CN102408475B - Bt protein Cryt1Da1, and coding gene and application thereof - Google Patents
Bt protein Cryt1Da1, and coding gene and application thereof Download PDFInfo
- Publication number
- CN102408475B CN102408475B CN 201110404408 CN201110404408A CN102408475B CN 102408475 B CN102408475 B CN 102408475B CN 201110404408 CN201110404408 CN 201110404408 CN 201110404408 A CN201110404408 A CN 201110404408A CN 102408475 B CN102408475 B CN 102408475B
- Authority
- CN
- China
- Prior art keywords
- protein
- gene
- albumen
- application
- cyt1da1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention provides a new Bt protein Cryt1Da1, and a coding gene and application thereof. The protein has an amino acid sequence disclosed as SEQ ID NO.2, or amino acid sequence with equal activity, which is obtained by substitution, deletion and/or addition of one or more amino acids on the basis of the amino acid sequence disclosed as SEQ ID NO.2. The protein provided by the invention can be used for preparing Bt insecticide. The coding gene of the protein can transform cotton, corn, rice, vegetables and other crops, so that the cotton, corn, rice, vegetables and other crops have corresponding insect resistance activity, thereby lowering the consumption of the insecticide and reducing the environmental pollution. Thus, the invention has important economic value and application prospects.
Description
Technical field
The present invention relates to biological technical field, be specifically related to a kind of new Bt albumen and encoding gene and application.
Background technology
In the human being's production process, insect pest is the important factor that causes the agriculture production loss and affect human health.In order to reduce these losses, for many years, generally adopt the chemical prevention means to prevent and treat to crop pests and mosquito, but because the long-term, a large amount of of chemical pesticide use, caused the pollution to environment, the agricultural byproducts Pesticide Residues increases, and has brought harm for the mankind's existence and health.In addition, chemical pesticide has has also killed and wounded natural enemy and other useful thing in kill pests, destroyed the eubiosis.Compare with chemical prevention, biological control has safe, effective, lasting characteristics.And the series of problems of having avoided chemical prevention to bring.Therefore, biological prevention has become the focus of people's researchs.In biotic pesticide, bacillus thuringiensis is the quasi-microorganism sterilant that purposes is the widest in the world, output is maximum at present.
Bacillus thuringiensis (Bacillus thuringiensis, be called for short Bt) be a kind of gram positive bacterium, its distribution is very extensive, can form the parasporal crystal that is formed by protein with insecticidal activity in sporulation, have another name called insecticidal crystal protein (Insectididal crystal proteins is called for short ICPs), ICPs is by the cry genes encoding, sensitive insect there is strong toxicity, and to higher animal and people's nontoxicity.At present Bt has become the strong substitute of chemical synthetic pesticide, Bt or the important gene source of transgenic pest-resistant engineered plant in the control of agricultural pests, injurious forest-insect and sanitary insect pest.
Cloned from strain HD-1 since first can express the gene of insecticidal activity from Schnepf in 1981, people separating clone the gene of 500 Multi-encoding insecticidal crystal proteins, they are defined as respectively different group, subgroup, class and subclass (Crickmore N according to the amino acid sequence homology of encoding, et al.Microbiol Mol Biol Rev, 1998,62:807-813; Http:// www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/).Generally speaking, Cry1, the toxalbumin such as Cry2 and Cry9 are effective to lepidoptera pest; Wherein the maximum of research are Cry1 and Cry9 proteinoid, and the insecticidal crystal protein molecular weight of their codings is 130-140kD, and many genes have been widely used in the control of the lepidoptera pest of plant at present.The toxin protein that Bacillus thuringiensissubsp.israelensis (B.thuringiensis subsp.israelensis is called for short Bti) produces has fine insecticidal activity to mosquito, is widely used in the control of mosquito.Simultaneously, Cyt albumen has cytolytic, the resistance that some Cry albumen is had synergism and delays insect.
The Utilization of pesticides history of existing more than 50 year take the Bt insecticidal crystal protein as the basis, at first insect never detected to the resistance of Bt, but, begin mid-term 80 year last century, resistance problem (the McGaughey that constantly is confirmed in laboratory and field test, W.H.1985.Science.229:193-195), reason is mainly continue to use single variety and inferiorly cause the Bt of dosage and the application of Bt transgenic anti-insect plants causes insect population to be subject to for a long time the selective pressure of sterilant.1985, McGaughey report warehouse grain pest Indian meal moth (Plodia interpunctella) was under the selective pressure of Dipel (the commodity preparation of Bt subsp.kurstaik HD-1), and after breeding for 15 generations, resistance increases by 97 times; Under the high dosage selective pressure, resistance can increase by 250 times.Nineteen ninety, the small cabbage moth that confirms first large Tanaka in Hawaii has produced obvious resistance (Tabashnik to the Bt sterilant, B.E., et al.1994.Proc.Natl.Acad.Sci.USA.91:4120-4124), since the nineties in last century, used the ground such as long Shenzhen and Guangzhou of Bt sterilant time, Shanghai in China, find that the Bt sterilant obviously descends to the small cabbage moth prevention effect, mean that resistance forms (Feng Xia .1996. insect journal, 39 (3): 238-244; Hofie, H., 1988.Appl.Environ.Microbiol.54:2010-2017).Find in the laboratory at present and the field has at least tens kinds of insects to produce resistance to Bt and insecticidal crystal protein thereof, arrive with the selective pressure mathematical model prediction, under the condition of Bt transgenic anti-insect plants selective pressure, insect will produce resistance (Schnepf, E., et al.1998.Mol.Biol.Rev.65 (3): 775-806).In addition, there are some researches prove that Bti not yet finds resistance problem in the use in land for growing field crops, but mosquito constantly is confirmed in the laboratory to its resistance problem, this situation also may (Georghiou G P occur large Tanaka, 1997.Applied and Environmental Microbiology, 63:1095-1101.).
Be the loss of avoiding resistant insects to cause, seeking new high virulence Bt genetic resources is the effective way that addresses this problem, and this biological control to China has very important meaning.
Summary of the invention
First purpose of the present invention is to provide a kind of new Bt virulence protein resource for above-mentioned deficiency.
Second purpose of the present invention is to provide the gene of encoding said proteins.
The 3rd purpose of the present invention is to provide the application of above-mentioned albumen and gene.
The present invention separates the new bacterial strain MC28 of bacillus thuringiensis that obtains from the virgin forest Soils In The Region of Muchuan, Sichuan Province, this bacterial strain (is called for short CGMCC on October 21st, 2008 at China Committee for Culture Collection of Microorganisms's common micro-organisms center, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode 100101) preservation, Classification And Nomenclature is bacillus thuringiensis (Bacillus thuringiensis), and preserving number is CGMCC No.2719.This bacterium is open in Chinese patent CN101503666B.
Show by the virulence test to MC28, MC28 all has high virulence to lepidoptera pest, Diptera pest etc.Find that from MC28 genome and plasmid sequencing result there is a cyt gene in this bacterial strain, further design its full-length gene primer, the clone obtains the cytlDa gene, its nucleotide sequence is as shown in sequence table SEQ ID No.1, total length is 1527bp, the analysis showed that, GC content is 28.81%, the albumen that 508 amino acid of encoding form.After measured, its aminoacid sequence is as shown in SEQ ID No.2.Adopt bacterial sigma7.0promoter program that complete sequence is predicted in the softberry website and show, contain the sequence in RNA polymerase activation site in the gene coding region upstream, with its called after cyt1Da1.The amino acid of Cyt1Da1 albumen forms as table 1.
The amino acid of table 1 Cyt1Da1 albumen forms
| Amino acid | Per-cent % | Amino acid | Per-cent % |
| Ala(A)： | 5.51 | Met(M)： | 1.97 |
| Cys(C)： | 0.00 | Asn(N)： | 13.78 |
| Asp(D)： | 4.92 | Pro(P)： | 1.97 |
| Glu(E)： | 2.76 | Gln(Q)： | 6.10 |
| Phe(F)： | 5.12 | Arg(R)： | 3.15 |
| Gly(G)： | 3.54 | Ser(S)： | 9.45 |
| His(H)： | 0.94 | Thr(T)： | 6.50 |
| Ile(I)： | 8.86 | Val(V)： | 7.68 |
| Lys(K)： | 2.95 | Trp(W)： | 1.97 |
| Leu(L)： | 7.48 | Tyr(Y)： | 5.51 |
Be to be understood that, those skilled in the art can be according to the aminoacid sequence (SEQ ID No.2) of PROTEIN C yt1Da1 disclosed by the invention, do not affecting under its active prerequisite, replacing, lack and/or increase one or several amino acid, obtaining the mutant nucleotide sequence of described albumen.For example at nonactive section, the Ala of the 441st is replaced with Val, the Gly of the 460th is replaced with Ala, with the Ala of the 31st disappearance, the 24th is increased a Gly or increase an Ile, do not affect its activity.Therefore, Bt PROTEIN C yt1Da1 of the present invention comprises that also shown in SEQ ID No.2, aminoacid sequence is substituted, replaces and/or increases one or several amino acid, have with Bt PROTEIN C yt1Da1 with isoreactivity by the derivative protein that obtains of Cyt1Da1.
Gene of the present invention comprises the nucleotide sequence of encoding said proteins Cyt1Da1.
The invention provides the gene of the above-mentioned Bt PROTEIN C yt1Da1 of coding, its nucleotides sequence is classified as:
(1) nucleotide sequence shown in sequence table SEQ ID NO.1, or
(2) nucleotide sequence shown in SEQ ID No.1 is substituted, lacks and/or increases one or several Nucleotide.
In addition, should be understood that the degeneracy of considering codon and the preferences of different plant species codon, those skilled in the art can use as required and be fit to the codon that specific species are expressed.
Gene of the present invention can be cloned or separate from Bt bacterial strain MC28 with protein and be obtained, and perhaps obtains by DNA or the synthetic method of peptide.
Gene of the present invention can be operably connected with expression vector, obtain to express the recombinant expression vector of albumen of the present invention, and then can pass through transgenic methods such as agrobacterium-mediated transformation, particle bombardment, pollen tube passage method, described expression vector is imported the host, obtain turning the transformant of cyt1Da1 gene, plants such as farm crop or fruit tree makes it possess anti-insect activity.
In one embodiment of the invention, the acquisition of Bt PROTEIN C yt1Da1 recombinant expression vector is to obtain recombinant expression vector pET-1Da by the cyt1Da1 gene being inserted into upper structure of expression vector pET-28a (+).
In addition, can also obtain containing the fermented liquid of Cyt1Da1 albumen by fermentation bacterial strain MC28 of the present invention, it is prepared into sterilant, be used for the control of crop pests.Those skilled in the art can also be with said gene transform bacteria or fungi, by large scale fermentation production Bt albumen of the present invention.
The present invention also provides the application of Bt PROTEIN C yt1Da1 in improving plant resistance to insect.
The invention provides the application of Bt PROTEIN C yt1Da1 in cultivating transgenic plant.
Those skilled in the art can also according to CytlDa1 gene disclosed by the invention, with farm crop such as its converting cotton, corn, paddy rice, vegetables, make it possess corresponding anti-insect activity.For example: the degeneracy of utilizing codon, the gene order that the cyt1Da1 gene design is had paddy rice preference codon, again synthetic cyt1Da1 gene order is connected with carrier pCAMBIA1300, be transferred in rice genome by agriculture bacillus mediated, thus the Transgenic Rice that obtains having anti-insect activity.
The invention provides Cyt1Da1 albumen is a kind of new Bt albumen, has insecticidal activity preferably, uses it for the preparation transgenic plant, can the specific killing insect, and reduce the usage quantity of agricultural chemicals, reduce costs environmental contamination reduction.Also do not have at present insect or insect this albumen to be produced the report of resistance, therefore, Bt PROTEIN C yt1Da1 of the present invention has important economic worth and application prospect, is fit to large-scale application in the insect-resistance that improves plant.
Description of drawings
Fig. 1 shows is the gel electrophoresis figure of the cyt1Da1 full-length gene that obtains of clone, M wherein, DNA marker; 1, cyt1Da1 gene;
Fig. 2 shows is that the enzyme of recombinant plasmid pET-1Da is cut the evaluation collection of illustrative plates, wherein 1, and the DNA of insertion; 2, recombinant plasmid pET-1Da; 3, the EcoR I+SalI double digestion product of recombinant plasmid pET-1Da; M, DNA marker;
What Fig. 3 showed is that the SDS-PAGE that the cyt1Da1 gene is expressed in E.coli BL21 (DE3) detects figure; M wherein, albumen marker; 1, contain E.coli BL21 (DE3) expressing protein (negative control) of carrier pET-28a; 2, the E.coli BL21 (DE3) that contains recombinant plasmid pET-1Da induces cellular lysate liquid without IPTG; 3, contain E.coli BL21 (DE3) cellular lysate liquid after IPTG induces of recombinant plasmid pET-1Da.
Embodiment
Following examples further illustrate content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.
If do not specialize, biochemical reagents used in embodiment are the commercial reagent, the conventional means that in embodiment, technique means used is well known to those skilled in the art.
The present invention separates the new bacterial strain of the bacillus thuringiensis (Bacillus thuringiensis) that obtains from the virgin forest Soils In The Region of Muchuan, Sichuan Province, this bacterial strain on October 21st, 2008 in (address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, China Committee for Culture Collection of Microorganisms's common micro-organisms center, Institute of Microorganism, Academia Sinica, postcode 100101) preservation, Classification And Nomenclature is bacillus thuringiensis (Bacillus thuringiensis), and preserving number is CGMCC No.2719.
This example is cloned the full length sequence that obtains the cyt1Da1 gene by the following method.
Adopt genomic dna purification kit (available from matching Parkson company) to extract total DNA of bacterial strain MC28 as the template of amplification cyt1Da1 gene, the design primer sequence is as follows:
P1：5’ATGCAATCAAAAGTGAGGG 3’；
P2：5’TCAATTAATATTTTCTATATAAA 3’
25 μ l PCR reaction systems:
Thermal cycle reaction: 94 ℃ of denaturation 5min; 94 ℃ of sex change 50s, 54 ℃ of 50s, 72 ℃ are extended 2min, 30 circulations; 72 ℃ are extended 5min; 4 ℃ of stopped reaction.The amplified reaction product is electrophoresis on 1% sepharose, puts and observes the pcr amplification result in gel imaging system.Result has obtained being about the sequence of 1500bp as shown in Figure 1 by amplification, this sequence is checked order, and its nucleotide sequence is as shown in SEQ ID No.1, and is consistent with aim sequence.
The acquisition of embodiment 2 Cyt1Da1 albumen
According to cyt1Da1 gene open reading frame two terminal sequences, design and synthesize a pair of special primer 1DaF:5 '-CG
GAATTCATGCAATCAAAAGTGAGGG-3 ' 1DaR:5 ' CGC
GTCGACTCAATTAATATTTTCTATATAAA-3 ', 5 ' end primer underscore part base is respectively EcoR I and Sa/I restriction enzyme site.Increase take the total DNA of MC28 as template, carrier pET-28a (+) after enzyme is cut product and carried out equally double digestion is connected, Transformed E .coli DH5 α competent cell, extract its plasmid enzyme restriction electrophoresis and verified that insertion segment size meets (Fig. 2) after expection purpose fragment, then change recipient bacterium E.coli.BL21 (DE3) (buying in the Beijing Quanshijin Biotechnology Co., Ltd) over to.With recombinant plasmid called after pET-1Da, contain the recon called after E.co/i.BL21 (1Da) of recombinant plasmid.With positive transformant in the LB substratum, in 200r/min, 37 ℃ of incubated overnight, again the ratio of nutrient solution according to 1: 100 is transferred in the 1L triangular flask that contains 400mL LB nutrient solution, 200r/min, 37 ℃ of cultivations, when the OD of nutrient solution value reaches 0.6-0.8, add 0.6mmol/L IPTG to carry out abduction delivering 20h, centrifugation medium is collected thalline, abandon supernatant, add 30mL 10mmol/L Tris-HCl (pH 8.0) ultrasonic disruption, with SDS-PAGE, expressing protein is detected.
SDS-PAGE the analysis showed that in the precipitation of expression product after the thalline ultrasonication of cyt1Da1 gene (Fig. 3), and molecular weight is about the 60kDa left and right, conforms to the molecular weight of albumen of prediction.
The Cyt1Da1 albumen that embodiment 2 is obtained carries out insecticidal activity assay to yellow-fever mosquito.At first with sterilized water, Cyt1Da1 albumen is mixed with 0.1,4,8,16,6 different concentration gradients such as 32,64mg/mL, then every processing drops into 20 albopictus larvaes, every processing repeats for 3 times, and E.coli.BL21 (DE3) is as negative control, and clear water is blank; Statistics after 12h, LC
50Use the SPSS10.0 software analysis.
Result shows (table 1): the insecticidal activity that expression product is certain to the yellow-fever mosquito tool, LC
50Be 46.32 μ g/mL.Give birth to survey result and show, E.coli.BL21 (DE3) and blank are not had an insecticidal activity to yellow-fever mosquito.
The insecticidal activity of table 1 Cyt1Da1 to yellow-fever mosquito
Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements, all belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Claims (9)
1. Bt PROTEIN C yt1Da1, its aminoacid sequence is the aminoacid sequence shown in SEQ ID No.2.
2. the gene of coding claim 1 described albumen, its nucleotide sequence is as shown in SEQ ID No.1 in sequence table.
3. the recombinant expression vector that contains the described gene of claim 2.
4. the host cell that is transformed by the described expression vector of claim 3.
5. host cell as claimed in claim 4, it is plant host cell.
6. the sterilant that contains the described albumen of claim 1.
7. the application of albumen claimed in claim 1 in the preparation sterilant.
8. albumen claimed in claim 1 or its encoding gene application in cultivating transgenic plant.
9. albumen claimed in claim 1 or its encoding gene application in improving plant resistance to insect.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110404408 CN102408475B (en) | 2011-12-07 | 2011-12-07 | Bt protein Cryt1Da1, and coding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110404408 CN102408475B (en) | 2011-12-07 | 2011-12-07 | Bt protein Cryt1Da1, and coding gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102408475A CN102408475A (en) | 2012-04-11 |
| CN102408475B true CN102408475B (en) | 2013-06-12 |
Family
ID=45910858
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110404408 Active CN102408475B (en) | 2011-12-07 | 2011-12-07 | Bt protein Cryt1Da1, and coding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102408475B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109112117B (en) * | 2017-09-04 | 2020-11-27 | 华中农业大学 | Separated chilo suppressalis CYP15C1 gene and encoded protein thereof |
| CN110066322B (en) * | 2019-04-04 | 2020-09-29 | 四川农业大学 | Bt protein Cyt2-like and gene and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006012366A3 (en) * | 2004-07-20 | 2006-09-28 | Phyllom Llc | Methods for making and using recombinant bacillus thuringiensis spores |
| EP2113172A1 (en) * | 2008-04-28 | 2009-11-04 | Bayer CropScience AG | Method for improved utilisation of the production potential of transgene plants |
