CN101497658B - Novel Bt protein Cry4Cc1, coding gene thereof and use - Google Patents

Abstract

The invention provides a new Bt protein Cry4Cc1 and an encoding gene thereof. The protein has an amino acid sequence shown in an SEQ ID No.2 or has coordination activity after replacing, deleting and/or increasing one or more amino acids in the amino acid sequence shown in the SEQ ID No.2. The protein can be used for preparing the Bt pesticide, and the gene transformation can be performed to agricultural crops such as cotton, corn, rice, vegetables, and the like, so that the agricultural crops have the corresponding binding activities, therefore, the consumption of the pesticide and the environmental pollution are reduced, and the invention has the important economic value and application prospect.

Description

A kind of new Bt PROTEIN C ry4Cc1, its encoding gene and application

Technical field

The present invention relates to biological technical field, be specifically related to a kind of new Bt albumen and encoding gene and application.

Background technology

In the human being's production process, insect pest is the important factor that causes agriculture production loss and influence human health, adds up according to FAO, and the financial loss that whole world agriculture production every year causes because of insect pest is up to 14%, and disease is with a toll of 12%, and crop smothering is with a toll of 11%.The amount of loss is equivalent to half of the Chinese agriculture gross output value up to 1,260 hundred million dollars, more than 4 times of Britain.In addition, mosquito matchmaker disease is occupied critical positions in preventive medicine, wherein the sick transmissibility of mosquito such as singapore hemorrhagic fever and yellow jack matchmaker strong, popular wide, sickness rate is high, hazardness is big.According to the WHO statistics, the annual singapore hemorrhagic fever number that infects in the whole world reached 8,000 ten thousand, and Hainan Province of China once broke out twice singapore hemorrhagic fever in 1980 and 1986, and morbidity reaches 437469 example and 113589 examples respectively.Singapore hemorrhagic fever and yellow jack are mainly propagated by Aedes aegypti.

In order to reduce these losses, for many years, generally adopt the chemical prevention means to prevent and treat to crop pests and mosquito, but because the long-term, a large amount of of chemical pesticide use, caused the pollution to environment, pesticide residue increases in the agricultural byproducts, has brought harm for human existence and health.In addition, chemical pesticide has has also killed and wounded natural enemy and other useful thing in kill pests, destroyed the eubiosis.Compare safe, effective, persistent characteristics that biological control has with chemical prevention.And a series of problems of having avoided chemical prevention to bring.Therefore, biological control technology has become the focus of people's researchs.In biotic pesticide, bacillus thuringiensis is the quasi-microorganism sterilant that purposes is the widest in the world, output is maximum at present.

Bacillus thuringiensis (Bacillus thuringiensis, be called for short Bt) be a kind of gram positive bacterium, its distribution is very extensive, when forming, gemma can form the parasporal crystal of forming by protein with insecticidal activity, have another name called insecticidal crystal protein (Insectididal crystalproteins is called for short ICPs), ICPs is by the cry genes encoding, sensitive insect there is strong toxicity, and to higher animal and people's nontoxicity.In recent decades, Bt has been widely used in controlling insects such as multiple lepidopteran, Diptera, Coleoptera.In addition, Bt also has the effect of control evil to various pests such as Hymenoptera, Homoptera, Orthoptera, Mallophaga and plant pathogeny line insect, mite class, protozoon.At present Bt has become the strong substitute of chemical synthetic pesticide in the control of agricultural pests, injurious forest-insect and sanitary insect pest, and Bt still be that transgenic pest-resistant engineered plant important function of gene is originated.

(Adang M.J et al from Schnepf in 1981 has cloned first gene that can express insecticidal activity from strain HD-1Dipel since, Characterized full-length andtruncated plasmid clones of the crystal protein of Bacillus thuringiensissubsp.kurstaki HD-73 and their toxicity to Manduca sexta, Gene, 1985,36 (3): 289～300.), people separating clone the gene of more than 390 kind of coded insect-killing crystallin, they are defined as different groups respectively according to the amino acid sequence coded homology, subgroup, class and subclass (Crickmore N, Zeigler D R, Feitelson J, et al.Revision of the nomenclature for the Bacillus thuringiensis pesticidalcrystal proteins.Microbiol Mol Biol Rev, 1998,62:807-813; Http:// www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/).Generally speaking, Cry1, toxalbumin such as Cry2 and Cry9 are effective to lepidoptera pest; Wherein the maximum of research are Cry1 and Cry9 proteinoid, the insecticidal crystal protein molecular weight of their codings is 130-140kD, many genes have been widely used in the control (Kozie of the lepidoptera pest of plant at present, M.G., Beland, G.L., Bowman, C., et al.Field performance of elite transgenicmaize plants expressing an insecticidal protein derived from Bacillusthuringiensis.Bio/Technology, 1993,11:194-200; Perlak, F.J., Deaton, R.W., Armstrong, T.A., et al.Insect resistant cotton plants.bio/technology, 1990; 8:939-943; Van Frankenhuyzen, K., Gringorten, L., and Gauhier, D.1997.Cry9Cal toxin, a Bacillus thuringiensis insecticidal crystalprotein with high activity against the spruce bud worm (Choristoneurafnniferana) .Appl.Environ, Microbviol.63:4132-4134; Wang Fei, 2001, the research of bacillus thuringiensis specific strain biological characteristics and the new gene of cry9, Master's thesis, Nankai University).Tribactur Israel subclass (B.thuringiensis subsp.israelensis, abbreviation Bti) toxin protein that produces has fine insecticidal activity to mosquito, extensively applied to control (the Goldberg L J of mosquito, and Margalit J, 1977.A bacterialspore demonstrating rapid larvicidal activity against Anopheles sergentii, Uranotaenia unguiculata, Culex univitattus, Aedes aegypti, and Culexpipiens.Mosqito News, 37:355-358; ).Simultaneously, Cyt albumen has cytolytic, some Cry albumen is had synergism and delays the resistance (Wu of insect, D., Johnson, J.J., and Federici, B.A.1994.Synergism of mosquitocidal toxicity betweenCytA and CryIVD Proteins using inclusion sproduced from cloned genesof Bacillus thuringiensis.Mol.Microbiol.13:965-972; Wirth, M.C., Georghiou, G.P., and Federeci, B.A.1997.CytA enables CryIVendotoxins of Bacillus thuringiensis to overcome high levels of CryIVresistance in the mosquito, Culex quinquefasciatus.Proc.Natl.Acad.Sci.94:10536-10540)

Find the history in existing so far more than 100 year of Tribactur from the beginning of this century, aspect the preventing and treating of farm crop and gardening plant insect, injurious forest-insect and sanitary insect pest, be widely used, also play good effect.But owing to use Tribactur on a large scale and repeatedly, many insect populations are producing resistance to insecticidal crystal protein in succession in varying degrees.The history in existing more than 50 year of Utilization of pesticides based on the Bt insecticidal crystal protein, the initial resistance of insect that never detect to Bt, but, begin mid-term 80 year last century, resistance problem (the M cGaughey that constantly in laboratory and field test, is confirmed, W.H.1985.Insect resistance to the biological insecticide Bacillus thuringiensis.Science.229:193-195), reason mainly is continue to use single variety and inferiorly cause the Bt of dosage and the application of Bt transgenic anti-insect plants causes insect population to be subjected to the selective pressure of sterilant for a long time.1985, McGaughey report warehouse grain pest Indian meal moth (Plodia interpunctella) under the selective pressure of Dipel (the commodity preparation of Bt subsp.kurstaik HD-1), bred for 15 generations after, resistance increases by 97 times; Under the high dosage selective pressure, resistance can increase by 250 times.Nineteen ninety, the small cabbage moth that confirms big Tanaka in Hawaii has first produced tangible resistance (Tabashnik to the Bt sterilant, B.E., Finson, N., Groeters, F.R., et al.1994.Reversal of resistance to Bacillus thuringiensisin Plutella xylostella.Proc.Natl.Acad.Sci.USA.91:4120-4124), since the nineties in last century, use long Shenzhen of Bt sterilant time in China, Guangzhou, ground such as Shanghai, find that the Bt sterilant obviously descends to the small cabbage moth prevention effect, mean resistance form (Feng Xia .1996. Guangdong small cabbage moth is to the resistance research of Bacillus thuringiensis. insect journal, 39 (3): 238-244; Hofte, H., Van Rie, J., Jansens, S., Van Houtven, A., Vanderbruggen, H., and Vaeck, M., 1988.Monoclonal antibody analysis and insecticidal spectrum ofthree types of lepidopteran-specific insecticidal crystal proteins ofBacillus thuringiensis.Appl.Environ.Microbiol.54:2010-2017).Find at present in the laboratory and the field has at least tens kinds of insects that Bt and insecticidal crystal protein thereof have been produced resistance, arrive with the selective pressure mathematical model prediction, under the condition of Bt transgenic anti-insect plants selective pressure, insect will produce resistance (Schnepf, E., Crickmore, N., Van Pie, J., et al.1998.Bacillus thuringiensis and its pesticidal Crystalproteins.Microbiol.Mol.Biol.Rev.65 (3): 77 5-806).In addition, there are some researches prove that Bti does not find resistance problem (Regis L as yet in the use in land for growing field crops, et al., 2000.The useof bacterial larvicides in mosquito and black fly control programsinBrazil.Mem.Instituto Oswaldo Cruz, 95:207-210.), but mosquito constantly is confirmed in the laboratory to its resistance problem, this situation also may (Georghiou G P occur big Tanaka, and Wirth M C, 1997.Influence of exposure to singleversus multiple toxins of Bacillus thuringiensis subsp.israelensis ondevelopment of resistance in the mosquito Culex quinquefasciatus (Diptera:Culicidae) .Applied and Environmental Microbiology, 63:1095-1101.).

Be the loss of avoiding resistant insects to cause, seeking new high virulence gene resource is the effective way that addresses this problem, and this biological control to China has crucial meaning.

Summary of the invention

First purpose of the present invention is to provide a kind of new BT virulence protein resource at above-mentioned deficiency.

Second purpose of the present invention is to provide the gene of encoding said proteins.

The present invention also aims to provide the application of above-mentioned albumen and gene.

The present invention separates the new bacterial strain BtMC28 of the bacillus thuringiensis (Bacillus thuringiensis) that obtains from the soil of Muchuan, Sichuan Province virgin forest area.By the virulence test shows to BtMC28, BtMC28 all has high virulence to lepidoptera pest, Diptera pest or the like.According to 1 pair of special primer of cry4 genoid conserved sequence design, its genomic dna increases, the result shows that there is the cry4 genoid in this bacterial strain, further its full-length gene primer of design is cloned and is obtained the cry4Cc gene, and its nucleotide sequence is shown in sequence table SEQ ID No.1, total length is 3474bp, analysis revealed, GC content is 35.72%, the albumen that 11 57 amino acid of encoding are formed.After measured, its aminoacid sequence is shown in SEQ ID No.2.Adopt bacterial sigma7.0 promoter program that complete sequence is predicted in the softberry website and show, contain the sequence in RNA polymerase activation site in the gene coding region upstream, its called after cry4Cc1.The proteic amino acid of Cry4Cc1 is formed as table 1.

The proteic amino acid of table 1 Cry4Cc1 is formed

Amino acid	Per-cent %	Amino acid	Per-cent %
				Ala(A)：	5.53	?Met(M)：	2.07
Cys(C)：	1.21	?Asn(N)：	8.04
				Asp(D)：	5.53	?Pro(P)：	4.24
Glu(E)：	5.27	?Gln(Q)：	4.67
				Phe(F)：	3.46	?Arg(R)：	3.63

Gly(G)：	5.96	?Ser(S)：	6.83
				His(H)：	2.51	?Thr(T)：	8.38
Ile(I)：	5.88	?Val(V)：	5.70
				Lys(K)：	5.45	?Trp(W)：	1.21
Leu(L)：	8.99	?Tyr(Y)：	5.45

Should be appreciated that those skilled in the art can not influence under its active prerequisite according to aminoacid sequence disclosed by the invention, replace, lack and/or increase one or several amino acid, obtain described proteic mutant nucleotide sequence.For example, (1) (His) replaced with (Lys) at nonactive section.Therefore, Bt albumen of the present invention comprises that also aminoacid sequence shown in the SEQ ID No.2 is substituted, replaces and/or increases one or several amino acid, has the equal active protein of being derived and being obtained by Cry4Cc1 of Cry4Cc1 albumen.Gene of the present invention comprises the nucleic acids encoding said proteins sequence.

In addition, should be understood that the degeneracy of considering codon and the preferences of different plant species codon, those skilled in the art can use as required and be fit to the codon that specific species are expressed.

Gene of the present invention can be cloned or separate from bacterial strain BtMC28 with protein and be obtained, and perhaps obtains by DNA or peptide synthetic method.

Gene of the present invention can be operably connected with expression vector, obtain to express the proteic recombinant expression vector of the present invention, and then can pass through such as transgenic methods such as agrobacterium-mediated transformation, particle bombardment, pollen tube passage methods, described expression vector is imported the host, obtain changeing the transformant of cry4Cc1 gene, for example plant such as farm crop or fruit tree makes it possess anti-insect activity.

In addition, can also obtain containing the proteic fermented liquid of Cry4Cc1, it is prepared into sterilant, be used for the control of crop pests by fermentation bacterial strain BtMC28 of the present invention.Those skilled in the art can also be with said gene transform bacteria or fungi, by large scale fermentation production Bt albumen of the present invention.

Those skilled in the art can also with farm crop such as its converting cotton, corn, paddy rice, vegetables, make it possess corresponding anti-insect activity according to gene disclosed by the invention.Thereby reduce the usage quantity of agricultural chemicals, reduce environmental pollution, have important economic value and application prospect.

Description of drawings

Fig. 1 shows is the gel electrophoresis figure of the cry4Cc1 total length base that obtains of clone, M wherein, marker; 1, the cry4Cc1 gene.

Fig. 2 shows is that the enzyme of recombinant plasmid pET-4Cc is cut the evaluation collection of illustrative plates, wherein 1, and plasmid pET-4Cc; 2, the Nde I+EcoR I double digestion product of pET-30a; 3, the Nde I+EcoR I double digestion product of pET-4Cc; 4, the DNA of insertion; M1, λ-Hind III enzyme is cut product; M2, the DL2000 molecular weight standard.

What Fig. 3 showed is that the SDS-PAGE of cry4Cc1 gene in E.coli BL21 (DE3) detects figure; M. albumen marker wherein; 1. negative control E.coii BL21 (DE3) (pET-30a); 2.E.coii BL21 (DE3) is the lysate supernatant (pET-4Cc); 3. the cry4Cc1 albumen in the inclusion body.

Embodiment

Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.

If do not specialize the conventional means that used technique means is well known to those skilled in the art among the embodiment.

The clone of embodiment 1 cry4Cc1 gene

The present invention separates the new bacterial strain of the bacillus thuringiensis (Bacillus thuringiensis) that obtains from the soil of Muchuan, Sichuan Province virgin forest area, this bacterial strain on October 21st, 2008 at China Committee for Culture Collection of Microorganisms common micro-organisms center (address: No. 3, A, DaTun Road, Chaoyang District, BeiJing City, Institute of Microorganism, Academia Sinica, postcode 100101) preservation, classification called after bacillus thuringiensis (Bacillus thuringiensis), preserving number is CGMCC No.2719.

This example is cloned the full length sequence that obtains the cry4Cc1 gene by the following method.

Adopt genomic dna purification kit (available from match Parkson company) to extract total DNA of bacterial strain BtMC28.The design primer sequence is as follows:

P1：5’ATGAATTCATATCAAAATAAAAATG?3’

P2：5’TTACCCTTTCATACAAAGAAACTCG?3

The PCR reaction system:

10×buffer 2.5μl

MgCl ₂(25mM) 1.5μl

Taq enzyme 0.2 μ l

dNTPs(2.5mM) 2μl

Primer 2 μ l

Template 5 μ l

End reaction volume 25 μ l

Thermal cycle reaction: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 1min, annealing temperature is decided according to primer, and 72 ℃ are extended 2min, 30 circulations; 72 ℃ are extended 5min; 4 ℃ of stopped reaction.The amplified reaction product is electrophoresis on 1% sepharose, puts and observes the pcr amplification result in the gel imaging system.The result has obtained being about the sequence of 3500bp by amplification as shown in Figure 1, and this sequence is checked order, and its nucleotide sequence is shown in SEQ ID No.1, and is consistent with aim sequence.

Embodiment 2 cry4Cc1 expression of gene and insecticidal activity assays

According to cry4Cc1 gene open reading frame two terminal sequences, design and synthesize a pair of Auele Specific Primer cry4F:5 '-GCG CATATG(NdeI) ATGAATTCATATCAAAATAAAAATG-3 '; Cry4R:5 '-CG GAATTC(EcoR I) GCTCAAAGAAACATACTTTCCCATT-3 ' is respectively at 5 ' end primer Nde I and EcoR I restriction enzyme site.With the total DNA of BtMC28 is that template increases, response procedures and amplification condition are with embodiment 1, the product of amplification adopts Nde I and EcoR I to carry out double digestion, carrier pET-30a (+) after enzyme is cut product and carried out double digestion equally is connected, Transformed E .coli DH5 α competent cell, extract its plasmid enzyme restriction electrophoresis and verified that insertion segment size meets (Fig. 2) after the intended purposes, changes recipient bacterium E.coli.BL21 (DE3) again over to.With recombinant plasmid called after pET-4Cc, contain the recon called after E.coli.BL21 (4Cc) of recombinant plasmid.In the precipitation of SDS-PAGE analysis revealed cry4Cc1 expression of gene product after the thalline ultrasonication (Fig. 3), molecular weight is about about 130kDa, conforms to the molecular weight of albumen of prediction.

The cry4Cc1 gene expression product is respectively to beet armyworm, and the survey result that gives birth to of bollworm and yellow-fever mosquito shows (table 1): expression product all has insecticidal activity preferably to these three kinds of worms.The highest to the bollworm insecticidal activity, LC ₅₀Be 11.26 μ g/mL; LC to yellow-fever mosquito ₅₀Be 19.08 μ g/mL; Minimum to the beet armyworm insecticidal activity, LC ₅₀Be 35.20 μ g/mL.E.coli.BL21 (DE3) is as negative control, gives birth to survey the result and show, E.coli.BL21 (DE3) is not had an insecticidal activity to above three kinds of insects.

The insecticidal activity of table 1 Cry4Cc

Sequence table

＜110〉Sichuan Agricultural University

Plant Protection institute, Chinese Academy of Agricultral Sciences

＜120〉a kind of new Bt PROTEIN C ry4Cc1, its encoding gene and application

<130>KHP09112182.4

<160>6

<170>PatentIn?version?3.5

<210>1

<211>3474

<212>DNA

＜213〉Bacillus thuringiensis bacterial strain (Bacillus thuringiensis) BtMC28

<220>

<221>CDS

<222>(1)..(3474)

<400>1

atg?aat?tca?tat?caa?aat?aaa?aat?gaa?tat?gaa?ata?ttg?gat?gct?tca 48

Met?Asn?Ser?Tyr?Gln?Asn?Lys?Asn?Glu?Tyr?Glu?Ile?Leu?Asp?Ala?Ser

1 5 10 15

caa?aac?aac?tct?aat?atg?tct?aat?cgt?tat?caa?agg?tac?cca?cta?gca 96

Gln?Asn?Asn?Ser?Asn?Met?Ser?Asn?Arg?Tyr?Gln?Arg?Tyr?Pro?Leu?Ala

20 25 30

cat?aat?cca?caa?act?tct?ata?caa?act?acg?aat?tat?aag?gat?tgg?ctg 144

His?Asn?Pro?Gln?Thr?Ser?Ile?Gln?Thr?Thr?Asn?Tyr?Lys?Asp?Trp?Leu

35 40 45

aaa?atg?tgt?caa?aat?cct?cat?caa?aat?ccc?tta?gac?atg?gaa?ggg?tat 192

Lys?Met?Cys?Gln?Asn?Pro?His?Gln?Asn?Pro?Leu?Asp?Met?Glu?Gly?Tyr

50 55 60

gat?agt?aat?tca?gtc?gtt?gtg?gta?agt?aca?ggt?ttg?att?gtt?gtt?ggt 240

Asp?Ser?Asn?Ser?Val?Val?Val?Val?Ser?Thr?Gly?Leu?Ile?Val?Val?Gly

65 70 75 80

act?tta?att?agt?att?ttg?agt?gcg?gga?ttg?gga?tct?ata?cct?ata?att 288

Thr?Leu?Ile?Ser?Ile?Leu?Ser?Ala?Gly?Leu?Gly?SerIle?Pro?Ile?Ile

85 90 95

tat?ggt?act?tta?ttg?cct?gtt?cta?tgg?aac?gat?cca?aac?aat?ccg?caa 336

Tyr?Gly?Thr?Leu?Leu?Pro?Val?Leu?Trp?Asn?Asp?Pro?Asn?Asn?Pro?Gln

100 105 110

aaa?act?tgg?cat?gaa?ttt?atg?agt?cat?ggt?gaa?aca?ctt?ttg?aac?caa 384

Lys?Thr?Trp?His?Glu?Phe?Met?Ser?His?Gly?Glu?Thr?Leu?Leu?Asn?Gln

115 120 125

aca?ata?tca?aca?gtt?gag?agg?aat?aga?gca?gca?gcc?tat?ttg?gag?gga 432

Thr?Ile?Ser?Thr?Val?Glu?Arg?Asn?Arg?Ala?Ala?Ala?Tyr?Leu?Glu?Gly

130 135 140

tac?aca?aca?gca?gta?aaa?aat?gtg?aag?aag?cac?tta?aat?gtg?tgg?ctc 480

Tyr?Thr?Thr?Ala?Val?Lys?Asn?Val?Lys?Lys?His?Leu?Asn?Val?Trp?Leu

145 150 155 160

aca?gca?cca?aat?caa?gct?aat?gca?cga?aca?gta?gca?gat?tta?tac?aag 528

Thr?Ala?Pro?Asn?Gln?Ala?Asn?Ala?Arg?Thr?Val?Ala?Asp?Leu?Tyr?Lys

165 170 175

gac?act?gat?ttt?tta?ttt?ttc?aca?act?ttg?ccc?cat?ctt?aaa?ctt?cgt 576

Asp?Thr?Asp?Phe?Leu?Phe?Phe?Thr?Thr?Leu?Pro?His?Leu?Lys?Leu?Arg

180 185 190

gac?ttt?gag?aca?tta?ctt?ctg?agt?tct?tat?aca?caa?gct?gca?aat?atg 624

Asp?Phe?Glu?Thr?Leu?Leu?Leu?Ser?Ser?Tyr?Thr?Gln?Ala?Ala?Asn?Met

195 200 205

cat?tta?att?ttg?tta?aag?caa?gct?tca?aaa?tac?gct?gat?caa?tgg?aat 672

His?Leu?Ile?Leu?Leu?Lys?Gln?Ala?Ser?Lys?Tyr?Ala?Asp?Gln?Trp?Asn

210 215 220

gcc?caa?ctt?cct?gtc?tct?gtt?cgg?aaa?aca?gca?aac?gat?tat?tat?act 720

Ala?Gln?Leu?Pro?Val?Ser?Val?Arg?Lys?Thr?Ala?Asn?Asp?Tyr?Tyr?Thr

225 230 235 240

gat?tta?gta?aaa?ctg?ata?gga?gaa?tat?aca?gat?tat?tgt?atc?gca?acc 768

Asp?Leu?Val?Lys?Leu?Ile?Gly?Glu?Tyr?Thr?Asp?Tyr?Cys?Ile?Ala?Thr

245 250 255

tac?aga?tca?gga?tta?aat?aca?att?aaa?tct?aga?gct?act?tca?tgg?aat 816

Tyr?Arg?Ser?Gly?Leu?Asn?Thr?Ile?Lys?Ser?Arg?Ala?Thr?Ser?Trp?Asn

260 265 270

ata?tac?aat?atg?tat?cgt?aga?gag?atg?act?att?ttg?gtg?tta?gat?ctc 864

Ile?Tyr?Asn?Met?Tyr?Arg?Arg?Glu?Met?Thr?Ile?Leu?Val?Leu?Asp?Leu

275 280 285

gta?gct?ctt?ttc?cct?gca?tat?gat?att?aaa?aaa?tat?cct?agt?gga?act 912

Val?Ala?Leu?Phe?Pro?Ala?Tyr?Asp?Ile?Lys?Lys?Tyr?Pro?Ser?Gly?Thr

290 295 300

aaa?gta?gag?ctt?act?aga?gaa?att?tat?act?gat?gca?ctt?ggt?gct?gta 960

Lys?Val?Glu?Leu?Thr?Arg?Glu?Ile?Tyr?Thr?Asp?Ala?Leu?Gly?Ala?Val

305 310 315 320

gcg?att?cca?caa?aac?att?gat?gct?aca?gag?caa?ttg?gcg?acc?cgt?gcg 1008

Ala?Ile?Pro?Gln?Asn?Ile?Asp?Ala?Thr?Glu?Gln?Leu?Ala?Thr?Arg?Ala

325 330 335

cct?aat?tta?ttt?agt?tgg?tta?aag?ggc?ttt?aaa?ttt?att?acg?act?cag 1056

Pro?Asn?Leu?Phe?Ser?Trp?Leu?Lys?Gly?Phe?Lys?Phe?Ile?Thr?Thr?Gln

340 345 350

tca?aca?aat?agg?tat?tat?tta?tca?ggt?att?gcg?aat?cga?tat?agc?ttt 1104

Ser?Thr?Asn?Arg?Tyr?Tyr?Leu?Ser?Gly?Ile?Ala?Asn?Arg?Tyr?Ser?Phe

355 360 365

acc?aat?tct?aat?gga?gag?ata?tgg?ggg?cct?att?tct?ggg?aat?cct?act 1152

Thr?Asn?Ser?Asn?Gly?Glu?Ile?Trp?Gly?Pro?Ile?Ser?Gly?Asn?Pro?Thr

370 375 380

ggt?gta?tcg?tct?gat?tta?acc?ata?gat?aat?aat?ttt?tct?att?tac?aaa 1200

Gly?Val?Ser?Ser?Asp?Leu?Thr?Ile?Asp?Asn?Asn?Phe?Ser?Ile?Tyr?Lys

385 390 395 400

ctt?tca?ata?tta?cgt?ggt?tat?caa?ctc?tca?cca?gat?ttt?tca?ttt?cat 1248

Leu?Ser?Ile?Leu?Arg?Gly?Tyr?Gln?Leu?Ser?Pro?Asp?Phe?Ser?Phe?His

405 410 415

aat?cca?gtt?cac?caa?att?gat?ttt?tct?aca?acg?aat?aac?caa?cag?gga 1296

Asn?Pro?Val?His?Gln?Ile?Asp?Phe?Ser?Thr?Thr?Asn?Asn?Gln?Gln?Gly

420 425 430

cga?gtt?cag?tca?tat?aaa?tca?ggc?ggc?cct?act?cct?gtt?aat?ccg?gag 1344

Arg?Val?Gln?Ser?Tyr?Lys?Ser?Gly?Gly?Pro?Thr?Pro?Val?Asn?Pro?Glu

435 440 445

acg?aca?gct?att?cat?tta?ccg?ata?gat?tca?aaa?tgt?aca?caa?aac?tgt 1392

Thr?Thr?Ala?Ile?His?Leu?Pro?Ile?Asp?Ser?Lys?Cys?Thr?Gln?Asn?Cys

450 455 460

aat?cct?aca?ttt?aat?aat?tac?agt?cat?ata?tta?tct?tac?gca?aaa?act 1440

Asn?Pro?Thr?Phe?Asn?Asn?Tyr?Ser?His?Ile?Leu?Ser?Tyr?Ala?Lys?Thr

465 470 475 480

ttc?aca?tca?aat?tta?acc?att?ggt?acc?aca?tca?aat?atc?act?tcg?ttt 1488

Phe?Thr?Ser?Asn?Leu?Thr?Ile?Gly?Thr?Thr?Ser?Asn?Ile?Thr?Ser?Phe

485 490 495

ggt?tgg?acg?cat?aat?agt?gtg?gat?cgt?gaa?aat?aca?att?gat?tta?aat 1536

Gly?Trp?Thr?His?Asn?Ser?Val?Asp?Arg?Glu?Asn?Thr?Ile?Asp?Leu?Asn

500 505 510

aat?att?aca?cag?att?cca?gct?gta?aag?gcc?agt?caa?gtt?tat?cca?gaa 1584

Asn?Ile?Thr?Gln?Ile?Pro?Ala?Val?Lys?Ala?Ser?Gln?Val?Tyr?Pro?Glu

515 520 525

aac?tct?gta?att?aaa?ggt?cct?ggt?cat?aca?ggt?gga?aat?ctg?gtt?aga 1632

Asn?Ser?Val?Ile?Lys?Gly?Pro?Gly?His?Thr?Gly?Gly?Asn?Leu?Val?Arg

530 535 540

att?gat?agt?agt?ggt?tat?atg?tca?att?gtt?tgt?aaa?ttc?cca?cta?caa 1680

Ile?Asp?Ser?Ser?Gly?Tyr?Met?Ser?Ile?Val?Cys?Lys?Phe?Pro?Leu?Gln

545 550 555 560

gta?aag?gga?tgt?cgt?gtt?cgt?att?aga?tat?gca?gca?aat?aat?aga?gct 1728

Val?Lys?Gly?Cys?Arg?Val?Arg?Ile?Arg?Tyr?Ala?Ala?Asn?Asn?Arg?Ala

565 570 575

gaa?ctt?tat?ata?tcg?tca?gct?gga?aat?agt?cca?agt?aaa?aat?gtt?gat 1776

Glu?Leu?Tyr?Ile?Ser?Ser?Ala?Gly?Asn?Ser?Pro?Ser?Lys?Asn?Val?Asp

580 585 590

cta?gac?cct?aca?ttt?tca?ggt?act?aac?tat?gaa?agc?tta?aat?tat?aca 1824

Leu?Asp?Pro?Thr?Phe?Ser?Gly?Thr?Asn?Tyr?Glu?Ser?Leu?Asn?Tyr?Thr

595 600 605

aat?ttt?aaa?gat?aaa?gaa?act?gag?ttt?ata?ata?aca?gaa?gga?cag?ctc 1872

Asn?Phe?Lys?Asp?Lys?Glu?Thr?Glu?Phe?Ile?Ile?Thr?Glu?Gly?Gln?Leu

610 615 620

gtt?aaa?caa?tca?ata?ata?ttc?tca?acc?aat?gga?aat?gtt?ctc?ctg?gat 1920

Val?Lys?Gln?Ser?Ile?Ile?Phe?Ser?Thr?Asn?Gly?Asn?Val?Leu?Leu?Asp

625 630 635 640

aag?att?gaa?ttt?att?cca?ctg?gga?acg?aca?acc?tat?gag?tat?gaa?gag 1968

Lys?Ile?Glu?Phe?Ile?Pro?Leu?Gly?Thr?Thr?Thr?Tyr?Glu?Tyr?Glu?Glu

645 650 655

aag?cag?aat?cta?gaa?aaa?gcg?cag?aaa?gcg?ttg?aac?gct?ttg?ttt?acg 2016

Lys?Gln?Asn?Leu?Glu?Lys?Ala?Gln?Lys?Ala?Leu?Asn?Ala?Leu?Phe?Thr

660 665 670

gat?ggc?acg?aat?ggc?tat?cta?caa?atg?gat?gcc?act?gat?tat?gat?atc 2064

Asp?Gly?Thr?Asn?Gly?Tyr?Leu?Gln?Met?Asp?Ala?Thr?Asp?Tyr?Asp?Ile

675 680 685

aat?caa?act?gca?aac?tta?ata?gaa?tgt?gta?tca?gat?gaa?ttg?tat?gca 2112

Asn?Gln?Thr?Ala?Asn?Leu?Ile?Glu?Cys?Val?Ser?Asp?Glu?Leu?Tyr?Ala

690 695 700

aaa?gaa?aag?ata?gtt?tta?tta?gat?gaa?gtc?aaa?tat?gcg?aag?cgg?ctt 2160

Lys?Glu?Lys?Ile?Val?Leu?Leu?Asp?Glu?Val?Lys?Tyr?Ala?Lys?Arg?Leu

705 710 715 720

agc?ata?tca?cgt?aac?cta?ctt?ttg?aac?gat?gat?tta?gaa?ttt?tca?gat 2208

Ser?Ile?Ser?Arg?Asn?Leu?Leu?Leu?Asn?Asp?Asp?Leu?Glu?Phe?Ser?Asp

725 730 735

gga?ttt?gga?gaa?aac?gga?tgg?acg?aca?agt?gat?aat?att?tca?atc?cag 2256

Gly?Phe?Gly?Glu?Asn?Gly?Trp?Thr?Thr?Ser?Asp?Asn?Ile?Ser?Ile?Gln

740 745 750

gcg?gat?aat?ccc?ctt?ttt?aag?ggg?aat?tat?tta?aaa?atg?ttt?ggg?gca 2304

Ala?Asp?Asn?Pro?Leu?Phe?Lys?Gly?Asn?Tyr?Leu?Lys?Met?Phe?Gly?Ala

755 760 765

aga?gat?att?gat?gga?acc?cta?ttt?cca?act?tat?ctc?tat?caa?aaa?ata 2352

Arg?Asp?Ile?Asp?Gly?Thr?Leu?Phe?Pro?Thr?Tyr?Leu?Tyr?Gln?Lys?Ile

770 775 780

gat?gag?tcc?agg?tta?aaa?cca?tat?aca?cgt?tat?cga?gta?aga?ggg?ttt 2400

Asp?Glu?Ser?Arg?Leu?Lys?Pro?Tyr?Thr?Arg?Tyr?Arg?Val?Arg?Gly?Phe

785 790 795 800

gtg?gga?agt?agt?aaa?aat?cta?aaa?tta?gtg?gta?aca?cgc?tat?gag?aaa 2448

Val?Gly?Ser?Ser?Lys?Asn?Leu?Lys?Leu?Val?Val?Thr?Arg?Tyr?Glu?Lys

805 810 815

gaa?att?gat?gcc?att?atg?aat?gtt?cca?aat?gat?ttg?gca?cat?atg?cag 2496

Glu?Ile?Asp?Ala?Ile?Met?Asn?Val?Pro?Asn?Asp?Leu?Ala?His?Met?Gln

820 825 830

ctt?aac?cct?tca?tgt?gga?gat?tat?cgc?tgt?gaa?tca?tcg?tcc?cag?ttt 2544

Leu?Asn?Pro?Ser?Cys?Gly?Asp?Tyr?Arg?Cys?Glu?Ser?Ser?Ser?Gln?Phe

835 840 845

ttg?gtg?aac?caa?gtg?cat?cct?aca?cca?aca?gct?gga?tat?gct?cct?gat 2592

Leu?Val?Asn?Gln?Val?His?Pro?Thr?Pro?Thr?Ala?Gly?Tyr?Ala?Pro?Asp

850 855 860

atg?tat?gca?tgc?ccg?tca?aat?tca?gat?gaa?aaa?cat?gtt?atg?tgc?cac 2640

Met?Tyr?Ala?Cys?Pro?Ser?Asn?Ser?Asp?Glu?Lys?His?Val?Met?Cys?His

865 870 875 880

gat?cgt?cat?cca?ttt?gat?ttt?cat?att?gac?acc?gga?gaa?tta?aat?cca 2688

Asp?Arg?His?Pro?Phe?Asp?Phe?His?Ile?Asp?Thr?Gly?Glu?Leu?Asn?Pro

885 890 895

aac?aca?aat?ctg?ggt?att?gat?gtc?ttg?ttt?aaa?att?tct?aat?cca?aat 2736

Asn?Thr?Asn?Leu?Gly?Ile?Asp?Val?Leu?Phe?Lys?Ile?Ser?Asn?Pro?Asn

900 905 910

gga?tac?gct?aca?tta?ggg?aat?cta?gaa?gtc?att?gaa?gaa?gga?cca?cta 2784

Gly?Tyr?Ala?Thr?Leu?Gly?Asn?Leu?Glu?Val?Ile?Glu?Glu?Gly?Pro?Leu

915 920 925

aca?gat?gaa?gca?ttg?gta?cat?gta?aaa?caa?aag?gaa?aag?aaa?tgg?cgt 2832

Thr?Asp?Glu?Ala?Leu?Val?His?Val?Lys?Gln?Lys?Glu?Lys?Lys?Trp?Arg

930 935 940

cag?cac?atg?gag?aaa?aaa?cga?atg?gaa?aca?caa?caa?gcc?tat?gat?cca 2880

Gln?His?Met?Glu?Lys?Lys?Arg?Met?Glu?Thr?Gln?Gln?Ala?Tyr?Asp?Pro

945 950 955 960

gca?aaa?cag?gct?gta?gat?gca?tta?ttt?aca?aat?gaa?caa?gag?tta?cac 2928

Ala?Lys?Gln?Ala?Val?Asp?Ala?Leu?Phe?Thr?Asn?Glu?Gln?Glu?Leu?His

965 970 975

tat?cat?att?act?tta?gat?cat?att?caa?aat?gct?ggt?cgg?ctg?gta?cag 2976

Tyr?His?Ile?Thr?Leu?Asp?His?Ile?Gln?Asn?Ala?Gly?Arg?Leu?Val?Gln

980 985 990

ttg?att?cca?tat?gca?cac?cat?gct?tgg?tta?ctg?gat?gtt?cca?ggt?atg 3024

Leu?Ile?Pro?Tyr?Ala?His?His?Ala?Trp?Leu?Leu?Asp?Val?Pro?Gly?Met

995 1000 1005

aac?tat?gat?gta?tat?aca?gaa?tta?aac?gtg?cgt?ata?acg?caa?gct 3069

Asn?Tyr?Asp?Val?Tyr?Thr?Glu?Leu?Asn?Val?Arg?Ile?Thr?Gln?Ala

1010 1015 1020

cgt?tat?tta?tat?aag?gaa?cga?aat?gtc?ata?aca?aat?ggt?gac?ttt 3114

Arg?Tyr?Leu?Tyr?Lys?Glu?Arg?Asn?Val?Ile?Thr?Asn?Gly?Asp?Phe

1025 1030 1035

aca?caa?gga?tta?aca?gga?tgg?cag?gaa?aca?gga?aag?gca?acg?gta 3159

Thr?Gln?Gly?Leu?Thr?Gly?Trp?Gln?Glu?Thr?Gly?Lys?Ala?Thr?Val

1040 1045 1050

caa?cag?atg?gat?gga?gct?tct?gta?tta?gtt?ctg?tca?aac?tgg?agt 3204

Gln?Gln?Met?Asp?Gly?Ala?Ser?Val?Leu?Val?Leu?Ser?Asn?Trp?Ser

1055 1060 1065

gct?ggg?gta?tct?caa?aat?ctg?cat?gtc?caa?gat?cag?cat?ggc?tat 3249

Ala?Gly?Val?Ser?Gln?Asn?Leu?His?Val?Gln?Asp?Gln?His?Gly?Tyr

1070 1075 1080

gtg?tta?cgt?gtg?act?gca?aaa?aaa?gaa?ggt?cct?gga?aaa?ggg?tat 3294

Val?Leu?Arg?Val?Thr?Ala?Lys?Lys?Glu?Gly?Pro?Gly?Lys?Gly?Tyr

1085 1090 1095

gta?acg?atg?atg?gat?tgt?aat?gga?aag?cag?gaa?aca?ctt?agg?ttt 3339

Val?Thr?Met?Met?Asp?Cys?Asn?Gly?Lys?Gln?Glu?Thr?Leu?Arg?Phe

1100 1105 1110

act?tct?tgt?gaa?gaa?gga?tat?atg?aca?aaa?aca?gta?gag?gta?ttc 3384

Thr?Ser?Cys?Glu?Glu?Gly?Tyr?Met?Thr?Lys?Thr?Val?Glu?Val?Phe

1115 1120 1125

cca?gaa?agt?gat?cat?gta?cgg?att?gaa?atg?gga?gaa?acc?gaa?ggt 3429

Pro?Glu?Ser?Asp?His?Val?Arg?Ile?Glu?Met?Gly?Glu?Thr?Glu?Gly

1130 1135 1140

acg?ttt?tat?ata?gat?agc?atc?gag?ttt?ctt?tgt?atg?aaa?ggg?taa 3474

Thr?Phe?Tyr?Ile?Asp?Ser?Ile?Glu?Phe?Leu?Cys?Met?Lys?Gly

1145 1150 1155

<210>2

<211>1157

<212>PRT

＜213〉Bacillus thuringiensis bacterial strain (Bacillus thuringiensis) BtMC28

<400>2

Met?Asn?Ser?Tyr?Gln?Asn?Lys?Asn?Glu?Tyr?Glu?Ile?Leu?Asp?Ala?Ser

1 5 10 15

Gln?Asn?Asn?Ser?Asn?Met?Ser?Asn?Arg?Tyr?Gln?Arg?Tyr?Pro?Leu?Ala

20 25 30

His?Asn?Pro?Gln?Thr?Ser?Ile?Gln?Thr?Thr?Asn?Tyr?Lys?Asp?Trp?Leu

35 40 45

Lys?Met?Cys?Gln?Asn?Pro?His?Gln?Asn?Pro?Leu?Asp?Met?Glu?Gly?Tyr

50 55 60

Asp?Ser?Asn?Ser?Val?Val?Val?Val?Ser?Thr?Gly?Leu?Ile?Val?Val?Gly

65 70 75 80

Thr?Leu?Ile?Ser?Ile?Leu?Ser?Ala?Gly?Leu?Gly?Ser?Ile?Pro?Ile?Ile

85 90 95

Tyr?Gly?Thr?Leu?Leu?Pro?Val?Leu?Trp?Asn?Asp?Pro?Asn?Asn?Pro?Gln

100 105 110

Lys?Thr?Trp?His?Glu?Phe?Met?Ser?His?Gly?Glu?Thr?Leu?Leu?Asn?Gln

115 120 125

Thr?Ile?Ser?Thr?Val?Glu?Arg?Asn?Arg?Ala?Ala?Ala?Tyr?Leu?Glu?Gly

130 135 140

Tyr?Thr?Thr?Ala?Val?Lys?Asn?Val?Lys?Lys?His?Leu?Asn?Val?Trp?Leu

145 150 155 160

Thr?Ala?Pro?Asn?Gln?Ala?Asn?Ala?Arg?Thr?Val?Ala?Asp?Leu?Tyr?Lys

165 170 175

Asp?Thr?Asp?Phe?Leu?Phe?Phe?Thr?Thr?Leu?Pro?His?Leu?Lys?Leu?Arg

180 185 190

Asp?Phe?Glu?Thr?Leu?Leu?Leu?Ser?Ser?Tyr?Thr?Gln?Ala?Ala?Asn?Met

195 200 205

His?Leu?Ile?Leu?Leu?Lys?Gln?Ala?Ser?Lys?Tyr?Ala?Asp?Gln?Trp?Asn

210 215 220

Ala?Gln?Leu?Pro?Val?Ser?Val?Arg?Lys?Thr?Ala?Asn?Asp?Tyr?Tyr?Thr

225 230 235 240

Asp?Leu?Val?Lys?Leu?Ile?Gly?Glu?Tyr?Thr?Asp?Tyr?Cys?Ile?Ala?Thr

245 250 255

Tyr?Arg?Ser?Gly?Leu?Asn?Thr?Ile?Lys?Ser?Arg?Ala?Thr?Ser?Trp?Asn

260 265 270

Ile?Tyr?Asn?Met?Tyr?Arg?Arg?Glu?Met?Thr?Ile?Leu?Val?Leu?Asp?Leu

275 280 285

Val?Ala?Leu?Phe?Pro?Ala?Tyr?Asp?Ile?Lys?Lys?Tyr?Pro?Ser?Gly?Thr

290 295 300

Lys?Val?Glu?Leu?Thr?Arg?Glu?Ile?Tyr?Thr?Asp?Ala?Leu?Gly?Ala?Val

305 310 315 320

Ala?Ile?Pro?Gln?Asn?Ile?Asp?Ala?Thr?Glu?Gln?Leu?Ala?Thr?Arg?Ala

325 330 335

Pro?Asn?Leu?Phe?Ser?Trp?Leu?Lys?Gly?Phe?Lys?Phe?Ile?Thr?Thr?Gln

340 345 350

Ser?Thr?Asn?Arg?Tyr?Tyr?Leu?Ser?Gly?Ile?Ala?Asn?Arg?Tyr?Ser?Phe

355 360 365

Thr?Asn?Ser?Asn?Gly?Glu?Ile?Trp?Gly?Pro?Ile?Ser?Gly?Asn?Pro?Thr

370 375 380

Gly?Val?Ser?Ser?Asp?Leu?Thr?Ile?Asp?Asn?Asn?Phe?Ser?Ile?Tyr?Lys

385 390 395 400

Leu?Ser?Ile?Leu?Arg?Gly?Tyr?Gln?Leu?Ser?Pro?Asp?Phe?Ser?Phe?His

405 410 415

Asn?Pro?Val?His?Gln?Ile?Asp?Phe?Ser?Thr?Thr?Asn?Asn?Gln?Gln?Gly

420 425 430

Arg?Val?Gln?Ser?Tyr?Lys?Ser?Gly?Gly?Pro?Thr?Pro?Val?Asn?Pro?Glu

435 440 445

Thr?Thr?Ala?Ile?His?Leu?Pro?Ile?Asp?Ser?Lys?Cys?Thr?Gln?Asn?Cys

450 455 460

Asn?Pro?Thr?Phe?Asn?Asn?Tyr?Ser?His?Ile?Leu?Ser?Tyr?Ala?Lys?Thr

465 470 475 480

Phe?Thr?Ser?Asn?Leu?Thr?Ile?Gly?Thr?Thr?Ser?Asn?Ile?Thr?Ser?Phe

485 490 495

Gly?Trp?Thr?His?Asn?Ser?Val?Asp?Arg?Glu?Asn?Thr?Ile?Asp?Leu?Asn

500 505 510

Asn?Ile?Thr?Gln?Ile?Pro?Ala?Val?Lys?Ala?Ser?Gln?Val?Tyr?Pro?Glu

515 520 525

Asn?Ser?Val?Ile?Lys?Gly?Pro?Gly?His?Thr?Gly?Gly?Asn?Leu?Val?Arg

530 535 540

Ile?Asp?Ser?Ser?Gly?Tyr?Met?Ser?Ile?Val?Cys?Lys?Phe?Pro?Leu?Gln

545 550 555 560

Val?Lys?Gly?Cys?Arg?Val?Arg?Ile?Arg?Tyr?Ala?Ala?Asn?Asn?Arg?Ala

565 570 575

Glu?Leu?Tyr?Ile?Ser?Ser?Ala?Gly?Asn?Ser?Pro?Ser?Lys?Asn?Val?Asp

580 585 590

Leu?Asp?Pro?Thr?Phe?Ser?Gly?Thr?Asn?Tyr?Glu?Ser?Leu?Asn?Tyr?Thr

595 600 605

Asn?Phe?Lys?Asp?Lys?Glu?Thr?Glu?Phe?Ile?Ile?Thr?Glu?Gly?Gln?Leu

610 615 620

Val?Lys?Gln?Ser?Ile?Ile?Phe?Ser?Thr?Asn?Gly?Asn?Val?Leu?Leu?Asp

625 630 635 640

Lys?Ile?Glu?Phe?Ile?Pro?Leu?Gly?Thr?Thr?Thr?Tyr?Glu?Tyr?Glu?Glu

645 650 655

Lys?Gln?Asn?Leu?Glu?Lys?Ala?Gln?Lys?Ala?Leu?Asn?Ala?Leu?Phe?Thr

660 665 670

Asp?Gly?Thr?Asn?Gly?Tyr?Leu?Gln?Met?Asp?Ala?Thr?Asp?Tyr?Asp?Ile

675 680 685

Asn?Gln?Thr?Ala?Asn?Leu?Ile?Glu?Cys?Val?Ser?Asp?Glu?Leu?Tyr?Ala

690 695 700

Lys?Glu?Lys?Ile?Val?Leu?Leu?Asp?Glu?Val?Lys?Tyr?Ala?Lys?Arg?Leu

705 710 715 720

Ser?Ile?Ser?Arg?Asn?Leu?Leu?Leu?Asn?Asp?Asp?Leu?Glu?Phe?Ser?Asp

725 730 735

Gly?Phe?Gly?Glu?Asn?Gly?Trp?Thr?Thr?Ser?Asp?Asn?Ile?Ser?Ile?Gln

740 745 750

Ala?Asp?Asn?Pro?Leu?Phe?Lys?Gly?Asn?Tyr?Leu?Lys?Met?Phe?Gly?Ala

755 760 765

Arg?Asp?Ile?Asp?Gly?Thr?Leu?Phe?Pro?Thr?Tyr?Leu?Tyr?Gln?Lys?Ile

770 775 780

Asp?Glu?Ser?Arg?Leu?Lys?Pro?Tyr?Thr?Arg?Tyr?Arg?Val?Arg?Gly?Phe

785 790 795 800

Val?Gly?Ser?Ser?Lys?Asn?Leu?Lys?Leu?Val?Val?Thr?Arg?Tyr?Glu?Lys

805 810 815

Glu?Ile?Asp?Ala?Ile?Met?Asn?Val?Pro?Asn?Asp?Leu?Ala?His?Met?Gln

820 825 830

Leu?Asn?Pro?Ser?Cys?Gly?Asp?Tyr?Arg?Cys?Glu?Ser?Ser?Ser?Gln?Phe

835 840 845

Leu?Val?Asn?Gln?Val?His?Pro?Thr?Pro?Thr?Ala?Gly?Tyr?Ala?Pro?Asp

850 855 860

Met?Tyr?Ala?Cys?Pro?Ser?Asn?Ser?Asp?Glu?Lys?His?Val?Met?Cys?His

865 870 875 880

Asp?Arg?His?Pro?Phe?Asp?Phe?His?Ile?Asp?Thr?Gly?Glu?Leu?Asn?Pro

885 890 895

Asn?Thr?Asn?Leu?Gly?Ile?Asp?Val?Leu?Phe?Lys?Ile?Ser?Asn?Pro?Asn

900 905 910

Gly?Tyr?Ala?Thr?Leu?Gly?Asn?Leu?Glu?Val?Ile?Glu?Glu?Gly?Pro?Leu

915 920 925

Thr?Asp?Glu?Ala?Leu?Val?His?Val?Lys?Gln?Lys?Glu?Lys?Lys?Trp?Arg

930 935 940

Gln?His?Met?Glu?Lys?Lys?Arg?Met?Glu?Thr?Gln?Gln?Ala?Tyr?Asp?Pro

945 950 955 960

Ala?Lys?Gln?Ala?Val?Asp?Ala?Leu?Phe?Thr?Asn?Glu?Gln?Glu?Leu?His

965 970 975

Tyr?His?Ile?Thr?Leu?Asp?His?Ile?Gln?Asn?Ala?Gly?Arg?Leu?Val?Gln

980 985 990

Leu?Ile?Pro?Tyr?Ala?His?His?Ala?Trp?Leu?Leu?Asp?Val?Pro?Gly?Met

995 1000 1005

Asn?Tyr?Asp?Val?Tyr?Thr?Glu?Leu?Asn?Val?Arg?Ile?Thr?Gln?Ala

1010 1015 1020

Arg?Tyr?Leu?Tyr?Lys?Glu?Arg?Asn?Val?Ile?Thr?Asn?Gly?Asp?Phe

1025 1030 1035

Thr?Gln?Gly?Leu?Thr?Gly?Trp?Gln?Glu?Thr?Gly?Lys?Ala?Thr?Val

1040 1045 1050

Gln?Gln?Met?Asp?Gly?Ala?Ser?Val?Leu?Val?Leu?Ser?Asn?Trp?Ser

1055 1060 1065

Ala?Gly?Val?Ser?Gln?Asn?Leu?His?Val?Gln?Asp?Gln?His?Gly?Tyr

1070 1075 1080

Val?Leu?Arg?Val?Thr?Ala?Lys?Lys?Glu?Gly?Pro?Gly?Lys?Gly?Tyr

1085 1090 1095

Val?Thr?Met?Met?Asp?Cys?Asn?Gly?Lys?Gln?Glu?Thr?Leu?Arg?Phe

1100 1105 1110

Thr?Ser?Cys?Glu?Glu?Gly?Tyr?Met?Thr?Lys?Thr?Val?Glu?Val?Phe

1115 1120 1125

Pro?Glu?Ser?Asp?His?Val?Arg?Ile?Glu?Met?Gly?Glu?Thr?Glu?Gly

1130 1135 1140

Thr?Phe?Tyr?Ile?Asp?Ser?Ile?Glu?Phe?Leu?Cys?Met?Lys?Gly

1145 1150 1155

<210>3

<211>25

<212>DNA

＜213〉artificial sequence

<400>3

atgaattcat?atcaaaataa?aaatg 25

<210>4

<211>25

<212>DNA

＜213〉artificial sequence

<400>4

ttaccctttc?atacaaagaa?actcg 25

<210>5

<211>34

<212>DNA

＜213〉artificial sequence

<400>5

gcgcatatga?tgaattcata?tcaaaataaa?aatg 34

<210>6

<211>33

<212>DNA

＜213〉artificial sequence

<400>6

cggaattcgc?tcaaagaaac?atactttccc?att 33

Claims (9)

1. Bt PROTEIN C ry4Cc1, its aminoacid sequence is:

1) aminoacid sequence shown in the SEQ ID No.2; Or

2) aminoacid sequence shown in the SEQ ID No.2 is substituted, lacks and/or increases the aminoacid sequence that one or several amino acid and coding have equal activated protein.

2. coding claim 1 described proteic gene.

3. gene as claimed in claim 2, its nucleotide sequence is shown in SEQ ID No.1.

4. contain claim 2 or 3 described expression carrier.

5. by the described expression vector transformed host cells of claim 4.

6. host cell as claimed in claim 5, it is a plant host cell.

7. contain the described proteic sterilant of claim 1.

8. claim 2 or 3 described genes or the described expression vector of claim 4 application in the preparation transgenic plant.

9. claim 2 or 3 described genes or the described expression vector of claim 4 application in improving plant resistance to insect.

Images