CN105367635B - A kind of Bt PROTEIN C ry1Hc1, its encoding gene and application - Google Patents
A kind of Bt PROTEIN C ry1Hc1, its encoding gene and application Download PDFInfo
- Publication number
- CN105367635B CN105367635B CN201410429772.7A CN201410429772A CN105367635B CN 105367635 B CN105367635 B CN 105367635B CN 201410429772 A CN201410429772 A CN 201410429772A CN 105367635 B CN105367635 B CN 105367635B
- Authority
- CN
- China
- Prior art keywords
- gene
- albumen
- amino acid
- cry1hc1
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The present invention provides a kind of Bt albumenCry1Hc1, its encoding gene and application, there is amino acid sequence shown in amino acid sequence shown in SEQ ID No.2 or SEQ ID No.2 to be substituted, lack and/or increase one or more amino acid and have active amino acid sequence on an equal basis the albumen.Albumen of the present invention can be used for preparing Bt insecticide, the gene for encoding the albumen can make it have corresponding anti-insect activity with crops such as converting cotton, corn, rice, vegetables, to reduce the usage amount of pesticide, it reduces environmental pollution, there is important economic value and application prospect.
Description
Technical field
The present invention relates to field of biotechnology, and in particular to a kind of Bt albumen and its encoding gene and application.
Background technique
During human being's production, insect pest is an important factor for causing agricultural production to lose and influence human health.According to FAO
Statistics, whole world agricultural production every year because caused by insect pest economic loss be up to 14%, up to 12%, crop smothering loss reaches for disease loss
11%.Loss is up to 126,000,000,000 dollars, is equivalent to the half of the Chinese agriculture gross output value, more than 4 times of Britain.In order to reduce these
Crop pests and mosquito for many years, are generallyd use chemical prevention means and prevented and treated, but due to the length of chemical pesticide by loss
Phase, a large amount of uses, the pollution to environment is caused, persticide residue increases in agricultural and sideline product, existence and health care belt to the mankind
Harm is carried out.In addition, chemical pesticide while killing pest, has also killed natural enemy and other beneficial objects, it is flat to destroy ecology
Weighing apparatus.Compared with chemical prevention, biological control has the characteristics that safely, effectively, persistently.And avoid chemical prevention bring one
Series of problems.Therefore, the hot spot that biological prevention is studied at people.In biological insecticides, bacillus thuringiensis is
Current purposes in the world is most wide, the maximum a kind of microbial insecticide of yield.
Bacillus thuringiensis（Bacillus thuringiensis, abbreviation Bt）It is a kind of gram-positive bacterium, it
Distribution it is extremely wide, the parasporal crystal being made of protein with insecticidal activity can be formed while sporulation, again
Name insecticidal crystal protein（Insectididal crystal proteins, abbreviation ICPs）, ICPs be bycryGene coding,
There is strong toxicity to sensitive insect, and it is non-toxic to higher mammal and people.At present in agricultural pests, injurious forest-insect and sanitary insect pest
Prevention and treatment in Bt have become the strong substitute of chemical synthetic pesticide, Bt or the important gene of transgenic pest-resistant engineered plant come
Source.
From Schnepf in 1981 cloned from strain HD -1 first can express the gene of insecticidal activity since, people
The gene for having cloned more than 500 kinds of coded insect-killing crystalline proteins is separated, according to their quilts of the amino acid sequence homology of coding
Be identified as different groups, subgroup, class and subclass (Crickmore N,et al. Microbiol Mol Biol Rev,
1998,62:807-813; http://www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/).It is general and
Speech,Cry1,Cry2WithCry9Equal toxalbumin are effective to lepidoptera pest；What is wherein studied most isCry1WithCry9Class egg
White, the insecticidal crystal protein molecular weight that they are encoded is 130-140kD, and many genes have been widely used in the squama of plant at present
The prevention and treatment of wing mesh pest.Bacillus thuringiensissubsp.israelensis (B.thuringiensis subsp. israelensis,
Abbreviation Bti) generate toxin protein to mosquito have fine insecticidal activity, be widely used in the prevention and treatment of mosquito.MeanwhileCytEgg
It is white that there is cytolytic, to certainCryAlbumen has synergistic effect and delays the resistance of insect.
The history of existing more than 50 years of the use of insecticide based on Bt insecticidal crystal protein initially never detects
To insect to the resistance of Bt, still, 80 years last century mid-term starts, and resistance problem constantly obtains in laboratory and field trial
It confirms（McGaughey,W. H. 1985. Science. 229:193-195）, reason mainly persistently use single variety and Asia
The application of the Bt and Bt transgenic anti-insect plants of dosage is caused to cause insect population for a long time by the selection pressure of insecticide.1985
Year, McGaughey reports warehouse grain pest Indian meal moth（Plodia interpunctella）In Dipel (Bt
subsp.kurstaikThe commercial preparation of HD-1) selection pressure under, breed 15 generations after, resistance increase by 97 times；It is selected in high dose
It selects under pressure, resistance can increase by 250 times.Nineteen ninety confirms that the diamondback moth of big Tanaka generates Bt insecticide in Hawaii for the first time
Apparent resistance（Tabashnik, B.E.,et al. 1994. Proc.Natl.Acad.Sci.USA.91:4120-
4124）, since the nineties in last century, in China using the longer Shenzhen and Guangzhou of Bt pesticide time, Shanghai and other places, found Bt
Insecticide is decreased obviously diamondback moth control efficiency, it is meant that resistance has been formed（1996. insect journal of Feng Xia, 39 (3):
238-244; Hofte, H., 1988. Appl. Environ. Microbiol. 54: 2010-2017）.It has now been found that
Several insects produce resistance to Bt and its insecticidal crystal protein for laboratory and field at least ten, with selection pressure mathematical model
It predicts, under conditions of Bt transgenic anti-insect plants select pressure, insect will generate resistance（Schnepf, E., et
al. 1998. Mol. Biol. Rev.65 (3):77 5-806）.In addition, there are some researches prove Bti in the use in crop field still
Resistance problem is not found, but mosquito is constantly confirmed to its resistance problem in the lab, such case may also can be
Big Tanaka occurs（Georghiou G P, 1997. Applied and Environmental Microbiology,63:
1095-1101.）.
To avoid loss caused by resistant insects, finding new high virulence Bt genetic resources is to solve having for this problem
Effect approach, this is of great significance to the biological control in China.
Summary of the invention
The first purpose of this invention is to provide a kind of Bt virulence protein resource in view of the above deficiencies.
Present invention bacillus thuringiensis new strains BN23-5 isolated from the Soils In The Region of Sichuan Province Chengdu, should
Bacterial strain is on 07 14th, 2014 in China Committee for Culture Collection of Microorganisms's common micro-organisms center（Abbreviation CGMCC,
Address：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Institute of Microorganism, Academia Sinica, postcode 100101）Preservation, classification
It is named as bacillus thuringiensis（Bacillus thuringiensis）, deposit number is CGMCC No.9448.
Show that BN23-5 has high virulence to lepidoptera pest by the virulence test to BN23-5.According tocry1
Genoid conserved sequence designs a pair of of special primer, expands its genomic DNA, the results showed that exist in the bacterial straincry1Class base
Cause, further designs its full-length gene primer, and clone obtainsCry1Ha-likeGene, nucleotide sequence such as sequence table SEQ
Shown in ID No.1, overall length 3507bp, analysis shows, G/C content 39.58% encodes the albumen of 1169 amino acid composition.
After measured, amino acid sequence is as shown in SEQ ID No.2.Bacterial sigma7.0 is used in the website softberry
Promoter program carries out prediction to complete sequence and shows to contain the sequence in RNA polymerase activation site in gene coding region upstream,
It is named asCry1Hc1。Cry1Hc1The amino acid composition such as table 1 of albumen.
It should be appreciated that those skilled in the art can disclosed albumen according to the present inventionCry1Hc1'sAmino acid sequence（SEQ
ID No.2）, do not influence its it is active under the premise of, replace, lack and/or increase one or several amino acid, obtain the egg
White mutant nucleotide sequence.Such as in nonactive section, the 1154th Gly is replaced with into Ala, the 1127th Leu is lacked,
26th insertion, one Leu, without influencing its activity.Therefore, Bt albumen of the inventionCry1Hc1It further include SEQ ID No.2
Shown amino acid sequence is substituted, replaces and/or increases one or several amino acid, has and Bt albumenCry1Hc1It is same living
Property byCry1Hc1Derivative obtained protein.
Second object of the present invention is to provide the gene of encoding said proteins.
Gene of the present invention includes encoding said proteinsCry1Hc1'sNucleotide sequence.
The present invention provides the gene for encoding above-mentioned Bt PROTEIN C ry1Hc1, nucleotides sequence is classified as：
（1）Nucleotide sequence shown in sequence table SEQ ID NO.1, or
（2）Nucleotide sequence shown in SEQ ID No.1 is substituted, lacks and/or increases one or several nucleotide.
Furthermore, it is to be understood that in view of the degeneracy of codon and the preferences of different plant species codon, art technology
Personnel can according to need using the codon for being suitble to particular species expression.
Gene and protein of the invention can clone or isolated from Bt bacterial strain BN23-5, or by DNA or
The method of peptide synthesis obtains.
Gene of the present invention can be operably connected with expression vector, obtain the recombinant expression that can express albumen of the present invention
Carrier, and then can be by transgenic methods such as agrobacterium-mediated transformation, particle bombardment, pollen tube passage methods, by the table
Up to vector introduction host, the transformant for turning Cry1Hc1 gene, such as the plants such as crops or fruit tree are obtained, have it anti-
Worm activity.
In one embodiment of the invention, Bt PROTEIN C ry1Hc1 recombinant expression carrier is obtained by Cry1Hc1
Gene is inserted into building on expression vector pET-28a (+) and obtains recombinant expression carrier pET-1H.
Further, it is also possible to the fermentation liquid containing Cry1Hc1 albumen be obtained, by it by the bacterial strain BN23-5 of the present invention that ferments
It is prepared into insecticide, the prevention and treatment for crop pests.Said gene can also be converted bacterium or true by those skilled in the art
Bacterium produces Bt albumen of the present invention by large scale fermentation.
Third object of the present invention is to provide the application of above-mentioned albumen and gene.
The present invention provides Bt PROTEIN C ry1Hc1 to improve the application in plant resistance to insect.
The present invention provides Bt PROTEIN C ry1Hc1 to cultivate the application in genetically modified plants.
Those skilled in the art can also disclosed Cry1Hc1 gene according to the present invention, by its converting cotton, corn, water
The crops such as rice, vegetables make it have corresponding anti-insect activity.Such as：Using the degeneracy of codon, by Cry1Hc1 gene
The gene order with rice preferred codons is designed, then the Cry1Hc1 gene order of synthesis and carrier pCAMBIA1300 are connected
It connects, is transferred in rice genome by mediated by agriculture bacillus, to obtain the Transgenic Rice with anti-insect activity.
It is a kind of Bt albumen that the present invention, which provides Cry1Hc1 albumen, has preferable insecticidal activity, is used for preparation and turns base
Because of plant, can specific killing pest, and reduce the usage amount of pesticide, reduce cost, reduce environmental pollution.Of the invention
In compliance test result experimentation, the case where pest generates resistance to the albumen is not found.Therefore, Bt albumen of the invention
Cry1Hc1 has important economic value and application prospect, is suitble to large-scale application in the insect resistace for improving plant.
Detailed description of the invention
Fig. 1 is shown what clone obtainedCry1Hc1The gel electrophoresis figure of full-length gene, wherein M, DNA marker; 1,Cry1Hc1Gene;
The digestion identification map of recombinant plasmid pET-1H is shown in Fig. 2, wherein 1, plasmid pET28a plasmid；2, recombination
Plasmid pET-1H'sBamH I+XHoIDouble enzyme digestion product；3, the DNA of insertion；M, DNA marker;
Fig. 3 is shownCry1Hc1Gene existsE. coliThe SDS-PAGE expressed in BL21 (DE3) detects figure；Wherein
1, contain carrier pET-28a'sE.coliBL21 (DE3) expresses albumen（Negative control）；2, contain recombinant plasmid pET-1H'sE.coliBL21 (DE3) induces thallus lysate without IPTG；3, contain recombinant plasmid pET-1H'sE.coli BL21(DE3)
The cellular lysate liquid after IPTG is induced；M, albumen marker.
Specific embodiment
Following embodiment further illustrates the contents of the present invention, but should not be construed as limiting the invention.Without departing substantially from
In the case where spirit of that invention and essence, to modifications or substitutions made by the method for the present invention, step or condition, the present invention is belonged to
Range.
Unless otherwise specified, biochemical reagents used in embodiment are commercial reagent, technology hand used in embodiment
The conventional means that section is well known to those skilled in the art.
Embodiment 1Cry1Hc1The clone of gene
Present invention bacillus thuringiensis isolated from the Soils In The Region of Sichuan Province Chengdu（Bacillus thuringiensis）New strains BN23-5, the bacterial strain were entrusted on 07 14th, 2014 in Chinese microorganism strain preservation management
Member can common micro-organisms center（Address：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Institute of Microorganism, Academia Sinica,
Postcode 100101）Preservation, classification naming are bacillus thuringiensis（Bacillus thuringiensis）, deposit number is
CGMCC No.9448。
This example clones obtain by the following methodCry1Hc1The full length sequence of gene.
Using genomic DNA purification kit（Purchased from SBS Genetech company）The total DNA of bacterial strain BN23-5 is extracted as amplificationCry1Hc1The template of gene, design primer sequence are as follows：
P1：5'- ATGGAGAATAAAAATCAACAC -3;
P2：5'- CTATTCCTCCATAAGGAG - 3'
25 μ l PCR reaction systems：
10 × buffer 2.5μl
MgCl2(25mM) 1.5μl
0.2 μ l of Taq enzyme
dNTPs(2.5mM) 2μl
1 μ l of primer P1
1 μ l of primer P2
5 μ l of template
11.8 μ l of distilled water
Thermal cycle reaction：94 DEG C of initial denaturation 5min；94 DEG C of denaturation 50s, 54 DEG C of 50s, 72 DEG C of extension 2min, 30 recycle；
72 DEG C of extension 10min；4 DEG C of stopping reactions.Amplified reaction product electrophoresis on 1% Ago-Gel, sets in gel imaging system and sees
Examine PCR amplification result.As a result as shown in Figure 1, having obtained the sequence of about 3507bp by amplification, which is sequenced,
Its nucleotide sequence is consistent with aim sequence as shown in SEQ ID No.1.
Embodiment 2Cry1Hc1The acquisition of albumen
According toCry1Hc1Two terminal sequence of gene open reading frame designs and synthesizes a pair of of special primer 1HTF：5'-
GCCGGATCCATGGAGAATAAAAATCAACAC-3', 1HTR:5'-CCCCTCGAG CTATTCCTCCATAAGGAG -3',
5 ' end primer underscore number of base be respectivelyBamH IWithXHoIRestriction enzyme site.It is expanded using BN23-5 total DNA as template,
Digestion products are connect with the carrier pET-28a (+) after same progress double digestion, are convertedE. coliDH5 α competent cell, mentions
Its plasmid enzyme restriction electrophoresis is taken to demonstrate after insertion size meets expected purpose segment（Fig. 2）, then it is transferred to recipient bacteriumE.coli.BL21(DE3)（It buys in Beijing Quanshijin Biotechnology Co., Ltd）.Recombinant plasmid is named as pET-1H, is contained
The recon of recombinant plasmid is named asE.coli.BL21(2L).By positive transformant in LB culture medium, in 200 r/min, 37
It DEG C is incubated overnight, then by culture solution according to 1:100 ratio is transferred in the 1L triangular flask containing 400mL LB culture solution, and 200
R/min, 37 DEG C of cultures are added 0.6 mmol/L IPTG and carry out induction table when the value of the OD of culture solution=600 reaches 0.6-0.8
Up to 12 h, centrifugation medium collects thallus, abandons supernatant, and 30 mL 10 mmol/L Tris-HCl (pH 8.0) ultrasonic wave is added
It is broken, expression albumen is detected with SDS-PAGE.
SDS-PAGE analysis shows the expression product of gene in the solution after thallus ultrasonication（Fig. 3）,Cry1Hc1Point
Son amount is about 132.5 kDa or so, is consistent with the molecular weight of albumen of prediction.
Embodiment 3Cry1Hc1Albumen insecticidal activity assay
Embodiment 2 is obtainedCry1Hc1Albumen carries out insecticidal activity assay to diamondback moth and corn borer.The life of diamondback moth
It surveys：It willCry1Hc1Albumen is configured to 6 different concentration gradients such as 200,100,50,25,12.5,1.25 ug/mL；Choosing is old tender
Moderate Cabbage leaf is cleaned, and is dried；15min is irradiated under ultraviolet lamp, is cut into 2 × 2cm2Size divides and is placed on various concentration bacterium
In liquid, 5min is impregnated；Taking-up drains extra liquid, is placed in the culture dish of disinfection and dries,E.coli.BL21 (DE3) conduct
Negative control, clear water are blank control, and each culture dish puts 4 blades；The 2-3 age diamondback moth 20 of health is put in choosing；Every processing
It is repeated 3 times, sets interior, dead larvae situation is investigated after 3d.The raw of corn borer is surveyed：It willCry1Hc1Albumen is configured to 400,
Albumen is added in the feed of raising corn borer and mixes by 6 different concentration gradients such as 200,100,50,25,0.1 ug/mL,E.coli.BL21 (DE3) is used as negative control, and clear water is blank control, and then every processing puts into 20 2-3 age corn borers, often
Handle 3 repetitions, statistical result after 7d.It is calculated with 10.0 software of SPSSLC 50 。
The result shows that（Table 2）：Expression product has higher insecticidal activity to diamondback moth,LC 50 For 117.84 ug/mL；To jade
Rice snout moth's larva also activity with higher,LC 50 For 118.44 ug/mL；It is raw survey the result shows that,E.coli.BL21 (DE3) and blank pair
Do not have insecticidal activity according to diamondback moth and corn borer.
The insecticidal activity of 2 CryHc1 of table
| For trying insect | LC 50 / (μg / mL) | 95% confidence limit/(μ g/mL) |
| Diamondback moth | 117.84 | 0.61442-143.33732 |
| Corn borer | 118.44 | 1.03674-161.65436 |
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this is to this
It is obvious for the technical staff of field.Therefore, done without departing from theon the basis of the spirit of the present invention this
It modifies or improves, falls within the scope of the claimed invention.
Claims (8)
1. a kind of Bt PROTEIN C ry1Hc1, amino acid sequence are：Amino acid sequence shown in SEQ ID No.2.
2. encoding the gene of albumen described in claim 1.
3. gene as claimed in claim 2 is following 1）：
1）Its nucleotides sequence is classified as shown in SEQ ID No.1 in sequence table.
4. the recombinant expression carrier containing gene described in Claims 2 or 3.
5. the insecticide containing albumen described in claim 1, the worm is diamondback moth and corn borer.
6. albumen described in claim 1 or its encoding gene are pickles preparing the application in insecticide, the worm
Moth and corn borer.
7. albumen described in claim 1 or its encoding gene are cultivating the application in genetically modified plants.
8. the application of albumen described in claim 1 or its encoding gene in raising plant resistance to insect, the worm are
Diamondback moth and corn borer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410429772.7A CN105367635B (en) | 2014-08-28 | 2014-08-28 | A kind of Bt PROTEIN C ry1Hc1, its encoding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410429772.7A CN105367635B (en) | 2014-08-28 | 2014-08-28 | A kind of Bt PROTEIN C ry1Hc1, its encoding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105367635A CN105367635A (en) | 2016-03-02 |
| CN105367635B true CN105367635B (en) | 2018-11-30 |
Family
ID=55370315
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410429772.7A Active CN105367635B (en) | 2014-08-28 | 2014-08-28 | A kind of Bt PROTEIN C ry1Hc1, its encoding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105367635B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111484548A (en) * | 2020-01-15 | 2020-08-04 | 四川农业大学 | Bt protein Cry1Ia-like and coding gene and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1990015139A1 (en) * | 1989-05-31 | 1990-12-13 | Plant Genetic Systems N.V. | Prevention of bt resistance development |
| CA2866166A1 (en) * | 2012-03-09 | 2013-09-12 | Vestaron Corporation | Toxic peptide production, peptide expression in plants and combinations of cysteine rich peptides |
-
2014
- 2014-08-28 CN CN201410429772.7A patent/CN105367635B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1990015139A1 (en) * | 1989-05-31 | 1990-12-13 | Plant Genetic Systems N.V. | Prevention of bt resistance development |
| CA2866166A1 (en) * | 2012-03-09 | 2013-09-12 | Vestaron Corporation | Toxic peptide production, peptide expression in plants and combinations of cysteine rich peptides |
Non-Patent Citations (3)
| Title |
|---|
| B.thuringiensis encoding crystal protein GenBank: 222513.1;Lambert, B;《GenBank》;20050418;第1-2页 * |
| Cry1 H-like protein [Bacillus thuringiensis]GenBank: AEH31434.1;Liu, D et al;《Genbank》;20131231;第1页 * |
| 四川盆地生态区苏云金芽胞杆菌cry 基因的鉴定及新型模式cry 基因的克隆;朱军等;《微生物学报》;20090304;第49卷(第3期);第324-330页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105367635A (en) | 2016-03-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101503666B (en) | Novel strain of Bacillus thuringiensis bacterial strain and use thereof | |
| CN101531980A (en) | Bacillus thuringiensis HS18-1 and application thereof | |
| CN105367634B (en) | A kind of Bt PROTEIN C ry1Ie5, its encoding gene and application | |
| CN105367633B (en) | A kind of BT PROTEIN C RY2Ab32, its encoding gene and application | |
| CN105367636B (en) | A kind of Bt PROTEIN C ry1Dd1, its encoding gene and application | |
| CN101497657B (en) | Novel disinsection Bt protein Cry54Aa1, coding gene thereof and use | |
| CN105367635B (en) | A kind of Bt PROTEIN C ry1Hc1, its encoding gene and application | |
| CN103525835B (en) | A kind of Bt cry71Aa1 genes and its encoding proteins and application | |
| CN101497658A (en) | Novel Bt protein Cry4Cc1, coding gene thereof and use | |
| CN101503464A (en) | Novel Bt protein Cry30Fa1, coding gene thereof and use | |
| CN101503463A (en) | Novel Bt protein Cry53Ab1, coding gene thereof and use | |
| CN102408475B (en) | Bt protein Cryt1Da1, and coding gene and application thereof | |
| CN103525837B (en) | Bt PROTEIN C ry72Aa1 operon genes and its application | |
| CN103525836B (en) | A kind of Bt Cry71Aa1 operon gene and proteins encoded thereof and application | |
| CN102363631B (en) | Insecticidal Bt (Bacillus thuringiensis) protein Cry8Qa1, coding gene thereof and application thereof | |
| CN102603876B (en) | Bt protein Cry59Bal, coding gene and application of Bt protein Cry59Bal | |
| CN103103204A (en) | Bt cry54Ab1 operon gene, protein encoded by gene and application of gene or protein | |
| CN103103203A (en) | Bt cry54Ab1 gene, protein encoded by gene and application of gene or protein | |
| CN102584960B (en) | Bt (Bacillus thuringiensis) protein Cry70Aa1 as well as encoding gene and application thereof | |
| CN103524605B (en) | Bt protein Cry72Aa1 and coding gene thereof and application | |
| CN102363630B (en) | Pesticide Bt protein Cry8Pa1 and coding gene and use thereof | |
| CN102532285B (en) | Bt protein Cry2Ac-like and coding gene and application thereof | |
| CN101531711A (en) | Bt protein Cry52Bal as well as encoding gene thereof and application thereof | |
| CN101531712A (en) | Bt protein Cry30Bal as well as encoding gene thereof and application thereof | |
| CN101531713A (en) | Bt protein Cry56Aal as well as encoding gene thereof and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230504 Address after: No. 22, 5th Floor, Unit 1, Building 3, No. 666 Guandong 1st Street, Chengdu High tech Zone, China (Sichuan) Pilot Free Trade Zone, Chengdu City, Sichuan Province, 610000 Patentee after: Sichuan Xinsiyuan High tech Co.,Ltd. Address before: 611130 Huimin Road, Wenjiang District, Chengdu, Sichuan Province, No. 211 Patentee before: SICHUAN AGRICULTURAL University |