| US7919272B2 (en) * | 2009-03-06 | 2011-04-05 | Athenix Corp. | Methods and compositions for controlling plant pests |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE10065395A1 (en) * | 2000-12-28 | 2002-07-04 | Aventis Cropscience Gmbh | Procedure for the control of harmful organisms in crops |
-
2011
- 2011-12-07 CN CN 201110404408 patent/CN102408475B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006012366A3 (en) * | 2004-07-20 | 2006-09-28 | Phyllom Llc | Methods for making and using recombinant bacillus thuringiensis spores |
| EP2113172A1 (en) * | 2008-04-28 | 2009-11-04 | Bayer CropScience AG | Method for improved utilisation of the production potential of transgene plants |
| US7919272B2 (en) * | 2009-03-06 | 2011-04-05 | Athenix Corp. | Methods and compositions for controlling plant pests |
Non-Patent Citations (2)
| Title |
|---|
| 张静涛等.苏云金芽胞杆菌cry2Ad基因的克隆及其表达产物的活性分析.《生物技术通报》.2009,(第10期), |
| 苏云金芽胞杆菌cry2Ad基因的克隆及其表达产物的活性分析;张静涛等;《生物技术通报》;20091026(第10期);第146-155页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102408475A (en) | 2012-04-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105367634B (en) | A kind of Bt PROTEIN C ry1Ie5, its encoding gene and application | |
| CN105367633B (en) | A kind of BT PROTEIN C RY2Ab32, its encoding gene and application | |
| CN101497657B (en) | Novel disinsection Bt protein Cry54Aa1, coding gene thereof and use | |
| CN101497658B (en) | Novel Bt protein Cry4Cc1, coding gene thereof and use | |
| CN101503463B (en) | Novel Bt protein Cry53Ab1, coding gene thereof and use | |
| CN102408475B (en) | Bt protein Cryt1Da1, and coding gene and application thereof | |
| CN105367636B (en) | A kind of Bt PROTEIN C ry1Dd1, its encoding gene and application | |
| CN103525836B (en) | A kind of Bt Cry71Aa1 operon gene and proteins encoded thereof and application | |
| CN102781955B (en) | Bt protein Cry4Cb2, encoding gene of same and use thereof | |
| CN101503464A (en) | Novel Bt protein Cry30Fa1, coding gene thereof and use | |
| CN103525837B (en) | Bt PROTEIN C ry72Aa1 operon genes and its application | |
| CN103525835B (en) | A kind of Bt cry71Aa1 genes and its encoding proteins and application | |
| CN102603876B (en) | Bt protein Cry59Bal, coding gene and application of Bt protein Cry59Bal | |
| CN102363631B (en) | Insecticidal Bt (Bacillus thuringiensis) protein Cry8Qa1, coding gene thereof and application thereof | |
| CN102584960B (en) | Bt (Bacillus thuringiensis) protein Cry70Aa1 as well as encoding gene and application thereof | |
| CN105367635B (en) | A kind of Bt PROTEIN C ry1Hc1, its encoding gene and application | |
| CN103103204A (en) | Bt cry54Ab1 operon gene, protein encoded by gene and application of gene or protein | |
| CN103524605B (en) | Bt protein Cry72Aa1 and coding gene thereof and application | |
| CN103103203A (en) | Bt cry54Ab1 gene, protein encoded by gene and application of gene or protein | |
| CN102532285B (en) | Bt protein Cry2Ac-like and coding gene and application thereof | |
| CN102417538B (en) | Bt protein Cry68Aa1 and encoding gene and application thereof | |
| CN102363630B (en) | Pesticide Bt protein Cry8Pa1 and coding gene and use thereof | |
| CN102584959B (en) | Bt (Bacillus thuringiensis) protein Cry70Ba1 as well as encoding gene and application thereof | |
| CN102408474B (en) | Bt protein Cry69Aa1, and coding gene and application thereof | |
| CN102408473B (en) | Bt (Bacillus Thuringiensis) protein Cyt3Aa1 and coding gene as well as application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |