CN105367633B - A kind of BT PROTEIN C RY2Ab32, its encoding gene and application - Google Patents
A kind of BT PROTEIN C RY2Ab32, its encoding gene and application Download PDFInfo
- Publication number
- CN105367633B CN105367633B CN201410428804.1A CN201410428804A CN105367633B CN 105367633 B CN105367633 B CN 105367633B CN 201410428804 A CN201410428804 A CN 201410428804A CN 105367633 B CN105367633 B CN 105367633B
- Authority
- CN
- China
- Prior art keywords
- gene
- albumen
- cry2ab32
- amino acid
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The present invention provides a kind of Bt albumenCry2Ab32And its there is amino acid sequence shown in amino acid sequence shown in SEQ ID No.2 or SEQ ID No.2 to be substituted, lack and/or increase one or more amino acid and have same active amino acid sequence for encoding gene, the albumen.Albumen of the present invention can be used for preparing Bt insecticide, the gene for encoding the albumen can make it have corresponding anti-insect activity with crops such as converting cotton, corn, rice, vegetables, to reduce the usage amount of pesticide, it reduces environmental pollution, there is important economic value and application prospect.
Description
Technical field
The present invention relates to field of biotechnology, and in particular to a kind of Bt albumen and its encoding gene and application.
Background technique
During human being's production, insect pest is an important factor for causing agricultural production to lose and influence human health.According to FAO
Statistics, whole world agricultural production every year because caused by insect pest economic loss be up to 14%, up to 12%, crop smothering loss reaches for disease loss
11%.Loss is up to 126,000,000,000 dollars, is equivalent to the half of the Chinese agriculture gross output value, more than 4 times of Britain.In order to reduce these
Crop pests and mosquito for many years, are generallyd use chemical prevention means and prevented and treated, but due to the length of chemical pesticide by loss
Phase, a large amount of uses, the pollution to environment is caused, persticide residue increases in agricultural and sideline product, existence and health care belt to the mankind
Harm is carried out.In addition, chemical pesticide while killing pest, has also killed natural enemy and other beneficial objects, it is flat to destroy ecology
Weighing apparatus.Compared with chemical prevention, biological control has the characteristics that safely, effectively, persistently.And avoid chemical prevention bring one
Series of problems.Therefore, the hot spot that biological prevention is studied at people.In biological insecticides, bacillus thuringiensis is
Current purposes in the world is most wide, the maximum a kind of microbial insecticide of yield.
Bacillus thuringiensis(Bacillus thuringiensis, abbreviation Bt)It is a kind of gram-positive bacterium, it
Distribution it is extremely wide, the parasporal crystal being made of protein with insecticidal activity can be formed while sporulation, again
Name insecticidal crystal protein(Insectididal crystal proteins, abbreviation ICPs), ICPs be bycryGene coding,
There is strong toxicity to sensitive insect, and it is non-toxic to higher mammal and people.At present in agricultural pests, injurious forest-insect and sanitary insect pest
Prevention and treatment in Bt have become the strong substitute of chemical synthetic pesticide, Bt or the important gene of transgenic pest-resistant engineered plant come
Source.
From Schnepf in 1981 cloned from strain HD -1 first can express the gene of insecticidal activity since, people
The gene for having cloned more than 500 kinds of coded insect-killing crystalline proteins is separated, according to their quilts of the amino acid sequence homology of coding
Be identified as different groups, subgroup, class and subclass (Crickmore N,et al. Microbiol Mol Biol Rev,
1998,62:807-813; http://www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/).It is general and
Speech,Cry1,Cry2WithCry9Equal toxalbumin are effective to lepidoptera pest;What is wherein studied most isCry1WithCry9Class egg
White, the insecticidal crystal protein molecular weight that they are encoded is 130-140kD, and many genes have been widely used in the squama of plant at present
The prevention and treatment of wing mesh pest.Bacillus thuringiensissubsp.israelensis (B.thuringiensis subsp. israelensis,
Abbreviation Bti) generate toxin protein to mosquito have fine insecticidal activity, be widely used in the prevention and treatment of mosquito.MeanwhileCytEgg
It is white that there is cytolytic, to certainCryAlbumen has synergistic effect and delays the resistance of insect.
The history of existing more than 50 years of the use of insecticide based on Bt insecticidal crystal protein initially never detects
To insect to the resistance of Bt, still, 80 years last century mid-term starts, and resistance problem constantly obtains in laboratory and field trial
It confirms(McGaughey,W. H. 1985. Science. 229:193-195), reason mainly persistently use single variety and Asia
The application of the Bt and Bt transgenic anti-insect plants of dosage is caused to cause insect population for a long time by the selection pressure of insecticide.1985
Year, McGaughey reports warehouse grain pest Indian meal moth(Plodia interpunctella)In Dipel (Bt
subsp.kurstaikThe commercial preparation of HD-1) selection pressure under, breed 15 generations after, resistance increase by 97 times;It is selected in high dose
It selects under pressure, resistance can increase by 250 times.Nineteen ninety confirms that the diamondback moth of big Tanaka generates Bt insecticide in Hawaii for the first time
Apparent resistance(Tabashnik, B.E.,et al. 1994. Proc.Natl.Acad.Sci.USA.91:4120-
4124), since the nineties in last century, in China using the longer Shenzhen and Guangzhou of Bt pesticide time, Shanghai and other places, found Bt
Insecticide is decreased obviously diamondback moth control efficiency, it is meant that resistance has been formed(1996. insect journal of Feng Xia, 39 (3):
238-244; Hofte, H., 1988. Appl. Environ. Microbiol. 54: 2010-2017).It has now been found that
Several insects produce resistance to Bt and its insecticidal crystal protein for laboratory and field at least ten, with selection pressure mathematical model
It predicts, under conditions of Bt transgenic anti-insect plants select pressure, insect will generate resistance(Schnepf, E., et
al. 1998. Mol. Biol. Rev.65 (3):77 5-806).In addition, there are some researches prove Bti in the use in crop field still
Resistance problem is not found, but mosquito is constantly confirmed to its resistance problem in the lab, such case may also can be
Big Tanaka occurs(Georghiou G P, 1997. Applied and Environmental Microbiology,63:
1095-1101.).
To avoid loss caused by resistant insects, finding new high virulence Bt genetic resources is to solve having for this problem
Effect approach, this is of great significance to the biological control in China.
Summary of the invention
The first purpose of this invention is to provide a kind of new Bt virulence protein resource in view of the above deficiencies.
Second object of the present invention is to provide the gene of encoding said proteins.
Third object of the present invention is to provide the application of above-mentioned albumen and gene.
Present invention bacillus thuringiensis new strains BN23-5 isolated from the Soils In The Region of Sichuan Province Chengdu, should
Bacterial strain is on 07 14th, 2014 in China Committee for Culture Collection of Microorganisms's common micro-organisms center(Abbreviation CGMCC,
Address:Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Institute of Microorganism, Academia Sinica, postcode 100101)Preservation, classification
It is named as bacillus thuringiensis(Bacillus thuringiensis), deposit number is CGMCC No.9448.
Show that BN23-5 has high virulence to lepidoptera pest etc. by the virulence test to BN23-5.According tocry2Genoid conserved sequence designs a pair of of special primer, expands its genomic DNA, the results showed that exist in the bacterial straincry2Class
Gene, further designs its full-length gene primer, and clone obtainsCry2Ab-likeGene, nucleotide sequence such as sequence table SEQ
Shown in ID No.1, overall length 1902bp, analysis shows, G/C content 34.65% encodes the albumen of 634 amino acid composition.Through
Measurement, amino acid sequence is as shown in SEQ ID No.2.Bacterial sigma7.0 is used in the website softberry
Promoter program carries out prediction to complete sequence and shows to contain the sequence in RNA polymerase activation site in gene coding region upstream,
It is named asCry2Ab32。Cry2Ab32The amino acid composition such as table 1 of albumen.
It should be appreciated that those skilled in the art can disclosed albumen according to the present inventionCry2Ab32'sAmino acid sequence(SEQ
ID No.2), do not influence its it is active under the premise of, replace, lack and/or increase one or several amino acid, obtain the egg
White mutant nucleotide sequence.Such as in nonactive section, the 34th Ile is replaced with into Val, the 19th Val replaces with Ala,
605th insertion, one Ser, in one leu of the 605th missing, without influencing its activity.Therefore, Bt albumen of the inventionCry2Ab32It further include that amino acid sequence shown in SEQ ID No.2 is substituted, replaces and/or increases one or several amino acid,
With with Bt albumenCry2Ab32It is same it is active byCry2Ab32Derivative obtained protein.
