CN105367633B - A kind of BT PROTEIN C RY2Ab32, its encoding gene and application - Google Patents

Abstract

The present invention provides a kind of Bt albumenCry2Ab32And its there is amino acid sequence shown in amino acid sequence shown in SEQ ID No.2 or SEQ ID No.2 to be substituted, lack and/or increase one or more amino acid and have same active amino acid sequence for encoding gene, the albumen.Albumen of the present invention can be used for preparing Bt insecticide, the gene for encoding the albumen can make it have corresponding anti-insect activity with crops such as converting cotton, corn, rice, vegetables, to reduce the usage amount of pesticide, it reduces environmental pollution, there is important economic value and application prospect.

Description

A kind of BT PROTEIN C RY2Ab32, its encoding gene and application

Technical field

The present invention relates to field of biotechnology, and in particular to a kind of Bt albumen and its encoding gene and application.

Background technique

During human being's production, insect pest is an important factor for causing agricultural production to lose and influence human health.According to FAO Statistics, whole world agricultural production every year because caused by insect pest economic loss be up to 14%, up to 12%, crop smothering loss reaches for disease loss 11%.Loss is up to 126,000,000,000 dollars, is equivalent to the half of the Chinese agriculture gross output value, more than 4 times of Britain.In order to reduce these Crop pests and mosquito for many years, are generallyd use chemical prevention means and prevented and treated, but due to the length of chemical pesticide by loss Phase, a large amount of uses, the pollution to environment is caused, persticide residue increases in agricultural and sideline product, existence and health care belt to the mankind Harm is carried out.In addition, chemical pesticide while killing pest, has also killed natural enemy and other beneficial objects, it is flat to destroy ecology Weighing apparatus.Compared with chemical prevention, biological control has the characteristics that safely, effectively, persistently.And avoid chemical prevention bring one Series of problems.Therefore, the hot spot that biological prevention is studied at people.In biological insecticides, bacillus thuringiensis is Current purposes in the world is most wide, the maximum a kind of microbial insecticide of yield.

Bacillus thuringiensis（Bacillus thuringiensis, abbreviation Bt）It is a kind of gram-positive bacterium, it Distribution it is extremely wide, the parasporal crystal being made of protein with insecticidal activity can be formed while sporulation, again Name insecticidal crystal protein（Insectididal crystal proteins, abbreviation ICPs）, ICPs be bycryGene coding, There is strong toxicity to sensitive insect, and it is non-toxic to higher mammal and people.At present in agricultural pests, injurious forest-insect and sanitary insect pest Prevention and treatment in Bt have become the strong substitute of chemical synthetic pesticide, Bt or the important gene of transgenic pest-resistant engineered plant come Source.

From Schnepf in 1981 cloned from strain HD -1 first can express the gene of insecticidal activity since, people The gene for having cloned more than 500 kinds of coded insect-killing crystalline proteins is separated, according to their quilts of the amino acid sequence homology of coding Be identified as different groups, subgroup, class and subclass (Crickmore N,et al. Microbiol Mol Biol Rev, 1998,62:807-813; http://www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/).It is general and Speech,Cry1,Cry2WithCry9Equal toxalbumin are effective to lepidoptera pest；What is wherein studied most isCry1WithCry9Class egg White, the insecticidal crystal protein molecular weight that they are encoded is 130-140kD, and many genes have been widely used in the squama of plant at present The prevention and treatment of wing mesh pest.Bacillus thuringiensissubsp.israelensis (B.thuringiensis subsp. israelensis, Abbreviation Bti) generate toxin protein to mosquito have fine insecticidal activity, be widely used in the prevention and treatment of mosquito.MeanwhileCytEgg It is white that there is cytolytic, to certainCryAlbumen has synergistic effect and delays the resistance of insect.

The history of existing more than 50 years of the use of insecticide based on Bt insecticidal crystal protein initially never detects To insect to the resistance of Bt, still, 80 years last century mid-term starts, and resistance problem constantly obtains in laboratory and field trial It confirms（McGaughey,W. H. 1985. Science. 229:193-195）, reason mainly persistently use single variety and Asia The application of the Bt and Bt transgenic anti-insect plants of dosage is caused to cause insect population for a long time by the selection pressure of insecticide.1985 Year, McGaughey reports warehouse grain pest Indian meal moth（Plodia interpunctella）In Dipel (Bt subsp.kurstaikThe commercial preparation of HD-1) selection pressure under, breed 15 generations after, resistance increase by 97 times；It is selected in high dose It selects under pressure, resistance can increase by 250 times.Nineteen ninety confirms that the diamondback moth of big Tanaka generates Bt insecticide in Hawaii for the first time Apparent resistance（Tabashnik, B.E.,et al. 1994. Proc.Natl.Acad.Sci.USA.91:4120- 4124）, since the nineties in last century, in China using the longer Shenzhen and Guangzhou of Bt pesticide time, Shanghai and other places, found Bt Insecticide is decreased obviously diamondback moth control efficiency, it is meant that resistance has been formed（1996. insect journal of Feng Xia, 39 (3): 238-244; Hofte, H., 1988. Appl. Environ. Microbiol. 54: 2010-2017）.It has now been found that Several insects produce resistance to Bt and its insecticidal crystal protein for laboratory and field at least ten, with selection pressure mathematical model It predicts, under conditions of Bt transgenic anti-insect plants select pressure, insect will generate resistance（Schnepf, E., et al. 1998. Mol. Biol. Rev.65 (3):77 5-806）.In addition, there are some researches prove Bti in the use in crop field still Resistance problem is not found, but mosquito is constantly confirmed to its resistance problem in the lab, such case may also can be Big Tanaka occurs（Georghiou G P, 1997. Applied and Environmental Microbiology,63: 1095-1101.）.

To avoid loss caused by resistant insects, finding new high virulence Bt genetic resources is to solve having for this problem Effect approach, this is of great significance to the biological control in China.

Summary of the invention

The first purpose of this invention is to provide a kind of new Bt virulence protein resource in view of the above deficiencies.

Second object of the present invention is to provide the gene of encoding said proteins.

Third object of the present invention is to provide the application of above-mentioned albumen and gene.

Present invention bacillus thuringiensis new strains BN23-5 isolated from the Soils In The Region of Sichuan Province Chengdu, should Bacterial strain is on 07 14th, 2014 in China Committee for Culture Collection of Microorganisms's common micro-organisms center（Abbreviation CGMCC, Address：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Institute of Microorganism, Academia Sinica, postcode 100101）Preservation, classification It is named as bacillus thuringiensis（Bacillus thuringiensis）, deposit number is CGMCC No.9448.

Show that BN23-5 has high virulence to lepidoptera pest etc. by the virulence test to BN23-5.According tocry2Genoid conserved sequence designs a pair of of special primer, expands its genomic DNA, the results showed that exist in the bacterial straincry2Class Gene, further designs its full-length gene primer, and clone obtainsCry2Ab-likeGene, nucleotide sequence such as sequence table SEQ Shown in ID No.1, overall length 1902bp, analysis shows, G/C content 34.65% encodes the albumen of 634 amino acid composition.Through Measurement, amino acid sequence is as shown in SEQ ID No.2.Bacterial sigma7.0 is used in the website softberry Promoter program carries out prediction to complete sequence and shows to contain the sequence in RNA polymerase activation site in gene coding region upstream, It is named asCry2Ab32。Cry2Ab32The amino acid composition such as table 1 of albumen.

It should be appreciated that those skilled in the art can disclosed albumen according to the present inventionCry2Ab32'sAmino acid sequence（SEQ ID No.2）, do not influence its it is active under the premise of, replace, lack and/or increase one or several amino acid, obtain the egg White mutant nucleotide sequence.Such as in nonactive section, the 34th Ile is replaced with into Val, the 19th Val replaces with Ala, 605th insertion, one Ser, in one leu of the 605th missing, without influencing its activity.Therefore, Bt albumen of the inventionCry2Ab32It further include that amino acid sequence shown in SEQ ID No.2 is substituted, replaces and/or increases one or several amino acid, With with Bt albumenCry2Ab32It is same it is active byCry2Ab32Derivative obtained protein.

Gene of the present invention includes encoding said proteinsCry2Ab32'sNucleotide sequence.

The present invention provides encode above-mentioned Bt albumenCry2Ab32Gene, nucleotides sequence is classified as：

（1）Nucleotide sequence shown in sequence table SEQ ID NO.1, or

（2）Nucleotide sequence shown in SEQ ID No.1 is substituted, lacks and/or increases one or several nucleotide.

Furthermore, it is to be understood that in view of the degeneracy of codon and the preferences of different plant species codon, art technology Personnel can according to need using the codon for being suitble to particular species expression.

Gene and protein of the invention can clone or isolated from Bt bacterial strain BN23-5, or by DNA or The method of peptide synthesis obtains.

Gene of the present invention can be operably connected with expression vector, obtain the recombinant expression that can express albumen of the present invention Carrier, and then can be by transgenic methods such as agrobacterium-mediated transformation, particle bombardment, pollen tube passage methods, by the table Up to vector introduction host, turnedCry2Ab32The transformant of gene, such as the plants such as crops or fruit tree, have it anti- Worm activity.

In one embodiment of the invention, Bt albumenCry2Ab32Being obtained by for recombinant expression carrier willCry2Ab32Gene is inserted into building on expression vector pET-28a (+) and obtains recombinant expression carrier pET-2A.

Further, it is also possible to be contained by the bacterial strain BN23-5 of the present invention that fermentsCry2Ab32The fermentation liquid of albumen, by it It is prepared into insecticide, the prevention and treatment for crop pests.Said gene can also be converted bacterium or true by those skilled in the art Bacterium produces Bt albumen of the present invention by large scale fermentation.

The present invention also provides Bt albumenCry2Ab32Improving the application in plant resistance to insect.

The present invention provides Bt albumenCry2Ab32Cultivating the application in genetically modified plants.

Those skilled in the art can also be disclosed according to the present inventionCry2Ab32Gene, by its converting cotton, corn, water The crops such as rice, vegetables make it have corresponding anti-insect activity.Such as：It, will using the degeneracy of codonCry2Ab32Gene The gene order with rice preferred codons is designed, then by synthesisCry2Ab32Gene order and carrier pCAMBIA1300 Connection, is transferred in rice genome, to obtain the Transgenic Rice with anti-insect activity by mediated by agriculture bacillus.

The present invention providesCry2Ab32Albumen is a kind of Bt albumen, has preferable insecticidal activity, is used for preparation and turns Gene plant, can specific killing pest, and reduce the usage amount of pesticide, reduce cost, reduce environmental pollution.In the present invention Compliance test result test during, also without discovery pest to the albumen generate resistance the case where.Therefore, Bt albumen of the inventionCry2Ab32With important economic value and application prospect, it is suitble to large-scale application in the insect resistace for improving plant.

Detailed description of the invention

Fig. 1 is shown what clone obtainedCry2Ab32The gel electrophoresis figure of full-length gene, wherein M, DNA marker; 1, Cry2Ab32Gene;

The digestion identification map of recombinant plasmid pET-2A is shown in Fig. 2, wherein M, DNA marker；1, the DNA of insertion； 2, recombinant plasmid pET-2A；3, recombinant plasmid pET-2ABamH I+XHo IDouble enzyme digestion product；

Fig. 3 is shownCry2Ab32Gene existsE. coliThe SDS-PAGE expressed in BL21 (DE3) detects figure；Wherein 1, contain recombinant plasmid pET-2A'sE.coliBL21 (DE3) cellular lysate liquid supernatant after IPTG is induced；2, contain recombination Plasmid pET-2A'sE.coliBL21 (DE3) cellular lysate liquid precipitate after IPTG is induced；3, contain carrier pET-28a'sE.coliBL21 (DE3) expresses albumen（Negative control）；M, albumen marker.

Specific embodiment

Following embodiment further illustrates the contents of the present invention, but should not be construed as limiting the invention.Without departing substantially from In the case where spirit of that invention and essence, to modifications or substitutions made by the method for the present invention, step or condition, the present invention is belonged to Range.

Unless otherwise specified, biochemical reagents used in embodiment are commercial reagent, technology hand used in embodiment The conventional means that section is well known to those skilled in the art.

Embodiment 1Cry2Ab32The clone of gene

Present invention bacillus thuringiensis isolated from the Soils In The Region of Sichuan Province Chengdu（Bacillus thuringiensis）New strains BN23-5, the bacterial strain were entrusted on 07 14th, 2014 in Chinese microorganism strain preservation management Member can common micro-organisms center（Address：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Institute of Microorganism, Academia Sinica, Postcode 100101）Preservation, classification naming are bacillus thuringiensis（Bacillus thuringiensis）, deposit number is CGMCC No.9448。

This example clones obtain by the following methodCry2Ab32The full length sequence of gene.

Using genomic DNA purification kit（Purchased from SBS Genetech company）The total DNA of bacterial strain BN23-5 is extracted as amplificationCry2Ab32The template of gene, design primer sequence are as follows：

P1（SEQ ID NO.3）：5'-ATGAATAGTGTATTGAATAGCG -3;

P2（SEQ ID NO.4）：5'- TTAATAAAGTGGTGAAATATTAGT - 3'

25 μ l PCR reaction systems：

10 × buffer 2.5μl

MgCl₂(25mM) 1.5μl

0.2 μ l of Taq enzyme

dNTPs(2.5mM) 2μl

1 μ l of primer P1

1 μ l of primer P2

5 μ l of template

11.8 μ l of distilled water

Thermal cycle reaction：94 DEG C of initial denaturation 5min；94 DEG C of denaturation 50s, 54 DEG C of 50s, 72 DEG C of extension 2min, 30 recycle； 72 DEG C of extension 10min；4 DEG C of stopping reactions.Amplified reaction product electrophoresis on 1% Ago-Gel, sets in gel imaging system and sees Examine PCR amplification result.As a result as shown in Figure 1, having obtained the sequence of about 1902bp by amplification, which is sequenced, Its nucleotide sequence is consistent with aim sequence as shown in SEQ ID No.1.

Embodiment 2Cry2Ab32The acquisition of albumen

According toCry2Ab32Two terminal sequence of gene open reading frame designs and synthesizes a pair of of special primer 2ATF（SEQ ID NO.5）：5'-GCCGGATCCATGAATAGTGTATTGAATAGCG-3', 2ATR（SEQ ID NO.6）: 5'- CCCCTCGAGTTAATAAAGTGGTGAAATATTAGT -3', 5 ' end primer underscore number of base are respectivelyBamH IWithXHo IRestriction enzyme site.It is expanded using BN23-5 total DNA as template, digestion products and the same carrier carried out after double digestion PET-28a (+) connection, conversionE. coliDH5 α competent cell, extracting its plasmid enzyme restriction electrophoresis, to demonstrate insertion big It is small meet expected purpose segment after（Fig. 2）, then it is transferred to recipient bacteriumE.coli.BL21(DE3)（It buys in the complete biological skill of formula gold in Beijing Art Co., Ltd）.Recombinant plasmid is named as pET-2A, the recon containing recombinant plasmid is named asE.coli.BL21(2A).It will Positive transformant is incubated overnight in LB culture medium in 200 r/min, 37 DEG C, then by culture solution according to 1:100 ratio switching Into the 1L triangular flask containing 400mL LB culture solution, 200 r/min, 37 DEG C of cultures, when the value of OD=600 of culture solution reaches When 0.6-0.8,0.4 mmol/L IPTG is added and carries out 12 h of inducing expression, centrifugation medium collects thallus, abandons supernatant, is added 30 mL 10 mmol/L Tris-HCl (pH 8.0) ultrasonic disruption detects expression albumen with SDS-PAGE.

SDS-PAGE analysis shows the expression product of gene in the precipitating after thallus ultrasonication（Fig. 3）,Cry2Ab32 Molecular weight is about 70.86 kDa or so, is consistent with the molecular weight of albumen of prediction.

Embodiment 3Cry2Ab32Albumen insecticidal activity assay

Embodiment 2 is obtainedCry2Ab32Albumen carries out insecticidal activity assay to diamondback moth, corn borer and bollworm.It is small Diamond-back moth is raw to be surveyed：It willCry2Ab32Albumen is configured to the different concentration ladder of 34,17,8.5,4.25,2.125,0.1 ug/mL etc. 6 Degree；It selects old tender moderate Cabbage leaf to clean, dries；15min is irradiated under ultraviolet lamp, is cut into 2 × 2cm²Size is divided and is placed on not With in concentration bacterium solution, 5min is impregnated；Taking-up drains extra liquid, is placed in the culture dish of disinfection and dries, and impregnates blade with LB As control, each culture dish puts 4 blades；The 2-3 age diamondback moth 20 of health is put in choosing；Every processing is repeated 3 times, and sets interior, Dead larvae situation is investigated after 3d.

Corn borer is raw to be surveyed：It willCry2Ab32Albumen is configured to 6 different concentration such as 0.1,5,10,20,40,80 ug/mL Albumen is added in the feed of raising corn borer and mixes by gradient, withE.coli.The feed of BL21 (DE3) mixing is control, then Every processing puts into 20 2-3 corn borers, 3 repetitions of every processing, investigation dead larvae situation after 7d.

Bollworm is raw to be surveyed：It willCry2Ab32The albumen of expression is configured to 6 differences such as 0.1,5,10,20,40,80 ug/mL Concentration gradient, by feed be added various concentration protein solution in, impregnate 5min；Taking-up drains extra liquid, is placed on and disappears It is dried in the culture dish of poison, withE.coli.BL21 (DE3) impregnates feed as negative control, and it is blank pair that clear water, which impregnates feed, According to then every processing puts into 20 2-3 age bollworms, 3 repetitions of every processing, statistical result after 3d.With 10.0 software meter of SPSS It calculatesLC ₅₀ ；As a result such as table 2, the results showed that,E.coli.BL21 (DE3) and blank control to diamondback moth, corn borer and bollworm not Have insecticidal activity, and bacterial strain all has cytotoxicity to these three types of pests.

The result shows that（Table 2）：Expression product has high insecticidal activity to diamondback moth,LC ₅₀ For 8.99ug/mL, to corn Snout moth's larva and bollworm insecticidal activity with higher,LC ₅₀ Respectively 19.34 ug/mL and 21.24 ug/mL；It is raw survey the result shows that,E.coli.BL21 (DE3) and blank control do not have insecticidal activity to diamondback moth, corn borer and bollworm.

Although above the present invention is described in detail with a general description of the specific embodiments, On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.

Claims (8)

1. a kind of Bt PROTEIN C RY2Ab32, amino acid sequence are：Amino acid sequence shown in SEQ ID No.2.

2. encoding the gene of albumen described in claim 1.

3. gene as claimed in claim 2 is following 1）：

1）Its nucleotides sequence is classified as shown in SEQ ID No.1 in sequence table.

4. the recombinant expression carrier containing gene described in Claims 2 or 3.

5. the insecticide containing albumen described in claim 1, the worm is diamondback moth and corn borer.

6. albumen described in claim 1 or its encoding gene are pickles preparing the application in insecticide, the worm

Moth and corn borer.

7. albumen described in claim 1 or its encoding gene are cultivating the application in genetically modified plants.

8. the application of albumen described in claim 1 or its encoding gene in raising plant resistance to insect, the worm are

Diamondback moth and corn borer.