follows:

P1：5’ATGAAGCCGTATCAAAGTG3’

P2：5’GTTCACTGGACAAGCAAATGC3’

The PCR reaction system:

10×buffer 2.5μl

MgCl ₂(25mM) 1.5μl

Taq enzyme 0.2 μ l

dNTPs(2.5mM) 2μl

Primer 2 μ l

Template 5 μ l

End reaction volume 25 μ l

Thermal cycle reaction: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 1min, annealing temperature is decided according to primer, and 72 ℃ are extended 2min, 30 circulations; 72 ℃ are extended 5min; 4 ℃ of stopped reaction.The amplified reaction product is electrophoresis on 1% sepharose, puts and observes the pcr amplification result in the gel imaging system.The result has obtained being about the sequence of 2000bp by amplification as shown in Figure 1, and this sequence is checked order, and its nucleotide sequence is shown in SEQ ID No.1, and is consistent with aim sequence.

Embodiment 2 cry30Fa1 expression of gene and insecticidal activity assays

According to cry30Fa1 gene open reading frame two terminal sequences, design and synthesize a pair of Auele Specific Primer cry30F:5 '-GCG CATATG(NdeI) ATGAAGCCGTATCAAAGTG-3 '; Cry30R:5 '-CG GAATTC(EcoR I) GTTCACTGGACAAGCAAATGC-3 ' is respectively at 5 ' end primer Nde I and EcoR I restriction enzyme site.With the total DNA of BtMC28 is that template increases, response procedures and reaction system are with embodiment 1, the product of amplification adopts Nde I and EcoR I to carry out double digestion, carrier pET-30a (+) after enzyme is cut product and carried out double digestion equally is connected, Transformed E .coli DH5 α competent cell, extract its plasmid enzyme restriction electrophoresis and verified that insertion segment size meets (Fig. 2) after the intended purposes, changes recipient bacterium E.coli.BL21 (DE3) again over to.With recombinant plasmid called after pET-30Fa, contain the recon called after E.coli.BL21 (30Fa) of recombinant plasmid.In the precipitation of SDS-PAGE analysis revealed cry30Fa expression of gene product after the thalline ultrasonication (Fig. 3), molecular weight is about about 76kDa, conforms to the molecular weight of albumen of prediction.

The cry30Fa1 gene expression product is respectively to beet armyworm, and the survey result that gives birth to of bollworm and yellow-fever mosquito shows (table 1): expression product all has insecticidal activity preferably to these three kinds of worms.The highest to the beet armyworm insecticidal activity, LC ₅₀Be 9.81 μ g/mL; LC to yellow-fever mosquito ₅₀Be 11.22 μ g/mL; Minimum to the bollworm insecticidal activity, LC ₅₀Be 24.06 μ g/mL.E.coli.BL21 (DE3) is as negative control, give birth to survey the result and show, E.coli.BL21 (DE3) to above three kinds of insects not tool kill

The worm activity.

The insecticidal activity of table 1 Cry30Fa1

Sequence table

＜110〉Sichuan Agricultural University

Plant Protection institute, Chinese Academy of Agricultral Sciences

＜120〉a kind of new Bt PROTEIN C ry30Fa1, its encoding gene and application

<130>KHP09112178.9

<160>6

<170>PatentIn version 3.5

<210>1

<211>2064

<212>DNA

＜213〉Bacillus thuringiensis bacterial strain (Bacillus thuringiensis) BtMC28

<220>

<221>CDS

<222>(1)..(2064)

<400>1

<210>2

<211>687

<212>PRT

＜213〉Bacillus thuringiensis bacterial strain (Bacillus thuringiensis) BtMC28

<400>2

<210>3

<211>19

<212>DNA

＜213〉artificial sequence

<400>3

<210>4

<211>21

<212>DNA

＜213〉artificial sequence

<400>4

<210>5

<211>28

<212>DNA

＜213〉artificial sequence

<400>5

<210>6

<211>29

<212>DNA

＜213〉artificial sequence

<400>6

Claims (9)

1, a kind of Bt PROTEIN C ry30Fa1, its aminoacid sequence is:

1) aminoacid sequence shown in the SEQ ID No.2; Or

2) aminoacid sequence shown in the SEQ ID No.2 is substituted, lacks and/or increases one or more amino acid and have equal active albumen.

2, the described proteic gene of coding claim 1.

3, gene as claimed in claim 2, its nucleotide sequence is shown in SEQ ID No.1.

4, contain claim 2 or 3 described expression carrier.

5, by the described expression vector transformed host cells of claim 4.

6, host cell as claimed in claim 5, it is a plant host cell.

7, contain the described proteic sterilant of claim.

8, claim 2 or 3 described genes or the described expression vector of claim 4 application in the preparation transgenic plant.

9, claim 2 or 3 described genes or the described expression vector of claim 4 application in improving plant resistance to insect.

Images