CN101497657B - Novel disinsection Bt protein Cry54Aa1, coding gene thereof and use - Google Patents

Abstract

The invention provides a new Bt protein Cry54Aa1 and an encoding gene thereof. The protein has an amino acid sequence shown in an SEQ ID No.2 or has coordination activity after replacing, deleting and/or increasing one or more amino acids in the amino acid sequence shown in the SEQ ID No.2. The protein can be used for preparing the Bt pesticide, and the gene transformation can be performed to agricultural crops such as cotton, corn, rice, vegetables, and the like so that the agricultural crops have the corresponding binding activities, therefore, the consumption of the pesticide and the environmental pollution are reduced, and the invention has important economic value and application prospect.

Description

A kind of new disinsection Bt protein Cry54Aa1, its encoding gene and application

Technical field

The present invention relates to biological technical field, be specifically related to a kind of new Bt albumen and encoding gene and application.

Background technology

In the human being's production process, insect pest is the important factor that causes agriculture production loss and influence human health, adds up according to FAO, and the financial loss that whole world agriculture production every year causes because of insect pest is up to 14%, and disease is with a toll of 12%, and crop smothering is with a toll of 11%.The amount of loss is equivalent to half of the Chinese agriculture gross output value up to 1,260 hundred million dollars, more than 4 times of Britain.In addition, mosquito matchmaker disease is occupied critical positions in preventive medicine, wherein the sick transmissibility of mosquito such as singapore hemorrhagic fever and yellow jack matchmaker strong, popular wide, sickness rate is high, hazardness is big.According to the WHO statistics, the annual singapore hemorrhagic fever number that infects in the whole world reached 8,000 ten thousand, and Hainan Province of China once broke out twice singapore hemorrhagic fever in 1980 and 1986, and morbidity reaches 437469 example and 113589 examples respectively.Singapore hemorrhagic fever and yellow jack are mainly propagated by Aedes aegypti.

In order to reduce these losses, for many years, generally adopt the chemical prevention means to prevent and treat to crop pests and mosquito, but because the long-term, a large amount of of chemical pesticide use, caused the pollution to environment, pesticide residue increases in the agricultural byproducts, has brought harm for human existence and health.In addition, chemical pesticide has has also killed and wounded natural enemy and other useful thing in kill pests, destroyed the eubiosis.Compare safe, effective, persistent characteristics that biological control has with chemical prevention.And a series of problems of having avoided chemical prevention to bring.Therefore, biological control technology has become the focus of people's researchs.In biotic pesticide, bacillus thuringiensis is the quasi-microorganism sterilant that purposes is the widest in the world, output is maximum at present.

Bacillus thuringiensis (Bacillus thuringiensis, be called for short Bt) be a kind of gram positive bacterium, its distribution is very extensive, when forming, gemma can form the parasporal crystal of forming by protein with insecticidal activity, have another name called insecticidal crystal protein (Insectididal crystalproteins is called for short ICPs), ICPs is by the cry genes encoding, sensitive insect there is strong toxicity, and to higher animal and people's nontoxicity.In recent decades, Bt has been widely used in controlling insects such as multiple lepidopteran, Diptera, Coleoptera.In addition, Bt also has the effect of control evil to various pests such as Hymenoptera, Homoptera, Orthoptera, Mallophaga and plant pathogeny line insect, mite class, protozoon.At present Bt has become the strong substitute of chemical synthetic pesticide in the control of agricultural pests, injurious forest-insect and sanitary insect pest, and Bt still be that transgenic pest-resistant engineered plant important function of gene is originated.

(Adang M.J et al from Schnepf in 1981 has cloned first gene that can express insecticidal activity from strain HD-1Dipel since, Characterized full-length andtruncated plasmid clones of the crystal protein of Bacillus thuringiensissubsp.kurstaki HD-73 and their toxicity to Manduca sexta, Gene, 1985,36 (3): 289～300.), people separating clone the gene of more than 390 kind of coded insect-killing crystallin, they are defined as different groups respectively according to the amino acid sequence coded homology, subgroup, class and subclass (Crickmore N, Zeigler D R, Feitelson J, et al.Revision of the nomenclature for the Bacillus thuringiensis pesticidalcrystal proteins.Microbiol Mol Biol Rev, 1998,62:807-813; Http:// www.biols.susx.ac.uk/Home/Neil Crickmore/Bt/).Generally speaking, Cry1, toxalbumin such as Cry2 and Cry9 are effective to lepidoptera pest; Wherein the maximum of research are Cry1 and Cry9 proteinoid, the insecticidal crystal protein molecular weight of their codings is 130-140kD, many genes have been widely used in the control (Kozie of the lepidoptera pest of plant at present, M.G., Beland, G.L., Bowman, C., et al.Field performance of elite transgenicmaize plants expressing an insecticidal protein derived from Bacillusthuringiensis.Bio/Technology, 1993,11:194-200; Perlak, F.J., Deaton, R.W., Armstrong, T.A., et al.Insect resistant cotton plants.bio/technology, 1990; 8:939-943; Van Frankenhuyzen, K., Gringorten, L, and Gauhier, D.1997.Cry9Cal toxin, a Bacillus thuringiensis insecticidal crystalprotein with high activity against the spruce bud worm (Choristoneurafnniferana) .Appl.Environ, Microbvio1.63:4132-4134; Wang Fei, 2001, the research of bacillus thuringiensis specific strain biological characteristics and the new gene of cry9, Master's thesis, Nankai University).Tribactur Israel subclass (B.thuringiensis subsp.israelensis, abbreviation Bti) toxin protein that produces has fine insecticidal activity to mosquito, extensively applied to control (the Goldberg L J of mosquito, and Margalit J, 1977.A bacterialspore demonstrating rapid larvicidal activity against Anopheles sergentii, Uranotaenia unguiculata, Culex univitattus, Aedes aegypti, and Culexpipiens.Mosqito News, 37:355-358; ).Simultaneously, Cyt albumen has cytolytic, some Cry albumen is had synergism and delays the resistance (Wu of insect, D., Johnson, J.J., and Federici, B.A.1994.Synergism of mosquitocidal toxicity betweenCytA and CryIVD Proteins using inclusion sproduced from clonedgenes of Bacillus thuringiensis.Mol.Microbiol.13:965-972; Wirth, M.C., Georghiou, G.P., and Federeci, B.A.1997.CytA enables CryIVendotoxins of Bacillus thuringiensis to overcome high levels of CryIVresistance in the mosquito, Culex quinquefasciatus.Proc.Natl.Acad.Sci.94:10536-10540)

Find the history in existing so far more than 100 year of Tribactur from the beginning of this century, aspect the preventing and treating of farm crop and gardening plant insect, injurious forest-insect and sanitary insect pest, be widely used, also play good effect.But owing to use Tribactur on a large scale and repeatedly, many insect populations are producing resistance to insecticidal crystal protein in succession in varying degrees.The history in existing more than 50 year of Utilization of pesticides based on the Bt insecticidal crystal protein, the initial resistance of insect that never detect to Bt, but, begin mid-term 80 year last century, resistance problem (the M cGaughey that constantly in laboratory and field test, is confirmed, W.H.1985.Insect resistance to the biological insecticide Bacillus thuringiensis.Science.229:193-195), reason mainly is continue to use single variety and inferiorly cause the Bt of dosage and the application of Bt transgenic anti-insect plants causes insect population to be subjected to the selective pressure of sterilant for a long time.1985, McGaughey report warehouse grain pest Indian meal moth (Plodiainterpunctella) under the selective pressure of Dipel (the commodity preparation of Bt subsp.kurstaik HD-1), bred for 15 generations after, resistance increases by 97 times; Under the high dosage selective pressure, resistance can increase by 250 times.Nineteen ninety, the small cabbage moth that confirms big Tanaka in Hawaii has first produced tangible resistance (Tabashnik to the Bt sterilant, B.E., Finson, N., Groeters, F.R., et al.1994.Reversal of resistance to Bacillus thuringiensisin Plutella xylostella.Proc.Natl.Acad.Sci.USA.91:4120-4124), since the nineties in last century, use long Shenzhen of Bt sterilant time in China, Guangzhou, ground such as Shanghai, find that the Bt sterilant obviously descends to the small cabbage moth prevention effect, mean resistance form (Feng Xia .1996. Guangdong small cabbage moth is to the resistance research of Bacillus thuringiensis. insect journal, 39 (3): 238-244; Hofte, H., Van Rie, J., Jansens, S., Van Houtven, A., Vanderbruggen, H., and Vaeck, M., 1988.Monoclonal antibody analysis and insecticidal spectrum ofthree types of lepidopteran-specific insecticidal crystal proteins ofBacillus thuringiensis.Appl.Environ.Microbiol.54:2010-2017).Find at present in the laboratory and the field has at least tens kinds of insects that Bt and insecticidal crystal protein thereof have been produced resistance, arrive with the selective pressure mathematical model prediction, under the condition of Bt transgenic anti-insect plants selective pressure, insect will produce resistance (Schnepf, E., Crickmore, N., Van Pie, J., et al.1998.Bacillus thuringiensis and its pesticidal Crystalproteins.Microbiol.Mol.Biol.Rev.65 (3): 77 5-806).In addition, there are some researches prove that Bti does not find resistance problem (Regis L.et al. as yet in the use in land for growing field crops, 2000.The useof bacterial larvicides in mosquito and black fly control programsinBrazil.Mem.Instituto Oswaldo Cruz, 95:207-210.), but mosquito constantly is confirmed in the laboratory to its resistance problem, this situation also may (Georghiou G P occur big Tanaka, and Wirth M C, 1997.Influence of exposure to singleversus multiple toxins of Bacillus thuringiensis subsp.israelensis ondevelopment of resistance in the mosquito Culex quinquefasciatus (Diptera:Culicidae) .Applied and Environmental Microbiology, 63:1095-1101.).

Be the loss of avoiding resistant insects to cause, seeking new high virulence gene resource is the effective way that addresses this problem, and this biological control to China has crucial meaning.

Summary of the invention

First purpose of the present invention is to provide a kind of new Bt virulence protein resource at above-mentioned deficiency.

Second purpose of the present invention is to provide the gene of encoding said proteins.

The present invention also aims to provide the application of above-mentioned albumen and gene.

The present invention separates the new bacterial strain BtMC28 of the bacillus thuringiensis (Bacillus thuringiensis) that obtains from the soil of Muchuan, Sichuan Province virgin forest area.By the virulence test shows to BtMC28, BtMC28 all has high virulence to lepidoptera pest, Diptera pest or the like.According to 1 pair of special primer of cry54 genoid conserved sequence design, its genomic dna increases, the result shows that there is the cry54 genoid in this bacterial strain, further its full-length gene primer of design is cloned and is obtained the cry54Aa gene, and its nucleotide sequence is shown in sequence table SEQ IDNo.1, total length is 2022bp, analysis revealed, GC content are 31.21%, the albumen that 673 amino acid of encoding are formed.After measured, its aminoacid sequence is shown in SEQ ID No.2.Adopt bacterial sigma7.0 promoter program that complete sequence is predicted in the softberry website and show, contain the sequence in RNA polymerase activation site in the gene coding region upstream, its called after cry54Aa1.The proteic amino acid of Cry54Aa1 is formed as table 1.

The proteic amino acid of table 1 Cry54Aa1 is formed

Amino acid	Per-cent %	Amino acid	Per-cent %
				Ala(A)：	4.75	Met(M)：	1.49
Cys(C)：	1.19	Asn(N)：	8.92
				Asp(D)：	4.90	Pro(P)：	5.35
Glu(E)：	3.57	Gln(Q)：	4.16
				Phe(F)：	4.16	Arg(R)：	4.31

Amino acid	Per-cent %	Amino acid	Per-cent %
				Gly(G)：	5.05	Ser(S)：	8.62
His(H)：	1.19	Thr(T)：	6.98
				Ile(I)：	9.66	Val(V)：	4.75
Lys(K)：	4.31	Trp(W)：	1.34
				Leu(L)：	9.36	Tyr(Y)：	5.94

Should be appreciated that those skilled in the art can not influence under its active prerequisite according to aminoacid sequence disclosed by the invention, replace, lack and/or increase one or several amino acid, obtain described proteic mutant nucleotide sequence.For example, (3) (Gln) replaced with (Met) at nonactive section.Therefore, Bt albumen of the present invention comprises that also aminoacid sequence shown in the SEQ ID No.2 is substituted, replaces and/or increases one or several amino acid, has the equal active protein of being derived and being obtained by Cry54Aa1 of Cry54Aa1 albumen.Gene of the present invention comprises the nucleic acids encoding said proteins sequence.

In addition, should be understood that the degeneracy of considering codon and the preferences of different plant species codon, those skilled in the art can use as required and be fit to the codon that specific species are expressed.

Gene of the present invention can be cloned or separate from bacterial strain BtMC28 with protein and be obtained, and perhaps obtains by DNA or peptide synthetic method.

Gene of the present invention can be operably connected with expression vector, obtain to express the proteic recombinant expression vector of the present invention, and then can pass through such as transgenic methods such as agrobacterium-mediated transformation, particle bombardment, pollen tube passage methods, described expression vector is imported the host, obtain changeing the transformant of Cry54Aa1 gene, for example plant such as farm crop or fruit tree makes it possess anti-insect activity.

In addition, can also obtain containing the proteic fermented liquid of Cry54Aa1, it is prepared into sterilant, be used for the control of crop pests by fermentation bacterial strain BtMC28 of the present invention.Those skilled in the art can also be with said gene transform bacteria or fungi, by large scale fermentation production Bt albumen of the present invention.

Those skilled in the art can also with farm crop such as its converting cotton, corn, paddy rice, vegetables, make it possess corresponding anti-insect activity according to gene disclosed by the invention.Thereby reduce the usage quantity of agricultural chemicals, reduce environmental pollution, have important economic value and application prospect.

Description of drawings

Fig. 1 shows is the gel electrophoresis figure of the Cry54Aa1 full-length gene that obtains of clone, M wherein, marker; 1, the Cry54Aa1 gene.

Fig. 2 shows is that the enzyme of recombinant plasmid pET-54Aa is cut the evaluation collection of illustrative plates, wherein 1, and the pET-54Aa plasmid; 2, the Nde I+EcoR I double digestion product of pET-30a; 3, the Nde I+EcoR I double digestion product of pET-54Aa; 4, the dna sequence dna of insertion; M1, λ-Hind III enzyme is cut product; M2, the DL2000 molecular weight standard.

What Fig. 3 showed is that the SDS-PAGE of Cry54Aa1 gene in E.coli BL21 (DE3) detects figure, wherein M. albumen marker; 1. negative control E.coiiBL21 (DE3) (pET-30a); 2.E.coii BL21 (DE3) is the lysate supernatant (pET-54Aa); 3. the Cry54Aa1 albumen in the inclusion body.

Embodiment

Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.

If do not specialize the conventional means that used technique means is well known to those skilled in the art among the embodiment.

The clone of embodiment 1 cry54Aa1 gene

The present invention separates the new bacterial strain of the bacillus thuringiensis (Bacillus thuringiensis) that obtains from the soil of Muchuan, Sichuan Province virgin forest area, this bacterial strain on October 21st, 2008 at China Committee for Culture Collection of Microorganisms common micro-organisms center (address: No. 3, A, DaTun Road, Chaoyang District, BeiJing City, Institute of Microorganism, Academia Sinica, postcode 100101) preservation, classification called after bacillus thuringiensis (Bacillus thuringiensis), preserving number is CGMCC No.2719.

This example is cloned the full length sequence that obtains the cry54Aal gene by the following method.

Adopt genomic dna purification kit (available from match Parkson company) to extract total DNA of bacterial strain BtMC28.The design primer sequence is as follows:

P1：5’ATGAGTATGAAATCATTGATTC3’

P2：5’CACGTCAGGGGTAAATTCGATT3’

The PCR reaction system:

10×buffer 2.5μl

MgCl ₂(25mM) 1.5μl

Taq enzyme 0.2 μ l

dNTPs(2.5mM) 2μl

Primer 2 μ l

Template 5 μ l

End reaction volume 25 μ l

Thermal cycle reaction: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 1min, annealing temperature is decided according to primer, and 72 ℃ are extended 2min, 30 circulations; 72 ℃ are extended 5min; 4 ℃ of stopped reaction.The amplified reaction product is electrophoresis on 1% sepharose, puts and observes the pcr amplification result in the gel imaging system.The result has obtained being about the sequence of 2000bp by amplification as shown in Figure 1, and this sequence is checked order, and its nucleotide sequence is shown in SEQ ID No.1, and is consistent with aim sequence.

Embodiment 2 cry54Aa1 expression of gene and insecticidal activity assays

According to cry54Aa1 gene open reading frame two terminal sequences, design and synthesize a pair of Auele Specific Primer cry54A:5 '-GCG CATATG(NdeI) ATGAGTATGAAATCATTGATTC-3 '; Cry30R:5 '-CG GAATTC(EcoR I) CACGTCAGGGGTAAATTCGATT-3 ' is respectively at 5 ' end primer Nde I and EcoR I restriction enzyme site.With the total DNA of BtMC28 is that template increases, the product of amplification adopts Nde I and EcoR I to carry out double digestion, carrier pET-30a (+) after enzyme is cut product and carried out double digestion equally is connected, Transformed E .coliDH5 α competent cell, extract its plasmid enzyme restriction electrophoresis and verified that insertion segment size meets (Fig. 2) after the intended purposes, changes recipient bacterium E.coli.BL21 (DE3) again over to.With recombinant plasmid called after pET-54Aa, contain the recon called after E.coli.BL21 (54Aa) of recombinant plasmid.In the precipitation of SDS-PAGE analysis revealed cry54Aa1 expression of gene product after the thalline ultrasonication (Fig. 3), molecular weight is about about 76kDa, conforms to the molecular weight of albumen of prediction.

The cry54Aa gene expression product is surveyed the result to giving birth to of cabbage caterpillar and culex respectively and shown (table 1): expression product all has insecticidal activity preferably to these two kinds of worms; LC to cabbage caterpillar ₅₀Be 7.18 μ g/mL; LC to culex ₅₀Be 10.21 μ g/mL.E.coli.BL21 (DE3) is as negative control, gives birth to survey the result and show, E.coli.BL21 (DE3) is not had an insecticidal activity to above two kinds of insects.

The insecticidal activity of table 1 Cry54Aa

Sequence table

＜110〉Sichuan Agricultural University

Plant Protection institute, Chinese Academy of Agricultral Sciences

＜120〉a kind of new Bt PROTEIN C ry54Aa1, its encoding gene and application

<130>KHP09112176.7

<160>6

<170>PatentIn version 3.5

<210>1

<211>2022

<212>DNA

＜213〉Bacillus thuringiensis bacterial strain (Bacillus thuringiensis) BtMC28

<220>

<221>CDS

<222>(1)..(2022)

<400>1

atg agt atg aaa atg ttg att caa aga att tac ctt gtc ctt atg aca 48

Met Ser Met Lys Met Leu Ile Gln Arg Ile Tyr Leu Val Leu Met Thr

1 5 10 15

gaa ata ttg act att cta gac acc ctt tta caa ata atc cga atc aac 96

Glu Ile Leu Thr Ile Leu Asp Thr Leu Leu Gln Ile Ile Arg Ile Asn

20 25 30

cat tac aaa aat tgg atc aat atg tgt caa aag aat caa caa tat ggt 144

His Tyr Lys Asn Trp Ile Asn Met Cys Gln Lys Asn Gln Gln Tyr Gly

35 40 45

gaa aat ctt gaa act ttt aat agt gct gat aca att gcc gga gtt agt 192

Glu Asn Leu Glu Thr Phe Asn Ser Ala Asp Thr Ile Ala Gly Val Ser

50 55 60

gca ggt gtt att gta gta ggc act atg tta gga gct ttt gct gct cct 240

Ala Gly Val Ile Val Val Gly Thr Met Leu Gly Ala Phe Ala Ala Pro

65 70 75 80

att aca gct ggt ctt atc ata tcc ttc tcc aca cta ttg ccg att ttt 288

Ile Thr Ala Gly Leu Ile Ile Ser Phe Ser Thr Leu Leu Pro Ile Phe

85 90 95

tgg aaa cca ggt gaa gat cct aaa aca gta tgg caa gca ttt tta aaa 336

Trp Lys Pro Gly Glu Asp Pro Lys Thr Val Trp Gln Ala Phe Leu Lys

100 105 110

ata gga aat aga cct ttt agt tca cca gta gat caa gct cta att gat 384

Ile Gly Asn Arg Pro Phe Ser Ser Pro Val Asp Gln Ala Leu Ile Asp

115 120 125

tta cta tct aat aaa gca agg agt tta gaa tcg caa ttt aac gat ttt 432

Leu Leu Ser Asn Lys Ala Arg Ser Leu Glu Ser Gln Phe Asn Asp Phe

130 135 140

caa agg tat ttt gat ata tgg aat aat aat aaa act cca gga aat gct 480

Gln Arg Tyr Phe Asp Ile Trp Asn Asn Asn Lys Thr Pro Gly Asn Ala

145 150 155 160

gga gaa gta cta aga agg ttt tct agt tta gat gct gat ata ata aga 528

Gly Glu Val Leu Arg Arg Phe Ser Ser Leu Asp Ala Asp Ile Ile Arg

165 170 175

gaa tta gaa caa tta aag gga aac tat tat atc acg gta ctt cct ggc 576

Glu Leu Glu Gln Leu Lys Gly Asn Tyr Tyr Ile Thr Val Leu Pro Gly

180 185 190

tat gca caa gta gct aat tgg cat tta aat cta tta cga ata gct gca 624

Tyr Ala Gln Val Ala Asn Trp His Leu Asn Leu Leu Arg Ile Ala Ala

195 200 205

ttt tat tac gac caa tgg gca tct tca tct aac tta tca ata caa agt 672

Phe Tyr Tyr Asp Gln Trp Ala Ser Ser Ser Asn Leu Ser Ile Gln Ser

210 215 220

ata tat cct gag gat tat att aat gat ctt cag act tgc cta acg aat 720

Ile Tyr Pro Glu Asp Tyr Ile Asn Asp Leu Gln Thr Cys Leu Thr Asn

225 230 235 240

tgc gca ata gaa agt ggt aat aag ata tct tct aaa tac tat aaa tgc 768

Cys Ala Ile Glu Ser Gly Asn Lys Ile Ser Ser Lys Tyr Tyr Lys Cys

245 250 255

gta tta aaa tgt aga att aat gaa tat att aat tat tgt tca aaa aca 816

Val Leu Lys Cys Arg Ile Asn Glu Tyr Ile Asn Tyr Cys Ser Lys Thr

260 265 270

tat caa gag ggc cta aat ata ctt aaa aat tca agt ggt ttg aaa tgg 864

Tyr Gln Glu Gly Leu Asn Ile Leu Lys Asn Ser Ser Gly Leu Lys Trp

275 280 285

aat gaa tat aat acg tat cgt aga gaa atg acc cta aat gta tta gat 912

Asn Glu Tyr Asn Thr Tyr Arg Arg Glu Met Thr Lys Asn Val Leu Asp

290 295 300

ctt att gct gtt ttt cca aat tat gac cca gat aaa tat cta ata agt 960

Leu Ile Ala Val Phe Pro Asn Tyr Asp Pro Asp Lys Tyr Leu Ile Ser

305 310 315 320

act aaa tct caa ctt act aga gaa att tat acg gat gct tta ata gat 1008

Thr Lys Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asp Ala Leu Ile Asp

325 330 335

gca ttt gct aat gct cat ttt aat ata aat gac att gaa aat agt tta 1056

Ala Phe Ala Asn Ala His Phe Asn Ile Asn Asp Ile Glu Asn Ser Leu

340 345 350

aca aga cct cct ggt tta gtt act tgg ata aat cgt tta gat ttt tat 1104

Thr Arg Pro Pro Gly Leu Val Thr Trp Ile Asn Arg Leu Asp Phe Tyr

355 360 365

aca gga atg ttt act aag agt gtc cct gga tta act gcc aat ggt att 1152

Thr Gly Met Phe Thr Lys Ser Val Pro Gly Leu Thr Ala Asn Gly Ile

370 375 380

aat tac tca ttt acg aat ggt aat tca aat gat agt cca att tat gga 1200

Asn Tyr Ser Phe Thr Asn Gly Asn Ser Asn Asp Ser Pro Ile Tyr Gly

385 390 395 400

tat cgt tta agc gat gat agt agc act cca att caa ata ccc cgt aat 1248

Tyr Arg Leu Ser Asp Asp Ser Ser Thr Pro Ile Gln Ile Pro Arg Asn

405 410 415

caa tat gtt tat aat atg tta atc aca tat tta aga gat agt cct agc 1296

Gln Tyr Val Tyr Asn Met Leu Ile Thr Tyr Leu Arg Asp Ser Pro Ser

420 425 430

gta ata caa aag att gag ttt aat tta aac aat caa caa aca cgt act 1344

Val Ile Gln Lys Ile Glu Phe Asn Leu Asn Asn Gln Gln Thr Arg Thr

435 440 445

tat gat act ggg cta aca tta gca cct act tac caa agt act ata aat 1392

Tyr Asp Thr Gly Leu Thr Leu Ala Pro Thr Tyr Gln Ser Thr Ile Asn

450 455 460

tta tca tta cca gga aag gat aga tca ttc cca ccc aaa ttt aat aac 1440

Leu Ser Leu Pro Gly Lys Asp Arg Ser Phe Pro Pro Lys Phe Asn Asn

465 470 475 480

tat act cat ttt tta tct tat gta aaa aca gct cct ggt gat gag aga 1488

Tyr Thr His Phe Leu Ser Tyr Val Lys Thr Ala Pro Gly Asp Glu Arg

485 490 495

cca tct agc tca agg gca aga aat gtt tgt ttt ggt tgg atg cat ttt 1536

Pro Ser Ser Ser Arg Ala Arg Asn Val Cys Phe Gly Trp Met His Phe

500 505 510

agt gtt aat gat tat gat gta ctt gcg ggt ggt tat aat aca att tct 1584

Ser Val Asn Asp Tyr Asp Val Leu Ala Gly Gly Tyr Asn Thr Ile Ser

515 520 525

aat aaa att att aca caa ata ccc gct gta aaa gct aga cat tta cct 1632

Asn Lys Ile Ile Thr Gln Ile Pro Ala Val Lys Ala Arg His Leu Pro

530 535 540

ctc ccg tct ttt gtg atg cct ggt cct ggt cat aca ggg ggt aat tta 1680

Leu Pro Ser Phe Val Met Pro Gly Pro Gly His Thr Gly Gly Asn Leu

545 550 555 560

gtt gtt ctt tca acc caa ata gaa ttt caa tgt att gta ctt aat cct 1728

Val Val Leu Ser Thr Gln Ile Glu Phe Gln Cys Ile Val Leu Asn Pro

565 570 575

gta tcc tat aaa att cgt atg cga tat gtt gca tac tct cct aat cgt 1776

Val Ser Tyr Lys Ile Arg Met Arg Tyr Val Ala Tyr Ser Pro Asn Arg

580 585 590

tca att aac cta aca gta agt ata aga agc gaa ata gga aat tat caa 1824

Ser Ile Asn Leu Thr Val Ser Ile Arg Ser Glu Ile Gly Asn Tyr Gln

595 600 605

aat ata gtt cca aat ata agt tcc aca gtt caa tca cct gaa gat aca 1872

Asn Ile Val Pro Asn Ile Ser Ser Thr Val Gln Ser Pro Glu Asp Thr

610 615 620

aaa aat cct aaa tat gag cac ttt caa tat cct gat ata tca ata ccg 1920

Lys Asn Pro Lys Tyr Glu His Phe Gln Tyr Pro Asp Ile Ser Ile Pro

625 630 635 640

tta gaa cta ttt gga ata act aat ata act att aca agg tca gac agt 1968

Leu Glu Leu Phe Gly Ile Thr Asn Ile Thr Ile Thr Arg Ser Asp Ser

645 650 655

ata tct aac aat aca ttg att ata gat aaa atc gaa ttt acc cct gac 2016

Ile Ser Asn Asn Thr Leu Ile Ile Asp Lys Ile Glu Phe Thr Pro Asp

660 665 670

gtg tga 2022

Val

<210>2

<211>673

<212>PRT

＜213〉Bacillus thuringiensis bacterial strain (Bacillus thuringiensis) BtMC28

<400>2

Met Ser Met Lys Met Leu Ile Gln Arg Ile Tyr Leu Val Leu Met Thr

1 5 10 15

Glu Ile Leu Thr Ile Leu Asp Thr Leu Leu Gln Ile Ile Arg Ile Asn

20 25 30

His Tyr Lys Asn Trp Ile Asn Met Cys Gln Lys Asn Gln Gln Tyr Gly

35 40 45

Glu Asn Leu Glu Thr Phe Asn Ser Ala Asp Thr Ile Ala Gly Val Ser

50 55 60

Ala Gly Val Ile Val Val Gly Thr Met Leu Gly Ala Phe Ala Ala Pro

65 70 75 80

Ile Thr Ala Gly Leu Ile Ile Ser Phe Ser Thr Leu Leu Pro Ile Phe

85 90 95

Trp Lys Pro Gly Glu Asp Pro Lys Thr Val Trp Gln Ala Phe Leu Lys

100 105 110

Ile Gly Asn Arg Pro Phe Ser Ser Pro Val Asp Gln Ala Leu Ile Asp

115 120 125

Leu Leu Ser Asn Lys Ala Arg Ser Leu Glu Ser Gln Phe Asn Asp Phe

130 135 140

Gln Arg Tyr Phe Asp Ile Trp Asn Asn Asn Lys Thr Pro Gly Asn Ala

145 150 155 160

Gly Glu Val Leu Arg Arg Phe Ser Ser Leu Asp Ala Asp Ile Ile Arg

165 170 175

Glu Leu Glu Gln Leu Lys Gly Asn Tyr Tyr Ile Thr Val Leu Pro Gly

180 185 190

Tyr Ala Gln Val Ala Asn Trp His Leu Asn Leu Leu Arg Ile Ala Ala

195 200 205

Phe Tyr Tyr Asp Gln Trp Ala Ser Ser Ser Asn Leu Ser Ile Gln Ser

210 215 220

Ile Tyr Pro Glu Asp Tyr Ile Asn Asp Leu Gln Thr Cys Leu Thr Asn

225 230 235 240

Cys Ala Ile Glu Ser Gly Asn Lys Ile Ser Ser Lys Tyr Tyr Lys Cys

245 250 255

Val Leu Lys Cys Arg Ile Asn Glu Tyr Ile Asn Tyr Cys Ser Lys Thr

260 265 270

Tyr Gln Glu Gly Leu Asn Ile Leu Lys Asn Ser Ser Gly Leu Lys Trp

275 280 285

Asn Glu Tyr Asn Thr Tyr Arg Arg Glu Met Thr Lys Asn Val Leu Asp

290 295 300

Leu Ile Ala Val Phe Pro Asn Tyr Asp Pro Asp Lys Tyr Leu Ile Ser

305 310 315 320

Thr Lys Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asp Ala Leu Ile Asp

325 330 335

Ala Phe Ala Asn Ala His Phe Asn Ile Asn Asp Ile Glu Asn Ser Leu

340 345 350

Thr Arg Pro Pro Gly Leu Val Thr Trp Ile Asn Arg Leu Asp Phe Tyr

355 360 365

Thr Gly Met Phe Thr Lys Ser Val Pro Gly Leu Thr Ala Asn Gly Ile

370 375 380

Asn Tyr Ser Phe Thr Asn Gly Asn Ser Asn Asp Ser Pro Ile Tyr Gly

385 390 395 400

Tyr Arg Leu Ser Asp Asp Ser Ser Thr Pro Ile Gln Ile Pro Arg Asn

405 410 415

Gln Tyr Val Tyr Asn Met Leu Ile Thr Tyr Leu Arg Asp Ser Pro Ser

420 425 430

Val Ile Gln Lys Ile Glu Phe Asn Leu Asn Asn Gln Gln Thr Arg Thr

435 440 445

Tyr Asp Thr Gly Leu Thr Leu Ala Pro Thr Tyr Gln Ser Thr Ile Asn

450 455 460

Leu Ser Leu Pro Gly Lys Asp Arg Ser Phe Pro Pro Lys Phe Asn Asn

465 470 475 480

Tyr Thr His Phe Leu Ser Tyr Val Lys Thr Ala Pro Gly Asp Glu Arg

485 490 495

Pro Ser Ser Ser Arg Ala Arg Asn Val Cys Phe Gly Trp Met His Phe

500 505 510

Ser Val Asn Asp Tyr Asp Val Leu Ala Gly Gly Tyr Asn Thr Ile Ser

515 520 525

Asn Lys Ile Ile Thr Gln Ile Pro Ala Val Lys Ala Arg His Leu Pro

530 535 540

Leu Pro Ser Phe Val Met Pro Gly Pro Gly His Thr Gly Gly Asn Leu

545 550 555 560

Val Val Leu Ser Thr Gln Ile Glu Phe Gln Cys Ile Val Leu Asn Pro

565 570 575

Val Ser Tyr Lys Ile Arg Met Arg Tyr Val Ala Tyr Ser Pro Asn Arg

580 585 590

Ser Ile Asn Leu Thr Val Ser Ile Arg Ser Glu Ile Gly Asn Tyr Gln

595 600 605

Asn Ile Val Pro Asn Ile Ser Ser Thr Val Gln Ser Pro Glu Asp Thr

610 615 620

Lys Asn Pro Lys Tyr Glu His Phe Gln Tyr Pro Asp Ile Ser Ile Pro

625 630 635 640

Leu Glu Leu Phe Gly Ile Thr Asn Ile Thr Ile Thr Arg Ser Asp Ser

645 650 655

Ile Ser Asn Asn Thr Leu Ile Ile Asp Lys Ile Glu Phe Thr Pro Asp

660 665 670

Val

<210>3

<211>22

<212>DNA

＜213〉artificial sequence

<400>3

atgagtatga aatcattgat tc 22

<210>4

<211>22

<212>DNA

＜213〉artificial sequence

<400>4

cacgtcaggg gtaaattcga tt 22

<210>5

<211>31

<212>DNA

＜213〉artificial sequence

<400>5

gcgcatatga tgagtatgaa atcattgatt c 31

<210>6

<211>30

<212>DNA

＜213〉artificial sequence

<400>6

cggaattcca cgtcaggggt aaattcgatt 30

Claims (9)

1. Bt PROTEIN C ry54Aa1, its aminoacid sequence is the aminoacid sequence shown in the SEQ ID No.2.

2. coding claim 1 described proteic gene.

3. gene as claimed in claim 2, its nucleotide sequence is shown in SEQ ID No.1.

4. contain claim 2 or 3 described expression carrier.

5. by the described expression vector transformed host cells of claim 4.

6. host cell as claimed in claim 5, it is a plant host cell.

7. contain the described proteic sterilant of claim 1.

8. claim 2 or 3 described genes or the described expression vector of claim 4 application in the preparation transgenic plant.

9. claim 2 or 3 described genes or the described expression vector of claim 4 application in improving plant resistance to insect.

Images