CN101497658B - Novel Bt protein Cry4Cc1, coding gene thereof and use - Google Patents
Novel Bt protein Cry4Cc1, coding gene thereof and use Download PDFInfo
- Publication number
- CN101497658B CN101497658B CN2009100788983A CN200910078898A CN101497658B CN 101497658 B CN101497658 B CN 101497658B CN 2009100788983 A CN2009100788983 A CN 2009100788983A CN 200910078898 A CN200910078898 A CN 200910078898A CN 101497658 B CN101497658 B CN 101497658B
- Authority
- CN
- China
- Prior art keywords
- leu
- thr
- asn
- ser
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention provides a new Bt protein Cry4Cc1 and an encoding gene thereof. The protein has an amino acid sequence shown in an SEQ ID No.2 or has coordination activity after replacing, deleting and/or increasing one or more amino acids in the amino acid sequence shown in the SEQ ID No.2. The protein can be used for preparing the Bt pesticide, and the gene transformation can be performed to agricultural crops such as cotton, corn, rice, vegetables, and the like, so that the agricultural crops have the corresponding binding activities, therefore, the consumption of the pesticide and the environmental pollution are reduced, and the invention has the important economic value and application prospect.
Description
Technical field
The present invention relates to biological technical field, be specifically related to a kind of new Bt albumen and encoding gene and application.
Background technology
In the human being's production process, insect pest is the important factor that causes agriculture production loss and influence human health, adds up according to FAO, and the financial loss that whole world agriculture production every year causes because of insect pest is up to 14%, and disease is with a toll of 12%, and crop smothering is with a toll of 11%.The amount of loss is equivalent to half of the Chinese agriculture gross output value up to 1,260 hundred million dollars, more than 4 times of Britain.In addition, mosquito matchmaker disease is occupied critical positions in preventive medicine, wherein the sick transmissibility of mosquito such as singapore hemorrhagic fever and yellow jack matchmaker strong, popular wide, sickness rate is high, hazardness is big.According to the WHO statistics, the annual singapore hemorrhagic fever number that infects in the whole world reached 8,000 ten thousand, and Hainan Province of China once broke out twice singapore hemorrhagic fever in 1980 and 1986, and morbidity reaches 437469 example and 113589 examples respectively.Singapore hemorrhagic fever and yellow jack are mainly propagated by Aedes aegypti.
In order to reduce these losses, for many years, generally adopt the chemical prevention means to prevent and treat to crop pests and mosquito, but because the long-term, a large amount of of chemical pesticide use, caused the pollution to environment, pesticide residue increases in the agricultural byproducts, has brought harm for human existence and health.In addition, chemical pesticide has has also killed and wounded natural enemy and other useful thing in kill pests, destroyed the eubiosis.Compare safe, effective, persistent characteristics that biological control has with chemical prevention.And a series of problems of having avoided chemical prevention to bring.Therefore, biological control technology has become the focus of people's researchs.In biotic pesticide, bacillus thuringiensis is the quasi-microorganism sterilant that purposes is the widest in the world, output is maximum at present.
Bacillus thuringiensis (Bacillus thuringiensis, be called for short Bt) be a kind of gram positive bacterium, its distribution is very extensive, when forming, gemma can form the parasporal crystal of forming by protein with insecticidal activity, have another name called insecticidal crystal protein (Insectididal crystalproteins is called for short ICPs), ICPs is by the cry genes encoding, sensitive insect there is strong toxicity, and to higher animal and people's nontoxicity.In recent decades, Bt has been widely used in controlling insects such as multiple lepidopteran, Diptera, Coleoptera.In addition, Bt also has the effect of control evil to various pests such as Hymenoptera, Homoptera, Orthoptera, Mallophaga and plant pathogeny line insect, mite class, protozoon.At present Bt has become the strong substitute of chemical synthetic pesticide in the control of agricultural pests, injurious forest-insect and sanitary insect pest, and Bt still be that transgenic pest-resistant engineered plant important function of gene is originated.
(Adang M.J et al from Schnepf in 1981 has cloned first gene that can express insecticidal activity from strain HD-1Dipel since, Characterized full-length andtruncated plasmid clones of the crystal protein of Bacillus thuringiensissubsp.kurstaki HD-73 and their toxicity to Manduca sexta, Gene, 1985,36 (3): 289~300.), people separating clone the gene of more than 390 kind of coded insect-killing crystallin, they are defined as different groups respectively according to the amino acid sequence coded homology, subgroup, class and subclass (Crickmore N, Zeigler D R, Feitelson J, et al.Revision of the nomenclature for the Bacillus thuringiensis pesticidalcrystal proteins.Microbiol Mol Biol Rev, 1998,62:807-813; Http:// www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/).Generally speaking, Cry1, toxalbumin such as Cry2 and Cry9 are effective to lepidoptera pest; Wherein the maximum of research are Cry1 and Cry9 proteinoid, the insecticidal crystal protein molecular weight of their codings is 130-140kD, many genes have been widely used in the control (Kozie of the lepidoptera pest of plant at present, M.G., Beland, G.L., Bowman, C., et al.Field performance of elite transgenicmaize plants expressing an insecticidal protein derived from Bacillusthuringiensis.Bio/Technology, 1993,11:194-200; Perlak, F.J., Deaton, R.W., Armstrong, T.A., et al.Insect resistant cotton plants.bio/technology, 1990; 8:939-943; Van Frankenhuyzen, K., Gringorten, L., and Gauhier, D.1997.Cry9Cal toxin, a Bacillus thuringiensis insecticidal crystalprotein with high activity against the spruce bud worm (Choristoneurafnniferana) .Appl.Environ, Microbviol.63:4132-4134; Wang Fei, 2001, the research of bacillus thuringiensis specific strain biological characteristics and the new gene of cry9, Master's thesis, Nankai University).Tribactur Israel subclass (B.thuringiensis subsp.israelensis, abbreviation Bti) toxin protein that produces has fine insecticidal activity to mosquito, extensively applied to control (the Goldberg L J of mosquito, and Margalit J, 1977.A bacterialspore demonstrating rapid larvicidal activity against Anopheles sergentii, Uranotaenia unguiculata, Culex univitattus, Aedes aegypti, and Culexpipiens.Mosqito News, 37:355-358; ).Simultaneously, Cyt albumen has cytolytic, some Cry albumen is had synergism and delays the resistance (Wu of insect, D., Johnson, J.J., and Federici, B.A.1994.Synergism of mosquitocidal toxicity betweenCytA and CryIVD Proteins using inclusion sproduced from cloned genesof Bacillus thuringiensis.Mol.Microbiol.13:965-972; Wirth, M.C., Georghiou, G.P., and Federeci, B.A.1997.CytA enables CryIVendotoxins of Bacillus thuringiensis to overcome high levels of CryIVresistance in the mosquito, Culex quinquefasciatus.Proc.Natl.Acad.Sci.94:10536-10540)
Find the history in existing so far more than 100 year of Tribactur from the beginning of this century, aspect the preventing and treating of farm crop and gardening plant insect, injurious forest-insect and sanitary insect pest, be widely used, also play good effect.But owing to use Tribactur on a large scale and repeatedly, many insect populations are producing resistance to insecticidal crystal protein in succession in varying degrees.The history in existing more than 50 year of Utilization of pesticides based on the Bt insecticidal crystal protein, the initial resistance of insect that never detect to Bt, but, begin mid-term 80 year last century, resistance problem (the M cGaughey that constantly in laboratory and field test, is confirmed, W.H.1985.Insect resistance to the biological insecticide Bacillus thuringiensis.Science.229:193-195), reason mainly is continue to use single variety and inferiorly cause the Bt of dosage and the application of Bt transgenic anti-insect plants causes insect population to be subjected to the selective pressure of sterilant for a long time.1985, McGaughey report warehouse grain pest Indian meal moth (Plodia interpunctella) under the selective pressure of Dipel (the commodity preparation of Bt subsp.kurstaik HD-1), bred for 15 generations after, resistance increases by 97 times; Under the high dosage selective pressure, resistance can increase by 250 times.Nineteen ninety, the small cabbage moth that confirms big Tanaka in Hawaii has first produced tangible resistance (Tabashnik to the Bt sterilant, B.E., Finson, N., Groeters, F.R., et al.1994.Reversal of resistance to Bacillus thuringiensisin Plutella xylostella.Proc.Natl.Acad.Sci.USA.91:4120-4124), since the nineties in last century, use long Shenzhen of Bt sterilant time in China, Guangzhou, ground such as Shanghai, find that the Bt sterilant obviously descends to the small cabbage moth prevention effect, mean resistance form (Feng Xia .1996. Guangdong small cabbage moth is to the resistance research of Bacillus thuringiensis. insect journal, 39 (3): 238-244; Hofte, H., Van Rie, J., Jansens, S., Van Houtven, A., Vanderbruggen, H., and Vaeck, M., 1988.Monoclonal antibody analysis and insecticidal spectrum ofthree types of lepidopteran-specific insecticidal crystal proteins ofBacillus thuringiensis.Appl.Environ.Microbiol.54:2010-2017).Find at present in the laboratory and the field has at least tens kinds of insects that Bt and insecticidal crystal protein thereof have been produced resistance, arrive with the selective pressure mathematical model prediction, under the condition of Bt transgenic anti-insect plants selective pressure, insect will produce resistance (Schnepf, E., Crickmore, N., Van Pie, J., et al.1998.Bacillus thuringiensis and its pesticidal Crystalproteins.Microbiol.Mol.Biol.Rev.65 (3): 77 5-806).In addition, there are some researches prove that Bti does not find resistance problem (Regis L as yet in the use in land for growing field crops, et al., 2000.The useof bacterial larvicides in mosquito and black fly control programsinBrazil.Mem.Instituto Oswaldo Cruz, 95:207-210.), but mosquito constantly is confirmed in the laboratory to its resistance problem, this situation also may (Georghiou G P occur big Tanaka, and Wirth M C, 1997.Influence of exposure to singleversus multiple toxins of Bacillus thuringiensis subsp.israelensis ondevelopment of resistance in the mosquito Culex quinquefasciatus (Diptera:Culicidae) .Applied and Environmental Microbiology, 63:1095-1101.).
Be the loss of avoiding resistant insects to cause, seeking new high virulence gene resource is the effective way that addresses this problem, and this biological control to China has crucial meaning.
Summary of the invention
First purpose of the present invention is to provide a kind of new BT virulence protein resource at above-mentioned deficiency.
Second purpose of the present invention is to provide the gene of encoding said proteins.
The present invention also aims to provide the application of above-mentioned albumen and gene.
The present invention separates the new bacterial strain BtMC28 of the bacillus thuringiensis (Bacillus thuringiensis) that obtains from the soil of Muchuan, Sichuan Province virgin forest area.By the virulence test shows to BtMC28, BtMC28 all has high virulence to lepidoptera pest, Diptera pest or the like.According to 1 pair of special primer of cry4 genoid conserved sequence design, its genomic dna increases, the result shows that there is the cry4 genoid in this bacterial strain, further its full-length gene primer of design is cloned and is obtained the cry4Cc gene, and its nucleotide sequence is shown in sequence table SEQ ID No.1, total length is 3474bp, analysis revealed, GC content is 35.72%, the albumen that 11 57 amino acid of encoding are formed.After measured, its aminoacid sequence is shown in SEQ ID No.2.Adopt bacterial sigma7.0 promoter program that complete sequence is predicted in the softberry website and show, contain the sequence in RNA polymerase activation site in the gene coding region upstream, its called after cry4Cc1.The proteic amino acid of Cry4Cc1 is formed as table 1.
The proteic amino acid of table 1 Cry4Cc1 is formed
Amino acid | Per-cent % | Amino acid | Per-cent % |
Ala(A): | 5.53 | ?Met(M): | 2.07 |
Cys(C): | 1.21 | ?Asn(N): | 8.04 |
Asp(D): | 5.53 | ?Pro(P): | 4.24 |
Glu(E): | 5.27 | ?Gln(Q): | 4.67 |
Phe(F): | 3.46 | ?Arg(R): | 3.63 |
Gly(G): | 5.96 | ?Ser(S): | 6.83 |
His(H): | 2.51 | ?Thr(T): | 8.38 |
Ile(I): | 5.88 | ?Val(V): | 5.70 |
Lys(K): | 5.45 | ?Trp(W): | 1.21 |
Leu(L): | 8.99 | ?Tyr(Y): | 5.45 |
Should be appreciated that those skilled in the art can not influence under its active prerequisite according to aminoacid sequence disclosed by the invention, replace, lack and/or increase one or several amino acid, obtain described proteic mutant nucleotide sequence.For example, (1) (His) replaced with (Lys) at nonactive section.Therefore, Bt albumen of the present invention comprises that also aminoacid sequence shown in the SEQ ID No.2 is substituted, replaces and/or increases one or several amino acid, has the equal active protein of being derived and being obtained by Cry4Cc1 of Cry4Cc1 albumen.Gene of the present invention comprises the nucleic acids encoding said proteins sequence.
In addition, should be understood that the degeneracy of considering codon and the preferences of different plant species codon, those skilled in the art can use as required and be fit to the codon that specific species are expressed.
Gene of the present invention can be cloned or separate from bacterial strain BtMC28 with protein and be obtained, and perhaps obtains by DNA or peptide synthetic method.
Gene of the present invention can be operably connected with expression vector, obtain to express the proteic recombinant expression vector of the present invention, and then can pass through such as transgenic methods such as agrobacterium-mediated transformation, particle bombardment, pollen tube passage methods, described expression vector is imported the host, obtain changeing the transformant of cry4Cc1 gene, for example plant such as farm crop or fruit tree makes it possess anti-insect activity.
In addition, can also obtain containing the proteic fermented liquid of Cry4Cc1, it is prepared into sterilant, be used for the control of crop pests by fermentation bacterial strain BtMC28 of the present invention.Those skilled in the art can also be with said gene transform bacteria or fungi, by large scale fermentation production Bt albumen of the present invention.
Those skilled in the art can also with farm crop such as its converting cotton, corn, paddy rice, vegetables, make it possess corresponding anti-insect activity according to gene disclosed by the invention.Thereby reduce the usage quantity of agricultural chemicals, reduce environmental pollution, have important economic value and application prospect.
Description of drawings
Fig. 1 shows is the gel electrophoresis figure of the cry4Cc1 total length base that obtains of clone, M wherein, marker; 1, the cry4Cc1 gene.
Fig. 2 shows is that the enzyme of recombinant plasmid pET-4Cc is cut the evaluation collection of illustrative plates, wherein 1, and plasmid pET-4Cc; 2, the Nde I+EcoR I double digestion product of pET-30a; 3, the Nde I+EcoR I double digestion product of pET-4Cc; 4, the DNA of insertion; M1, λ-Hind III enzyme is cut product; M2, the DL2000 molecular weight standard.
What Fig. 3 showed is that the SDS-PAGE of cry4Cc1 gene in E.coli BL21 (DE3) detects figure; M. albumen marker wherein; 1. negative control E.coii BL21 (DE3) (pET-30a); 2.E.coii BL21 (DE3) is the lysate supernatant (pET-4Cc); 3. the cry4Cc1 albumen in the inclusion body.
Embodiment
Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.
If do not specialize the conventional means that used technique means is well known to those skilled in the art among the embodiment.
The clone of embodiment 1 cry4Cc1 gene
The present invention separates the new bacterial strain of the bacillus thuringiensis (Bacillus thuringiensis) that obtains from the soil of Muchuan, Sichuan Province virgin forest area, this bacterial strain on October 21st, 2008 at China Committee for Culture Collection of Microorganisms common micro-organisms center (address: No. 3, A, DaTun Road, Chaoyang District, BeiJing City, Institute of Microorganism, Academia Sinica, postcode 100101) preservation, classification called after bacillus thuringiensis (Bacillus thuringiensis), preserving number is CGMCC No.2719.
This example is cloned the full length sequence that obtains the cry4Cc1 gene by the following method.
Adopt genomic dna purification kit (available from match Parkson company) to extract total DNA of bacterial strain BtMC28.The design primer sequence is as follows:
P1:5’ATGAATTCATATCAAAATAAAAATG?3’
P2:5’TTACCCTTTCATACAAAGAAACTCG?3
The PCR reaction system:
10×buffer 2.5μl
MgCl
2(25mM) 1.5μl
Taq enzyme 0.2 μ l
dNTPs(2.5mM) 2μl
Primer 2 μ l
End reaction volume 25 μ l
Thermal cycle reaction: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 1min, annealing temperature is decided according to primer, and 72 ℃ are extended 2min, 30 circulations; 72 ℃ are extended 5min; 4 ℃ of stopped reaction.The amplified reaction product is electrophoresis on 1% sepharose, puts and observes the pcr amplification result in the gel imaging system.The result has obtained being about the sequence of 3500bp by amplification as shown in Figure 1, and this sequence is checked order, and its nucleotide sequence is shown in SEQ ID No.1, and is consistent with aim sequence.
According to cry4Cc1 gene open reading frame two terminal sequences, design and synthesize a pair of Auele Specific Primer cry4F:5 '-GCG
CATATG(NdeI) ATGAATTCATATCAAAATAAAAATG-3 '; Cry4R:5 '-CG
GAATTC(EcoR I) GCTCAAAGAAACATACTTTCCCATT-3 ' is respectively at 5 ' end primer Nde I and EcoR I restriction enzyme site.With the total DNA of BtMC28 is that template increases, response procedures and amplification condition are with embodiment 1, the product of amplification adopts Nde I and EcoR I to carry out double digestion, carrier pET-30a (+) after enzyme is cut product and carried out double digestion equally is connected, Transformed E .coli DH5 α competent cell, extract its plasmid enzyme restriction electrophoresis and verified that insertion segment size meets (Fig. 2) after the intended purposes, changes recipient bacterium E.coli.BL21 (DE3) again over to.With recombinant plasmid called after pET-4Cc, contain the recon called after E.coli.BL21 (4Cc) of recombinant plasmid.In the precipitation of SDS-PAGE analysis revealed cry4Cc1 expression of gene product after the thalline ultrasonication (Fig. 3), molecular weight is about about 130kDa, conforms to the molecular weight of albumen of prediction.
The cry4Cc1 gene expression product is respectively to beet armyworm, and the survey result that gives birth to of bollworm and yellow-fever mosquito shows (table 1): expression product all has insecticidal activity preferably to these three kinds of worms.The highest to the bollworm insecticidal activity, LC
50Be 11.26 μ g/mL; LC to yellow-fever mosquito
50Be 19.08 μ g/mL; Minimum to the beet armyworm insecticidal activity, LC
50Be 35.20 μ g/mL.E.coli.BL21 (DE3) is as negative control, gives birth to survey the result and show, E.coli.BL21 (DE3) is not had an insecticidal activity to above three kinds of insects.
The insecticidal activity of table 1 Cry4Cc
Sequence table
<110〉Sichuan Agricultural University
Plant Protection institute, Chinese Academy of Agricultral Sciences
<120〉a kind of new Bt PROTEIN C ry4Cc1, its encoding gene and application
<130>KHP09112182.4
<160>6
<170>PatentIn?version?3.5
<210>1
<211>3474
<212>DNA
<213〉Bacillus thuringiensis bacterial strain (Bacillus thuringiensis) BtMC28
<220>
<221>CDS
<222>(1)..(3474)
<400>1
atg?aat?tca?tat?caa?aat?aaa?aat?gaa?tat?gaa?ata?ttg?gat?gct?tca 48
Met?Asn?Ser?Tyr?Gln?Asn?Lys?Asn?Glu?Tyr?Glu?Ile?Leu?Asp?Ala?Ser
1 5 10 15
caa?aac?aac?tct?aat?atg?tct?aat?cgt?tat?caa?agg?tac?cca?cta?gca 96
Gln?Asn?Asn?Ser?Asn?Met?Ser?Asn?Arg?Tyr?Gln?Arg?Tyr?Pro?Leu?Ala
20 25 30
cat?aat?cca?caa?act?tct?ata?caa?act?acg?aat?tat?aag?gat?tgg?ctg 144
His?Asn?Pro?Gln?Thr?Ser?Ile?Gln?Thr?Thr?Asn?Tyr?Lys?Asp?Trp?Leu
35 40 45
aaa?atg?tgt?caa?aat?cct?cat?caa?aat?ccc?tta?gac?atg?gaa?ggg?tat 192
Lys?Met?Cys?Gln?Asn?Pro?His?Gln?Asn?Pro?Leu?Asp?Met?Glu?Gly?Tyr
50 55 60
gat?agt?aat?tca?gtc?gtt?gtg?gta?agt?aca?ggt?ttg?att?gtt?gtt?ggt 240
Asp?Ser?Asn?Ser?Val?Val?Val?Val?Ser?Thr?Gly?Leu?Ile?Val?Val?Gly
65 70 75 80
act?tta?att?agt?att?ttg?agt?gcg?gga?ttg?gga?tct?ata?cct?ata?att 288
Thr?Leu?Ile?Ser?Ile?Leu?Ser?Ala?Gly?Leu?Gly?SerIle?Pro?Ile?Ile
85 90 95
tat?ggt?act?tta?ttg?cct?gtt?cta?tgg?aac?gat?cca?aac?aat?ccg?caa 336
Tyr?Gly?Thr?Leu?Leu?Pro?Val?Leu?Trp?Asn?Asp?Pro?Asn?Asn?Pro?Gln
100 105 110
aaa?act?tgg?cat?gaa?ttt?atg?agt?cat?ggt?gaa?aca?ctt?ttg?aac?caa 384
Lys?Thr?Trp?His?Glu?Phe?Met?Ser?His?Gly?Glu?Thr?Leu?Leu?Asn?Gln
115 120 125
aca?ata?tca?aca?gtt?gag?agg?aat?aga?gca?gca?gcc?tat?ttg?gag?gga 432
Thr?Ile?Ser?Thr?Val?Glu?Arg?Asn?Arg?Ala?Ala?Ala?Tyr?Leu?Glu?Gly
130 135 140
tac?aca?aca?gca?gta?aaa?aat?gtg?aag?aag?cac?tta?aat?gtg?tgg?ctc 480
Tyr?Thr?Thr?Ala?Val?Lys?Asn?Val?Lys?Lys?His?Leu?Asn?Val?Trp?Leu
145 150 155 160
aca?gca?cca?aat?caa?gct?aat?gca?cga?aca?gta?gca?gat?tta?tac?aag 528
Thr?Ala?Pro?Asn?Gln?Ala?Asn?Ala?Arg?Thr?Val?Ala?Asp?Leu?Tyr?Lys
165 170 175
gac?act?gat?ttt?tta?ttt?ttc?aca?act?ttg?ccc?cat?ctt?aaa?ctt?cgt 576
Asp?Thr?Asp?Phe?Leu?Phe?Phe?Thr?Thr?Leu?Pro?His?Leu?Lys?Leu?Arg
180 185 190
gac?ttt?gag?aca?tta?ctt?ctg?agt?tct?tat?aca?caa?gct?gca?aat?atg 624
Asp?Phe?Glu?Thr?Leu?Leu?Leu?Ser?Ser?Tyr?Thr?Gln?Ala?Ala?Asn?Met
195 200 205
cat?tta?att?ttg?tta?aag?caa?gct?tca?aaa?tac?gct?gat?caa?tgg?aat 672
His?Leu?Ile?Leu?Leu?Lys?Gln?Ala?Ser?Lys?Tyr?Ala?Asp?Gln?Trp?Asn
210 215 220
gcc?caa?ctt?cct?gtc?tct?gtt?cgg?aaa?aca?gca?aac?gat?tat?tat?act 720
Ala?Gln?Leu?Pro?Val?Ser?Val?Arg?Lys?Thr?Ala?Asn?Asp?Tyr?Tyr?Thr
225 230 235 240
gat?tta?gta?aaa?ctg?ata?gga?gaa?tat?aca?gat?tat?tgt?atc?gca?acc 768
Asp?Leu?Val?Lys?Leu?Ile?Gly?Glu?Tyr?Thr?Asp?Tyr?Cys?Ile?Ala?Thr
245 250 255
tac?aga?tca?gga?tta?aat?aca?att?aaa?tct?aga?gct?act?tca?tgg?aat 816
Tyr?Arg?Ser?Gly?Leu?Asn?Thr?Ile?Lys?Ser?Arg?Ala?Thr?Ser?Trp?Asn
260 265 270
ata?tac?aat?atg?tat?cgt?aga?gag?atg?act?att?ttg?gtg?tta?gat?ctc 864
Ile?Tyr?Asn?Met?Tyr?Arg?Arg?Glu?Met?Thr?Ile?Leu?Val?Leu?Asp?Leu
275 280 285
gta?gct?ctt?ttc?cct?gca?tat?gat?att?aaa?aaa?tat?cct?agt?gga?act 912
Val?Ala?Leu?Phe?Pro?Ala?Tyr?Asp?Ile?Lys?Lys?Tyr?Pro?Ser?Gly?Thr
290 295 300
aaa?gta?gag?ctt?act?aga?gaa?att?tat?act?gat?gca?ctt?ggt?gct?gta 960
Lys?Val?Glu?Leu?Thr?Arg?Glu?Ile?Tyr?Thr?Asp?Ala?Leu?Gly?Ala?Val
305 310 315 320
gcg?att?cca?caa?aac?att?gat?gct?aca?gag?caa?ttg?gcg?acc?cgt?gcg 1008
Ala?Ile?Pro?Gln?Asn?Ile?Asp?Ala?Thr?Glu?Gln?Leu?Ala?Thr?Arg?Ala
325 330 335
cct?aat?tta?ttt?agt?tgg?tta?aag?ggc?ttt?aaa?ttt?att?acg?act?cag 1056
Pro?Asn?Leu?Phe?Ser?Trp?Leu?Lys?Gly?Phe?Lys?Phe?Ile?Thr?Thr?Gln
340 345 350
tca?aca?aat?agg?tat?tat?tta?tca?ggt?att?gcg?aat?cga?tat?agc?ttt 1104
Ser?Thr?Asn?Arg?Tyr?Tyr?Leu?Ser?Gly?Ile?Ala?Asn?Arg?Tyr?Ser?Phe
355 360 365
acc?aat?tct?aat?gga?gag?ata?tgg?ggg?cct?att?tct?ggg?aat?cct?act 1152
Thr?Asn?Ser?Asn?Gly?Glu?Ile?Trp?Gly?Pro?Ile?Ser?Gly?Asn?Pro?Thr
370 375 380
ggt?gta?tcg?tct?gat?tta?acc?ata?gat?aat?aat?ttt?tct?att?tac?aaa 1200
Gly?Val?Ser?Ser?Asp?Leu?Thr?Ile?Asp?Asn?Asn?Phe?Ser?Ile?Tyr?Lys
385 390 395 400
ctt?tca?ata?tta?cgt?ggt?tat?caa?ctc?tca?cca?gat?ttt?tca?ttt?cat 1248
Leu?Ser?Ile?Leu?Arg?Gly?Tyr?Gln?Leu?Ser?Pro?Asp?Phe?Ser?Phe?His
405 410 415
aat?cca?gtt?cac?caa?att?gat?ttt?tct?aca?acg?aat?aac?caa?cag?gga 1296
Asn?Pro?Val?His?Gln?Ile?Asp?Phe?Ser?Thr?Thr?Asn?Asn?Gln?Gln?Gly
420 425 430
cga?gtt?cag?tca?tat?aaa?tca?ggc?ggc?cct?act?cct?gtt?aat?ccg?gag 1344
Arg?Val?Gln?Ser?Tyr?Lys?Ser?Gly?Gly?Pro?Thr?Pro?Val?Asn?Pro?Glu
435 440 445
acg?aca?gct?att?cat?tta?ccg?ata?gat?tca?aaa?tgt?aca?caa?aac?tgt 1392
Thr?Thr?Ala?Ile?His?Leu?Pro?Ile?Asp?Ser?Lys?Cys?Thr?Gln?Asn?Cys
450 455 460
aat?cct?aca?ttt?aat?aat?tac?agt?cat?ata?tta?tct?tac?gca?aaa?act 1440
Asn?Pro?Thr?Phe?Asn?Asn?Tyr?Ser?His?Ile?Leu?Ser?Tyr?Ala?Lys?Thr
465 470 475 480
ttc?aca?tca?aat?tta?acc?att?ggt?acc?aca?tca?aat?atc?act?tcg?ttt 1488
Phe?Thr?Ser?Asn?Leu?Thr?Ile?Gly?Thr?Thr?Ser?Asn?Ile?Thr?Ser?Phe
485 490 495
ggt?tgg?acg?cat?aat?agt?gtg?gat?cgt?gaa?aat?aca?att?gat?tta?aat 1536
Gly?Trp?Thr?His?Asn?Ser?Val?Asp?Arg?Glu?Asn?Thr?Ile?Asp?Leu?Asn
500 505 510
aat?att?aca?cag?att?cca?gct?gta?aag?gcc?agt?caa?gtt?tat?cca?gaa 1584
Asn?Ile?Thr?Gln?Ile?Pro?Ala?Val?Lys?Ala?Ser?Gln?Val?Tyr?Pro?Glu
515 520 525
aac?tct?gta?att?aaa?ggt?cct?ggt?cat?aca?ggt?gga?aat?ctg?gtt?aga 1632
Asn?Ser?Val?Ile?Lys?Gly?Pro?Gly?His?Thr?Gly?Gly?Asn?Leu?Val?Arg
530 535 540
att?gat?agt?agt?ggt?tat?atg?tca?att?gtt?tgt?aaa?ttc?cca?cta?caa 1680
Ile?Asp?Ser?Ser?Gly?Tyr?Met?Ser?Ile?Val?Cys?Lys?Phe?Pro?Leu?Gln
545 550 555 560
gta?aag?gga?tgt?cgt?gtt?cgt?att?aga?tat?gca?gca?aat?aat?aga?gct 1728
Val?Lys?Gly?Cys?Arg?Val?Arg?Ile?Arg?Tyr?Ala?Ala?Asn?Asn?Arg?Ala
565 570 575
gaa?ctt?tat?ata?tcg?tca?gct?gga?aat?agt?cca?agt?aaa?aat?gtt?gat 1776
Glu?Leu?Tyr?Ile?Ser?Ser?Ala?Gly?Asn?Ser?Pro?Ser?Lys?Asn?Val?Asp
580 585 590
cta?gac?cct?aca?ttt?tca?ggt?act?aac?tat?gaa?agc?tta?aat?tat?aca 1824
Leu?Asp?Pro?Thr?Phe?Ser?Gly?Thr?Asn?Tyr?Glu?Ser?Leu?Asn?Tyr?Thr
595 600 605
aat?ttt?aaa?gat?aaa?gaa?act?gag?ttt?ata?ata?aca?gaa?gga?cag?ctc 1872
Asn?Phe?Lys?Asp?Lys?Glu?Thr?Glu?Phe?Ile?Ile?Thr?Glu?Gly?Gln?Leu
610 615 620
gtt?aaa?caa?tca?ata?ata?ttc?tca?acc?aat?gga?aat?gtt?ctc?ctg?gat 1920
Val?Lys?Gln?Ser?Ile?Ile?Phe?Ser?Thr?Asn?Gly?Asn?Val?Leu?Leu?Asp
625 630 635 640
aag?att?gaa?ttt?att?cca?ctg?gga?acg?aca?acc?tat?gag?tat?gaa?gag 1968
Lys?Ile?Glu?Phe?Ile?Pro?Leu?Gly?Thr?Thr?Thr?Tyr?Glu?Tyr?Glu?Glu
645 650 655
aag?cag?aat?cta?gaa?aaa?gcg?cag?aaa?gcg?ttg?aac?gct?ttg?ttt?acg 2016
Lys?Gln?Asn?Leu?Glu?Lys?Ala?Gln?Lys?Ala?Leu?Asn?Ala?Leu?Phe?Thr
660 665 670
gat?ggc?acg?aat?ggc?tat?cta?caa?atg?gat?gcc?act?gat?tat?gat?atc 2064
Asp?Gly?Thr?Asn?Gly?Tyr?Leu?Gln?Met?Asp?Ala?Thr?Asp?Tyr?Asp?Ile
675 680 685
aat?caa?act?gca?aac?tta?ata?gaa?tgt?gta?tca?gat?gaa?ttg?tat?gca 2112
Asn?Gln?Thr?Ala?Asn?Leu?Ile?Glu?Cys?Val?Ser?Asp?Glu?Leu?Tyr?Ala
690 695 700
aaa?gaa?aag?ata?gtt?tta?tta?gat?gaa?gtc?aaa?tat?gcg?aag?cgg?ctt 2160
Lys?Glu?Lys?Ile?Val?Leu?Leu?Asp?Glu?Val?Lys?Tyr?Ala?Lys?Arg?Leu
705 710 715 720
agc?ata?tca?cgt?aac?cta?ctt?ttg?aac?gat?gat?tta?gaa?ttt?tca?gat 2208
Ser?Ile?Ser?Arg?Asn?Leu?Leu?Leu?Asn?Asp?Asp?Leu?Glu?Phe?Ser?Asp
725 730 735
gga?ttt?gga?gaa?aac?gga?tgg?acg?aca?agt?gat?aat?att?tca?atc?cag 2256
Gly?Phe?Gly?Glu?Asn?Gly?Trp?Thr?Thr?Ser?Asp?Asn?Ile?Ser?Ile?Gln
740 745 750
gcg?gat?aat?ccc?ctt?ttt?aag?ggg?aat?tat?tta?aaa?atg?ttt?ggg?gca 2304
Ala?Asp?Asn?Pro?Leu?Phe?Lys?Gly?Asn?Tyr?Leu?Lys?Met?Phe?Gly?Ala
755 760 765
aga?gat?att?gat?gga?acc?cta?ttt?cca?act?tat?ctc?tat?caa?aaa?ata 2352
Arg?Asp?Ile?Asp?Gly?Thr?Leu?Phe?Pro?Thr?Tyr?Leu?Tyr?Gln?Lys?Ile
770 775 780
gat?gag?tcc?agg?tta?aaa?cca?tat?aca?cgt?tat?cga?gta?aga?ggg?ttt 2400
Asp?Glu?Ser?Arg?Leu?Lys?Pro?Tyr?Thr?Arg?Tyr?Arg?Val?Arg?Gly?Phe
785 790 795 800
gtg?gga?agt?agt?aaa?aat?cta?aaa?tta?gtg?gta?aca?cgc?tat?gag?aaa 2448
Val?Gly?Ser?Ser?Lys?Asn?Leu?Lys?Leu?Val?Val?Thr?Arg?Tyr?Glu?Lys
805 810 815
gaa?att?gat?gcc?att?atg?aat?gtt?cca?aat?gat?ttg?gca?cat?atg?cag 2496
Glu?Ile?Asp?Ala?Ile?Met?Asn?Val?Pro?Asn?Asp?Leu?Ala?His?Met?Gln
820 825 830
ctt?aac?cct?tca?tgt?gga?gat?tat?cgc?tgt?gaa?tca?tcg?tcc?cag?ttt 2544
Leu?Asn?Pro?Ser?Cys?Gly?Asp?Tyr?Arg?Cys?Glu?Ser?Ser?Ser?Gln?Phe
835 840 845
ttg?gtg?aac?caa?gtg?cat?cct?aca?cca?aca?gct?gga?tat?gct?cct?gat 2592
Leu?Val?Asn?Gln?Val?His?Pro?Thr?Pro?Thr?Ala?Gly?Tyr?Ala?Pro?Asp
850 855 860
atg?tat?gca?tgc?ccg?tca?aat?tca?gat?gaa?aaa?cat?gtt?atg?tgc?cac 2640
Met?Tyr?Ala?Cys?Pro?Ser?Asn?Ser?Asp?Glu?Lys?His?Val?Met?Cys?His
865 870 875 880
gat?cgt?cat?cca?ttt?gat?ttt?cat?att?gac?acc?gga?gaa?tta?aat?cca 2688
Asp?Arg?His?Pro?Phe?Asp?Phe?His?Ile?Asp?Thr?Gly?Glu?Leu?Asn?Pro
885 890 895
aac?aca?aat?ctg?ggt?att?gat?gtc?ttg?ttt?aaa?att?tct?aat?cca?aat 2736
Asn?Thr?Asn?Leu?Gly?Ile?Asp?Val?Leu?Phe?Lys?Ile?Ser?Asn?Pro?Asn
900 905 910
gga?tac?gct?aca?tta?ggg?aat?cta?gaa?gtc?att?gaa?gaa?gga?cca?cta 2784
Gly?Tyr?Ala?Thr?Leu?Gly?Asn?Leu?Glu?Val?Ile?Glu?Glu?Gly?Pro?Leu
915 920 925
aca?gat?gaa?gca?ttg?gta?cat?gta?aaa?caa?aag?gaa?aag?aaa?tgg?cgt 2832
Thr?Asp?Glu?Ala?Leu?Val?His?Val?Lys?Gln?Lys?Glu?Lys?Lys?Trp?Arg
930 935 940
cag?cac?atg?gag?aaa?aaa?cga?atg?gaa?aca?caa?caa?gcc?tat?gat?cca 2880
Gln?His?Met?Glu?Lys?Lys?Arg?Met?Glu?Thr?Gln?Gln?Ala?Tyr?Asp?Pro
945 950 955 960
gca?aaa?cag?gct?gta?gat?gca?tta?ttt?aca?aat?gaa?caa?gag?tta?cac 2928
Ala?Lys?Gln?Ala?Val?Asp?Ala?Leu?Phe?Thr?Asn?Glu?Gln?Glu?Leu?His
965 970 975
tat?cat?att?act?tta?gat?cat?att?caa?aat?gct?ggt?cgg?ctg?gta?cag 2976
Tyr?His?Ile?Thr?Leu?Asp?His?Ile?Gln?Asn?Ala?Gly?Arg?Leu?Val?Gln
980 985 990
ttg?att?cca?tat?gca?cac?cat?gct?tgg?tta?ctg?gat?gtt?cca?ggt?atg 3024
Leu?Ile?Pro?Tyr?Ala?His?His?Ala?Trp?Leu?Leu?Asp?Val?Pro?Gly?Met
995 1000 1005
aac?tat?gat?gta?tat?aca?gaa?tta?aac?gtg?cgt?ata?acg?caa?gct 3069
Asn?Tyr?Asp?Val?Tyr?Thr?Glu?Leu?Asn?Val?Arg?Ile?Thr?Gln?Ala
1010 1015 1020
cgt?tat?tta?tat?aag?gaa?cga?aat?gtc?ata?aca?aat?ggt?gac?ttt 3114
Arg?Tyr?Leu?Tyr?Lys?Glu?Arg?Asn?Val?Ile?Thr?Asn?Gly?Asp?Phe
1025 1030 1035
aca?caa?gga?tta?aca?gga?tgg?cag?gaa?aca?gga?aag?gca?acg?gta 3159
Thr?Gln?Gly?Leu?Thr?Gly?Trp?Gln?Glu?Thr?Gly?Lys?Ala?Thr?Val
1040 1045 1050
caa?cag?atg?gat?gga?gct?tct?gta?tta?gtt?ctg?tca?aac?tgg?agt 3204
Gln?Gln?Met?Asp?Gly?Ala?Ser?Val?Leu?Val?Leu?Ser?Asn?Trp?Ser
1055 1060 1065
gct?ggg?gta?tct?caa?aat?ctg?cat?gtc?caa?gat?cag?cat?ggc?tat 3249
Ala?Gly?Val?Ser?Gln?Asn?Leu?His?Val?Gln?Asp?Gln?His?Gly?Tyr
1070 1075 1080
gtg?tta?cgt?gtg?act?gca?aaa?aaa?gaa?ggt?cct?gga?aaa?ggg?tat 3294
Val?Leu?Arg?Val?Thr?Ala?Lys?Lys?Glu?Gly?Pro?Gly?Lys?Gly?Tyr
1085 1090 1095
gta?acg?atg?atg?gat?tgt?aat?gga?aag?cag?gaa?aca?ctt?agg?ttt 3339
Val?Thr?Met?Met?Asp?Cys?Asn?Gly?Lys?Gln?Glu?Thr?Leu?Arg?Phe
1100 1105 1110
act?tct?tgt?gaa?gaa?gga?tat?atg?aca?aaa?aca?gta?gag?gta?ttc 3384
Thr?Ser?Cys?Glu?Glu?Gly?Tyr?Met?Thr?Lys?Thr?Val?Glu?Val?Phe
1115 1120 1125
cca?gaa?agt?gat?cat?gta?cgg?att?gaa?atg?gga?gaa?acc?gaa?ggt 3429
Pro?Glu?Ser?Asp?His?Val?Arg?Ile?Glu?Met?Gly?Glu?Thr?Glu?Gly
1130 1135 1140
acg?ttt?tat?ata?gat?agc?atc?gag?ttt?ctt?tgt?atg?aaa?ggg?taa 3474
Thr?Phe?Tyr?Ile?Asp?Ser?Ile?Glu?Phe?Leu?Cys?Met?Lys?Gly
1145 1150 1155
<210>2
<211>1157
<212>PRT
<213〉Bacillus thuringiensis bacterial strain (Bacillus thuringiensis) BtMC28
<400>2
Met?Asn?Ser?Tyr?Gln?Asn?Lys?Asn?Glu?Tyr?Glu?Ile?Leu?Asp?Ala?Ser
1 5 10 15
Gln?Asn?Asn?Ser?Asn?Met?Ser?Asn?Arg?Tyr?Gln?Arg?Tyr?Pro?Leu?Ala
20 25 30
His?Asn?Pro?Gln?Thr?Ser?Ile?Gln?Thr?Thr?Asn?Tyr?Lys?Asp?Trp?Leu
35 40 45
Lys?Met?Cys?Gln?Asn?Pro?His?Gln?Asn?Pro?Leu?Asp?Met?Glu?Gly?Tyr
50 55 60
Asp?Ser?Asn?Ser?Val?Val?Val?Val?Ser?Thr?Gly?Leu?Ile?Val?Val?Gly
65 70 75 80
Thr?Leu?Ile?Ser?Ile?Leu?Ser?Ala?Gly?Leu?Gly?Ser?Ile?Pro?Ile?Ile
85 90 95
Tyr?Gly?Thr?Leu?Leu?Pro?Val?Leu?Trp?Asn?Asp?Pro?Asn?Asn?Pro?Gln
100 105 110
Lys?Thr?Trp?His?Glu?Phe?Met?Ser?His?Gly?Glu?Thr?Leu?Leu?Asn?Gln
115 120 125
Thr?Ile?Ser?Thr?Val?Glu?Arg?Asn?Arg?Ala?Ala?Ala?Tyr?Leu?Glu?Gly
130 135 140
Tyr?Thr?Thr?Ala?Val?Lys?Asn?Val?Lys?Lys?His?Leu?Asn?Val?Trp?Leu
145 150 155 160
Thr?Ala?Pro?Asn?Gln?Ala?Asn?Ala?Arg?Thr?Val?Ala?Asp?Leu?Tyr?Lys
165 170 175
Asp?Thr?Asp?Phe?Leu?Phe?Phe?Thr?Thr?Leu?Pro?His?Leu?Lys?Leu?Arg
180 185 190
Asp?Phe?Glu?Thr?Leu?Leu?Leu?Ser?Ser?Tyr?Thr?Gln?Ala?Ala?Asn?Met
195 200 205
His?Leu?Ile?Leu?Leu?Lys?Gln?Ala?Ser?Lys?Tyr?Ala?Asp?Gln?Trp?Asn
210 215 220
Ala?Gln?Leu?Pro?Val?Ser?Val?Arg?Lys?Thr?Ala?Asn?Asp?Tyr?Tyr?Thr
225 230 235 240
Asp?Leu?Val?Lys?Leu?Ile?Gly?Glu?Tyr?Thr?Asp?Tyr?Cys?Ile?Ala?Thr
245 250 255
Tyr?Arg?Ser?Gly?Leu?Asn?Thr?Ile?Lys?Ser?Arg?Ala?Thr?Ser?Trp?Asn
260 265 270
Ile?Tyr?Asn?Met?Tyr?Arg?Arg?Glu?Met?Thr?Ile?Leu?Val?Leu?Asp?Leu
275 280 285
Val?Ala?Leu?Phe?Pro?Ala?Tyr?Asp?Ile?Lys?Lys?Tyr?Pro?Ser?Gly?Thr
290 295 300
Lys?Val?Glu?Leu?Thr?Arg?Glu?Ile?Tyr?Thr?Asp?Ala?Leu?Gly?Ala?Val
305 310 315 320
Ala?Ile?Pro?Gln?Asn?Ile?Asp?Ala?Thr?Glu?Gln?Leu?Ala?Thr?Arg?Ala
325 330 335
Pro?Asn?Leu?Phe?Ser?Trp?Leu?Lys?Gly?Phe?Lys?Phe?Ile?Thr?Thr?Gln
340 345 350
Ser?Thr?Asn?Arg?Tyr?Tyr?Leu?Ser?Gly?Ile?Ala?Asn?Arg?Tyr?Ser?Phe
355 360 365
Thr?Asn?Ser?Asn?Gly?Glu?Ile?Trp?Gly?Pro?Ile?Ser?Gly?Asn?Pro?Thr
370 375 380
Gly?Val?Ser?Ser?Asp?Leu?Thr?Ile?Asp?Asn?Asn?Phe?Ser?Ile?Tyr?Lys
385 390 395 400
Leu?Ser?Ile?Leu?Arg?Gly?Tyr?Gln?Leu?Ser?Pro?Asp?Phe?Ser?Phe?His
405 410 415
Asn?Pro?Val?His?Gln?Ile?Asp?Phe?Ser?Thr?Thr?Asn?Asn?Gln?Gln?Gly
420 425 430
Arg?Val?Gln?Ser?Tyr?Lys?Ser?Gly?Gly?Pro?Thr?Pro?Val?Asn?Pro?Glu
435 440 445
Thr?Thr?Ala?Ile?His?Leu?Pro?Ile?Asp?Ser?Lys?Cys?Thr?Gln?Asn?Cys
450 455 460
Asn?Pro?Thr?Phe?Asn?Asn?Tyr?Ser?His?Ile?Leu?Ser?Tyr?Ala?Lys?Thr
465 470 475 480
Phe?Thr?Ser?Asn?Leu?Thr?Ile?Gly?Thr?Thr?Ser?Asn?Ile?Thr?Ser?Phe
485 490 495
Gly?Trp?Thr?His?Asn?Ser?Val?Asp?Arg?Glu?Asn?Thr?Ile?Asp?Leu?Asn
500 505 510
Asn?Ile?Thr?Gln?Ile?Pro?Ala?Val?Lys?Ala?Ser?Gln?Val?Tyr?Pro?Glu
515 520 525
Asn?Ser?Val?Ile?Lys?Gly?Pro?Gly?His?Thr?Gly?Gly?Asn?Leu?Val?Arg
530 535 540
Ile?Asp?Ser?Ser?Gly?Tyr?Met?Ser?Ile?Val?Cys?Lys?Phe?Pro?Leu?Gln
545 550 555 560
Val?Lys?Gly?Cys?Arg?Val?Arg?Ile?Arg?Tyr?Ala?Ala?Asn?Asn?Arg?Ala
565 570 575
Glu?Leu?Tyr?Ile?Ser?Ser?Ala?Gly?Asn?Ser?Pro?Ser?Lys?Asn?Val?Asp
580 585 590
Leu?Asp?Pro?Thr?Phe?Ser?Gly?Thr?Asn?Tyr?Glu?Ser?Leu?Asn?Tyr?Thr
595 600 605
Asn?Phe?Lys?Asp?Lys?Glu?Thr?Glu?Phe?Ile?Ile?Thr?Glu?Gly?Gln?Leu
610 615 620
Val?Lys?Gln?Ser?Ile?Ile?Phe?Ser?Thr?Asn?Gly?Asn?Val?Leu?Leu?Asp
625 630 635 640
Lys?Ile?Glu?Phe?Ile?Pro?Leu?Gly?Thr?Thr?Thr?Tyr?Glu?Tyr?Glu?Glu
645 650 655
Lys?Gln?Asn?Leu?Glu?Lys?Ala?Gln?Lys?Ala?Leu?Asn?Ala?Leu?Phe?Thr
660 665 670
Asp?Gly?Thr?Asn?Gly?Tyr?Leu?Gln?Met?Asp?Ala?Thr?Asp?Tyr?Asp?Ile
675 680 685
Asn?Gln?Thr?Ala?Asn?Leu?Ile?Glu?Cys?Val?Ser?Asp?Glu?Leu?Tyr?Ala
690 695 700
Lys?Glu?Lys?Ile?Val?Leu?Leu?Asp?Glu?Val?Lys?Tyr?Ala?Lys?Arg?Leu
705 710 715 720
Ser?Ile?Ser?Arg?Asn?Leu?Leu?Leu?Asn?Asp?Asp?Leu?Glu?Phe?Ser?Asp
725 730 735
Gly?Phe?Gly?Glu?Asn?Gly?Trp?Thr?Thr?Ser?Asp?Asn?Ile?Ser?Ile?Gln
740 745 750
Ala?Asp?Asn?Pro?Leu?Phe?Lys?Gly?Asn?Tyr?Leu?Lys?Met?Phe?Gly?Ala
755 760 765
Arg?Asp?Ile?Asp?Gly?Thr?Leu?Phe?Pro?Thr?Tyr?Leu?Tyr?Gln?Lys?Ile
770 775 780
Asp?Glu?Ser?Arg?Leu?Lys?Pro?Tyr?Thr?Arg?Tyr?Arg?Val?Arg?Gly?Phe
785 790 795 800
Val?Gly?Ser?Ser?Lys?Asn?Leu?Lys?Leu?Val?Val?Thr?Arg?Tyr?Glu?Lys
805 810 815
Glu?Ile?Asp?Ala?Ile?Met?Asn?Val?Pro?Asn?Asp?Leu?Ala?His?Met?Gln
820 825 830
Leu?Asn?Pro?Ser?Cys?Gly?Asp?Tyr?Arg?Cys?Glu?Ser?Ser?Ser?Gln?Phe
835 840 845
Leu?Val?Asn?Gln?Val?His?Pro?Thr?Pro?Thr?Ala?Gly?Tyr?Ala?Pro?Asp
850 855 860
Met?Tyr?Ala?Cys?Pro?Ser?Asn?Ser?Asp?Glu?Lys?His?Val?Met?Cys?His
865 870 875 880
Asp?Arg?His?Pro?Phe?Asp?Phe?His?Ile?Asp?Thr?Gly?Glu?Leu?Asn?Pro
885 890 895
Asn?Thr?Asn?Leu?Gly?Ile?Asp?Val?Leu?Phe?Lys?Ile?Ser?Asn?Pro?Asn
900 905 910
Gly?Tyr?Ala?Thr?Leu?Gly?Asn?Leu?Glu?Val?Ile?Glu?Glu?Gly?Pro?Leu
915 920 925
Thr?Asp?Glu?Ala?Leu?Val?His?Val?Lys?Gln?Lys?Glu?Lys?Lys?Trp?Arg
930 935 940
Gln?His?Met?Glu?Lys?Lys?Arg?Met?Glu?Thr?Gln?Gln?Ala?Tyr?Asp?Pro
945 950 955 960
Ala?Lys?Gln?Ala?Val?Asp?Ala?Leu?Phe?Thr?Asn?Glu?Gln?Glu?Leu?His
965 970 975
Tyr?His?Ile?Thr?Leu?Asp?His?Ile?Gln?Asn?Ala?Gly?Arg?Leu?Val?Gln
980 985 990
Leu?Ile?Pro?Tyr?Ala?His?His?Ala?Trp?Leu?Leu?Asp?Val?Pro?Gly?Met
995 1000 1005
Asn?Tyr?Asp?Val?Tyr?Thr?Glu?Leu?Asn?Val?Arg?Ile?Thr?Gln?Ala
1010 1015 1020
Arg?Tyr?Leu?Tyr?Lys?Glu?Arg?Asn?Val?Ile?Thr?Asn?Gly?Asp?Phe
1025 1030 1035
Thr?Gln?Gly?Leu?Thr?Gly?Trp?Gln?Glu?Thr?Gly?Lys?Ala?Thr?Val
1040 1045 1050
Gln?Gln?Met?Asp?Gly?Ala?Ser?Val?Leu?Val?Leu?Ser?Asn?Trp?Ser
1055 1060 1065
Ala?Gly?Val?Ser?Gln?Asn?Leu?His?Val?Gln?Asp?Gln?His?Gly?Tyr
1070 1075 1080
Val?Leu?Arg?Val?Thr?Ala?Lys?Lys?Glu?Gly?Pro?Gly?Lys?Gly?Tyr
1085 1090 1095
Val?Thr?Met?Met?Asp?Cys?Asn?Gly?Lys?Gln?Glu?Thr?Leu?Arg?Phe
1100 1105 1110
Thr?Ser?Cys?Glu?Glu?Gly?Tyr?Met?Thr?Lys?Thr?Val?Glu?Val?Phe
1115 1120 1125
Pro?Glu?Ser?Asp?His?Val?Arg?Ile?Glu?Met?Gly?Glu?Thr?Glu?Gly
1130 1135 1140
Thr?Phe?Tyr?Ile?Asp?Ser?Ile?Glu?Phe?Leu?Cys?Met?Lys?Gly
1145 1150 1155
<210>3
<211>25
<212>DNA
<213〉artificial sequence
<400>3
atgaattcat?atcaaaataa?aaatg 25
<210>4
<211>25
<212>DNA
<213〉artificial sequence
<400>4
ttaccctttc?atacaaagaa?actcg 25
<210>5
<211>34
<212>DNA
<213〉artificial sequence
<400>5
gcgcatatga?tgaattcata?tcaaaataaa?aatg 34
<210>6
<211>33
<212>DNA
<213〉artificial sequence
<400>6
cggaattcgc?tcaaagaaac?atactttccc?att 33
Claims (9)
1. Bt PROTEIN C ry4Cc1, its aminoacid sequence is:
1) aminoacid sequence shown in the SEQ ID No.2; Or
2) aminoacid sequence shown in the SEQ ID No.2 is substituted, lacks and/or increases the aminoacid sequence that one or several amino acid and coding have equal activated protein.
2. coding claim 1 described proteic gene.
3. gene as claimed in claim 2, its nucleotide sequence is shown in SEQ ID No.1.
4. contain claim 2 or 3 described expression carrier.
5. by the described expression vector transformed host cells of claim 4.
6. host cell as claimed in claim 5, it is a plant host cell.
7. contain the described proteic sterilant of claim 1.
8. claim 2 or 3 described genes or the described expression vector of claim 4 application in the preparation transgenic plant.
9. claim 2 or 3 described genes or the described expression vector of claim 4 application in improving plant resistance to insect.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100788983A CN101497658B (en) | 2009-03-05 | 2009-03-05 | Novel Bt protein Cry4Cc1, coding gene thereof and use |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100788983A CN101497658B (en) | 2009-03-05 | 2009-03-05 | Novel Bt protein Cry4Cc1, coding gene thereof and use |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101497658A CN101497658A (en) | 2009-08-05 |
CN101497658B true CN101497658B (en) | 2010-12-08 |
Family
ID=40944943
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2009100788983A Expired - Fee Related CN101497658B (en) | 2009-03-05 | 2009-03-05 | Novel Bt protein Cry4Cc1, coding gene thereof and use |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101497658B (en) |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101870979B (en) * | 2010-06-02 | 2012-08-01 | 中国农业科学院植物保护研究所 | Insecticidal gene cryX with high toxicity to lepidopterous pests and application thereof |
CN102363631B (en) * | 2011-11-09 | 2013-09-11 | 四川农业大学 | Insecticidal Bt (Bacillus thuringiensis) protein Cry8Qa1, coding gene thereof and application thereof |
CN103333230B (en) * | 2013-07-09 | 2016-02-17 | 福建农林大学 | Bacillus thuringiensis Genes cry1Da3 and application thereof |
CN117660225B (en) * | 2023-11-17 | 2024-05-14 | 宁夏农林科学院植物保护研究所(宁夏植物病虫害防治重点实验室) | Bacillus thuringiensis LSYS-16 with disease prevention and insect killing effects and application thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1401773A (en) * | 2001-08-20 | 2003-03-12 | 中国农业科学院植物保护研究所 | Bt gene with high toxicity to Lepidoptera and Coleoptera insects, expression vector and engineering bacteria |
-
2009
- 2009-03-05 CN CN2009100788983A patent/CN101497658B/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1401773A (en) * | 2001-08-20 | 2003-03-12 | 中国农业科学院植物保护研究所 | Bt gene with high toxicity to Lepidoptera and Coleoptera insects, expression vector and engineering bacteria |
Also Published As
Publication number | Publication date |
---|---|
CN101497658A (en) | 2009-08-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101531980B (en) | Bacillus thuringiensis HS18-1 and application thereof | |
CN101503666B (en) | Novel strain of Bacillus thuringiensis bacterial strain and use thereof | |
CN101497658B (en) | Novel Bt protein Cry4Cc1, coding gene thereof and use | |
CN101503463B (en) | Novel Bt protein Cry53Ab1, coding gene thereof and use | |
CN101497657B (en) | Novel disinsection Bt protein Cry54Aa1, coding gene thereof and use | |
CN101503464A (en) | Novel Bt protein Cry30Fa1, coding gene thereof and use | |
CN102781955B (en) | Bt protein Cry4Cb2, encoding gene of same and use thereof | |
CN101531981B (en) | Bacillus thuringiensis BM59-2 and application thereof | |
CN101591381A (en) | Bt PROTEIN C ry4Cb1, its encoding gene and application | |
CN101531713B (en) | Bt protein Cry56Aal as well as encoding gene thereof and application thereof | |
CN101531711B (en) | Bt protein Cry52Bal as well as encoding gene thereof and application thereof | |
CN101531712B (en) | Bt protein Cry30Bal as well as encoding gene thereof and application thereof | |
CN102363631B (en) | Insecticidal Bt (Bacillus thuringiensis) protein Cry8Qa1, coding gene thereof and application thereof | |
CN101531982B (en) | Bacillus thuringiensis YWC2-8 and application thereof | |
CN102408475B (en) | Bt protein Cryt1Da1, and coding gene and application thereof | |
CN103103203A (en) | Bt cry54Ab1 gene, protein encoded by gene and application of gene or protein | |
CN103103204A (en) | Bt cry54Ab1 operon gene, protein encoded by gene and application of gene or protein | |
CN103525835A (en) | Bt Cry71Aa1 gene and coded protein thereof and application | |
CN102363630B (en) | Pesticide Bt protein Cry8Pa1 and coding gene and use thereof | |
CN102603876B (en) | Bt protein Cry59Bal, coding gene and application of Bt protein Cry59Bal | |
CN102584959B (en) | Bt (Bacillus thuringiensis) protein Cry70Ba1 as well as encoding gene and application thereof | |
CN102584960B (en) | Bt (Bacillus thuringiensis) protein Cry70Aa1 as well as encoding gene and application thereof | |
CN102408474B (en) | Bt protein Cry69Aa1, and coding gene and application thereof | |
CN102417538B (en) | Bt protein Cry68Aa1 and encoding gene and application thereof | |
CN102532285B (en) | Bt protein Cry2Ac-like and coding gene and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20101208 Termination date: 20210305 |