Gene of the present invention includes encoding said proteinsCry2Ab32'sNucleotide sequence.
The present invention provides encode above-mentioned Bt albumenCry2Ab32Gene, nucleotides sequence is classified as:
(1)Nucleotide sequence shown in sequence table SEQ ID NO.1, or
(2)Nucleotide sequence shown in SEQ ID No.1 is substituted, lacks and/or increases one or several nucleotide.
Furthermore, it is to be understood that in view of the degeneracy of codon and the preferences of different plant species codon, art technology
Personnel can according to need using the codon for being suitble to particular species expression.
Gene and protein of the invention can clone or isolated from Bt bacterial strain BN23-5, or by DNA or
The method of peptide synthesis obtains.
Gene of the present invention can be operably connected with expression vector, obtain the recombinant expression that can express albumen of the present invention
Carrier, and then can be by transgenic methods such as agrobacterium-mediated transformation, particle bombardment, pollen tube passage methods, by the table
Up to vector introduction host, turnedCry2Ab32The transformant of gene, such as the plants such as crops or fruit tree, have it anti-
Worm activity.
In one embodiment of the invention, Bt albumenCry2Ab32Being obtained by for recombinant expression carrier willCry2Ab32Gene is inserted into building on expression vector pET-28a (+) and obtains recombinant expression carrier pET-2A.
Further, it is also possible to be contained by the bacterial strain BN23-5 of the present invention that fermentsCry2Ab32The fermentation liquid of albumen, by it
It is prepared into insecticide, the prevention and treatment for crop pests.Said gene can also be converted bacterium or true by those skilled in the art
Bacterium produces Bt albumen of the present invention by large scale fermentation.
The present invention also provides Bt albumenCry2Ab32Improving the application in plant resistance to insect.
The present invention provides Bt albumenCry2Ab32Cultivating the application in genetically modified plants.
Those skilled in the art can also be disclosed according to the present inventionCry2Ab32Gene, by its converting cotton, corn, water
The crops such as rice, vegetables make it have corresponding anti-insect activity.Such as:It, will using the degeneracy of codonCry2Ab32Gene
The gene order with rice preferred codons is designed, then by synthesisCry2Ab32Gene order and carrier pCAMBIA1300
Connection, is transferred in rice genome, to obtain the Transgenic Rice with anti-insect activity by mediated by agriculture bacillus.
The present invention providesCry2Ab32Albumen is a kind of Bt albumen, has preferable insecticidal activity, is used for preparation and turns
Gene plant, can specific killing pest, and reduce the usage amount of pesticide, reduce cost, reduce environmental pollution.In the present invention
Compliance test result test during, also without discovery pest to the albumen generate resistance the case where.Therefore, Bt albumen of the inventionCry2Ab32With important economic value and application prospect, it is suitble to large-scale application in the insect resistace for improving plant.
Detailed description of the invention
Fig. 1 is shown what clone obtainedCry2Ab32The gel electrophoresis figure of full-length gene, wherein M, DNA marker;
1, Cry2Ab32Gene;
The digestion identification map of recombinant plasmid pET-2A is shown in Fig. 2, wherein M, DNA marker;1, the DNA of insertion;
2, recombinant plasmid pET-2A;3, recombinant plasmid pET-2ABamH I+XHo IDouble enzyme digestion product;
Fig. 3 is shownCry2Ab32Gene existsE. coliThe SDS-PAGE expressed in BL21 (DE3) detects figure;Wherein
1, contain recombinant plasmid pET-2A'sE.coliBL21 (DE3) cellular lysate liquid supernatant after IPTG is induced;2, contain recombination
Plasmid pET-2A'sE.coliBL21 (DE3) cellular lysate liquid precipitate after IPTG is induced;3, contain carrier pET-28a'sE.coliBL21 (DE3) expresses albumen(Negative control);M, albumen marker.
Specific embodiment
Following embodiment further illustrates the contents of the present invention, but should not be construed as limiting the invention.Without departing substantially from
In the case where spirit of that invention and essence, to modifications or substitutions made by the method for the present invention, step or condition, the present invention is belonged to
Range.
Unless otherwise specified, biochemical reagents used in embodiment are commercial reagent, technology hand used in embodiment
The conventional means that section is well known to those skilled in the art.
Embodiment 1Cry2Ab32The clone of gene
Present invention bacillus thuringiensis isolated from the Soils In The Region of Sichuan Province Chengdu(Bacillus thuringiensis)New strains BN23-5, the bacterial strain were entrusted on 07 14th, 2014 in Chinese microorganism strain preservation management
Member can common micro-organisms center(Address:Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Institute of Microorganism, Academia Sinica,
Postcode 100101)Preservation, classification naming are bacillus thuringiensis(Bacillus thuringiensis), deposit number is
CGMCC No.9448。
This example clones obtain by the following methodCry2Ab32The full length sequence of gene.
Using genomic DNA purification kit(Purchased from SBS Genetech company)The total DNA of bacterial strain BN23-5 is extracted as amplificationCry2Ab32The template of gene, design primer sequence are as follows:
P1(SEQ ID NO.3):5'-ATGAATAGTGTATTGAATAGCG -3;
P2(SEQ ID NO.4):5'- TTAATAAAGTGGTGAAATATTAGT - 3'
25 μ l PCR reaction systems:
10 × buffer 2.5μl
MgCl2(25mM) 1.5μl
0.2 μ l of Taq enzyme
dNTPs(2.5mM) 2μl
1 μ l of primer P1
1 μ l of primer P2
5 μ l of template
11.8 μ l of distilled water
Thermal cycle reaction:94 DEG C of initial denaturation 5min;94 DEG C of denaturation 50s, 54 DEG C of 50s, 72 DEG C of extension 2min, 30 recycle;
72 DEG C of extension 10min;4 DEG C of stopping reactions.Amplified reaction product electrophoresis on 1% Ago-Gel, sets in gel imaging system and sees
Examine PCR amplification result.As a result as shown in Figure 1, having obtained the sequence of about 1902bp by amplification, which is sequenced,
Its nucleotide sequence is consistent with aim sequence as shown in SEQ ID No.1.
Embodiment 2Cry2Ab32The acquisition of albumen
According toCry2Ab32Two terminal sequence of gene open reading frame designs and synthesizes a pair of of special primer 2ATF(SEQ ID
NO.5):5'-GCCGGATCCATGAATAGTGTATTGAATAGCG-3', 2ATR(SEQ ID NO.6): 5'-
CCCCTCGAGTTAATAAAGTGGTGAAATATTAGT -3', 5 ' end primer underscore number of base are respectivelyBamH IWithXHo IRestriction enzyme site.It is expanded using BN23-5 total DNA as template, digestion products and the same carrier carried out after double digestion
PET-28a (+) connection, conversionE. coliDH5 α competent cell, extracting its plasmid enzyme restriction electrophoresis, to demonstrate insertion big
It is small meet expected purpose segment after(Fig. 2), then it is transferred to recipient bacteriumE.coli.BL21(DE3)(It buys in the complete biological skill of formula gold in Beijing
Art Co., Ltd).Recombinant plasmid is named as pET-2A, the recon containing recombinant plasmid is named asE.coli.BL21(2A).It will
Positive transformant is incubated overnight in LB culture medium in 200 r/min, 37 DEG C, then by culture solution according to 1:100 ratio switching
Into the 1L triangular flask containing 400mL LB culture solution, 200 r/min, 37 DEG C of cultures, when the value of OD=600 of culture solution reaches
When 0.6-0.8,0.4 mmol/L IPTG is added and carries out 12 h of inducing expression, centrifugation medium collects thallus, abandons supernatant, is added
30 mL 10 mmol/L Tris-HCl (pH 8.0) ultrasonic disruption detects expression albumen with SDS-PAGE.
SDS-PAGE analysis shows the expression product of gene in the precipitating after thallus ultrasonication(Fig. 3),Cry2Ab32
Molecular weight is about 70.86 kDa or so, is consistent with the molecular weight of albumen of prediction.
Embodiment 3Cry2Ab32Albumen insecticidal activity assay
Embodiment 2 is obtainedCry2Ab32Albumen carries out insecticidal activity assay to diamondback moth, corn borer and bollworm.It is small
Diamond-back moth is raw to be surveyed:It willCry2Ab32Albumen is configured to the different concentration ladder of 34,17,8.5,4.25,2.125,0.1 ug/mL etc. 6
Degree;It selects old tender moderate Cabbage leaf to clean, dries;15min is irradiated under ultraviolet lamp, is cut into 2 × 2cm2Size is divided and is placed on not
With in concentration bacterium solution, 5min is impregnated;Taking-up drains extra liquid, is placed in the culture dish of disinfection and dries, and impregnates blade with LB
As control, each culture dish puts 4 blades;The 2-3 age diamondback moth 20 of health is put in choosing;Every processing is repeated 3 times, and sets interior,
Dead larvae situation is investigated after 3d.
Corn borer is raw to be surveyed:It willCry2Ab32Albumen is configured to 6 different concentration such as 0.1,5,10,20,40,80 ug/mL
Albumen is added in the feed of raising corn borer and mixes by gradient, withE.coli.The feed of BL21 (DE3) mixing is control, then
Every processing puts into 20 2-3 corn borers, 3 repetitions of every processing, investigation dead larvae situation after 7d.
Bollworm is raw to be surveyed:It willCry2Ab32The albumen of expression is configured to 6 differences such as 0.1,5,10,20,40,80 ug/mL
Concentration gradient, by feed be added various concentration protein solution in, impregnate 5min;Taking-up drains extra liquid, is placed on and disappears
It is dried in the culture dish of poison, withE.coli.BL21 (DE3) impregnates feed as negative control, and it is blank pair that clear water, which impregnates feed,
According to then every processing puts into 20 2-3 age bollworms, 3 repetitions of every processing, statistical result after 3d.With 10.0 software meter of SPSS
It calculatesLC 50 ;As a result such as table 2, the results showed that,E.coli.BL21 (DE3) and blank control to diamondback moth, corn borer and bollworm not
Have insecticidal activity, and bacterial strain all has cytotoxicity to these three types of pests.
The result shows that(Table 2):Expression product has high insecticidal activity to diamondback moth,LC 50 For 8.99ug/mL, to corn
Snout moth's larva and bollworm insecticidal activity with higher,LC 50 Respectively 19.34 ug/mL and 21.24 ug/mL;It is raw survey the result shows that,E.coli.BL21 (DE3) and blank control do not have insecticidal activity to diamondback moth, corn borer and bollworm.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.
Claims (8)
1. a kind of Bt PROTEIN C RY2Ab32, amino acid sequence are:Amino acid sequence shown in SEQ ID No.2.
2. encoding the gene of albumen described in claim 1.
3. gene as claimed in claim 2 is following 1):
1)Its nucleotides sequence is classified as shown in SEQ ID No.1 in sequence table.
4. the recombinant expression carrier containing gene described in Claims 2 or 3.
5. the insecticide containing albumen described in claim 1, the worm is diamondback moth and corn borer.
6. albumen described in claim 1 or its encoding gene are pickles preparing the application in insecticide, the worm
Moth and corn borer.
7. albumen described in claim 1 or its encoding gene are cultivating the application in genetically modified plants.
8. the application of albumen described in claim 1 or its encoding gene in raising plant resistance to insect, the worm are
Diamondback moth and corn borer.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410428804.1A CN105367633B (en) | 2014-08-28 | 2014-08-28 | A kind of BT PROTEIN C RY2Ab32, its encoding gene and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410428804.1A CN105367633B (en) | 2014-08-28 | 2014-08-28 | A kind of BT PROTEIN C RY2Ab32, its encoding gene and application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105367633A CN105367633A (en) | 2016-03-02 |
CN105367633B true CN105367633B (en) | 2018-11-30 |
Family
ID=55370313
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410428804.1A Active CN105367633B (en) | 2014-08-28 | 2014-08-28 | A kind of BT PROTEIN C RY2Ab32, its encoding gene and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105367633B (en) |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105936644B (en) * | 2016-07-09 | 2021-11-16 | 河北省农林科学院植物保护研究所 | Insecticidal protein and nucleotide sequence and application thereof |
CN106928329B (en) * | 2017-03-06 | 2020-09-22 | 中国农业科学院植物保护研究所 | Novel insecticidal protein and nucleotide sequence thereof |
CN111171118B (en) * | 2019-12-23 | 2021-08-06 | 隆平生物技术(海南)有限公司 | Plant insect-resistant gene mCry2Ab, and vector and application thereof |
CN115197305A (en) * | 2021-04-12 | 2022-10-18 | 四川农业大学 | Bt protein Cry53A and gene and application thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6489542B1 (en) * | 1998-11-04 | 2002-12-03 | Monsanto Technology Llc | Methods for transforming plants to express Cry2Ab δ-endotoxins targeted to the plastids |
CN1484702A (en) * | 2001-01-09 | 2004-03-24 | �Ϻ���ͨ��ѧ | Novel bacillus thuringiensis insecticidal proteins |
-
2014
- 2014-08-28 CN CN201410428804.1A patent/CN105367633B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6489542B1 (en) * | 1998-11-04 | 2002-12-03 | Monsanto Technology Llc | Methods for transforming plants to express Cry2Ab δ-endotoxins targeted to the plastids |
CN1484702A (en) * | 2001-01-09 | 2004-03-24 | �Ϻ���ͨ��ѧ | Novel bacillus thuringiensis insecticidal proteins |
Non-Patent Citations (2)
Title |
---|
四川盆地生态区苏云金芽胞杆菌cry 基因的鉴定及新型模式cry 基因的克隆;朱军等;《微生物学报》;20090304;第49卷(第3期);第324-330页 * |
雅安周公山土壤苏云金芽孢杆菌菌株资源的筛选和初步鉴定;李云艳等;《四川农业大学学报》;20090331;第27卷(第1期);第51-54页 * |
Also Published As
Publication number | Publication date |
---|---|
CN105367633A (en) | 2016-03-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101503666B (en) | Novel strain of Bacillus thuringiensis bacterial strain and use thereof | |
CN101531980A (en) | Bacillus thuringiensis HS18-1 and application thereof | |
CN105367633B (en) | A kind of BT PROTEIN C RY2Ab32, its encoding gene and application | |
CN105367634B (en) | A kind of Bt PROTEIN C ry1Ie5, its encoding gene and application | |
CN101497657B (en) | Novel disinsection Bt protein Cry54Aa1, coding gene thereof and use | |
CN101497658B (en) | Novel Bt protein Cry4Cc1, coding gene thereof and use | |
CN105367636B (en) | A kind of Bt PROTEIN C ry1Dd1, its encoding gene and application | |
CN101503464A (en) | Novel Bt protein Cry30Fa1, coding gene thereof and use | |
CN101503463A (en) | Novel Bt protein Cry53Ab1, coding gene thereof and use | |
CN103525835B (en) | A kind of Bt cry71Aa1 genes and its encoding proteins and application | |
CN105367635B (en) | A kind of Bt PROTEIN C ry1Hc1, its encoding gene and application | |
CN103525837B (en) | Bt PROTEIN C ry72Aa1 operon genes and its application | |
CN102408475B (en) | Bt protein Cryt1Da1, and coding gene and application thereof | |
CN103525836B (en) | A kind of Bt Cry71Aa1 operon gene and proteins encoded thereof and application | |
CN102363631B (en) | Insecticidal Bt (Bacillus thuringiensis) protein Cry8Qa1, coding gene thereof and application thereof | |
CN102781955A (en) | Bt protein Cry4Cb2, encoding gene of same and use thereof | |
CN101591381A (en) | Bt PROTEIN C ry4Cb1, its encoding gene and application | |
CN102603876B (en) | Bt protein Cry59Bal, coding gene and application of Bt protein Cry59Bal | |
CN103103203A (en) | Bt cry54Ab1 gene, protein encoded by gene and application of gene or protein | |
CN103103204A (en) | Bt cry54Ab1 operon gene, protein encoded by gene and application of gene or protein | |
CN103524605B (en) | Bt protein Cry72Aa1 and coding gene thereof and application | |
CN102584960B (en) | Bt (Bacillus thuringiensis) protein Cry70Aa1 as well as encoding gene and application thereof | |
CN102363630B (en) | Pesticide Bt protein Cry8Pa1 and coding gene and use thereof | |
CN101531712A (en) | Bt protein Cry30Bal as well as encoding gene thereof and application thereof | |
CN101531713A (en) | Bt protein Cry56Aal as well as encoding gene thereof and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |