CN101531711B - Bt protein Cry52Bal as well as encoding gene thereof and application thereof - Google Patents
Bt protein Cry52Bal as well as encoding gene thereof and application thereof Download PDFInfo
- Publication number
- CN101531711B CN101531711B CN2009100815957A CN200910081595A CN101531711B CN 101531711 B CN101531711 B CN 101531711B CN 2009100815957 A CN2009100815957 A CN 2009100815957A CN 200910081595 A CN200910081595 A CN 200910081595A CN 101531711 B CN101531711 B CN 101531711B
- Authority
- CN
- China
- Prior art keywords
- leu
- asn
- ser
- gly
- thr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 50
- 102000004169 proteins and genes Human genes 0.000 title claims abstract description 15
- 235000018102 proteins Nutrition 0.000 claims abstract description 14
- 125000003275 alpha amino acid group Chemical group 0.000 claims abstract description 7
- 241000238631 Hexapoda Species 0.000 claims description 19
- 239000013604 expression vector Substances 0.000 claims description 6
- 230000014509 gene expression Effects 0.000 claims description 5
- 230000009261 transgenic effect Effects 0.000 claims description 5
- 239000002773 nucleotide Substances 0.000 claims description 4
- 125000003729 nucleotide group Chemical group 0.000 claims description 4
- 238000002360 preparation method Methods 0.000 claims description 2
- 235000001014 amino acid Nutrition 0.000 abstract description 8
- 150000001413 amino acids Chemical class 0.000 abstract description 8
- 230000000694 effects Effects 0.000 abstract description 8
- 229920000742 Cotton Polymers 0.000 abstract description 2
- 241000219146 Gossypium Species 0.000 abstract description 2
- 240000007594 Oryza sativa Species 0.000 abstract description 2
- 235000007164 Oryza sativa Nutrition 0.000 abstract description 2
- 240000008042 Zea mays Species 0.000 abstract description 2
- 235000002017 Zea mays subsp mays Nutrition 0.000 abstract description 2
- 239000003905 agrochemical Substances 0.000 abstract description 2
- 239000002917 insecticide Substances 0.000 abstract description 2
- 235000009566 rice Nutrition 0.000 abstract description 2
- 235000013311 vegetables Nutrition 0.000 abstract description 2
- 235000016383 Zea mays subsp huehuetenangensis Nutrition 0.000 abstract 1
- 235000009973 maize Nutrition 0.000 abstract 1
- 230000000749 insecticidal effect Effects 0.000 description 18
- 241000193388 Bacillus thuringiensis Species 0.000 description 17
- 229940097012 bacillus thuringiensis Drugs 0.000 description 17
- 241000607479 Yersinia pestis Species 0.000 description 15
- 241000255925 Diptera Species 0.000 description 13
- 101710151559 Crystal protein Proteins 0.000 description 9
- 108020004414 DNA Proteins 0.000 description 9
- 241000196324 Embryophyta Species 0.000 description 9
- 241000282326 Felis catus Species 0.000 description 9
- 230000001580 bacterial effect Effects 0.000 description 8
- 102220023257 rs387907546 Human genes 0.000 description 8
- 238000000034 method Methods 0.000 description 7
- 239000013612 plasmid Substances 0.000 description 7
- 239000000126 substance Substances 0.000 description 7
- 101000702488 Rattus norvegicus High affinity cationic amino acid transporter 1 Proteins 0.000 description 5
- 239000000047 product Substances 0.000 description 5
- 238000011160 research Methods 0.000 description 5
- 241000256118 Aedes aegypti Species 0.000 description 4
- 241000193830 Bacillus <bacterium> Species 0.000 description 4
- 108090000790 Enzymes Proteins 0.000 description 4
- 102000004190 Enzymes Human genes 0.000 description 4
- 241000588724 Escherichia coli Species 0.000 description 4
- 241000500437 Plutella xylostella Species 0.000 description 4
- 208000009714 Severe Dengue Diseases 0.000 description 4
- 102220369445 c.668T>C Human genes 0.000 description 4
- 238000006243 chemical reaction Methods 0.000 description 4
- 230000029087 digestion Effects 0.000 description 4
- 238000005516 engineering process Methods 0.000 description 4
- 238000004519 manufacturing process Methods 0.000 description 4
- 239000000575 pesticide Substances 0.000 description 4
- 230000002265 prevention Effects 0.000 description 4
- 102220023256 rs387907547 Human genes 0.000 description 4
- 108020004705 Codon Proteins 0.000 description 3
- 241000255777 Lepidoptera Species 0.000 description 3
- 238000004458 analytical method Methods 0.000 description 3
- 238000013461 design Methods 0.000 description 3
- 239000003550 marker Substances 0.000 description 3
- 230000001988 toxicity Effects 0.000 description 3
- 231100000419 toxicity Toxicity 0.000 description 3
- 108700012359 toxins Proteins 0.000 description 3
- 230000001018 virulence Effects 0.000 description 3
- 241000193365 Bacillus thuringiensis serovar israelensis Species 0.000 description 2
- 241000894006 Bacteria Species 0.000 description 2
- 101150102464 Cry1 gene Proteins 0.000 description 2
- 241000256057 Culex quinquefasciatus Species 0.000 description 2
- 241000255967 Helicoverpa zea Species 0.000 description 2
- 244000223072 Narcissus jonquilla Species 0.000 description 2
- 235000013862 Narcissus jonquilla Nutrition 0.000 description 2
- 241000595629 Plodia interpunctella Species 0.000 description 2
- 241000256247 Spodoptera exigua Species 0.000 description 2
- 208000003152 Yellow Fever Diseases 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 102220369446 c.1274G>A Human genes 0.000 description 2
- 230000008859 change Effects 0.000 description 2
- 229920001940 conductive polymer Polymers 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 238000000855 fermentation Methods 0.000 description 2
- 230000004151 fermentation Effects 0.000 description 2
- 230000036541 health Effects 0.000 description 2
- 238000009616 inductively coupled plasma Methods 0.000 description 2
- 230000000266 injurious effect Effects 0.000 description 2
- 238000003780 insertion Methods 0.000 description 2
- 230000037431 insertion Effects 0.000 description 2
- 244000005700 microbiome Species 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 102220023258 rs387907548 Human genes 0.000 description 2
- 238000002415 sodium dodecyl sulfate polyacrylamide gel electrophoresis Methods 0.000 description 2
- 239000002689 soil Substances 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 239000003053 toxin Substances 0.000 description 2
- 231100000765 toxin Toxicity 0.000 description 2
- FRXSZNDVFUDTIR-UHFFFAOYSA-N 6-methoxy-1,2,3,4-tetrahydroquinoline Chemical compound N1CCCC2=CC(OC)=CC=C21 FRXSZNDVFUDTIR-UHFFFAOYSA-N 0.000 description 1
- 241000589158 Agrobacterium Species 0.000 description 1
- 241000436937 Anopheles sergentii Species 0.000 description 1
- 241001425390 Aphis fabae Species 0.000 description 1
- 108700003918 Bacillus Thuringiensis insecticidal crystal Proteins 0.000 description 1
- 241001147758 Bacillus thuringiensis serovar kurstaki Species 0.000 description 1
- 101150078024 CRY2 gene Proteins 0.000 description 1
- 241000929260 Choristoneura orae Species 0.000 description 1
- 108091026890 Coding region Proteins 0.000 description 1
- 241000254173 Coleoptera Species 0.000 description 1
- 241000256059 Culex pipiens Species 0.000 description 1
- 241001306100 Culex univittatus Species 0.000 description 1
- 241000256113 Culicidae Species 0.000 description 1
- 241001071944 Cyta Species 0.000 description 1
- 102000004163 DNA-directed RNA polymerases Human genes 0.000 description 1
- 108090000626 DNA-directed RNA polymerases Proteins 0.000 description 1
- 241000233866 Fungi Species 0.000 description 1
- 241000726221 Gemma Species 0.000 description 1
- 240000002024 Gossypium herbaceum Species 0.000 description 1
- 235000004341 Gossypium herbaceum Nutrition 0.000 description 1
- 241000258937 Hemiptera Species 0.000 description 1
- 241000257303 Hymenoptera Species 0.000 description 1
- 241001495069 Ischnocera Species 0.000 description 1
- 241000255908 Manduca sexta Species 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 108700026244 Open Reading Frames Proteins 0.000 description 1
- 241000238814 Orthoptera Species 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 229920002684 Sepharose Polymers 0.000 description 1
- 101710117021 Tyrosine-protein phosphatase YopH Proteins 0.000 description 1
- 241000551459 Uranotaenia unguiculata Species 0.000 description 1
- 235000005824 Zea mays ssp. parviglumis Nutrition 0.000 description 1
- 230000004913 activation Effects 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 210000004666 bacterial spore Anatomy 0.000 description 1
- 239000006227 byproduct Substances 0.000 description 1
- 210000004027 cell Anatomy 0.000 description 1
- 235000013339 cereals Nutrition 0.000 description 1
- 238000012512 characterization method Methods 0.000 description 1
- 239000007795 chemical reaction product Substances 0.000 description 1
- 230000004087 circulation Effects 0.000 description 1
- 108091036078 conserved sequence Proteins 0.000 description 1
- 235000005822 corn Nutrition 0.000 description 1
- 238000005336 cracking Methods 0.000 description 1
- 239000013078 crystal Substances 0.000 description 1
- 230000001461 cytolytic effect Effects 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 230000001934 delay Effects 0.000 description 1
- 238000009826 distribution Methods 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 235000013399 edible fruits Nutrition 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 238000003912 environmental pollution Methods 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000010413 gardening Methods 0.000 description 1
- 238000003384 imaging method Methods 0.000 description 1
- 210000003000 inclusion body Anatomy 0.000 description 1
- 230000000974 larvacidal effect Effects 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 206010025482 malaise Diseases 0.000 description 1
- 238000013178 mathematical model Methods 0.000 description 1
- 230000001404 mediated effect Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000002231 mosquitocidal effect Effects 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 231100000956 nontoxicity Toxicity 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 239000002245 particle Substances 0.000 description 1
- 230000002085 persistent effect Effects 0.000 description 1
- 230000000361 pesticidal effect Effects 0.000 description 1
- 239000000447 pesticide residue Substances 0.000 description 1
- 238000001556 precipitation Methods 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 230000003449 preventive effect Effects 0.000 description 1
- 108090000765 processed proteins & peptides Proteins 0.000 description 1
- 230000000644 propagated effect Effects 0.000 description 1
- 238000003259 recombinant expression Methods 0.000 description 1
- 108091008146 restriction endonucleases Proteins 0.000 description 1
- 238000012772 sequence design Methods 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 238000001228 spectrum Methods 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 238000010189 synthetic method Methods 0.000 description 1
- 239000006273 synthetic pesticide Substances 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
- 238000002525 ultrasonication Methods 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/50—Isolated enzymes; Isolated proteins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
- C07K14/325—Bacillus thuringiensis crystal peptides, i.e. delta-endotoxins
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Pest Control & Pesticides (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Insects & Arthropods (AREA)
- Agronomy & Crop Science (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention provides a new Bt protein Cry52Bal as well as an encoding gene thereof; the protein is provided with an aminoacid sequence as shown by SEQ ID No.2 or the protein which has the same activity and is obtained by substituting, deleting and/or adding one or plural aminoacid to an amino acid sequence as shown by SEQ ID No.2. The protein of the invention can be used for preparing Bt insecticides, the gene can be used for converting cotton, maize, rice, vegetables and other crops to ensure that the crops have corresponding anti-insect activity, thereby reducing the use of agricultural chemical, alleviating environment pollution, and having significant economic value and application prospect.
Description
Technical field
The present invention relates to biological technical field, be specifically related to a kind of new Bt albumen and encoding gene and application.
Background technology
In the human being's production process, insect pest is the important factor that causes agriculture production loss and influence human health, adds up according to FAO, and the financial loss that whole world agriculture production every year causes because of insect pest is up to 14%, and disease is with a toll of 12%, and crop smothering is with a toll of 11%.The amount of loss is equivalent to half of the Chinese agriculture gross output value up to 1,260 hundred million dollars, more than 4 times of Britain.In addition, mosquito matchmaker disease is occupied critical positions in preventive medicine, wherein the sick transmissibility of mosquito such as singapore hemorrhagic fever and yellow jack matchmaker strong, popular wide, sickness rate is high, hazardness is big.According to the WHO statistics, the annual singapore hemorrhagic fever number that infects in the whole world reached 8,000 ten thousand, and Hainan Province of China once broke out twice singapore hemorrhagic fever in 1980 and 1986, and morbidity reaches 437469 example and 113589 examples respectively.Singapore hemorrhagic fever and yellow jack are mainly propagated by Aedes aegypti.
In order to reduce these losses, for many years, generally adopt the chemical prevention means to prevent and treat to crop pests and mosquito, but because the long-term, a large amount of of chemical pesticide use, caused the pollution to environment, pesticide residue increases in the agricultural byproducts, has brought harm for human existence and health.In addition, chemical pesticide has has also killed and wounded natural enemy and other useful thing in kill pests, destroyed the eubiosis.Compare safe, effective, persistent characteristics that biological control has with chemical prevention.And a series of problems of having avoided chemical prevention to bring.Therefore, biological control technology has become the focus of people's researchs.In biotic pesticide, bacillus thuringiensis is the quasi-microorganism sterilant that purposes is the widest in the world, output is maximum at present.
Bacillus thuringiensis (Bacillus thuringiensis, be called for short Bt) be a kind of gram positive bacterium, its distribution is very extensive, when forming, gemma can form the parasporal crystal of forming by protein with insecticidal activity, have another name called insecticidal crystal protein (Insectididal crystalproteins is called for short ICPs), ICPs is by the cry genes encoding, sensitive insect there is strong toxicity, and to higher animal and people's nontoxicity.In recent decades, Bt has been widely used in controlling insects such as multiple lepidopteran, Diptera, Coleoptera.In addition, Bt also has the effect of control evil to various pests such as Hymenoptera, Homoptera, Orthoptera, Mallophaga and plant pathogeny line insect, mite class, protozoon.At present Bt has become the strong substitute of chemical synthetic pesticide in the control of agricultural pests, injurious forest-insect and sanitary insect pest, and Bt still be that transgenic pest-resistant engineered plant important function of gene is originated.
(Adang M.J et al from Schnepf in 1981 has cloned first gene that can express insecticidal activity from strain HD-1Dipel since, Characterized full-length andtruncated plasmid clones of the crystal protein of Bacillus thuringiensissubsp.kurstaki HD-73 and their toxicity to Manduca sexta, Gene, 1985,36 (3): 289~300.), people separating clone the gene of more than 390 kind of coded insect-killing crystallin, they are defined as different groups respectively according to the amino acid sequence coded homology, subgroup, class and subclass (Crickmore N, Zeigler D R, Feitelson J, et al.Revision of the nomenclature for the Bacillus thuringiensis pesticidalcrystal proteins.Microbiol Mol Biol Rev, 1998,62:807-813; Http:// www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/).Generally speaking, Cry1, toxalbumin such as Cry2 and Cry9 are effective to lepidoptera pest; Wherein the maximum of research are Cry1 and Cry9 proteinoid, the insecticidal crystal protein molecular weight of their codings is 130-140kD, many genes have been widely used in the control (Kozie of the lepidoptera pest of plant at present, M.G., Beland, G.L., Bowman, C., et al.Field performance of elite transgenicmaize plants expressing an insecticidal protein derived from Bacillusthuringiensis.Bio/Technology, 1993,11:194-200; Perlak, F.J., Deaton, R.W., Armstrong, T.A., et al.Insect resistant cotton plants.bio/technology, 1990; 8:939-943; Van Frankenhuyzen, K., Gringorten, L., and Gauhier, D.1997.Cry9Ca1 toxin, a Bacillus thuringiensis insecticidal crystalprotein with high activity against the spruce bud worm (Choristoneurafnniferana) .Appl.Environ, Microbviol.63:4132-4134; Wang Fei, 2001, the research of bacillus thuringiensis specific strain biological characteristics and the new gene of cry9, Master's thesis, Nankai University).Tribactur Israel subclass (B.thuringiensis subsp.israelensis, abbreviation Bti) toxin protein that produces has fine insecticidal activity to mosquito, extensively applied to control (the Goldberg L J of mosquito, and Margalit J, 1977.A bacterialspore demonstrating rapid larvicidal activity against Anopheles sergentii, Uranotaenia unguiculata, Culex univitattus, Aedes aegypti, and Culexpipiens.Mosqito News, 37:355-358; ).Simultaneously, Cyt albumen has cytolytic, some Cry albumen is had synergism and delays the resistance (Wu of insect, D., Johnson, J.J., and Federici, B.A.1994.Synergism of mosquitocidal toxicity betweenCytA and CryIVD Proteins using inclusion sproduced from clonedgenes of Bacillus thuringiensis.Mol.Microbiol.13:965-972; Wirth, M.C., Georghiou, G.P., and Federeci, B.A.1997.CytA enables CryIVendotoxins of Bacillus thuringiensis to overcome high levels of CryIVresistance in the mosquito, Culex quinquefasciatus.Proc.Natl.Acad.Sci.94:10536-10540)
Find the history in existing so far more than 100 year of Tribactur from the beginning of this century, aspect the preventing and treating of farm crop and gardening plant insect, injurious forest-insect and sanitary insect pest, be widely used, also play good effect.But owing to use Tribactur on a large scale and repeatedly, many insect populations are producing resistance to insecticidal crystal protein in succession in varying degrees.The history in existing more than 50 year of Utilization of pesticides based on the Bt insecticidal crystal protein, the initial resistance of insect that never detect to Bt, but, begin mid-term 80 year last century, resistance problem (the M cGaughey that constantly in laboratory and field test, is confirmed, W.H.1985.Insect resistance to the biological insecticide Bacillus thuringiensis.Science.229:193-195), reason mainly is continue to use single variety and inferiorly cause the Bt of dosage and the application of Bt transgenic anti-insect plants causes insect population to be subjected to the selective pressure of sterilant for a long time.1985, McGaughey report warehouse grain pest Indian meal moth (Plodia interpunctella) under the selective pressure of Dipel (the commodity preparation of Bt subsp.kurstaik HD-1), bred for 15 generations after, resistance increases by 97 times; Under the high dosage selective pressure, resistance can increase by 250 times.Nineteen ninety, the small cabbage moth that confirms big Tanaka in Hawaii has first produced tangible resistance (Tabashnik to the Bt sterilant, B.E., Finson, N., Groeters, F.R., et al.1994.Reversal of resistance to Bacillus thuringiensisin Plutella xylostella.Proc.Natl.Acad.Sci.USA.91:4120-4124), since the nineties in last century, use long Shenzhen of Bt sterilant time in China, Guangzhou, ground such as Shanghai, find that the Bt sterilant obviously descends to the small cabbage moth prevention effect, mean resistance form (Feng Xia .1996. Guangdong small cabbage moth is to the resistance research of Bacillus thuringiensis. insect journal, 39 (3): 238-244; Hofte, H., Van Rie, J., Jansens, S., Van Houtven, A., Vanderbruggen, H., and Vaeck, M., 1988.Monoclonal antibody analysis and insecticidal spectrum ofthree types of lepidopteran-specific insecticidal crystal proteins ofBacillus thuringiensis.Appl.Environ.Microbiol.54:2010-2017).Find at present in the laboratory and the field has at least tens kinds of insects that Bt and insecticidal crystal protein thereof have been produced resistance, arrive with the selective pressure mathematical model prediction, under the condition of Bt transgenic anti-insect plants selective pressure, insect will produce resistance (Schnepf, E., Crickmore, N., Van Pie, J., et al.1998.Bacillus thuringiensis and its pesticidal Crystalproteins.Microbiol.Mol.Biol.Rev.65 (3): 775-806).In addition, there are some researches prove that Bti does not find resistance problem (Regis L as yet in the use in land for growing field crops, et al., 2000.The useof bacterial larvicides in mosquito and black fly control programsinBrazil.Mem.Instituto Oswaldo Cruz, 95:207-210.), but mosquito constantly is confirmed in the laboratory to its resistance problem, this situation also may (Georghiou G P occur big Tanaka, and Wirth M C, 1997.Influence of exposure to singleversus multiple toxins of Bacillus thuringiensis subsp.israelensis ondevelopment of resistance in the mosquito Culex quinquefasciatus (Diptera:Culicidae) .Applied and Environmental Microbiology, 63:1095-1101.).
Be the loss of avoiding resistant insects to cause, seeking new high virulence gene resource is the effective way that addresses this problem, and this biological control to China has crucial meaning.
Summary of the invention
First purpose of the present invention is to provide a kind of new BT virulence protein resource at above-mentioned deficiency.
Second purpose of the present invention is to provide the gene of encoding said proteins.
The present invention also aims to provide the application of above-mentioned albumen and gene.
The present invention separates the new bacterial strain BM59-2 of the bacillus thuringiensis (Bacillus thuringiensis) that obtains from Sichuan Province's Chengdu Plain soil.By the virulence test shows to BM59-2, BM59-2 all has high virulence to lepidoptera pest, Diptera pest or the like.According to 1 pair of special primer of cry52 genoid conserved sequence design, its genomic dna increases, the result shows that there is the cry52 genoid in this bacterial strain, further its full-length gene primer of design is cloned and is obtained the cry52Ba gene, and its nucleotide sequence is shown in sequence table SEQ ID No.1, this sequence total length 2112bp, analysis revealed, GC content are 36.9%, the albumen that 703 amino acid of encoding are formed.After measured, its aminoacid sequence is shown in SEQ ID No.2.Adopt bacterial sigma7.0 promoter program that complete sequence is predicted in the softberry website and show, contain the sequence in RNA polymerase activation site in the gene coding region upstream, its called after cry52Ba1.The present invention has further analyzed the proteic amino acid of Cry52Ba1 and has formed (seeing Table 1).
The proteic amino acid of table 1 Cry52Ba1 is formed
Amino acid | Per-cent % | Amino acid | Per-cent % |
Ala(A): | 5.26 | Met(M): | 1.28 |
Cys(C): | 1.71 | Asn(N): | 7.54 |
Asp(D): | 4.41 | Pro(P): | 5.12 |
Glu(E): | 5.41 | Gln(Q): | 2.56 |
Phe(F): | 4.27 | Arg(R): | 4.41 |
Gly(G): | 6.97 | Ser(S): | 7.25 |
His(H): | 1.42 | Thr(T): | 6.83 |
Ile(I): | 5.26 | Val(V): | 5.97 |
Lys(K): | 5.69 | Trp(W): | 1.99 |
Leu(L): | 10.10 | Tyr(Y): | 6.54 |
Should be appreciated that those skilled in the art can not influence under its active prerequisite according to aminoacid sequence disclosed by the invention, replace, lack and/or increase one or several amino acid, obtain described proteic mutant nucleotide sequence.For example, the 75th Ala is replaced with Met at nonactive section.Therefore, Bt albumen of the present invention comprises that also aminoacid sequence shown in the SEQ ID No.2 is substituted, replaces and/or increases one or several amino acid, has the equal active protein of being derived and being obtained by Cry52Ba1 of Cry52Ba1 albumen.Gene of the present invention comprises the nucleic acids encoding said proteins sequence.
In addition, should be understood that the degeneracy of considering codon and the preferences of different plant species codon, those skilled in the art can use as required and be fit to the codon that specific species are expressed.
Gene of the present invention can be cloned or separate from bacterial strain BM59-2 with protein and be obtained, and perhaps obtains by DNA or peptide synthetic method.
Gene of the present invention can be operably connected with expression vector, obtain to express the proteic recombinant expression vector of the present invention, and then can pass through such as transgenic methods such as agrobacterium-mediated transformation, particle bombardment, pollen tube passage methods, described expression vector is imported the host, obtain changeing the transformant of cry52Ba1 gene, for example plant such as farm crop or fruit tree makes it possess anti-insect activity.
In addition, can also obtain containing the proteic fermented liquid of Cry52Ba1, it is prepared into sterilant, be used for the control of crop pests by fermentation bacterial strain BM59-2 of the present invention.Those skilled in the art can also be with said gene transform bacteria or fungi, by large scale fermentation production Bt albumen of the present invention.
Those skilled in the art can also with farm crop such as its converting cotton, corn, paddy rice, vegetables, make it possess corresponding anti-insect activity according to gene disclosed by the invention.Thereby reduce the usage quantity of agricultural chemicals, reduce environmental pollution, have important economic value and application prospect.
Description of drawings
That Fig. 1 shows is cry52Ba1 full-length gene clone, M wherein, marker; 1, the cry52Ba1 gene.
Fig. 2 shows is that the enzyme of recombinant plasmid pET-52Ba is cut the evaluation collection of illustrative plates, wherein 1 recombinant plasmid pET-52Ba; 2, with Nde I+EcoR I double digestion pET-30a; 3, Nde I+EcoR I double digestion pET-52Ba; 4, the DNA of insertion; M1, M2 are Marker.
What Fig. 3 showed is that the SDS-PAGE that expresses Cry52Ba1 in E.coli BL21 (DE3) detects, and wherein M is albumen marker; 1. negative control (E.coiiBL21 (DE3) (pET-30a)); 2. cracking supernatant; 3.Cry52Ba1 inclusion body.
Embodiment
Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.
If do not specialize the conventional means that used technique means is well known to those skilled in the art among the embodiment.
The clone of embodiment 1cry52Ba1 gene
The present invention separates the new bacterial strain of the bacillus thuringiensis (Bacillus thuringiensis) that obtains from the soil of Muchuan, Sichuan Province virgin forest area, this bacterial strain on January 12nd, 2009 at China Committee for Culture Collection of Microorganisms common micro-organisms center (address: No. 3, A, DaTun Road, Chaoyang District, BeiJing City, Institute of Microorganism, Academia Sinica, postcode 100101) preservation, classification called after bacillus thuringiensis (Bacillus thuringiensis), preserving number is CGMCC No.2871.
This example is cloned the full length sequence that obtains the cry52Ba1 gene by the following method.
Total DNA of BM59-2.The design primer sequence is as follows:
P1:5’ATGAATTCATATCAAAATAAAAATG3’
P2:5’TTACCTCCTACTTCAGTACATACTTT3’
The PCR reaction system:
10×buffer 2.5μl
MgCl
2(25mM) 1.5μl
Taq enzyme 0.2 μ l
dNTPs(2.5mM) 2μl
Primer 2 μ l
End reaction volume 25 μ l
Thermal cycle reaction: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 1min, 52 ℃ of annealing 1min, 72 ℃ are extended 2min, 30 circulations; 72 ℃ are extended 5min; 4 ℃ of stopped reaction.The amplified reaction product is electrophoresis on 1% sepharose, puts and observes the pcr amplification result in the gel imaging system.The result has obtained being about the sequence of 2000bp by amplification as shown in Figure 1, and this sequence is checked order, and its nucleotide sequence is shown in SEQ ID No.1, and is consistent with aim sequence.
According to cry52Ba1 gene open reading frame two terminal sequences, design and synthesize a pair of Auele Specific Primer cry53F:5 '-GCG
CATATG(NdeI) ATGAATTCATATCAAAATAAAAATG-3, cry53R:5 '-CG
GAATTC(EcoR I) TTACCTCCTACTTCAGTACATACTTT-3 ' is respectively at 5 ' end primer Nde I and EcoR I restriction enzyme site.With the BM59-2 plasmid is that template increases, the product of amplification adopts Nde I and EcoR I to carry out double digestion, carrier pET-30a (+) after enzyme is cut product and carried out double digestion equally is connected, Transformed E .coli DH5 α competent cell, extract its plasmid enzyme restriction electrophoresis and verified that insertion segment size meets (Fig. 2) after the intended purposes, changes recipient bacterium E.coli.BL21 (DE3) again over to.With recombinant plasmid called after pET-52Ba, contain the recon called after E.coli.BL21 (52Ba) of recombinant plasmid.In the precipitation of SDS-PAGE analysis revealed cry52Ba1 expression of gene product after the thalline ultrasonication (Fig. 3), molecular weight is about about 76kDa, conforms to the molecular weight of albumen of prediction.The Cry52Ba1 gene expression product is respectively to beet armyworm, and the survey result that gives birth to of bollworm and yellow-fever mosquito shows: expression product all has insecticidal activity preferably to these three kinds of worms.The highest to the beet armyworm insecticidal activity, LC
50Be 25.2 μ g/mL; LC to yellow-fever mosquito
50Be 34.63 μ g/mL; Minimum to the bollworm insecticidal activity, LC
50Be 58.19 μ g/mL.Albumen to the lepidopteran insecticidal activity measuring method referring to (SongFP, Zhang J, Gu AX, et al., 2003.Identification of cry1I-type genes fromBacillus thuringiensis strains and characterization of a novel cry1I-typegene.Appl.Environ.Microbiol 69:5207-5211), albumen to the Diptera insecticidal activity measuring method referring to (Ibarra JE, del Rinc ó n MC, Sergio Ord ú z, et al., 2003.Diversity of Bacillus thuringienisis Strains from Latin Americawith Insecticidal Activity against Different Mosquito Species.ApplEnviron Microbiol 69:5269-5274).
Sequence table
<110〉Sichuan Agricultural University
<120〉Tribactur BM59-2 and application thereof
<130>KHP09112216.2
<160>6
<170>PatentIn?version?3.5
<210>1
<211>2111
<212>DNA
<213>Bacillus?thuringiensis?BM59-2
<220>
<221>CDS
<222>(1)..(2109)
<400>1
atg?aat?tca?tat?caa?aat?aaa?aat?gaa?tat?gaa?ata?ttg?gat?gct?tca 48
Met?Asn?Ser?Tyr?Gln?Asn?Lys?Asn?Glu?Tyr?Glu?Ile?Leu?Asp?Ala?Ser
1 5 10 15
caa?aac?aac?tct?aat?atg?tct?aat?cgt?tat?cca?agg?tat?cca?tta?gca 96
Gln?Asn?Asn?Ser?Asn?Met?Ser?Asn?Arg?Tyr?Pro?Arg?Tyr?Pro?Leu?Ala
20 25 30
aat?gat?cca?caa?gct?tct?atg?cag?aat?acg?aat?tat?aaa?gat?tgg?ttg 144
Asn?Asp?Pro?Gln?Ala?Ser?Met?Gln?Asn?Thr?Asn?Tyr?Lys?Asp?Trp?Leu
35 40 45
gct?acg?tgc?aac?gga?acg?cct?gcc?ccg?ctt?tat?aat?tct?tca?caa?cta 192
Ala?Thr?Cys?Asn?Gly?Thr?Pro?Ala?Pro?Leu?Tyr?Asn?Ser?Ser?Gln?Leu
50 55 60
ctt?aaa?att?tca?gga?aat?gta?gtt?tct?agg?gct?ctc?gga?atg?ctt?ccc 240
Leu?Lys?Ile?Ser?Gly?Asn?Val?Val?Ser?Arg?Ala?Leu?Gly?Met?Leu?Pro
65 70 75 80
att?cct?ggg?att?gct?cct?ctt?tta?agt?ttt?ctc?tct?act?ttg?ctt?tgg 288
Ile?Pro?Gly?Ile?Ala?Pro?Leu?Leu?Ser?Phe?Leu?Ser?Thr?Leu?Leu?Trp
85 90 95
cca?agt?gga?tca?tcc?gga?aat?act?att?tgg?gaa?tcg?ttg?atg?aaa?gaa 336
Pro?Ser?Gly?Ser?Ser?Gly?Asn?Thr?Ile?Trp?Glu?Ser?Leu?Met?Lys?Glu
100 105 110
gct?gcg?gat?ttg?ata?gac?caa?aag?tta?gag?gag?aat?ata?tta?cgc?caa 384
Ala?Ala?Asp?Leu?Ile?Asp?Gln?Lys?Leu?Glu?Glu?Asn?Ile?Leu?Arg?Gln
115 120 125
gca?acg?gcc?aat?tta?gcc?gga?tta?caa?gga?cta?ttg?gga?tca?tat?aac 432
Ala?Thr?Ala?Asn?Leu?Ala?Gly?Leu?Gln?Gly?Leu?Leu?Gly?Ser?Tyr?Asn
130 135 140
agc?gct?ttt?gct?tca?tgg?gaa?gca?ggc?ggc?aat?gca?act?cct?gat?ctg 480
Ser?Ala?Phe?Ala?Ser?Trp?Glu?Ala?Gly?Gly?Asn?Ala?Thr?Pro?Asp?Leu
145 150 155 160
gta?aaa?ggt?tat?atg?gag?agc?ctt?cat?cgt?acg?ttt?gtg?cag?gat?att 528
Val?Lys?Gly?Tyr?Met?Glu?Ser?Leu?His?Arg?Thr?Phe?Val?Gln?Asp?Ile
165 170 175
ata?ggc?agc?ttc?acg?ata?cca?ggt?tat?gaa?aaa?ata?tta?tta?cct?acc 576
Ile?Gly?Ser?Phe?Thr?Ile?Pro?Gly?Tyr?Glu?Lys?Ile?Leu?Leu?Pro?Thr
180 185 190
tat?gcg?att?acc?gcc?aat?ttt?cat?ttg?atg?tta?tta?cgt?gac?att?gaa 624
Tyr?Ala?Ile?Thr?Ala?Asn?Phe?His?Leu?Met?Leu?Leu?Arg?Asp?Ile?Glu
195 200 205
att?tat?gga?ggt?aaa?aaa?acc?cca?gaa?ggt?aaa?gat?ggc?ctg?aat?ttt 672
Ile?Tyr?Gly?Gly?Lys?Lys?Thr?Pro?Glu?Gly?Lys?Asp?Gly?Leu?Asn?Phe
210 215 220
gat?cca?aaa?gac?cta?aat?ttt?tat?aat?tgt?gaa?cta?aag?aaa?tat?aag 720
Asp?Pro?Lys?Asp?Leu?Asn?Phe?Tyr?Asn?Cys?Glu?Leu?Lys?Lys?Tyr?Lys
225 230 235 240
gaa?ctg?tat?acg?aat?cat?tgc?tta?aat?act?tac?aat?aaa?ggt?ttg?gcc 768
Glu?Leu?Tyr?Thr?Asn?His?Cys?Leu?Asn?Thr?Tyr?Asn?Lys?Gly?Leu?Ala
245 250 255
tca?gaa?aaa?gaa?aaa?ggt?tgg?gtg?cct?ttc?cat?cga?tat?cgt?aga?gaa 816
Ser?Glu?Lys?Glu?Lys?Gly?Trp?Val?Pro?Phe?His?Arg?Tyr?Arg?Arg?Glu
260 265 270
atg?act?ttg?gct?gta?tta?gat?ata?att?gca?tta?ttc?cca?ctc?tat?gat 864
Met?Thr?Leu?Ala?Val?Leu?Asp?Ile?Ile?Ala?Leu?Phe?Pro?Leu?Tyr?Asp
275 280 285
gca?aga?ctc?tat?cct?gct?aag?aat?aat?aaa?gaa?atg?cca?gtt?aaa?tcc 912
Ala?Arg?Leu?Tyr?Pro?Ala?Lys?Asn?Asn?Lys?Glu?Met?Pro?Val?Lys?Ser
290 295 300
gaa?ttg?act?cga?gaa?att?tat tcg?gat?gtc?att?aat?agc?gat?agg?ttc 960
Glu?Leu?Thr?Arg?Glu?Ile?Tyr?Ser?Asp?Val?Ile?Asn?Ser?Asp?Arg?Phe
305 310 315 320
gga?gtg?gta?ccc?cct?tat?aat?tat?gct?caa?aac?gaa?gaa?cgt?tat?aca 1008
Gly?Val?Val?Pro?Pro?Tyr?Asn?Tyr?Ala?Gln?Asn?Glu?Glu?Arg?Tyr?Thr
325 330 335
cga?cca?cct?cat?ctc?ttc?act?tgg?tta?cga?ggg?ctt?gac?ttt?gta?acc 1056
Arg?Pro?Pro?His?Leu?Phe?Thr?Trp?Leu?Arg?Gly?Leu?Asp?Phe?Val?Thr
340 345 350
aat?gtt?ctg?act?agc?gga?act?tgg?gtt?tat?aga?tgg?agc?gtt?tta?act 1104
Asn?Val?Leu?Thr?Ser?Gly?Thr?Trp?Val?Tyr?Arg?Trp?Ser?Val?Leu?Thr
355 360 365
ggg?ttg?tca?aaa?gaa?ata?ttc?tta?tac?aaa?agg?gaa?tgg?tac?tat?aac 1152
Gly?Leu?Ser?Lys?Glu?Ile?Phe?Leu?Tyr?Lys?Arg?Glu?Trp?Tyr?Tyr?Asn
370 375 380
tgg?tcc?ttt?tcg?ggg?tta?tcc?tgt?aga?gtc?tgg?tgg?aag?aac?ttc?caa 1200
Trp?Ser?Phe?Ser?Gly?Leu?Ser?Cys?Arg?Val?Trp?Trp?Lys?Asn?Phe?Gln
385 390 395 400
cat?tac?tat?tgc?aga?agg?ttc?cta?tat?tta?gaa?ctt?gtt?gcc?aag?aag 1248
His?Tyr?Tyr?Cys?Arg?Arg?Phe?Leu?Tyr?Leu?Glu?Leu?Val?Ala?Lys?Lys
405 410 415
ctt?tca?ata?tat?ttc?ccc?ttg?gta?ttt?tac?gac?aaa?tat?cgc?act?gat 1296
Leu?Ser?Ile?Tyr?Phe?Pro?Leu?Val?Phe?Tyr?Asp?Lys?Tyr?Arg?Thr?Asp
420 425 430
tac?ttt?ctt?act?aac?aaa?aat?aat?agt?tca?aca?gaa?aaa?gtt?tat?ggt 1344
Tyr?Phe?Leu?Thr?Asn?Lys?Asn?Asn?Ser?Ser?Thr?Glu?Lys?Val?Tyr?Gly
435 440 445
tat?gta?gcc?ggc?aac?gct?aat?tta?cct?act?gtt?caa?aca?gat?ttt?gat 1392
Tyr?Val?Ala?Gly?Asn?Ala?Asn?Leu?Pro?Thr?Val?Gln?Thr?Asp?Phe?Asp
450 455 460
ttt?ctt?aca?aat?aaa?gaa?gta?act?ggc?cct?cca?aca?tac?aat?aac?tat 1440
Phe?Leu?Thr?Asn?Lys?Glu?Val?Thr?Gly?Pro?Pro?Thr?Tyr?Asn?Asn?Tyr
465 470 475 480
aat?cat?att?ttg?tca?tac?ttg?ttg?cta?ggt?tat?gat?tgg?aat?cag?acg 1488
Asn?His?Ile?Leu?Ser?Tyr?Leu?Leu?Leu?Gly?Tyr?Asp?Trp?Asn?Gln?Thr
485 490 495
ggt?gga?ata?ggc?aca?cac?gga?tat?tca?ttt?gca?ttt?aca?cat?agt?agc 1536
Gly?Gly?Ile?Gly?Thr?His?Gly?Tyr?Ser?Phe?Ala?Phe?Thr?His?Ser?Ser
500 505 510
gtt?gat?cct?tat?aac?acc?att?gcc?cca?gat?aaa?att?acg?caa?att?cct 1584
Val?Asp?Pro?Tyr?Asn?Thr?Ile?Ala?Pro?Asp?Lys?Ile?Thr?Gln?Ile?Pro
515 520 525
gca?gtg?aag?gct?ttt?gaa?ata?tca?gat?gca?gga?cca?agt?caa?gtc?ata 1632
Ala?Val?Lys?Ala?Phe?Glu?Ile?Ser?Asp?Ala?Gly?Pro?Ser?Gln?Val?Ile
530 535 540
gct?gga?cct?ggt?cat?aca?gga?gga?gat?gta?gta?agg?tta?tac?ctt?tca 1680
Ala?Gly?Pro?Gly?His?Thr?Gly?Gly?Asp?Val?Val?Arg?Leu?Tyr?Leu?Ser
545 550 555 560
ggc?cgt?tta?aaa?ata?cgt?tta?act?cct?gca?tcc?acg?aat?aaa?aat?tac 1728
Gly?Arg?Leu?Lys?Ile?Arg?Leu?Thr?Pro?Ala?Ser?Thr?Asn?Lys?Asn?Tyr
565 570 575
ctt?gtt?aga?gtt?cgc?tat?gca?agt?ccg?gta?tct?ggt?acg?tta?cga?gta 1776
Leu?Val?Arg?Val?Arg?Tyr?Ala?Ser?Pro?Val?Ser?Gly?Thr?Leu?Arg?Val
580 585 590
gaa?aga?tgg?tcg?cct?agt?tct?gtt?aca?aat?cgt?gat?ttt?act?cgt?ttg 1824
Glu?Arg?Trp?Ser?Pro?Ser?Ser?Val?Thr?Asn?Arg?Asp?Phe?Thr?Arg?Leu
595 600 605
gct?acg?ggt?ggt?ttt?aat?tca?ttt?ggc?tat?gtg?gac?acc?tta?gtt?act 1872
Ala?Thr?Gly?Gly?Phe?Asn?Ser?Phe?Gly?Tyr?Val?Asp?Thr?Leu?Val?Thr
610 615 620
aca?tgt?aat?caa?tca?ggt?gtt?gaa?ata?att?ata?caa?aat?cta?ggt?gct 1920
Thr?Cys?Asn?Gln?Ser?Gly?Val?Glu?Ile?Ile?Ile?Gln?Asn?Leu?Gly?Ala
625 630 635 640
tct?gac?gtt?atc?att?gac?aaa?gtt?gaa?ttt?atc?cct?tat?gac?atc?cca 1968
Ser?Asp?Val?Ile?Ile?Asp?Lys?Val?Glu?Phe?Ile?Pro?Tyr?Asp?Ile?Pro
645 650 655
att?gat?aaa?tgt?acg?aaa?tgt?gaa?ttc?gaa?gga?aac?gta?tgt?aca?tgt 2016
Ile?Asp?Lys?Cys?Thr?Lys?Cys?Glu?Phe?Glu?Gly?Asn?Val?Cys?Thr?Cys
660 665 670
aga?tgt?gaa?gga?gta?caa?tcc?tta?gaa?aaa?gaa?aaa?gag?att?gta?aat 2064
Arg?Cys?Glu?Gly?Val?Gln?Ser?Leu?Glu?Lys?Glu?Lys?Glu?Ile?Val?Asn
675 680 685
agt?tta?ttt?gtc?aaa?gaa?aac?aaa?gta?tgt?act?gaa?gta?gga?ggt?aa 2111
Ser?Leu?Phe?Val?Lys?Glu?Asn?Lys?Val?Cys?Thr?Glu?Val?Gly?Gly
690 695 700
<210>2
<211>703
<212>PRT
<213>Bacillus?thuringiensis?BM59-2
<400>2
Met?Asn?Ser?Tyr?Gln?Asn?Lys?Asn?Glu?Tyr?Glu?Ile?Leu?Asp?Ala?Ser
1 5 10 15
Gln?Asn?Asn?Ser?Asn?Met?Ser?Asn?Arg?Tyr?Pro?Arg?Tyr?Pro?Leu?Ala
20 25 30
Asn?Asp?Pro?Gln?Ala?Ser?Met?Gln?Asn?Thr?Asn?Tyr?Lys?Asp?Trp?Leu
35 40 45
Ala?Thr?Cys?Asn?Gly?Thr?Pro?Ala?Pro?Leu?Tyr?Asn?Ser?Ser?Gln?Leu
50 55 60
Leu?Lys?Ile?Ser?Gly?Asn?Val?Val?Ser?Arg?Ala?Leu?Gly?Met?Leu?Pro
65 70 75 80
Ile?Pro?Gly?Ile?Ala?Pro?Leu?Leu?Ser?Phe?Leu?Ser?Thr?Leu?Leu?Trp
85 90 95
Pro?Ser?Gly?Ser?Ser?Gly?Asn?Thr?Ile?Trp?Glu?Ser?Leu?Met?Lys?Glu
100 105 110
Ala?Ala?Asp?Leu?Ile?Asp?Gln?Lys?Leu?Glu?Glu?Asn?Ile?Leu?Arg?Gln
115 120 125
Ala?Thr?Ala?Asn?Leu?Ala?Gly?Leu?Gln?Gly?Leu?Leu?Gly?Ser?Tyr?Asn
130 135 140
Ser?Ala?Phe?Ala?Ser?Trp?Glu?Ala?Gly?Gly?Asn?Ala?Thr?Pro?Asp?Leu
145 150 155 160
Val?Lys?Gly?Tyr?Met?Glu?Ser?Leu?His?Arg?Thr?Phe?Val?Gln?Asp?Ile
165 170 175
Ile?Gly?Ser?Phe?Thr?Ile?Pro?Gly?Tyr?Glu?Lys?Ile?Leu?Leu?Pro?Thr
180 185 190
Tyr?Ala?Ile?Thr?Ala?Asn?Phe?His?Leu?Met?Leu?Leu?Arg?Asp?Ile?Glu
195 200 205
Ile?Tyr?Gly?Gly?Lys?Lys?Thr?Pro?Glu?Gly?Lys?Asp?Gly?Leu?Asn?Phe
210 215 220
Asp?Pro?Lys?Asp?Leu?Asn?Phe?Tyr?Asn?Cys?Glu?Leu?Lys?Lys?Tyr?Lys
225 230 235 240
Glu?Leu?Tyr?Thr?Asn?His?Cys?Leu?Asn?Thr?Tyr?Asn?Lys?Gly?Leu?Ala
245 250 255
Ser?Glu?Lys?Glu?Lys?Gly?Trp?Val?Pro?Phe?His?Arg?Tyr?Arg?Arg?Glu
260 265 270
Met?Thr?Leu?Ala?Val?Leu?Asp?Ile?Ile?Ala?Leu?Phe?Pro?Leu?Tyr?Asp
275 280 285
Ala?Arg?Leu?Tyr?Pro?Ala?Lys?Asn?Asn?Lys?Glu?Met?Pro?Val?Lys?Ser
290 295 300
Glu?Leu?Thr?Arg?Glu?Ile?Tyr?Ser?Asp?Val?Ile?Asn?Ser?Asp?Arg?Phe
305 310 315 320
Gly?Val?Val?Pro?Pro?Tyr?Asn?Tyr?Ala?Gln?Asn?Glu?Glu?Arg?Tyr?Thr
325 330 335
Arg?Pro?Pro?His?Leu?Phe?Thr?Trp?Leu?Arg?Gly?Leu?Asp?Phe?Val?Thr
340 345 350
Asn?Val?Leu?Thr?Ser?Gly?Thr?Trp?Val?Tyr?Arg?Trp?Ser?Val?Leu?Thr
355 360 365
Gly?Leu?Ser?Lys?Glu?Ile?Phe?Leu?Tyr?Lys?Arg?Glu?Trp?Tyr?Tyr?Asn
370 375 380
Trp?Ser?Phe?Ser?Gly?Leu?Ser?Cys?Arg?Val?Trp?Trp?Lys?Asn?Phe?Gln
385 390 395 400
His?Tyr?Tyr?Cys?Arg?Arg?Phe?Leu?Tyr?Leu?Glu?Leu?Val?Ala?Lys?Lys
405 410 415
Leu?Ser?Ile?Tyr?Phe?Pro?Leu?Val?Phe?Tyr?Asp?Lys?Tyr?Arg?Thr?Asp
420 425 430
Tyr?Phe?Leu?Thr?Asn?Lys?Asn?Asn?Ser?Ser?Thr?Glu?Lys?Val?Tyr?Gly
435 440 445
Tyr?Val?Ala?Gly?Asn?Ala?Asn?Leu?Pro?Thr?Val?Gln?Thr?Asp?Phe?Asp
450 455 460
Phe?Leu?Thr?Asn?Lys?Glu?Val?Thr?Gly?Pro?Pro?Thr?Tyr?Asn?Asn?Tyr
465 470 475 480
Asn?His?Ile?Leu?Ser?Tyr?Leu?Leu?Leu?Gly?Tyr?Asp?Trp?Asn?Gln?Thr
485 490 495
Gly?Gly?Ile?Gly?Thr?His?Gly?Tyr?Ser?Phe?Ala?Phe?Thr?His?Ser?Ser
500 505 510
Val?Asp?Pro?Tyr?Asn?Thr?Ile?Ala?Pro?Asp?Lys?Ile?Thr?Gln?Ile?Pro
515 520 525
Ala?Val?Lys?Ala?Phe?Glu?Ile?Ser?Asp?Ala?Gly?Pro?Ser?Gln?Val?Ile
530 535 540
Ala?Gly?Pro?Gly?His?Thr?Gly?Gly?Asp?Val?Val?Arg?Leu?Tyr?Leu?Ser
545 550 555 560
Gly?Arg?Leu?Lys?Ile?Arg?Leu?Thr?Pro?Ala?Ser?Thr?Asn?Lys?Asn?Tyr
565 570 575
Leu?Val?Arg?Val?Arg?Tyr?Ala?Ser?Pro?Val?Ser?Gly?Thr?Leu?Arg?Val
580 585 590
Glu?Arg?Trp?Ser?Pro?Ser?Ser?Val?Thr?Asn?Arg?Asp?Phe?Thr?Arg?Leu
595 600 605
Ala?Thr?Gly?Gly?Phe?Asn?Ser?Phe?Gly?Tyr?Val?Asp?Thr?Leu?Val?Thr
610 615 620
Thr?Cys?Asn?Gln?Ser?Gly?Val?Glu?Ile?Ile?Ile?Gln?Asn?Leu?Gly?Ala
625 630 635 640
Ser?Asp?Val?Ile?Ile?Asp?Lys?Val?Glu?Phe?Ile?Pro?Tyr?Asp?Ile?Pro
645 650 655
Ile?Asp?Lys?Cys?Thr?Lys?Cys?Glu?Phe?Glu?Gly?Asn?Val?Cys?Thr?Cys
660 665 670
Arg?Cys?Glu?Gly?Val?Gln?Ser?Leu?Glu?Lys?Glu?Lys?Glu?Ile?Val?Asn
675 680 685
Ser?Leu?Phe?Val?Lys?Glu?Asn?Lys?Val?Cys?Thr?Glu?Val?Gly?Gly
690 695 700
<210>3
<211>25
<212>DNA
<213〉artificial sequence
<400>3
atgaattcat?atcaaaataa?aaatg 25
<210>4
<211>26
<212>DNA
<213〉artificial sequence
<400>4
ttacctccta?cttcagtaca?tacttt 26
<210>5
<211>34
<212>DNA
<213〉artificial sequence
<400>5
gcgcatatga?tgaattcata?tcaaaataaa?aatg 34
<210>6
<211>34
<212>DNA
<213〉artificial sequence
<400>6
cggaattctt?acctcctact?tcagtacata?cttt 34
Claims (9)
1. Bt PROTEIN C ry52Ba1, its aminoacid sequence is shown in SEQ ID No.2.
2. coding claim 1 described proteic gene.
3. gene as claimed in claim 2, its nucleotide sequence is shown in SEQ ID No.1.
4. contain claim 2 or 3 described expression carrier.
5. by the described expression vector transformed host cells of claim 4.
6. host cell as claimed in claim 5, it is a plant host cell.
7. contain the described proteic sterilant of claim 1.
8. claim 2 or 3 described genes or the described expression vector of claim 4 application in the preparation transgenic plant.
9. claim 2 or 3 described genes or the described expression vector of claim 4 application in improving plant resistance to insect.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100815957A CN101531711B (en) | 2009-04-13 | 2009-04-13 | Bt protein Cry52Bal as well as encoding gene thereof and application thereof |
PCT/CN2010/000482 WO2010118630A1 (en) | 2009-04-13 | 2010-04-13 | Insecticidal crystal protein gene cry52ba1, its encoded protein and uses |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100815957A CN101531711B (en) | 2009-04-13 | 2009-04-13 | Bt protein Cry52Bal as well as encoding gene thereof and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101531711A CN101531711A (en) | 2009-09-16 |
CN101531711B true CN101531711B (en) | 2011-01-12 |
Family
ID=41102586
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2009100815957A Active CN101531711B (en) | 2009-04-13 | 2009-04-13 | Bt protein Cry52Bal as well as encoding gene thereof and application thereof |
Country Status (2)
Country | Link |
---|---|
CN (1) | CN101531711B (en) |
WO (1) | WO2010118630A1 (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101531711B (en) * | 2009-04-13 | 2011-01-12 | 四川农业大学 | Bt protein Cry52Bal as well as encoding gene thereof and application thereof |
AU2014323834A1 (en) * | 2013-09-18 | 2016-03-10 | Sichuan Agricultural University | Compositions and methods for improving insect resistance |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101531711B (en) * | 2009-04-13 | 2011-01-12 | 四川农业大学 | Bt protein Cry52Bal as well as encoding gene thereof and application thereof |
CN101531981B (en) * | 2009-04-13 | 2010-11-10 | 四川农业大学 | Bacillus thuringiensis BM59-2 and application thereof |
-
2009
- 2009-04-13 CN CN2009100815957A patent/CN101531711B/en active Active
-
2010
- 2010-04-13 WO PCT/CN2010/000482 patent/WO2010118630A1/en active Application Filing
Non-Patent Citations (2)
Title |
---|
谭芙蓉 等.苏云金芽胞杆菌Rpp39杀虫晶体蛋白基因的鉴定及cry2Aa12基因的克隆表达.微生物学报48 5.2008,48(5),684-687. |
谭芙蓉 等.苏云金芽胞杆菌Rpp39杀虫晶体蛋白基因的鉴定及cry2Aa12基因的克隆表达.微生物学报48 5.2008,48(5),684-687. * |
Also Published As
Publication number | Publication date |
---|---|
CN101531711A (en) | 2009-09-16 |
WO2010118630A1 (en) | 2010-10-21 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101531980B (en) | Bacillus thuringiensis HS18-1 and application thereof | |
CN101503666B (en) | Novel strain of Bacillus thuringiensis bacterial strain and use thereof | |
CN101503463B (en) | Novel Bt protein Cry53Ab1, coding gene thereof and use | |
CN101497658B (en) | Novel Bt protein Cry4Cc1, coding gene thereof and use | |
CN101497657B (en) | Novel disinsection Bt protein Cry54Aa1, coding gene thereof and use | |
CN105367633B (en) | A kind of BT PROTEIN C RY2Ab32, its encoding gene and application | |
CN101503464A (en) | Novel Bt protein Cry30Fa1, coding gene thereof and use | |
CN102781955B (en) | Bt protein Cry4Cb2, encoding gene of same and use thereof | |
CN101531981B (en) | Bacillus thuringiensis BM59-2 and application thereof | |
CN101531711B (en) | Bt protein Cry52Bal as well as encoding gene thereof and application thereof | |
CN101531713B (en) | Bt protein Cry56Aal as well as encoding gene thereof and application thereof | |
CN101591381A (en) | Bt PROTEIN C ry4Cb1, its encoding gene and application | |
CN101531712B (en) | Bt protein Cry30Bal as well as encoding gene thereof and application thereof | |
CN102363631B (en) | Insecticidal Bt (Bacillus thuringiensis) protein Cry8Qa1, coding gene thereof and application thereof | |
CN101531982B (en) | Bacillus thuringiensis YWC2-8 and application thereof | |
CN103103203A (en) | Bt cry54Ab1 gene, protein encoded by gene and application of gene or protein | |
CN103103204A (en) | Bt cry54Ab1 operon gene, protein encoded by gene and application of gene or protein | |
CN103525835A (en) | Bt Cry71Aa1 gene and coded protein thereof and application | |
CN102603876B (en) | Bt protein Cry59Bal, coding gene and application of Bt protein Cry59Bal | |
CN102363630B (en) | Pesticide Bt protein Cry8Pa1 and coding gene and use thereof | |
CN102584959B (en) | Bt (Bacillus thuringiensis) protein Cry70Ba1 as well as encoding gene and application thereof | |
CN102408475A (en) | Bt protein Cryt1Da1, and coding gene and application thereof | |
CN102408474B (en) | Bt protein Cry69Aa1, and coding gene and application thereof | |
CN102417538B (en) | Bt protein Cry68Aa1 and encoding gene and application thereof | |
CN102532285B (en) | Bt protein Cry2Ac-like and coding gene and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |