EP1778714A2 - Verfahren zur herstellung und verwendung von rekombinanten sporen des bacillus thuringiensis - Google Patents

Verfahren zur herstellung und verwendung von rekombinanten sporen des bacillus thuringiensis

Info

Publication number
EP1778714A2
EP1778714A2 EP05795245A EP05795245A EP1778714A2 EP 1778714 A2 EP1778714 A2 EP 1778714A2 EP 05795245 A EP05795245 A EP 05795245A EP 05795245 A EP05795245 A EP 05795245A EP 1778714 A2 EP1778714 A2 EP 1778714A2
Authority
EP
European Patent Office
Prior art keywords
seq
protein
peptide
nucleic acid
spore
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP05795245A
Other languages
English (en)
French (fr)
Other versions
EP1778714A4 (de
Inventor
Stanley Goldman
John Libs
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Phyllom LLC
Original Assignee
Phyllom LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Phyllom LLC filed Critical Phyllom LLC
Publication of EP1778714A2 publication Critical patent/EP1778714A2/de
Publication of EP1778714A4 publication Critical patent/EP1778714A4/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
    • C07K14/325—Bacillus thuringiensis crystal peptides, i.e. delta-endotoxins
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/50—Isolated enzymes; Isolated proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/035—Fusion polypeptide containing a localisation/targetting motif containing a signal for targeting to the external surface of a cell, e.g. to the outer membrane of Gram negative bacteria, GPI- anchored eukaryote proteins

Definitions

  • the present invention relates to spore coat genes and proteins and exosporium genes and proteins from Bacillus thuringiensis and particularly to methods for making and using recombinant Bacillus thuringiensis spores.
  • BacillusJhuringiensis was first discovered in Japan in 1901 by Ishawata and then in 1911 in Germany by Principle. A widely used biopesticide, it was first applied as a commercial insecticide in France in 1938, and then in the USA in the 1950s. These early products were replaced by more effective ones in the 1960s, when various highly pathogenic strains were discovered with specific activity against different types of insects. Thereafter, thousands of strains of B. thuringiensis were subsequently found to exist.
  • Bacillus thuringiensis is a sporulating soil bacterium that produces insecticidal proteins during sporulation.
  • the vegetative cells contain endospores and crystals of an insecticidal protein toxin (these crystal insecticidal toxins are also known as "delta-endotoxin") which usually have a bipyramidal shape.
  • delta-endotoxin crystal insecticidal toxins
  • Bt is grown in industrial fermentors, most cells lyse and release the endospores and toxin crystals. The material is then harvested and formulated into the biopesticide product.
  • These commercial Bt products are powders containing a mixture of dried spores and toxin crystals. They are applied to leaves, plants, shrubs or other environments in which the insect larvae feed.
  • Bt-based insecticides are formulated and marketed worldwide for control of many important plant pests - mainly caterpillars of the Lepidoptera family (i.e., butterflies and moths) but also mosquito larvae, and simuliid blackflies that vector river blindness in Africa.
  • Bt products represent about 1% of the total "agrochemical" market (i.e., fungicides, herbicides and insecticides) across the world.
  • the typical Bt insecticide product is composed of one strain of Bt, which is limited in its insecticidal activity because naturally-occurring Bt strains generally are active against a few insect species. Therefore, activity against a broad array of insecticidal pests cannot be achieved with current Bt-based insecticide products.
  • Bt insecticidal protein toxin called Cry ICa, which is a major component of a widely-used commercial Bt insecticide.
  • the Cryl Ca protein toxin has no activity against scarab beetles, which are common and destructive pests to a number of crops.
  • Bt insecticidal protein called Cry8Da has strong activity against scarab beetles but no activity against beet armyworm, Spodoptera exigua, another common and destructive crop pest. Therefore, in order to control multiple insect pests, current Bt-based technologies require the application of several strains of Bt, each specific to one, or at best a few, insect types. This is costly since considerable amounts of biopesticides are required to be applied to achieve the desired effect.
  • the present invention overcomes the limitations of currently-existing Bt-based insecticide products by providing recombinant Bt strains that have insecticidal activity against a variety of different insect pests.
  • the methods allow the skilled artisan to make Bt-based insecticides that control both scarab beetles, such as the Japanese beetle, and the beet armyworm. This would widely benefit producers and caretakers of crops and other plant-based products such as turf grass by providing more effective biopesticides than the currently available Bt formulations.
  • significant cost savings can be achieved.
  • a recombinant Bt strain that can be produced by the methods of the present invention is one containing the beet armyworm-active CrylCa protein gene, which can be expressed on the surface of the spore of a Bt strain called SDS-502, which contains an endogenous insecticide crystal protein toxin active against the Japanese beetle.
  • Another advantage the present invention provides is the rapidity of insectidal activity.
  • Current Bt products are formulated to contain a mixture of spores and isolated crystalline protein toxin. Although the crystalline protein toxin is effective, the spores themselves are slow to act as they must germinate in the gut of the insect, lyse the gut lining, and multiply in the blood to become effective at killing the insect.
  • the recombinant Bt spores of the present invention overcome this limitation by expressing an exogenous insecticide protein toxin on there surface, thereby producing a rapid and lethal response.
  • the present invention provides methods for making recombinant Bt strains having exogenous proteins attached to the outer coats of their spores or to their exosporia component found to be a part of the spore or exosporium, not non-spore or exosporium origin like Bt insecticidal protein.
  • recombinant spores have been constructed in Bacillus subtilis, the method of producing Bt spores having exogenous proteins linked to their outer coats or exosporia has not been reported in Bt. Until now, it was not possible to practice this method in Bt because none of the spore coat genes or exosporia genes were isolated and sequenced.
  • novel spore coat protein genes and one novel exosporium protein gene from a strain of B. thuringiensis subspecies gallariae are used to express exogenous proteins on the Bt spore.
  • the spore coat gene or exosporium gene fused to an exogenous gene produces a heterologous protein wherein the spore coat protein or the exosporium protein and the exogenous protein are functionally and operationally linked.
  • the heterologous protein is incorporated into the Bt spore coat or exosporium.
  • the invention also comprises methods for using compositions made from the resulting recombinant Bt strains expressing one or more exogenous genes on the Bt spore coat or exosporium.
  • the exogenous protein attached to the Bt spore or exosporium is an insecticidal protein toxin.
  • insecticidal protein toxin There may be more than one insecticidal protein toxins so attached.
  • Many Bt strains produce one or more endogenous insecticidal protein toxins. These often form heterogenous crystal structures within the cell.
  • the expression of one or more exogenous protein toxins on the outer coat or exosporium of the Bt spore confers significantly improved insecticidal activity than current Bt insecticides.
  • an additional insecticide incorporated onto the surface of the spore can provide a substantial increase in the amount of protein insecticide toxin produced by each Bt cell.
  • an exogenous insecticidal protein toxin on the outer coat or exosporium of Bt spores confers a broadening of the insecticidal range.
  • improved biopesticide efficiency can be achieved This is because the resulting recombinant Bt strain continues to produce endogenous insecticidal toxins that are contained within the spore, and additionally, produces one or more exogenous insecticidal proteins attached to the spore outer coat or exosporium.
  • Exogenous insecticidal proteins may be derived from one or more endogenous Bt insecticidal protein toxins or from insecticidal proteins found in other Bacillus strains, including those that are listed, infra.
  • the exogenous insecticidal protein however is not limited to those derived from Bacillui strains but also may be obtained from non-Bacillui sources, the important point being the ability of the exogenous protein to kill a desired insect.
  • the invention contemplates the use of any insecticidal protein toxin capable of being expressed on the outer coat or exosporium of Bt spores.
  • the methods of the present invention allow for the expression of one or more insecticidal protein toxins on the surface of the Bt spore, in which the one or more protein toxins may include an endogenous protein toxin from the host strain, an endogenous protein toxin from a non- host Bt strain, or a protein toxin from a non-Bacillus strain. Any combinations are contemplated and may be incorporated into the Bt host strain as needed to target specific insect pests.
  • Additional benefits may be realized from attachment of one or more insecticidal protein toxins to the surface of the Bt spore.
  • isolated insecticidal crystal protein toxins are inactivated by ultra violet light and therefore have a limited duration of activity when sprayed onto crops or other plant resources, spores are resistant to ultra violet light and may provide protection for the associated insecticidal protein toxin displayed on the surface. Assembly of the insecticidal toxin on the spore may also increase the toxin stability since immobilized proteins often have greater stability. The close association of the insecticidal protein toxin with the spore i.e., by its display on the surface of the spore, will also enhance the effectiveness of the product.
  • the exogenous protein attached to the surface of the Bt spore may be an enzyme. More than one enzyme may be so attached. Much like the advantages for insecticidal protein toxins described, supra, the surface of the Bt spore can provide physical protection for enzymes so they can persist longer in the environment. Enzymes attached to the surface of the spore may be used for a variety of applications including production of useful compounds by enzymatic reaction and environmental cleanup. Enzymes so attached can be useful in bioremediation including degradation of chemical pesticides, herbicides, or clean up of industrial pollutants such as PCB.
  • the recombinant Bt spores can act as antigen-delivery vehicles.
  • the exogenous protein attached to the surface of the Bt spore can be an antigen that produces immunity in higher animals, including but not limited to farm animals such as cattle, chicken, or fish.
  • nucleic acid constructs that include a copy of a first nucleic acid molecule encoding a first peptide derived from a Bacillus thuringiensis spore coat protein or an exosporium protein that when expressed targets to the Bacillus thuringiensis spore coat or exosporium which is operably linked to a second nucleic acid molecule encoding a second peptide.
  • the first peptide has substantial identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, and SEQ ID NO: 10, more preferably, at least 60% identity, more preferably at least 70% identity, more preferably at least 75% identity, more preferably at least 80% identity, more preferably at least 85% identity, more preferably at least 90% identity, more preferably at least 93% identity, more preferably at least 95% identity, more preferably at least 97% identity, more preferably at least 98% identity, and even more preferably at least 99% identity.
  • the operable linkage between the first and second peptide includes a linker peptide.
  • the second peptide is a therapeutic peptide, a diagnostic peptide, an insecticidal peptide, a vaccine peptide, or an industrial enzyme peptide.
  • the spore may respond as a receptor to the presence of the specific molecule or organism by germinating.
  • the actual detection would generally be accomplished by one of three ways. The first is direct observation of the spores after exposure to the sample. The exposure could be in either liquid or on a Petri dish. If the spores initiate germination the molecule or organism is present in the sample.
  • the second way is to mix the spores and the sample in question and then plate the mixture on a Petri dish containing LB agar and selective antibiotics. If colonies become visible on the plate in 8 to 10 hours then that sample contains the target of the detection system.
  • the third way would use the additional modification of the detector recombinant spore to contain any one of several enzymes glucoronidase, beta-galactosideas, thrombin, or naturally occurring GRP. These enzymes would be stored in the core of the spore by linking to Small Acid Soluble Proteins (SASPs) that are specifically delivered and bind the DNA that represents the bacterial genome.
  • SASPs Small Acid Soluble Proteins
  • SASPs Small Acid Soluble Proteins
  • the integrity of the spore is compromised as the nascent vegetative cells erupts from the spore.
  • beta-galactosidase and/or glucoronidase will be released and in the presence of the proper substrate generate a blue color.
  • Other fusion proteins can be considered for placement in different compartments of the spore to facilitate specific detector types. It should be possible to assemble the detector enzyme into the inner coat or the cortex of the spore as well as the core.
  • the first method had the benefit of being very rapid since germination is generally initiated in less than two minutes and the spore characteristics clearly change from phase bright to phase dark when viewed with a phase contrast microscope. This method generally requires use of a phase contrast microscope.
  • the benefit of the second method is that one needs only a Petri dish with Luria Broth and selective antibiotic to complete the assay. This is minimal technology and is generally cheaper and easier to maintain then a phase contrast microscope.
  • the selective antibiotics that will be used will not interfere with germination since the recombinant spore will have the needed resistance genes.
  • the antibiotics will ensure that only the Bacillus thuringiensis will be able to grow on the plate greatly reducing the likelihood of false positives.
  • the benefits of the third option are manifold. There is need for little else but a sample that needs testing, and a solution that is mixed with that sample that contains the recombinant detector spores and the substrate. Should the spores germinate in response to a specific signal, an enzyme can be released and a blue color or fluorescence is generated. If the signal and response is weak a spectrophotometer can be used to detect enzymatic reaction, if the response is strong than the change is easily seen by eye. The most significant difference between weak and strong responses is the amount of time before the color can be detected by eye. Such enzymes are generally stable and will react over a long period of time (24 hours) thus even a weak signal will become detectable by eye over a period of time.
  • the spectrophotometer is a simple, small and stable tool that can be reduced in size so that rapid assays determinations can be completed in the field with a small hand held unit.
  • GRP a specific endoprotease such as thrombin
  • GPR has a specific penta-residue binding site where cleavage of a protein would be made. When germination takes place these proteases would be activated and then released. The released protease would cleave a fusion protein to produce active green fluorescent protein or react with another substrate in the incubation media to produce a visible color.
  • the benefit of activating green fluorescent protein is in the sensitivity of the assay since this type of assay is typically 1000 times as sensitive as simple colorimetric assays.
  • the method of producing these detector spores generally occurs in three steps. First the native and natural germination receptors need to be mutated to inactivity. This will be accomplished by gene-replacement double recombination with active antibiotic resistance genes replacing the germination receptors. At this time continued gene replacement could be completed to place in the genome the specific enzymes required for either colorimetric or fluorescent assay activity. In some circumstance, fusion proteins of enzymes with the SASP gene sequences can be utilized to ensure that the reactive enzyme is sequestered in the core of the spore until germination. These are the basic strains that will generally not germinate naturally, have the capacity to produce a measurable response in the assay format and can be kept viable in vegetative cell form.
  • the second step is generally acquiring or producing specific receptor molecules that can be fused to the receptor region of the knock-out germination genes.
  • the signal that activates the signal transduction pathway that leads to germination should continue to be active in the fusion proteins.
  • a variety of molecular binding motifs including specific DNA sequences, proteins, viruses, bacteria and small molecules can be utilized.
  • the third step is generally a second round of double recombination that will insert the fusion receptor molecules back into the bacillus genome and insert the resulting fusion proteins into the recombinant spore. Since there are more germination genes than there are needed antibiotic markers, the second round of double recombination will generally replace inactivated germination receptors that do not contain antibiotic resistance genes.
  • insecticidal peptides include CrylAal, CrylAa2, CrylAa3, CrylAa4, CrylAa5, CrylAa ⁇ , CrylAa7, CrylAa ⁇ , CrylAa9, CrylAalO, CrylAal 1, CrylAal2, CrylAal3, CrylAal4, CrylAbl, CrylAb2, CrylAb3, CrylAb4, CrylAb5, CrylAb ⁇ , CrylAb7, CrylAb ⁇ , CrylAb9, CrylAblO, CrylAbl 1, CrylAbl2, CrylAbl3, CrylAbl4, CrylAbl5, CrylAbl ⁇ , OyI AcI, CrylAc2, CrylAc3, CrylAc4, CrylAc5, CrylAc ⁇ , CrylAc7, CrylAc8, CrylAc9, CrylAclO, CrylAcll, CrylAcl2, CrylAcl3, CrylAcl4, CrylAcl5, OyI
  • Preferred examples of industrial enzymes include glucose oxidase, galactosidase, glucosidase, nitrilase, alkene monooxygenase, hydroxylase, aldehyde reductase, alcohol dehydrogenase, D-hydantoinase, D-carbamoylase, L- hydantoinase, L-decarbamoylase, beta-tyrosinase, dioxygenase, serine hydroxy- methyltransferase, carbonyl reductase, nitrile hydratase, o-phthalyl amidase, halohydrin hydrogen-halide lyase, maltooligosyl trehalose synthase, maltooligosyl trehalose trehalohydrolase, lactonase, oxygenase, adenosylmethionine synthetase, cephal
  • vaccine peptides include antigenic peptides from the vectors for diseases including Marek disease, (MDV) Herpes Virus; Infectious bronchitis disease: (IBV); Infectious Larygotracheitis, (ILV) Herpes Virus; Infectious Bursal Disease, (IBV) Birna Virus; Newcastle Disease: (ND); Encephalomyelitis; Fowl Pox; Reovirus; Avian Flu, strain N5H1 flu; Mycoplasma; Cholera; and Coccidia, Eimeria and Isospora.
  • MDV Marek disease
  • IBV Infectious bronchitis disease
  • IBV Infectious Larygotracheitis
  • IBV Infectious Larygotracheitis
  • IBV Infectious Bursal Disease
  • Birna Virus Infectious Bursal Disease
  • Newcastle Disease Newcastle Disease: (ND); Encephalomyelitis
  • Fowl Pox Reovirus
  • Avian Flu strain N5H1 flu
  • cancer antigens which can include bullous pemphigoid antigen 2, prostate mucin antigen (PMA), tumor associated Thomsen- Friedenreich antigen, prostate-specific antigen (PSA), EpCam/KSA antigen, luminal epithelial antigen (LEA.135) of breast carcinoma and bladder transitional cell carcinoma (TCC), cancer-associated serum antigen (CASA) and cancer antigen 125 (CA 125), the epithelial glycoprotein 40 (EGP40), squamous cell carcinoma antigen (SCC), cathepsin E, tyrosinase in melanoma, cell nuclear antigen (PCNA) of cerebral cavernomas, DF3/MUC1 breast cancer antigen, carcinoembryonic antigen, tumor-associated antigen CA 19-9, human melanoma antigens MART-l/Melan-A27-35 and gplOO, the T and Tn pancarcinoma (CA) glycopeptide epi
  • PMA prostate mucin anti
  • the first and second nucleic acids are operably linked to a promoter operable in the target host cell.
  • promoters for Bacillis are bclA, dal, exsB, exsC, exsCL, exsD, exsE, exsF, exsG, exsH, exsl, exsJ, exsY, cotA, cotB, cotC, cotD, cotE, cotF, cotG, cotN, cotS, cotT, cotV, cotW, cotX, cotY, and cotZ.
  • Yet another aspect of the present invention includes a host cell comprising a nucleic acid construct in any of the above mentioned variations.
  • the host cell is an expression system for producing the fusion protein.
  • the host cell may be a bacterial, yeast, insect, fish or mammalian cell, which more preferably may be used as an expression system for the fusion protein.
  • Preferred examples of host cells include any subspecies of Bacillus thuringiensis including Bacillus thuringiensis subsp. aizawai, Bacillus thuringiensis subsp. galleriae, Bacillus thuringiensis subsp. entomocidus, Bacillus thuringiensis subsp.
  • Bacillus thuringiensis subsp. thuringiensis Bacillus thuringiensis subsp. alesti, Bacillus thuringiensis subsp. americansis, Bacillus thuringiensis subsp. darmstadiensis, Bacillus thuringiensis subsp. dendrolimus, Bacillus thuringiensis subsp. ⁇ nitimus, Bacillus thuringiensis subsp. kenyae, Bacillus thuringiensis subsp. morrisoni, Bacillus thuringiensis subsp. subtoxicus, Bacillus thuringiensis subsp. toumanoffi, Bacillus thuringiensis subsp.
  • Bacillus thuringiensis subsp. shandogiensis Bacillus thuringiensis subsp. sotto, Bacillus thuringiensis subsp. nigeriae, Bacillus thuringiensis subsp. yunnanensis, Bacillus thuringiensis subsp. dakota, Bacillus thuringiensis subsp. indiana, Bacillus thuringiensis subsp. tohokuensis, Bacillus thuringiensis subsp. kumamotoensis, Bacillus thuringiensis subsp. tochigiensis, Bacillus thuringiensis subsp.
  • Bacillus thuringiensis subsp. wuhanensis Bacillus thuringiensis subsp. kyushuensis, Bacillus thuringiensis subsp. ostriniae, Bacillus thuringiensis subsp. tolworthi, Bacillus thuringiensis subsp. pakistani, Bacillus thuringiensis subsp. japonensis, Bacillus thuringiensis subsp. colmeri, Bacillus thuringiensis subsp. pondicheriensis, Bacillus thuringiensis subsp. shandongiensis, Bacillus thuringiensis subsp.
  • Bacillus thuringiensis subsp. coreanensis Bacillus thuringiensis subsp. silo, Bacillus thuringiensis subsp. mexcanensis, Bacillus thuringiensis subsp. israelensis, Bacillus thuringiensis subsp. berliner, Bacillus thuringiensis subsp. cameroun, Bacillus thuringiensis subsp. ongbei, Bacillus thuringiensis subsp. fukuokaensis, Bacillus thuringiensis subsp. higo, Bacillus thuringiensis subsp.
  • the first nucleic acide is endogenous and the second nucleic acid is exogenous.
  • Yet another aspect of the present invention includes fusion proteins expressed from any of the above nucleic acid constructs in all the variations discussed.
  • the fusion protein is part of a pharmaceutical composition that includes a pharmaceutically acceptable carrier.
  • any of the fusion proteins and pharmaceutical compositions may be used in therapeutic methods whereby therapeutically effective doses of the fusion protein or pharmaceutical compositions may be administered to a subject in need of treatment or at risk of a disorder.
  • Preferred methods of administion includedy oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, or intranasal.
  • Still another embodiment of the present invention includes methods of screening the fusion proteins of the present invention for a desired activity.
  • An example of such a screening method is providing a nucleic acid constructs as described above where the second nucleic acid molecules is selected based upon likelihood of having the desired activity and determining whether of the fusion protein has the desired activity.
  • the desired activity is pesticidal for which preferred second peptides are insecticidal peptides.
  • the desired activity is vaccination for which the preferred second peptides are derived from the pathogen or cancer to be vaccinated against.
  • FIGURE 1 depicts the cotG promoter linked to the aprE upstream mRNA stabilizing region +1-59 of the aprE transcribed region which gives very high mRNA stability and very high levels of expression (from Bacillus subtilis).
  • cotG from Bt in upper case aprE leader sequence in lower case.
  • FIGURE 2 is the expression cassette sequence for Example 2.
  • FIGURE 3 depicts an expression cassette DNA and protein sequence showing a multifunctional linker.
  • the spore coat protein is cotYl and is fused to 628 amino acids of the N-terminal coding region of the insecticidal protein gene Cry ICa.
  • Amino acids 1 through 628 of the Cry 1 CaI protein comprise the active portion of the toxin after cleavage by insect midgut proteases.
  • the linker contains restriction sites for in-frame cloning, a nine amino acid epitope for antibody detection (bold), and a proteolytic cleavage site to ensure that the Cry 1 CaI protein is released from the spore after it is orally consumed by the insect.
  • FIGURE 4 is the expression cassette sequence for Example 2.
  • the expression cassette contains an exosporium gene promoter, the exsCL gene sequence, and the cry ICa gene sequence.
  • FIGURE 5 is the expression cassette DNA and protein sequence for Example 4 showing a multifunctional linker.
  • the exosporium gene, exsCL is fused to 628 amino acids of the N-terminal coding region of the insecticidal protein gene cry ICa.
  • Amino acids 1 through 628 of the CrylCal protein comprise the active portion of the toxin after cleavage by insect midgut proteases.
  • the linker contains restriction sites for in-frame cloning, a nine- amino acid epitope for antibody detection (bold typeface), and a proteolytic cleavage site to ensure that the insecticidal CrylCal protein is released from the spore after it is orally consumed by the insect.
  • FIGURE 6 depicts nucleotide and peptide sequences showing the junction between CotYl and Cry ICa including the HA epitope and proteolytic cleavage site. This figure shows nucleotides 481 through 660 of SEQ ID NO:26 and amino acids 161 through 220 of SEQ ID NO:27.
  • FIGURE 7 depicts nucleotide and peptide sequences showing the junction between ExsCL and Cry ICa including the HA epitope and proteolytic cleavage site. This figure shows nucleotides 661 through 840 of SEQ ID NO:32 and amino acids 112 through 171 of SEQ ID NO:33.
  • FIGURE 8 (A)-(E) depicts the sequence alignment of CotG (SEQ ID NO:4), CotYl(SEQ ID NO:4),
  • exosporium protein [Bacillus thuringiensis serovar konkukian str.
  • exosporium protein [Bacillus thuringiensis serovar konkukian str.
  • Bacillus thuringiensis (“Bt”) is a widely used biopesticide effective against insects of the lepidopteran family (i.e., moths and butterflies) and also other insects such as the larvae of mosquitoes. Over the years it has proven to be safe, as evidenced from the lack of reported or observed toxicological effects in humans from exposures in the field. However, despite its record, Bt use as a biopesticide suffers from several drawbacks including the necessity to apply significant amounts of formulated material onto crops and other plant-based resources (such as turf grass). A large amount is required for application because of the relative lack of efficacy of the Bt spores in the formulated pesticides. Current Bt products are mixtures of spores and isolated crystalline protein toxins.
  • the spores although contributing to insecticidal activity, are relatively slow in onset of action because the spores, after ingestion by the target insect, must germinate in the midgut of the target insect before they exert their insecticidal activity. Once the spores germinate into vegetative cells and become metabolically active, a phenomenon elicited by the favorable environment of the insect's gut, they replicate and colonize in the insect. It is this process of colonization that confers insecticidal activity since many of the viable cells are lysed, which enables the release of endogenous insecticidal protein toxins, previously contained within the vegetative cell (or the predecessor endospore).
  • the endogenous toxins act in the same manner as ingested isolated protein toxins, in effect, killing the target insect.
  • the methods of the present invention allow for the expression of endogenous protein toxin on the surface of the spore making the protein toxin immediately accessible to receptors in the gut of the target insect (the mechanism of action of the toxin's toxicity), thereby conferring rapidity of insecticidal activity, since the spores essentially will act as if they were isolated protein toxins.
  • the longer-term benefits of the germination process will be retained by the methods of the present invention.
  • Bt insecticide formulations Another drawback of current Bt insecticide formulations is their relatively narrow range of insecticidal activity. Most Bt insecticide formulations target a few insect species. To overcome this limitation, one would have to apply several different Bt formulations containing several different Bt strains known to target different insects to achieve a broad range of insecticidal activity. This, of course, would be a time-consuming and costly approach.
  • the methods of the present invention overcome these drawbacks by allowing for the expression of one or more insecticidal protein toxins on the surface of the Bt spore.
  • the methods allow for the expression of endogenous Bt insecticidal protein toxins, including those of the host Bt strain (as described, supra), and/or the expression of non-host strain Bt endogenous insecticidal protein toxins, and/or the expression of non-Bt endogenous insecticidal protein toxins, and/or the expression of non-bacillus insecticidal protein toxins on the surface of Bt spores.
  • endogenous Bt insecticidal protein toxins including those of the host Bt strain (as described, supra), and/or the expression of non-host strain Bt endogenous insecticidal protein toxins, and/or the expression of non-Bt endogenous insecticidal protein toxins, and/or the expression of non-bacillus insecticidal protein toxins on the surface of Bt spores.
  • the methods of the present invention allow for the insecticidal protein toxins to be expressed on the surface of Bt spores during the process of sporulation.
  • Genes encoding such insecticidal protein toxins are operably linked, with or without a linker, to an outer core protein gene or an exosporium gene, which is operably linked to a sporulation promoter sequence, such as an outer coat protein gene promoter sequence or an exosporium protein gene promoter sequence, which is then cloned into a suitable expression vector such as any of a number of commercially-available plasmids.
  • the expression vector is then introduced into one or more cells of a suitable host Bt strain (i.e., the host Bt strain is transformed or transfected) by any suitable method known in the art such as electroporation.
  • a suitable host Bt strain i.e., the host Bt strain is transformed or transfected
  • electroporation any suitable method known in the art such as electroporation.
  • the one or more Bt cells are induced to sporulate causing the expression cassettes to express the outer coat protein gene or the exosporium gene operably linked to the one or more insecticidal protein genes.
  • endogenous insecticidal protein toxins form aggregates or crystals, which are comprised of one or more types of proteins, typically of the size of about 130-140 kDa.
  • the insecticidal protein toxin is actually a protoxin — that is, it must be activated before it has any effect.
  • the crystal form of the insecticidal protein toxin is highly insoluble under normal conditions, so it is safe to humans, higher animals and most insects. However, the crystal toxin is solubilized in reducing conditions of high pH (above about pH 9.5) - the conditions commonly found in the midgut of lepidopteran larvae. For this reason, Bt is a highly specific insecticidal agent. Current Bt products are formulated with crystal toxins since this structure stabilizes the insecticidal protein once applied to the environment.
  • the protoxin is cleaved by a gut protease to produce an active toxin of about 60 kDa.
  • the toxin binds to the midgut epithelial cells, creating pores in the cell membranes and leading to equilibration of ions.
  • the gut is rapidly immobilized, the epithelial cells lyse, the larva stops feeding, and the gut pH is lowered by equilibration with the blood pH.
  • the Bt spores play a contributing role in insect control.
  • the gut pH is lowered, the spores can germinate, allowing the bacterium to invade the host, and causing a lethal bacterial infection or septicemia.
  • the Bt recombinant spores of the present invention have additional applications such as industrial enzymes and vaccines.
  • One or more exogenous enzyme genes can be expressed in a Bt spore during sporulation in the same manner as an exogenous insecticidal protein toxin is. That is, an entire enzyme gene or a portion of it (i.e., a portion that codes for the active form of the enzyme) can be operably linked to an outer coat protein gene or exosporium gene and a suitable promoter thereby creating an expression cassette.
  • the expression cassette can then be cloned into a suitable expression vector and introduced into one or more cells of a host Bt strain.
  • the one or more cells can then be induced to sporulate, which triggers expression of the exogenous enzyme (or component thereof) on the surface of the Bt spore.
  • the resulting recombinant spores function as immobilized enzymes, which can be produced inexpensively by bacillus fermentation and can be easily isolated from the enzyme reaction mixture by simple sedimentation or centrifugation. Since the enzyme attached on the spore surface is more stable than a corresponding free enzyme, the spore-bound enzyme can be used repeatedly.
  • the methods of the present invention allow for the creation of one or more recombinant Bt spores expressing one or more antigens on their surface. In this manner, the present invention allows for the creation of one or more vaccines.
  • the present invention includes the use of Bt spores as an immobilized enzyme matrix and vaccine.
  • the spore structure of Bacillus subtilis has been characterized using various techniques including microscopy, staining, genetics, and sequence analysis.
  • the spores are encased in a complex protein coat comprised of three spore coat layers; an amorphous undercoat, a lightly staining inner structure, and an electron-dense outer coat.
  • B. subtilis spore coat proteins have been cloned and sequenced and the sequence information has been used to express exogenous genes (those derived from non Bacillus hosts for example) on the surface of the spore.
  • exogenous genes such as derived from non Bacillus hosts for example
  • the present invention utilizes a Bt spore structural protein, such as spore coat protein or an exosporium protein to anchor a heterologous protein that is desirable to have expressed on the spore surface.
  • Bt spore structural protein such as spore coat protein or an exosporium protein
  • a large number of Bt isolates have been reported and these isolates are highly diversified.
  • the technology only describes the non- covalent association of these proteins and does not describe display on the exosporium (Du C, Chan WC, McKeithan TW, Nickerson KW. Appl Environ Microbiol. 2005,71(6):3337-41).
  • the present invention is not limited to Bt spore structural proteins but contemplates the use of other Bacillus spore structural proteins including, but not limited to, the spore outer coat protein genes of B. subtilis and B. cereus, and the exosporium protein genes of B. cereus.
  • Bt spores In addition to their outer coat, Bt spores contain an exosporium, which is a loose balloon-like structure, a structure which appears to be absent from the spores of B. subtilis. Since the exosporium is the outermost layer of the spore, it is the portion of the spore that makes the initial contact with a host organism (such as an insect including a target insect) or the environment. The exosporium is composed primarily of protein, but also contains lipid and carbohydrate. Exosporium proteins from related Bacilli have been identified, but to the Applicants' knowledge, none of the corresponding proteins from Bt have been cloned or sequenced.
  • Bacillus thuringiensis refers to a gram positive soil bacterium characterized by its ability to produce crystalline inclusions during sporulation.
  • a "subspecies” is defined as a taxonomic group that is a division of a species which is genetically distinguishable from other such populations of the same species.
  • exogenous as used herein means derived from outside the Bt host strain and the term “exogenous proteins” includes proteins, peptides, and polypeptides. Conversely, the term “endogenous” means derived from within the Bt host strain.
  • endogenous means derived from within the Bt host strain.
  • heterologous as used herein means derived from a different genetic source.
  • homologous as used herein means similar in structure and evolutionary origin.
  • a “host cell” or “host strain” is defined herein as a cell, which is a specific Bt strain, that is used in lab techniques such as DNA cloning to receive, maintain, and allow the reproduction of cloning vectors, for example, the expression vectors or plasmids of the present invention.
  • a “strain” is defined as a population of cells all descended from a single cell.
  • spore structural gene is meant any gene encoding a spore outer coat protein or an exosporium protein, or any functional derivatives or equivalents thereof.
  • Polynucleotide and “nucleic acid” refer to a polymer composed of nucleotide units (ribonucleotides, deoxyribonucleotides, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof) linked via phosphodiester bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof.
  • nucleotide polymers in which the nucleotides and the linkages between them include non-naturally occurring synthetic analogs.
  • nucleotide sequence when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T.”
  • upstream refers to the region or DNA extending in a 5' direction and the term “downstream” refers to an area on the same strand of DNA, that is located past the gene if one moves along the strand in a 5'-3' direction (the normal direction of transcription and leading strand replication).
  • a “gene” is a defined hereditary unit that occupies a specific location on a chromosome, determines a particular characteristic in an organism by directing the formation of a specific protein, and is capable of replicating itself at each cell division.
  • the term “reading frame” refers to a contiguous, non-overlapping set of triplet codons in RNA or DNA that begin from a specific nucleotide.
  • a “codon” is defined as the basic unit of the genetic code, comprising three-nucleotide sequences of messenger ribonucleic acid (mRNA), each of which is translated into one amino acid in protein synthesis.
  • recombinant refers to polynucleotides synthesized or otherwise manipulated in vitro ("recombinant polynucleotides”) and to methods of using recombinant polynucleotides to produce gene products encoded by those polynucleotides in cells or other biological systems.
  • a cloned polynucleotide may be inserted into a suitable expression vector, such as a bacterial plasmid, and the plasmid can be used to transform a suitable host cell.
  • a host cell that comprises the recombinant polynucleotide is referred to as a "recombinant host cell” or a “recombinant bacterium.”
  • the gene is then expressed in the recombinant host cell to produce, e.g., a "recombinant protein.”
  • a recombinant polynucleotide may serve a non-coding function (e.g., promoter, origin of replication, ribo some-binding site, etc.) as well.
  • a "cloning vector” is defined as a DNA molecule originating from a virus, a plasmid, or the cell of a higher organism into which another DNA fragment of appropriate size can be integrated without loss of the vector's capacity for self-replication.
  • Vectors introduce foreign DNA into host cells, where it can be reproduced.
  • Vectors are often recombinant molecules containing DNA sequences from several sources. The DNA introduced with the vector is replicated whenever the cell divides.
  • a “promoter” is an array of nucleic acid control sequences that direct transcription of an associated polynucleotide, which may be a heterologous or a native polynucleotide.
  • a promoter includes nucleic acid sequences near the start site of transcription, such as an RNA polymerase binding site.
  • an "expression cassette” refers to a series of polynucleotide elements that permit transcription of a gene in a host cell.
  • the expression cassette includes a promoter and a heterologous or native polynucleotide sequence that is transcribed.
  • a “linker” is a double-stranded oligonucleotide containing a number of restriction endonuclease recognition sites.
  • a “restriction endonuclease recognition site” or a “restriction site” is a specific nucleotide sequence at which a particular restriction enzyme cleaves the DNA.
  • a “restriction enzyme” or “restriction endonuclease” is a protein that recognizes specific, short nucleotide sequences and cleaves DNA at those sites.
  • operably linked refers to a functional relationship between two parts in which the activity of one part (e.g., the ability to regulate transcription) results in an action on the other part (e.g., transcription of the sequence).
  • a polynucleotide is "operably linked to a promoter" when there is a functional linkage between a polynucleotide expression control sequence (such as a promoter or other transcription regulation sequences) and a second polynucleotide sequence (e.g., a native or a heterologous polynucleotide), where the expression control sequence directs transcription of the polynucleotide.
  • PCR polymerase chain reaction
  • PCR is method for amplifying a DNA base sequence using a heat-stable polymerase and two primers, one complementary to the plus strand at one end of the sequence to be amplified and the other complementary to the minus strand at the other end. Because the newly synthesized DNA strands can subsequently serve as additional templates for the same primer sequences, successive rounds of primer annealing, strand elongation, and dissociation produce rapid and highly specific amplification of the desired sequence. PCR also can be used to detect the existence of the defined sequence in a DNA sample.
  • oligonucleotide and oligonucleotide primer
  • Polymerase is defined as an enzyme that catalyzes the synthesis of nucleic acids on preexisting nucleic acid templates.
  • the term "surface of the spore” or “the spore surface” means both the outer coat of the Bt spore and the exosporium of the Bt spore.
  • the term is used in its generic sense so, for example, when a heterologous protein is expressed on the surface of the spore (or the spore surface), the protein may be found on the outer coat or on the exosporium such that said heterologous protein is displayed in such a way that it is oriented to the outer environment such as the lumen of an insect's gut.
  • the term "attached” when used in the context of proteins "attached” the surface of the spore means a heterologous protein, fused with an outer coat protein or an exosporium protein, so that the heterologous protein is covalently linked to the surface of the spore by means of its fusion with an outer coat protein or an exosporium protein.
  • polypeptide polypeptide
  • peptide protein
  • amino acid polymers in which one or more amino acid residues is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
  • Amino acids may be referred to herein by either their commonly known three letter symbols or by Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes, i.e., the one-letter symbols recommended by the IUPAC-IUB.
  • High stringency conditions may be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.015 M sodium citrate/0.1% sodium dodecyl sulfate at 50-68 °C; (2) employ during hybridization a denaturing agent such as formamide, for example, 50% (v/v) formamide with 0.1 % bovine serum albumin/0.1 % Ficoll/0.1 % polyvinylpyrrolidone/50niM sodium phosphate buffer at pH 6.5 with 750 mM sodium , chloride, 75 mM sodium citrate at 42 0 C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 Dg/ml), 0.1% SDS, and 10% dextran sulfate at 42
  • Preferred hybridization conditions for very high stringency hybridization include at least one wash at 0.1 x SSC, 0.1 % SDS, at 6O 0 C for 15 minutes.
  • Preferred hybridization conditions for high stringency hybridization include at least one wash at 0.2 x SSC, 0.1 % SDS, at 60 0 C for 15 minutes.
  • Preferred hybridization conditions for moderate stringency hybridization include at least one wash at 0.5 x SSC, 0.1 % SDS, at 60 0 C for 15 minutes.
  • Preferred hybridization conditions for low stringency hybridization include at least one wash at 1.0 x SSC, 0.1 % SDS, at 60°C for 15 minutes.
  • hybridizing specifically to refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA.
  • Stringent conditions are sequence-dependent and will be different in different circumstances. As is well known in the art, longer sequences hybridize specifically at higher temperatures.
  • stringent conditions are selected to be about 5 0 C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
  • Tm is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium.
  • stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.05 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 0 C for short probes (e.g., 10 to 50 nucleotides) and at least about 60 °C for long probes (e.g., greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of DNA duplex destabilizing agents such as formamide.
  • nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence over a comparison window, as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
  • the percent identity exists over a region of the sequence that is at least about 25 amino acids in length, more preferably over a region that is 50 or 100 amino acids in length.
  • This definition also refers to the complement of a test sequence, provided that the test sequence has a designated or substantial identity to a reference sequence.
  • the percent identity exists over a region of the sequence that is at least about 25 nucleotides in length, more preferably over a region that is 50 or 100 nucleotides in length.
  • substantially identical in the context of two nucleic acids or polypeptides, refers to two or more sequences or subsequences that have at least 60%, preferably 70%, more preferably 80%, preferably 85%, more preferably 90%, more preferably 93%, more preferably 95%, more preferably 97%, preferably 98%, and most preferably 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection.
  • the substantial identity exists over a region of the sequences that is at least about 50 residues in length, more preferably over a region of at least about 100 residues, and most preferably the sequences are substantially identical over at least about 150 residues. In a most preferred embodiment, the sequences are substantially identical over the entire length of the coding regions.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. MoI. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection.
  • BLAST algorithm One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. MoI. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information website at http://www.ncbi.nlm.nih.gov. In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul (1993) Proc. Nat'l. Acad Sci. USA 90:5873-5787).
  • BLAST algorithm One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
  • sequence identity When percentage of sequence identity is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Alternatively, when one includes such conservative substitutions in the comparison, a percent "similarity" can be noted, as opposed to a percent “identity”. Means for making this adjustment are well known to those of skill in the art. The scoring of conservative substitutions can be calculated according to, e.g., the algorithm of Meyers & Millers, Computer Applic. Biol. ScL 4:11- 17 (1988), e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif.).
  • Target proteins may include insecticidal protein toxins, enzymes, and antigenic proteins. Such proteins may be expressed on the surface of one or more Bt spores in their entirety (i.e., the entire gene is introduced into the host cell and expressed as described more fully above and below) or as active components or subunits. Included in the target proteins of the present invention are amino acid sequence variants of the wild-type target proteins. These variants fall into one or more of three classes: substitution, insertion or deletion variants.
  • variants ordinarily are prepared by site-specific mutagenesis of nucleotides in the DNA encoding the target protein, using cassette or PCR mutagenesis or other techniques well known in the art, to produce DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture.
  • Variant target protein fragments having up to about 100-150 amino acid residues may be prepared by in vitro synthesis using established techniques.
  • Amino acid sequence variants are characterized by the predetermined nature of the variation, a feature that sets them apart from naturally occurring allelic or interspecies variation of the target protein amino acid sequence.
  • the variants typically exhibit the same qualitative biological activity as the naturally occurring analogue, although variants can also be selected that have modified characteristics.
  • Amino acid substitutions are typically of single residues; insertions usually will be on the order of from about 1 to about 20 amino acids, although considerably longer insertions may be tolerated. Deletions range from about 1 to about 20 residues, although in some cases, deletions may be much longer.
  • an “antigen” refers generally to a substance capable of eliciting the formation of antibodies in a host or generating a specific population of lymphocytes reactive with that substance.
  • Antigens may comprise macromolecules (e.g., polypeptides, proteins, and polysaccharides) that are foreign to the host.
  • the present invention provides methods for making and using recombinant Bacillus thuringiensis strains that have exogenous proteins attached to their spores.
  • Bacillus spores contain a protein coat which, in B. subtilis, is known to contain at least 20 polypeptides.
  • B. thuringiensis spores have an exosporium surrounding the mature spore which is comprised of protein, lipid, and carbohydrate.
  • Applicants cloned and sequenced four homologous spore outer coat protein genes from Bt, a spore outer coat protein gene promoter sequence, and an exosporium protein gene from Bt.
  • an expression cassette is placed in a Bt host to produce a recombinant Bt strain having an exogenous protein attached to its spore.
  • the expression cassette is comprised of a suitable sporulation promoter such as an outer coat protein gene promoter or an exosporium protein gene promoter, followed by a portion of a Bt spore coat protein gene or a Bt exosporium protein gene fused, in frame, to the exogenous gene of interest.
  • a suitable sporulation promoter such as an outer coat protein gene promoter or an exosporium protein gene promoter, followed by a portion of a Bt spore coat protein gene or a Bt exosporium protein gene fused, in frame, to the exogenous gene of interest.
  • the terms "fuse”, “fusion”, and “fusing” refer to the blending together of nucleic acid molecules, genes or proteins.
  • Suitable promoters include those found in Bacillus strains such as the cotG promoter from B. cereus (GenBank Accession
  • Applicants designed oligonucleotide primers based on B. cereus spore coat genes and on the B. cereus exosporium gene sequence and used the polymerase chain reaction to clone four Bt spore coat genes and a Bt exosporium gene. Based on their similarity to the B. cereus spore coat genes and B. cereus exosporium gene, Applicants designated the cloned Bt genes as cotE, cotG, cotYl, cotY2, and exsCL. Sequences upstream of the cotG gene were isolated that comprise the Bt cotG promoter.
  • sporulation-specific promoter preferably a spore coat protein gene promoter or an exosporium protein gene promoter. Use of a spore coat protein gene promoter or an exosporium protein gene promoter ensures expression at the appropriate time during the Bt life cycle.
  • the novel Bt cotG promoter from the present invention can be placed in the expression cassette, or another sporulation-specific promoter can be used.
  • Promoters used in the expression cassette may include any Bacillus sporulation-specific promoter, but preferably an exosporium protein gene promoter or spore coat protein gene promoter including, but not limited to, the specific promoters of bclA, dal, exsB, exsC, exsCL, exsD, exsE, exsF, exsG, exsH, exsl, exsJ, exsY, cotA, cotB, cotC, cotD, cotE, cotF, cotG, cotN, cotS, cotT, cotV, cotW, cotX, cotY, and cotZ.
  • the sequences of such promoters are readily obtainable from public nucleotide databases or can be identified using standard molecular biology techniques well within the skill of the ordinary artisan.
  • the portion of the spore outer coat protein gene or exosporium protein gene present in the expression cassette can be relatively small or it may include almost the entire spore coat or exosporium protein.
  • the number of spore coat protein gene or exosporium protein gene codons present in the expression cassette can be at least five, and preferably, at least twenty-seven. For example the entire Bt cotG gene excluding the stop codon can be placed in the expression cassette.
  • cotE SEQ ID NO:7
  • cotG SEQ ID NO:3
  • cotYl SEQ ID NO:1
  • cotY2 SEQ ID NO:5
  • the newly- identified spore genes cotE, cotG, cotYl, and cotY2 of the present invention or portions thereof may be used in the expression cassette.
  • spore outer coat protein genes for use in the present invention may be isolated from any Bacillus strain including, but not limited to, cotA, cotB, cotC, cotD, cotE, cotF, cotG, cotN, cotS, cotT, cotV, cotW, cotX, cotY, and cotZ among others.
  • Gene sequences for the above-mentioned genes may be found in any public source including public databases such as those maintained by the National Center for Biotechnology Information, university databases, publications including various those from various scientific journals and others well known to those of skill in the art.
  • exosporium protein gene exsCL (SEQ ID NO: 10) from the Bt galleriae strain SDS-502.
  • the newly-identified exsCL gene of the present invention or portions thereof may be used in the expression cassette.
  • exosporium proteins genes for use in the present invention may be isolated from any Bacillus strain including, but not limited to, bclA, dal, exsB, exsC, exsCL, exsD, exsE, exsF, exsG, exsH, exsl, exsJ, exsY among others. Gene sequences for the above-mentioned genes may be found in any public source including public databases such as those maintained by the National Center for Biotechnology Information, university databases, publications including various those from various scientific journals and others well known to those of skill in the art.
  • sequences of the present invention can be identified and defined in terms of their similarity or identity to the sequences of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO:10.
  • the sequences of the present invention comprise sequences which have greater than 55 or 60% sequence identity with SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO: 10, preferably greater than 70%, more preferably greater than 80%, more preferably greater than 90 or 95% or, in another embodiment, have 98 to 100% sequence identity with SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO:10.
  • the nucleic acid hybridizes under stringent conditions to nucleic acids having a sequence or complementary sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO: 10.
  • hybridize means to form base pairs between complementary regions of two strands of DNA.
  • spore coat protein gene sequences and their modified variations as both polynucleotides and polypeptides can be used to direct expression of a heterologous protein to the surface of a spore.
  • the genes and proteins of the present invention can also be defined in terms of the ability to hybridize with, or be amplified by, certain nucleic acid sequences.
  • the polynucleotides of the present invention include those that hybridize under stringent conditions to each of the above-mentioned polynucleotides or a probe that can be prepared from the above-mentioned polynucleotide, as far as they encode polypeptides having a functional effect allowing the assembly of heterologous proteins into the spores.
  • CotE SEQ ID NO: 8
  • CotG SEQ ID NO:4
  • CotYl SEQ ID NO:2
  • CotY2 SEQ ID NO: 6
  • Equivalent proteins will have amino acid similarity (and/or homology) with the exemplified proteins.
  • the amino acid identity will typically be greater than 60%, preferably greater than 75%, more preferably greater than 80%, even more preferably greater than 90%, and can be greater than 95%.
  • the classes of spore outer coat proteins provided herein can also be identified based on their immunoreactivity with certain antibodies.
  • the proteins further specifically bind to polyclonal antibodies raised against SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8, or portions of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8.
  • exosporium protein gene sequences and their modified variations as both polynucleotides and polypeptides can be used to direct expression of a heterologous protein to the exosporium.
  • the genes and proteins of the subject invention can also be defined in terms of the ability to hybridize with, or be amplified by, certain nucleic acid sequences.
  • the polynucleotides of the present invention include those that hybridize under stringent conditions to each of the above-mentioned polynucleotides or a probe that can be prepared from the above-mentioned polynucleotide as far as they encode polypeptides having a functional effect allowing the assembly of heterologous proteins into the spores.
  • ExsCL protein of the present invention has been specifically provided in SEQ ID NO:11. Since this protein is merely exemplary of the proteins of the subject invention, it should be readily apparent that the subject invention comprises modified variations or equivalent proteins (and nucleotide sequences coding for equivalent proteins) having the same or similar activity as the exemplified proteins.
  • Equivalent proteins will have amino acid similarity (and/or homology) with the exemplified proteins. The amino acid identity will typically be greater than 60%, preferably greater than 75%, more preferably greater than 80%, even more preferably greater than 90%, and can be greater than 95%.
  • exosporium proteins can also be identified based on their immuno-reactivity with certain antibodies.
  • the proteins further specifically bind to polyclonal antibodies raised against SEQ ID NO:11.
  • the exogenous gene placed in the expression cassette can encode a protein from a variety of classes depending on the desired application.
  • the exogenous gene encodes an insecticidal protein toxin isolated from a Bacillus species.
  • genes or nucleic acid sequences placed in the expression cassette can encode proteins, peptides, or polypeptides useful for vaccinations, particularly wildlife vaccinations. Target diseases include rabies, Lyme disease, and other diseases that are preventable by the administration of a vaccine.
  • genes placed in the expression cassette can encode enzymes or proteins useful in bio-remediation and other industrial applications.
  • any exogenous or endogenous gene can be placed in the expression cassette. The gene choice depends on the desired application of the resulting protein attached to the Bt spore.
  • the expression cassette may further include a linker to operably link, or join the spore outer coat protein or exosporium protein gene with the desired exogenous gene.
  • the linker restriction sites also called the “multiple cloning site" allow rapid and easy placement of a spore coat protein gene or exosporium protein gene upstream of the linker and the desired exogenous gene downstream of the linker.
  • the linker sequence can preferably encode as few as 10 and as many as 100 amino acids, although it is also possible for the linker to encode more than 100 amino acids.
  • the linker sequence must be designed in such a way that the reading frame is continued from the spore coat protein gene into the desired exogenous gene.
  • the linker maybe further comprised of an epitope that can be recognized by an antibody. This reactivity allows for tracking of the exogenous protein during product development and use.
  • the linker sequence allows the secondary and tertiary structures of the spore outer coat or exosporium protein to form correctly to ensure the heterologous protein fusion is directed to the spore outer coat or exosporium.
  • the linker structure permits the attached exogenous protein to be in an active form or precursor form such that it is functional, or can be correctly processed post-translationally.
  • the gene placed in the expression cassette will encode an insecticidal protein.
  • Insecticidal protein genes occur naturally in Bt as well as some other Bacillus species, such as Bacillus popilliae.
  • Insecticidal proteins, also called delta- endotoxins, or crystal protein, form crystals visible by phase contrast microscopy.
  • Insecticidal protein genes used in the present invention may include, but are not limited to, the following list (see also at the website biols.susx.ac.uk/home/Neil_C/rickmore/Bt/toxins2.html where sequences to the following proteins can be obtained either directly or via links to other websites): CrylAal, CrylAa2, CrylAa3, CrylAa4, CrylAa5, CrylAa ⁇ , CrylAa7, CrylAa8, CrylAa9, CrylAalO, CrylAal 1, CrylAal2, CrylAal3, CrylAal4, CrylAbl, CrylAb2, CrylAb3, CrylAb4, CrylAb5, CrylAb ⁇ , CrylAb7, CrylAb8, CrylAb9, CrylAblO, CrylAbl 1, CrylAbl2, CrylAbl3, CrylAbH, CrylAbl5, CrylAbl ⁇ , CrylAcl, CrylAc2, CrylAc3,
  • Recombinant or engineered insecticidal protein genes can also be used in the methods of the present invention.
  • a hybrid insecticidal protein gene made by fusing the N-terminal coding region of one insecticidal protein gene with the C- terminal coding region of another insecticidal protein gene can be used, hi another example, the insecticidal protein gene is engineered to encode a number of amino acid changes.
  • Bt insecticidal proteins are large protein protoxins (approximately 130 — 140 kDa). When larval insects ingest the crystal protoxin, it is solubilized in the insect midgut, and then cleaved by insect gut proteases to produce an active protein toxin of approximately 60 kDa from the N-terminal portion of the protein. In one embodiment of the present invention, only the portion of the crystal toxin gene or genes that encode the active toxin is placed in the expression cassette. In this embodiment, the proteolytic cleavage site can be placed in the linker sequence between the outer coat protein gene sequence and the active toxin sequence.
  • the active toxin is cleaved from the spore surface thereby inhibiting feeding on the crop or other plant treated with recombinant Bt spores.
  • the expression cassette can be placed in an expression vector such as a plasmid.
  • a plasmid expression vector can be further comprised of a gram positive origin of replication, a selectable marker, such as an antibiotic resistance gene, and optionally, a gram negative origin of replication.
  • selectable marker is a gene whose expression allows identification of cells that have been transformed or transfected with a vector containing the marker gene.
  • Plasmid expression vectors suitable for use in Bt include pUBl 10, pBC16-l, pC194, pE194, pUSHl, pUSH2, and pGVDl, among others ⁇ Bacillus genetic stock center catalog of strains, seventh edition, volume 2), which are readily available from well known commercial sources.
  • the expression cassette can be incorporated into the Bt genome, either on the chromosome or into a native Bt plasmid. Incorporation into the Bt genome can be accomplished using standard molecular biology techniques known to those skilled in the art, using for example transposons, bacteriophage, or homologous recombination with linear or circular DNA.
  • the expression vector can be introduced into Bt by electroporation or another method of nucleic acid transfer used by those skilled in the art.
  • Electroporation is the exposure of cells to rapid pulses of high- voltage current which renders the membrane of the cells permeable, thus allowing uptake, incorporation, and expression of DNA.
  • the host for the expression vector can be any Bacillus ihuringiensis strain including those Bt strains used to make commercial insecticides.
  • the Bt host strain can be selected from any subspecies including Bacillus thuringiensis subsp. aizawai, Bacillus thuringiensis subsp. galleriae, Bacillus thuringiensis subsp. entomocidus, Bacillus thuringiensis subsp. tenebrionis, Bacillus thuringiensis subsp. thuringiensis, Bacillus thuringiensis subsp. alesti, Bacillus thuringiensis subsp. americansis, Bacillus thuringiensis subsp.
  • darmstadiensis Bacillus thuringiensis subsp. dendrolimus, Bacillus thuringiensis subsp.finitimus, Bacillus thuringiensis subsp. kenyae, Bacillus thuringiensis subsp. monisoni, Bacillus thuringiensis subsp. subtoxicus, Bacillus thuringiensis subsp. toumanoffi, Bacillus thuringiensis subsp. pondicheriensis, Bacillus thuringiensis subsp. shandogiensis, Bacillus thuringiensis subsp. sotto, Bacillus thuringiensis subsp. nigeriae, Bacillus thuringiensis subsp.
  • Bacillus thuringiensis subsp. pakistani Bacillus thuringiensis subsp. japonensis, Bacillus thuringiensis subsp. colmeri, Bacillus thuringiensis subsp. pondicheriensis, Bacillus thuringiensis subsp. shandongiensis, Bacillus thuringiensis subsp. neoleonensis, Bacillus thuringiensis subsp. coreanensis, Bacillus thuringiensis subsp. silo, Bacillus thuringiensis subsp. mexcanensis, Bacillus thuringiensis subsp.
  • Bacillus thuringiensis subsp. berliner Bacillus thuringiensis subsp. cameroun, Bacillus thuringiensis subsp. ongbei, Bacillus thuringiensis subsp. fukuokaensis, Bacillus thuringiensis subsp. higo, Bacillus thuringiensis subsp. israelensis, Bacillus thuringiensis subsp. japonensis Buibui, Bacillus thuringiensis subsp. jegathesan, Bacillus thuringiensis subsp. kenyae, Bacillus thuringiensis subsp.
  • Bacillus thuringiensis subsp. medellin Bacillus thuringiensis subsp. roskildiensis, Bacillus thuringiensis subsp. san diego, Bacillus thuringiensis subsp. shanghai, Bacillus thuringiensis subsp. sotto, Bacillus thuringiensis subsp. tenebrionis, and Bacillus thuringiensis subsp. thompsoni.
  • Many of the above- listed strains may be obtained from commercial sources including the American Type Culture Collection, the U.S. Department of Agriculture, the Ohio State University Bacillus Genetic Stock Center and others that are well known to those of skill in the art.
  • Bacillus thuringiensis strains expressing fusion proteins may be constructed by homologous recombination of the second peptide coding into the endogenous spore coat gene such that the second peptide coding region is in frame with the spore coat gene reading frame to produce a single polypeptide.
  • the sequences of the present invention may be used as regions of homology to allow recombination into any desired Bacillus thuringiensis strain.
  • the present invention provides a means of controlling insects comprising delivering to the insects an effective amount of an insecticidal product according to the present invention.
  • the insecticidal protein and recombinant spore mixture is delivered to the insects orally.
  • Recombinant Bt strains can be fermented industrially and formulated into a composition suitable for the desired use.
  • Insecticidal Bt strains can be formulated into granules, droplets, wettable granules, powder, wettable powder, and aqueous-based formulation, or other appropriate formulations known to those of skill in the art.
  • the formulated Bt is delivered to the target insect pests on their locations, including the appropriate crop, turf, or body of water among others.
  • the formulated insecticide is applied using a suitable procedure and application rate.
  • the "application rate” is defined as the total pounds of the pesticide active ingredient applied to the selected crop or site. Preferred application rates can be between 0.01 and 10 pounds per acre depending on the insect pest and the insecticide.
  • the target insects of the present invention are lepidopteran and coleopteran insect pests, and particularly lamellicorn beetles (Scarabaeidae), although other insects can be targeted.
  • Bacillus species other than Bt
  • Bacillus israelensis commonly used to control mosquitoes
  • Bacillus sphaericus complements the weakness of B. israelensis.
  • B. sphaericus produces a number of mosquitocidal proteins.
  • the methods of the present invention allow for the expression of one or more B. sphaericus mosquitocidal proteins on the surface of B. israelensis spores.
  • the resulting recombinant spores will have an improved spectrum of mosquitocidal activity to control a wide variety of human disease mosquito vectors.
  • Bt spores are also useful for the production and immobilization of enzymes or proteins for industrial use. That is, the Bt spores find use as an industrial delivery platform for enzymes, binding and capture molecules, and detector reagents. In industrial biocatalysis, the spore may be decorated with a required enzymatic activity. In some instances, production synthesis can be performed that may be otherwise impossible in single organism fermentation runs. Enzymes of industrial relevance may be assembled into the spore outer and inner coat layers as fusion proteins. The modified or recombinant spores can be assayed for expression, stability, and activity. Immobilization of the spore can be accomplished by attachment of modified or recombinant spores to any type of solid support.
  • Appropriate solid supports include, but are not limited to, beads, glass beads, metal beads, membranes, gels, microtiter plates, vessels, containers, pellets, and polymers. Immobilization of the spore system allows repeated uses of the immobilized spore system, although mobile spores may also be reused.
  • Spore display systems of the present invention can be used as the source of a wide variety of enzymes and non-enzyme polypeptides having industrial, biomedical, and biotechnological uses.
  • the polypeptides to be displayed, incorporated, or expressed may originate in any species and can be either mononieric or multimeric.
  • Such polypeptides may be enzymes that are useful in detergent formulations, such as lipases, proteases, amylases, and the like.
  • such polypeptides may be enzymes that are useful for a variety of industrial or biosynthetic processes.
  • Such enzymes include, but are not limited to, glucose oxidase, galactosidase, glucosidase, nitrilase, alkene monooxygenase, hydroxylase, aldehyde reductase, alcohol dehydrogenase, D-hydantoinase, D- carbamoylase, L-hydantoinase, L-decarbamoylase, beta-tyrosinase, dioxygenase, serine hydroxy-methyltransferase, carbonyl reductase, nitrile hydratase, o-phthalyl amidase, halohydrin hydrogen-halide lyase, maltooligosyl trehalose synthase, maltooligosyl trehalose trehalohydrolase, lactonase, oxygenase, adenosylmethionine synthetase, cephal
  • Enzymes that may be used in spore systems of the present invention include proteins that interfere with mammalian cell viability or protein assembly in mammalian cell expression systems, such as retinoblastoma protein and leptin.
  • Other examples of enzymes suitable for use in the present invention are listed in Table 1 below.
  • the transformation of a substrate to a desired product in biocatalytic pathway is often a multi-step process requiring multiple enzymes.
  • One of the limiting factors in this kind of enzymatic transformation is the substrate concentration for the intermediate steps.
  • Individual intermediate substrates for transformation into the product each represent a potential limiting component of the entire chemical transformation.
  • the recombinant spores can be used to locally increase the substrate concentrations and thereby greatly increase the reaction rates of each of the intermediate steps increasing yields.
  • the different enzymes needed for a particular biocatalytic transformation can all be displayed on a single spore.
  • the proximity of catalytic centers acts to increase substrate concentration and enhance the completion rate of multi-step enzymatic transformations.
  • the topology of the spore surface is highly structured and provides a highly ordered three-dimensional lattice structure. That is, the different coat proteins occupy a specific predetermined and assembled location with respect to each other. This lattice structure defines a certain degree of proximity or distance from coat protein to coat protein.
  • This lattice structure defines a certain degree of proximity or distance from coat protein to coat protein.
  • An enzyme expressed on the surface of the spore is easily removed from the enzyme reaction mixture by simple sedimentation or centrifugation, washed and re-used. AU of these usages are made possible by immobilizing the enzyme on the surface of the Bt spores, such immobilization occurring by means of the enzyme's covalent linkage to a spore outer coat protein or exosporium protein. No special formulation of the spore enzyme is needed. The enzyme attached on the surface of the Bt spore is very stable. Often no refrigeration is needed for long-term storage. Once the recombinant Bt that is capable of expressing an enzyme on the surface is made, it can be produced in an industrial fermentor tank (bioreactor).
  • a simple fermentation media like nutrient broth or a complex medium like soybean flour with starch with or without a proper sporulation- supporting ingredient consisting of magnesium, manganese, iron, calcium salts can be used.
  • the spores may be harvested by centrifuging the fermentation broth and washing the pellet in a proper solution like 50 mM potassium phosphate buffer, pH 7.
  • Enzyme Utility i.e., Reaction Catalyzed
  • the methods of the present invention confer several advantages in the use of enzymes including: enabling simple process design using enzymes, low initial investment and operational costs; robustness in presence of organic solvents; stable in storage, under mechanical stress and/or high temperatures; high rate of recovery of the enzyme(s) following the industrial process for re-use; one vessel process with mixes of different spore-enzyme products; reducing part of customer's operational costs (less inventory and enzyme waste, higher enzyme recovery rate, stable input products); higher process yields (higher enzyme stability and better control of optimal process conditions e.g., enzyme concentration etc.); improvement of overall product quality (e.g.
  • the recombinant spores of the invention can be used in many industrial settings including, industrial fermentation reactions, industrial column reactors, cleanups, bioremediation of organic solvents and heavy metals, as delivery systems in agricultural applications, and the like.
  • the enzyme will vary depending upon the application.
  • Yet another application of the present invention is the use of the recombinant Bt spores as a vaccine.
  • One or more proteins that have one or more desired antigenic qualities may be expressed on the surface of Bt spores.
  • the recombinant Bt spores expressing the one or more antigens can be produced in a fermentor tank as described above.
  • the recombinant spores are harvested from the fermentation broth, washed and suspended in water or phosphate buffered saline.
  • Such a suspension may be formulated using suitable pharmaceutical excipients, adjuvants, and other materials well known to those of skill in the art and injected in animals or humans to immunize them.
  • the recombinant Bt spores expressing an antigen on the surface are dried by spray drying or freeze drying.
  • Animals or humans can inhale such a dry spore formulation and absorb the spore vaccine through the respiratory system.
  • diseases in which the methods of the present invention are directed to include: Marek disease, (MDV) Herpes Virus; Infectious bronchitis disease: (IBV); Infectious Larygotracheitis, (ILV) Herpes Virus; Infectious Bursal Disease, (IBV) Birna Virus; Newcastle Disease: (ND); Encephalomyelitis; Fowl Pox; Reovirus; Avian Flu, strain N5H1 flu; Mycoplasma; Cholera; Anthrax, Bubonic Plague; and Coccidia, Eimeria and Isospora.
  • MDV Herpes Virus
  • IBV Infectious Larygotracheitis
  • IBV Infectious Larygotracheitis
  • IBV Infectious Burs
  • the methods confer several advantages including: the recombinant Bt spores may be administered in food or via mucosal surfaces (nose, gills, etc.) by spray, that is, no injection with a syringe is needed; versatile system allowing the presentation of several antigens in one vaccine preparation therefore, conferring protection against multiple pathogens via one vaccine treatment; low development costs; and the recombinant Bt spores themselves may be used as adjuvants and/or enhancers of innate immunity, in conjunction with expressed antigens on their surface.
  • the disease-associated antigens include, but are not limited to, toxins, virulence factors, cancer antigens, such as tumor-associated antigens expressed on cancer cells, antigens associated with autoimmunity disorders, antigens associated with inflammatory conditions, antigens associated with allergic reactions, antigens associated with infectious agents, and autoantigens that play a role in induction of autoimmune diseases.
  • cancer antigens that can be used with spore systems and methods of the invention include, but are not limited to, Among the tumor-specific antigens that can be used in the antigen shuffling methods of the invention are: bullous pemphigoid antigen 2, prostate mucin antigen (PMA) (Beckett and Wright (1995) Int. J. Cancer 62: 703-710), tumor associated Thomsen-Friedenreich antigen (Dahlenborg et al. (1997) Int. J. Cancer 70: 63-71), prostate-specific antigen (PSA) (Dannull and Belldegrun (1997) Br. J. Urol.
  • PMA prostate mucin antigen
  • PSA prostate-specific antigen
  • EpCam/KSA antigen EpCam/KSA antigen
  • luminal epithelial antigen LEA.135
  • TCC breast carcinoma and bladder transitional cell carcinoma
  • CA 125 cancer-associated serum antigen
  • ECP40 epithelial glycoprotein 40
  • SCC squamous cell carcinoma antigen
  • the invention provides spore systems displaying at least one rotavirus capsid protein VP4, VP6, or VP7. Such spore systems are useful in methods for inducing an immune response against a VP4, VP6, or VP7 rotavirus, respectively.
  • Additional viral antigens that can be used with spore systems of the invention, methods for modulating immune responses against diseases and disorders associated with such antigens, and vaccines comprising spore systems, include, but are not limited to, hepatitis B capsid protein, hepatitis C capsid protein, hepatitis A capsid protein, Norwalk diarrheal virus capsid protein, influenza A virus N2 neuraminidase (Kilbourne et al. (1995) Vaccine 13: 1799-1803); Dengue virus envelope (E) and premembrane (prM) antigens (Feighny et al. (1994) Am. J. Trop. Med. Hyg. 50: 322-328; Putnak et al.
  • HIV antigens Gag, Pol, Vif andNef HIV antigens Gag, Pol, Vif andNef (Vogt et al. (1995) Vaccine 13: 202-208); HIV antigens gpl20 and gpl60 (Achour et al. (1995) Cell. MoI. Biol. 41:395-400; Hone et al. (1994) Dev. Biol. Stand. 82: 159-162); gp41 epitope of human immunodeficiency virus (Eckhart et al. (1996) J. Gen. Virol. 77:2001-2008); rotavirus antigen VP4 (Mattion et al. (1995) J. Virol.
  • rotavirus protein VP7 or VP7sc the rotavirus protein VP7 or VP7sc (Emslie et al. (1995) J. Virol. 69: 1747-1754; Xu et al. (1995) J. Gen. Virol. 76: 1971-1980; Chen et al. (1998) Journal of Virology VoI 72:7; pp 5757-5761); herpes simplex virus (HSV) glycoproteins gB, gC, gD, gE, gG, gH, and gl (Fleck et al. (1994) Med. Microbiol. Immunol.
  • HSV herpes simplex virus
  • influenza virus nucleoprotein and hemagglutinin (Deck et al. (1997) Vaccine 15: 71-78; Fu et al. (1997) J. Virol. 71: 2715-2721); B19 parvovirus capsid proteins VPl (Kawase et al. (1995) Virology 211: 359-366) or VP2 (Brown et al. (1994) Virology 198: 477-488); Hepatitis B virus core and e antigen (Schodel et al. (1996) Intervirology 39: 104-106); hepatitis B surface antigen (Shiau and Murray (1997) J. Med. Virol.
  • hepatitis B surface antigen fused to the core antigen of the virus Id.
  • Hepatitis B virus core-preS2 particles Nemeckova et al. (1996) Acta Virol. 40: 273-279
  • HBV preS2-S protein Kutinova et al. (1996) Vaccine 14: 1045-1052
  • VZV glycoprotein I Kutinova et al. (1996) Vaccine 14: 1045-1052
  • rabies virus glycoproteins Xiang et al. (1994) Virology 199: 132-140; Xuan et al. (1995) Virus Res.
  • HCV hepatitis C virus
  • Epstein-Barr virus (EBV) gp340 Mackett et al. (1996) J. Med. Virol. 50:263-271
  • Epstein-Barr virus (EBV) latent membrane protein LMP2 Lee et al. (1996) Eur. J. Immunol. 26: 1875-1883
  • Epstein-Barr virus nuclear antigens 1 and 2 Choen and Cooper (1996) J. Virol. 70: 4849-4853; Khanna et al. (1995) Virology 214: 633-637
  • the measles virus nucleoprotein (N) (Fooks et al.
  • Examples of medical conditions and/or diseases where down-regulation or decreased immune response is desirable include, but are not limited to, allergy, asthma, autoimmune diseases (e.g., rheumatoid arthritis, SLE, diabetes mellitus, myasthenia gravis, reactive arthritis, ankylosing spondylitis, and multiple sclerosis), septic shock, organ transplantation, and inflammatory conditions, including IBD, psoriasis, pancreatitis, and various immunodeficiencies.
  • autoimmune diseases e.g., rheumatoid arthritis, SLE, diabetes mellitus, myasthenia gravis, reactive arthritis, ankylosing spondylitis, and multiple sclerosis
  • septic shock e.g., rheumatoid arthritis, SLE, diabetes mellitus, myasthenia gravis, reactive arthritis, ankylosing spondylitis, and multiple sclerosis
  • septic shock e.g., rheum
  • autoimmune diseases including diabetes and rheumatoid arthritis
  • Other autoimmune-type disorders such as reactive arthritis
  • antigens for use in spore systems and methods of the invention to treat autoimmune diseases, inflammatory conditions, and other immunodeficiency-associated conditions are provided in Punnonen et al. (1999) WO 99/41369; Punnonen et al. (1999) WO 99/41383; Punnonen et al. (1999) WO 99/41368; and Punnonen et al. (1999) WO 99/41402), each of which is incorporated herein by reference for all purposes.
  • spore systems comprising one or more polypeptides, proteins, peptides, or nucleic acids capable of reducing or suppressing an immune response (e.g., antigens specific for or associated with a disease), such as T cell proliferation or activation, can be administered according to the methods described herein.
  • an immune response e.g., antigens specific for or associated with a disease
  • T cell proliferation or activation can be administered according to the methods described herein.
  • the invention provides spore systems and vaccines for treating allergies, and prophylactic and therapeutic treatment methods utilizing such spore systems and vaccines.
  • Antigens of allergens can be incorporated into spore systems as, e.g., using one of the display, presentation, or attachment formats described above so as to display, present, bind or express the antigen on the surface of a spore.
  • the antigen can also be expressed on the spore surface by, e.g., incorporating a DNA plasmid vector comprising a nucleotide sequence encoding the antigen into the spore and facilitating expression of the antigen on the spore surface.
  • allergies examples include, but are not limited to, allergies against house dust mite, grass pollen, birch pollen, ragweed pollen, hazel pollen, cockroach, rice, olive tree pollen, fungi, mustard, bee venom.
  • Antigens of interest include those of animals, including the mite (e.g., Dermatophagoides pteronyssinus, Dermatophagoides farinae, Blomia tropicalis), such as the allergens der pi (Scobie et al. (1994) Biochem. Soc. Trans. 22: 448S; Yssel et al. (1992) J. Immunol.
  • apple allergens such as the major allergen MaI d 1 (Vanek-Krebitz et al. (1995) Biochem. Biophys. Res. Commun. 214: 538-551); and peanut allergens, such as Ara h I (Burks et al. (1995) J. Clin. Invest. 96: 1715-1721).
  • a Bt spore is engineered to express a binding molecule, such as avidin or streptavidin, on its surface.
  • a binding molecule such as avidin or streptavidin
  • biotinylated molecules including, e.g., polypeptides, proteins, peptides, nucleic acids, polysaccharides, bacteria, viruses, small chemical or biological molecules, and other molecules as described herein, can be bound.
  • the spore serves as a carrier or delivery device.
  • the invention provides protein-based vaccine and immunomodulatory compositions comprising spores and spore systems expressing such binding molecules with immunomodulatory molecules or protein-based vaccines bound thereto for use in therapeutic or prophylactic applications.
  • the spores themselves can be used as an adjuvant for immunomodulatory molecules or vaccines (e.g., genetic vaccines, DNA vaccines, protein vaccines, attenuated or killed viral vaccines).
  • the spores can be modified or recombinant spores, non-modified or non-recombinant spores.
  • any such spores can be viable or non-viable.
  • an “adjuvant” is a compound that acts in a non-specific manner to augment specific immunity (e.g., an immune response) to an immunomodulatory molecule, such as, e.g., an immunogenic polypeptide or peptide or antigen, by stimulating an earlier, stronger or more prolonged response to an immunomodulatory molecule.
  • an immunomodulatory molecule such as, e.g., an immunogenic polypeptide or peptide or antigen
  • the Bt spore serves as an adjuvant, acting in a non ⁇ specific manner to enhance specific immunity to the immunomodulatory molecule or vaccine by stimulating an earlier, stronger or more prolonged response to the immunomodulatory molecule or vaccine.
  • the spores may comprise viable spores or non ⁇ viable or non-germinating spores.
  • the immunomodulatory molecule may comprise, e.g., an immunogenic protein, polypeptide, or peptide; or antigen or fragment thereof; a nucleic acid having immunomodulatory properties; or a nucleotide sequence encoding an immunomodulatory molecule; or the like.
  • the vaccine may comprise, e.g., a genetic vaccine, DNA vaccine, protein-vaccine, or attenuated or killed viral vaccine.
  • the enhanced immune response comprises an increased production of antibodies specific to the immunomodulatory protein, polypeptide, peptide or antigen that is readily measured by known assays, including those described herein (e.g., ELISA, etc.).
  • spores can be prepared that express other immunostimulatory molecules or other molecules involved in determining vaccine effectiveness, such as, e.g., cytokines (e.g., interleukins (IL), interferons (IFN), chemokines, hematopoietic growth factors, tumor necrosis factors and transforming growth factors), which are small molecular weight proteins that regulate maturation, activation, proliferation and differentiation of the cells of the immune system.
  • cytokines e.g., interleukins (IL), interferons (IFN), chemokines, hematopoietic growth factors, tumor necrosis factors and transforming growth factors
  • IL interleukins
  • IFN interferons
  • chemokines e.g., hematop
  • Cytokines suitable for use in the invention include IL-I, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-IO, IL-I l, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, GM-CSF, G-CSF, TNF-O, IFN-D, IFN-65 , and IL-20 (MDA-7). Antagonists of such cytokines can also be expressed on spores for use as therapeutic and/or prophylactic agents in immunomodulatory methods described herein.
  • Bt spores can be prepared that express co-stimulatory molecules that play a fundamental role in the regulation of immune responses.
  • a co-stimulatory molecule refers to a molecule that acts in association or conjunction with, or is involved with, a second molecule or with respect to an immune response in a co-stimulatory pathway.
  • a co-stimulatory molecule may be an immunomodulatory molecule that acts in association or conjunction with, or is involved with, another molecule to stimulate or enhance an immune response, hi another aspect, a co-stimulatory molecule is immunomodulatory molecule that acts in association or conjunction with, or is involved with, another molecule to inhibit or suppress an immune response.
  • a co-stimulatory molecule need not act simultaneously with or by the same mechanism as the second molecule.
  • Some such co-stimulatory molecules comprise co- stimulatory polypeptides that have positive co-stimulatory properties, such as the ability to stimulate or augment T cell activation and/or proliferation.
  • Membrane-bound co- stimulatory molecules include CDl, CD40, CD 154 (ligand for CD40), CD40 ligand, CD27, CD80 (B7-1), CD86 (B7-2) and CD150 (SLAM), and variants or mutants thereof. May such co-stimulatory molecules are typically expressed on lymphoid cells after activation via antigen recognition or through cell-cell interactions.
  • heterologous antigens, polypeptides, proteins, and peptides can be attached to the spore outer-coat by creating genetic fusions between outer-coat proteins and target antigens, polypeptides, proteins, or peptides.
  • target antigens polypeptides, proteins, or peptides.
  • coat proteins to attach and display proteins, polypeptides, or peptides, it is recognized that such proteins, polypeptides, or peptides may be displayed in a manner to stretch or torque such sequences, e.g., to expose internal domain surfaces or to change enzyme or antigenic activities.
  • the protein, polypeptide, or peptide of interest can be fused to one coat protein at the amino terminal, may be fused to a coat protein at the carboxyl terminal, may be fused to one coat protein at the amino terminal and a second coat protein at the carboxyl terminal, or may be internally fused to a coat protein.
  • the central protein, polypeptide, or peptide of interest will be stretched.
  • the invention also provides a spore system comprising one or more combinations of any one of the following components: nucleic acids, polypeptides, proteins, peptides, antigens, co-stimulatory agents, immunomodulatory molecules, adjuvants, cytokines, any of the biotinylated molecules bound to the spore surface via streptavidin or avidin as described above, or other molecules of interest.
  • Such components can be, e.g., displayed on, presented on, bound or attached to the spore surface, encapsulated or contained with the spore, associated with the spore, carried or held by the spore, or coated onto the spore surface.
  • Such combinations of multiple components and different components are especially useful in methods of modulating immune responses.
  • an antigen and co-stimulatory molecule or cytokine in conjunction with one another can augment the immunostimulatory response, since both types of molecules are integral to responses.
  • an adjuvant with an antigen and adjuvant can dramatically increase the immunostimulatory effectiveness of the antigen.
  • Spore systems can be made to comprise selected combinations of such molecules dependent upon the specific application and treatment protocol. Methods of modulating immune response in a subject by administering such spore systems or compositions thereof in an amount sufficient to modulate the response are also included.
  • proteins or polypeptides or peptides suitable for use in the present invention include full-length native proteins, partial proteins or protein fragments, or peptides or polypeptides or polypeptide fragments.
  • Proteins and polypeptides include suitable biologically active variants of native or naturally occurring proteins and can be fragments, analogues, and derivatives of such proteins.
  • Such biological activity may be any biological activity.
  • such biological activity may be insecticidal activity, or enzymatic activity, or it may be the ability to alter or modulate an immune response in a subject.
  • a polypeptide, protein, or peptide of the present invention may be an enzyme, such as, for example, lactase.
  • a polypeptide, protein, or peptide of the present invention is molecule capable of augmenting an immune response, such as, e.g., an antigen or an adjuvant.
  • polypeptide, protein, or peptide may be an insecticide.
  • Polypeptides, proteins, and peptides of interest include, but are not limited to, insecticidal protein toxins, cytokines, antigens, antibodies, binding receptors, defensive agents, anti-microbial agents, immunomodulatory molecules, co- stimulatory molecules, enzymes, and epitopes.
  • Suitable routes of administration or "delivery systems” include parenteral delivery and enteral delivery, such as, for example, oral, transdermal, transmucosal, intravenous, subcutaneous, intramuscular, intradermal, intraperitoneal, intracapsular, intraspinal, intrasternal, intrapulmonary, intranasal, vaginal, rectal, intraocular, and intrathecal, buccal (e.g., sublingual), respiratory, topical, ingestion, and local delivery, such as by aerosol or transdermally, and the like.
  • parenteral delivery and enteral delivery such as, for example, oral, transdermal, transmucosal, intravenous, subcutaneous, intramuscular, intradermal, intraperitoneal, intracapsular, intraspinal, intrasternal, intrapulmonary, intranasal, vaginal, rectal, intraocular, and intrathecal, buccal (e.g., sublingual), respiratory, topical, ingestion, and local delivery, such as by aerosol or transdermally
  • the methods comprise preparing and administering to a subject a composition comprising a spore system of the present invention.
  • a composition comprising a spore system of the present invention.
  • Such composition may include a carrier or excipient.
  • a polypeptide, protein, peptide, nucleic acid, or other molecule of interest is displayed on the surface of the spore.
  • the polypeptide, protein, or peptide of interest is expressed by the vegetative cells resulting from the germination and/or vegetative reproduction of a spore.
  • the spore displays a polypeptide, protein, or peptide with DNA binding capabilities that is bound to a DNA molecule encoding an antigen or immunomodulatory molecule or that is an antigen or immunomodulatory molecule.
  • Subject animals can also include wild animals.
  • subjects include American buffalo (bison), which often carry the disease brucellosis, which can infect humans and causes spontaneous abortions in cattle.
  • rabies vaccinations or therapeutic or prophylactic agents comprising spore systems of the invention are administered to a variety of wild animal populations in a particular area by distributing spores from an overflying plane.
  • the present invention provides a relatively inexpensive means for vaccinating or treating wild populations against a variety of illnesses and diseases.
  • Diseases and illnesses that are potential targets of this vaccination approach include all those described above, including, e.g., those caused by cholera (e.g., enterotoxins from V. cholerae), Japanese encephalitis, tick-borne encephalitis, Venezuelan Equine encephalitis, enterotoxins produced by Staphylococcus and Streptococcus species, and enterotoxigenic strains of E. coli (e.g., heat-labile toxin from E. coli), and salmonella toxin, shigella toxin and Campylobacter toxin, dengue fever, and hantavirus.
  • cholera e.g., enterotoxins from V. cholerae
  • Japanese encephalitis tick-borne encephalitis
  • Venezuelan Equine encephalitis enterotoxins produced by Staphylococcus and Streptococcus species
  • enterotoxigenic strains of E. coli e.g., heat-labile toxin from E.
  • Distribution of the vaccine or other prophylactic or therapeutic agent comprising a spore system of the invention to fish in the aquaculture or aquarium trades can be accomplished by injection or immersion techniques.
  • Immersion, or dipping is an inoculation or vaccination method well known to one of skill in the art (see e.g., Vinitnantharat et al. (1999) Adv. Vet. Med. 41:539-550).
  • a dip treatment involves dipping whole fish in a dilution of the inoculant or vaccine whereupon the inoculant or vaccine is absorbed by the gills.
  • Intraperitoneal injection is another vaccination method well known to one of skill in the art.
  • Injection involves anesthetizing and injecting the fish intraperitoneally (Vinitnantharat et al. (1999) Adv. Vet. Med. 41:539-550).
  • Diseases of cultivated fish that may be treated using a spore system of the invention include, but are not limited to, infectious pancreatic necrosis (IPN), infectious hematopoietic necrosis (IHN), Vibriosis (Vibrio anguillaruni), cold-water vibriosis (Vibrio salmonicida), Vibrio ordalii, winter ulcer (Vibrio viscosus), Vibrio wodanis, yersiniosis (Yersinia ruckeri) or Enteric Red Mouth, Bacterial Kidney Disease, Furunculosis (Aeromonas salmonicida subsp.
  • Fish species of interest include, but are not limited to, salmonids, including Rainbow Trout (Onchorhycus mykiss), salmon (Salmo salar), Coho salmon (Oncorhynchus kisutch), Steelhed (Oncorhynchus mykiss), rockfish (Sebastis schlegeli), catfish (Ictalurus punctatus), yellowtail, Pseudobagrus fulvidraco, Gilt-head Sea Bream, Red Drum, European Sea Bass fish, striped bass, white bass, yellow perch, whitefish, sturgeon, largemouth bass, Northern pike, walleye, black crappie, fathead minnows, and Golden Shiner minnows.
  • Invertebrates of interest include, but are not limited to, oysters, shrimp, crab, and lobsters.
  • pulmonary inhalation Delivery by pulmonary inhalation, nasal delivery, gill delivery, or respiratory delivery provides a promising route for absorption of polypeptides and other molecules of interest having poor oral bioavailability due to inefficient transport across the gastrointestinal epithelium or high levels of first-pass hepatic clearance.
  • nasal delivery is intended that the polypeptide is administered to the subject through the nose.
  • pulmonary inhalation is intended that the polypeptide or other substance of interest is administered to the subject through the airways in the nose or mouth so as to result in delivery of the polypeptide or other substance to the lung tissues and into the interior of the lung.
  • Both nasal delivery and pulmonary inhalation can result in delivery of the polypeptide or other substance to the lung tissues and into the interior of the lung, also referred to herein as "pulmonary delivery.”
  • pulmonary delivery is intended that the polypeptide or other substance is administered to the subject through the respiratory system of the subject so as to result in delivery of the polypeptide or other substance to the organs and tissues of the respiratory system of the subject organism.
  • the organs and tissues of the respiratory system of a subject organism include, but are not limited to, the lungs, nose, or gills.
  • compositions including those comprising spore systems, as an aqueous liquid aerosol, a nonaqueous suspension aerosol, or dry powder aerosol for pulmonary administration using these respective delivery devices can influence polypeptide stability, and hence bioavailability as well as biological activity following delivery. See Wall (1995) Drug Delivery 2:1-20; Krishnamurthy (March 1999) BioPharm., pp. 34-38).
  • the enhanced stability of the spore systems of the present invention is therefore of value in administration by respiratory delivery.
  • the Bt spore is between 1 and 1.5 uM in size which is the optimal size range for deep lung delivery, further enhancing its efficacy as a respiratory delivery vehicle.
  • nucleic acids sizes are given in either kilobases (kb) or base pairs (bp). These are estimates derived from agarose or acrylamide gel electrophoresis, from sequenced nucleic acids, or from published DNA sequences.
  • kb kilobases
  • bp base pairs
  • proteins sizes are given in kilodaltons (kDa) or amino acid residue numbers. Proteins sizes are estimated from gel electrophoresis, from mass spectroscopy, from sequenced proteins, from derived amino acid sequences, or from published protein sequences.
  • Oligonucleotides that are not commercially available can be chemically synthesized according to the solid phase phosphoramidite triester method first described by Beaucage & Caruthers, Tetrahedron Letts. 22:1859-1862 (1981), using an automated synthesizer, as described in Van Devanter et al., Nucleic Acids Res. 12:6159-6168 (1984).
  • sequence of the cloned genes and synthetic oligonucleotides can be verified after cloning using, e.g., the chain termination method for sequencing double-stranded templates of Wallace et al., Gene 16:21-26 (1981).
  • spore outer coat protein genes were isolated from Bt strain SDS-502 using the polymerase chain reaction (PCR). Primers were designed based on gene sequences published for Bacillus anthracis and Bacillus cereus. All primer pairs were used with genomic DNA as a template.
  • the primer pairs are shown as follows: cotYl-F: 5"- AGTTGTAACGAAAATAAACACC ⁇ SEQ ID NO:12> cotYl-R: 5'- TTAGATAGTAACGTCGCGTTAAGC ⁇ SEQ ID NO:13> amplified the spore coat protein Yl gene (cotYl), cotG-F: 5'- ATGAAACGTGATATTAGAAAAGC ⁇ SEQ ID NO:14> cotG-R: 5'- CTAGCAGTTACGTTTTTTATACC ⁇ SEQ ID NO:15> amplified the spore coat protein G gene (cotG), cotY2-F: 5'- ATGAGCTGCAATTGTAACGAAGACC ⁇ SEQ ID NO:16> cotY2-R: TTAAATAGAAACATCGCGTAAGC ⁇ SEQ ID NO:17> amplified the spore coat protein Y2 gene (cotYl), and cotE-F: 5' ATGTCCGAATTTAGAGAG
  • the polymerase chain reaction mixture contained: 10 ⁇ l 1OX buffer, 2 ⁇ l d-NTP, 2.5 ⁇ l Primer 1 (20 ⁇ M), 2.5 ⁇ l Primer 2 (20 ⁇ M), 2 ⁇ l Taq Polymerase, 1 ⁇ l template DNA (a genomic DNA preparation of Bt SDS-502) and 80 ⁇ l water.
  • the temperature cycling in the PCR was 96°C (30 sec.) 45°C (45 sec.) 72°C (1 min. 30 sec), for 30 cycles, with the exception of cotE, which was amplified using 40 cycles.
  • exsCL The exosporium gene, exsCL, was isolated from Bt strain SDS-502 using the polymerase chain reaction (PCR). Primers were designed based on a gene sequence published for Bacillus cereus. Primer pairs are as follows: PHN007 5'-TGTATGCATTTAACTCCGCTGG ⁇ SEQ ID NO:21> PHN008 5'- TTAAGCGATTTTTTCAATAATAATAG ⁇ SEQ ID NO:22>
  • the primer pairs were used with genomic DNA as a template to amplify the exosporium gene, exsCL.
  • the polymerase chain reaction mixture contained: 10 ⁇ l 1OX buffer, 2 ⁇ l d-NTP, 2.5 ⁇ l Primer 1 (20 ⁇ M), 2.5 ⁇ l Primer 2 (20 ⁇ M), 2 ⁇ l Taq Polymerase, 1 ⁇ l template DNA (a genomic DNA preparation of Bt SDS-502) and 80 ⁇ l water.
  • the temperature cycling in the PCR was 96°C (30 sec.) 45°C (45 sec.) 72°C (1 min. 30 sec), for 30 cycles.
  • a band of the anticipated size (approximately 387 bp) was identified by agarose gel electrophoresis and cloning was done with the TA Topo cloning kit (Clontech Inc.). DNA sequencing was performed on an ABI 3700 with the M13 forward and reverse universal primers. Sequence discrepancies were resolved by aligning complimentary sequences and viewing the chromatographs.
  • the cotG gene under the control of its own promoter is fused to a Bt insecticidal protein gene and expressed on the surface of Bt spores (see FIG. 2).
  • the host Bt strain is B. kurstaki, HD-I, a naturally occurring Bt strain used in commercial insecticides active against lepidopteran crop pests such as tomato horn worms.
  • the insecticidal protein gene, cry ICa is obtained from B. thuringiensis subspecies aizawai.
  • the Cry ICa protein is also active against lepidopteran pests, but is more active against beet armyworm, Spodoptera exigua, than any insecticidal proteins found in Bt strain HD- 1. Addition of the Cry ICa protein to Bt strain HD-I broadens the insecticidal range of the strain.
  • the expression cassette used in this example is shown in SEQ ID NO:23 (nucleotide) and SEQ ID NO:24 (peptide).
  • the expression cassette contains the cotG promoter, the spore outer coat protein gene cotG, and the cry ICa gene sequence. Translation of the sequence, SEQ ID NO:23, produces one large heterologous protein which is an in-frame fusion of CotG and Cry ICa. Use of the cotG promoter ensures expression of the heterologous protein during sporulation.
  • the expression cassette is cloned into an appropriate expression vector such as one reported by Sasaki et al., ⁇ Current Microbiol.
  • the recombinant strain is industrially fermented, formulated, and applied to vegetable crops to control a variety of lepidopteran pests.
  • the expression cassette that is cloned in the Sasaki expression vector is also introduced into the cry-minus (plasmid cured to eliminate insecticidal protein genes) Bt HD-I derivative called BT51, which is obtained from Dr. Shin-ichiro Asano, Hokkaido University ⁇ Current Microbiol. 1996, 32 195-200). While the spores ofBT51 show no insecticidal activity against S. exigua by diet-mixing assay, the recombinant spores containing this expression cassette exert insecticidal activity against S. exigua.
  • the Cry ⁇ Da protein gene from B. thuringiensis subsp. galleriae strain SDS-502 is toxic to scarabaeid insects (beetles).
  • the expression cassette contains a sporulation-specific promoter, and the cotE gene fused in frame to the cry8Da gene (FIG. 4 depicts the nucleotide and protein sequences of the expression cassette).
  • the expression cassette is cloned in an appropriate expression vector such as one reported by Sasaki et al., (Current Microbiol. 1996, 32 195-200) and transformed into Bt kurstaki HDl, a Bt strain with insecticidal activity against lepidopteran pests (such as moth larvae).
  • the resulting recombinant Bt strain is fermented industrially and formulated into an insecticidal product.
  • the cotYl Gene Fused to the N-Terminal Coding Region of the cry ICa Gene The naturally-occurring cry ICa gene is 3570 bp and encodes a 135 kDa Cry ICa protoxin (Nucleic Acids Res. 1988 July 11; 16 (13): 6240).
  • the CrylCa protein When the CrylCa protein is ingested by the insect, it is cleaved to an approximately 66 kDa toxin by proteases present in the insect midgut.
  • the cleavage site is comprised of the amino acids 621 through 638 which have the sequence 621-AESDLER-AQKAVNALFTS-638 ⁇ SEQ ID NO:25>.
  • the C-terminal sequence of the 66-kDa active toxin is 621 -AESDLER- 627 ⁇ SEQ ID NO:26>.
  • the expression cassette contains a Bt sporulation-specific promoter, the Bt cotYl gene, a linker sequence, and a portion of the cry ICa gene encoding only the active portion of the CrylCa protein.
  • a truncated cry ICa gene encoding only amino acids 1 though 627 is inserted into the expression cassette.
  • the cassette sequences are SEQ ID NO:26 (nucleotide) and SEQ ID NO:27 (peptide).
  • Figure 3 depicts the nucleotide and protein sequences of the expression cassette.
  • the linker design in this example includes several important features. First, it includes two restriction sites Ncol and Ndel that provide convenient cloning sites for insertion of the cry ICa gene and contain the ATG translation start sequence (FIG 6). Second, the linker is designed to encode the CrylCa proteolytic cleavage site, 624- DLER-AQKAV ⁇ ALFTS-638 ⁇ SEQ ID NO:28>. When spores with attached CrylCa heterologous proteins on their surface are ingested by a susceptible insect, the linker sequence ensures that the midgut proteases release the activated CrylCa from the spore effectively.
  • the nucleic acid sequence of the linker encoding the proteolytic cleavage site is carefully designed so it is not identical to the coding region at the cry ICa C-terminal encoding the last four amino acids DLER. This important feature prevents a recombination event between two identical DNA sequences that could remove the cry 1 CaI gene from the expression cassette.
  • the linker is further comprised of an epitope which has the amino acid sequence YPYDVPDYA ⁇ SEQ ID NO:29>. Commercial monoclonal antibodies are available that bind the epitope to allow tracking of the fusion protein.
  • the fusion protein produced is substantially smaller because the 65-kDa carboxyl end of the CrylCa protoxin is not included in the expression cassette.
  • the linker sequence serves as a flexible tether allowing proper folding of both the spore outer coat protein CotYl and the active portion of the CrylCa insecticidal protein. By acting as a tether there is also a reduction of the possibility of functional hindrance of the proteolytic cleavage site.
  • the immobilization of proteins (tethering) also adds stability to the proteins increasing the half life of the insecticide.
  • This expression cassette is cloned into an expression vector which is then transformed into B. kurstaki strain HD-I.
  • the resulting recombinant Bt strain is fermented industrially, formulated into a wettable powder insecticide, and sprayed onto the appropriate vegetable crops.
  • the recombinant Bt strain produces the Cry ICa protein attached to the spore during sporulation.
  • the recombinant Bt strain has two different crystal proteins attached to the surface of the spore. Both proteins attached to the spore have insecticidal activity against scarabaeidae larvae (beetles).
  • the cotG sporulation-specific promoter drives expression of the cotG gene operably linked to the cry 8Da gene from B. thuringiensis subsp. galleriae SDS-502, and the cotYl gene is operably linked to the cryhimel gene, a cry43Aa-like gene isolated by Dr. Shin-ichiro Asano, Hokkaido University, from Bacillus popilliae strain Hime.
  • Bacterial promoters often drive the expression of several genes at one time. In this example, a single promoter is used to direct the expression of two different insecticidal protein genes with the resulting gene products attached to the surface of the spore.
  • the expression cassette is cloned into the appropriate expression vector which is then transformed into Bt HD-73.
  • the Bt strain selected as the host strain for this plasmid is also capable of producing at least one endogenous insecticidal protein so that the resulting recombinant strain of Bt can produce at least three insecticidal toxins (one endogenous, two exogenous), each having a distinct insecticidal activity.
  • One strategy for design of the expression cassette utilizes the first 53 amino acids of the CotG protein (SEQ ID NO:4).
  • a linker is inserted between amino acid proline 53 and amino acid arginine 54, and the insecticidal protein is added to the 3' end of the linker.
  • the expression cassette encodes the first 53 amino acids of the Bt CotG protein, followed by the amino acids comprising the linker sequence including an insecticidal proteolytic site, the insecticidal protein, or the active portion of the insecticidal protein, and finally the remaining amino acids of the CotG protein, starting from the arginine at amino acid 54.
  • the heterologous protein produced from the expression cassette contains two proteolytic cleavage sites; one encoded by the linker, while the other is the naturally-occurring proteolytic cleavage site present in the insecticidal protein.
  • the heterologous protein produced from the expression cassette undergoes two cleavage events to release the active insecticidal toxin from the spore.
  • the exsCL gene under the control of a Bt exosporium gene promoter is fused to the insecticidal cry ICa gene from B. thuringiensis subsp. aizawai.
  • the host strain is Bt kurstaki, HD-I, a naturally occurring Bt strain used in commercial insecticides active against lepidopteran crop pests such as tomato horn worms.
  • the Cry ICa protein is also active against lepidopteran pests, but is more active against Spodoptera exigua than the toxins found in Bt strain HD-I. Addition of the Cry ICa protein to Bt strain HD-I broadens the insecticidal range of the strain.
  • the expression cassette used in this example is shown in SEQ ID NO: 16 (nucleotide).
  • the expression cassette contains a Bt promoter (which can be a sporulation- specific promoter), the exosporium gene exsCL, a DNA linker sequence, and the cry ICa gene sequence.
  • the sequence used in the expression cassette contains an exosporium gene promoter, the exsCL gene sequence, and the crylCa gene sequence (SEQ ID NO:30). Translation of the sequence SEQ ID NO:30 produces one large heterologous protein as shown in SEQ ID NO:31 which is an in-frame fusion of ExsCL and CrylCa. Use of a Bt exosporium gene promoter ensures expression of the heterologous protein during sporulation.
  • the Cry8Da protein gene from B. thuringiensis subsp. galleriae strain SDS-502 is toxic to scarabaeid insects (beetles).
  • the expression cassette contains a sporulation-specific promoter, and the exsCL gene fused in frame to the c?y8Da gene.
  • the expression cassette is cloned in an appropriate expression vector and transformed into Bt kurstaki HDl, a Bt stain with insecticidal activity against lepidopteran pests (such as moth larvae).
  • the resulting recombinant Bt strain is fermented industrially and formulated into an insecticidal product.
  • Example 5 showed the toxic region of Cry ICa fused to CotG protein with certain linkers that allow easy processing in the insect gut to liberate the toxic protein (see FIG. 5 for the nucleotide and protein sequences of the cassette).
  • a similar construct is made with ExsCL as shown in SEQ ID NO:32 (nucleotide) and SEQ ID NO:33 (peptide). The junction sequence is shown in FIG 7.
  • the recombinant Bt strain has two different crystal proteins attached to the exosporium. Both of the attached proteins have insecticidal activity against scarabaeidae larvae (beetles).
  • Bacterial promoters often drive the expression of several genes at one time. In this example, a single promoter is used to direct the expression of two different insecticidal proteins to the exosporium.
  • the sporulation- specific promoter drives expression of the exsCL gene operably linked to the cr ⁇ 8Dal gene from Bacillus thuringiensis subsp. galleriae SDS-502, and cryhimel, a gene isolated from Bacillus popilliae var. popilliae Hime, cry 43 A.
  • a fungal lipase of Penicillium expanswn (GenBank Accession No. AAK07480) is fused to the first 53 amino acid residues of the N-terminal end of CotG via a flexible linker and expressed on the surface of Bt spores.
  • the lipase protein sequence is back- translated using a Bt codon usage table provided by Vector NTI.
  • the back-translated lipase nucleotide sequence is linked to the N-terminal portion of the native cotG protein gene via a linker that provides the protein structural flexibility.
  • the nucleotide sequence coding for the entire CotG-Lipase fusion protein is synthesized with Apal and Ban ⁇ Rl cloning sites at the 5' and 3' ends as shown in SEQ ID NO:34. This nucleotide is then cloned in the Sasaki vector as described in Example 3, supra, between Apal and Bam ⁇ I.
  • the synthesized nucleotide contains the cotG promoter and the vector provides the transcription terminator between BamR ⁇ and Notl.
  • the vector containing the fusion gene is introduced to Bt cry-minus strain BT51 by electroporation.
  • the BT51 spore expresses the fusion protein as shown in SEQ ID NO:35.
  • Recombinant spore lipase activity on soybean lipid is detected by Rhodamine B.
  • the lipase on the spore hydrolyzes triacylglycerol in soybean oil to release free fatty acids which produce fluorescence with Rhodamine B. No fluorescence is observed with the native spores.
  • the recombinant Bt (BT51) spores expressing the cry ICa gene described in Example 3, supra, are injected into rabbits without any adjuvant. About 0.5 ml spore-in- water suspension containing about 10 billion spores are injected subcutaneously on the shoulder of each rabbit every one week for 4 weeks. One week after the final injection, serum is collected and the immuno-reactivity against Cry ICa is tested by Western Blot. One ng of Cry ICa band on the blot is detectable with 1/1000 diluted serum. No immuno- reaction is found with the serum collected from rabbits treated with non-recombinant BT51 spores.
  • Example 14 Affinity Purification:
  • the antibody is purified from the antiserum produced against the Bt spore expressing the Bt cry ICa gene as described in Example 13, supra, using the spores as immobilized affinity purification matrix.
  • 20 ml antiserum that has been prepared by centrifuging approx. 40 ml blood collected from an immunized rabbit 20 ml of the Bt spores suspended in water at the concentration of 10 billion spores per 1 ml are added. The mixture is incubated at room temperature for 30 min with gentle shaking and the spores are removed by centrifugation.
  • the spores precipitated as a pellet are washed with 40 ml 0.5 M NaCl + 10 mM Tris-HCl, buffer, pH 8, by repeating centrifugation three times and with water once.
  • the washed spores are then suspended in 20 ml of water and chilled on ice, and NaOH is added to a final concentration of 0.05N.
  • the resulting high pH releases the antibody bound to the spores.
  • the spores are removed by centrifugation at 2 0 C and the pH of the supernatant that contains the antibody is lowered to pH 7.5 with 20 mM Tris-HCl buffer, pH 7.5 and HCl.
  • the affinity purified antibody is diluted to 1/1000 with PBS and is shown to be functional by Western blot as described in Example 13, supra. Purity of the affinity purified antibody is tested by SDS-PAGE which shows a single band at the size of immunoglobulin.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Pest Control & Pesticides (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Agronomy & Crop Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Dentistry (AREA)
  • Wood Science & Technology (AREA)
  • Environmental Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
EP05795245A 2004-07-20 2005-07-20 Verfahren zur herstellung und verwendung von rekombinanten sporen des bacillus thuringiensis Withdrawn EP1778714A4 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US58898204P 2004-07-20 2004-07-20
US59114204P 2004-07-27 2004-07-27
PCT/US2005/025788 WO2006012366A2 (en) 2004-07-20 2005-07-20 Methods for making and using recombinant bacillus thuringiensis spores

Publications (2)

Publication Number Publication Date
EP1778714A2 true EP1778714A2 (de) 2007-05-02
EP1778714A4 EP1778714A4 (de) 2008-05-21

Family

ID=35786687

Family Applications (1)

Application Number Title Priority Date Filing Date
EP05795245A Withdrawn EP1778714A4 (de) 2004-07-20 2005-07-20 Verfahren zur herstellung und verwendung von rekombinanten sporen des bacillus thuringiensis

Country Status (2)

Country Link
EP (1) EP1778714A4 (de)
WO (1) WO2006012366A2 (de)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116514936A (zh) * 2023-06-29 2023-08-01 莱肯生物科技(海南)有限公司 一种抗虫蛋白及其制备方法和应用

Families Citing this family (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0504940D0 (en) * 2005-03-10 2005-04-20 Secr Defence Vaccine formulation
US9133251B2 (en) 2008-02-22 2015-09-15 The Curators Of The University Of Missouri Bacillus based delivery system and methods of use
WO2012090789A1 (ja) * 2010-12-28 2012-07-05 国立大学法人広島大学 酸化ケイ素と窒化ケイ素とを識別するポリペプチドおよびその利用
CN102408473B (zh) * 2011-11-29 2013-06-12 四川农业大学 一种Bt蛋白Cyt3Aa1、其编码基因及应用
CN102408472B (zh) * 2011-11-29 2013-04-10 四川农业大学 一种Bt蛋白Cry62Aa1、其编码基因及应用
CN102408474B (zh) * 2011-12-07 2013-04-10 四川农业大学 一种Bt蛋白Cry69Aa1、其编码基因及应用
CN102417538B (zh) * 2011-12-07 2013-06-19 四川农业大学 一种Bt蛋白Cry68Aa1、其编码基因及应用
CN102408475B (zh) * 2011-12-07 2013-06-12 四川农业大学 一种Bt蛋白Cyt1Da1、其编码基因及应用
AU2013337422A1 (en) * 2012-11-02 2015-05-07 Genesys Research Institute Compositions and methods for auditory therapy
US9403881B2 (en) * 2013-03-14 2016-08-02 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods of use
US9573980B2 (en) * 2013-03-15 2017-02-21 Spogen Biotech Inc. Fusion proteins and methods for stimulating plant growth, protecting plants from pathogens, and immobilizing Bacillus spores on plant roots
BR112017005509A2 (pt) 2014-09-17 2018-08-14 Bayer Cropscience Lp composições que compreendem células recombinantes de bacillus e um outro agente de controle biológico.
WO2016044533A1 (en) 2014-09-17 2016-03-24 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and a fungicide
US20170295798A1 (en) * 2014-09-17 2017-10-19 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and a fungicide
AR101959A1 (es) 2014-09-17 2017-01-25 Bayer Cropscience Lp Composiciones que comprenden células recombinantes de bacillus y un insecticida
WO2016044542A1 (en) * 2014-09-17 2016-03-24 Bayer Cropscience Lp Compositions comprising recombinant bacillus cells and an insecticide
BR122023020858A2 (pt) 2014-09-17 2024-01-30 Spogen Biotech Inc Semente de planta revestida com um microrganismo recombinante que expressa uma enzima que catalisa a produção de óxido nítrico
KR102179224B1 (ko) * 2014-09-17 2020-11-16 바이엘 크롭사이언스 엘피 재조합 바실루스 세포 및 또 다른 생물학적 방제제를 포함하는 조성물
PE20170942A1 (es) * 2014-10-16 2017-07-13 Monsanto Technology Llc Proteinas de variantes de secuencias de aminoacidos de cry1da1 activas para lepidopteros
BR112018068719A2 (pt) * 2016-03-16 2019-01-22 Spogen Biotech Inc métodos para produzir uma resposta imunogênica em um animal aquático e composição farmacêutica
IL295513B1 (en) 2016-03-16 2024-04-01 Spogen Biotech Inc Methods for promoting plant health using free enzymes and microorganisms that cause enzyme overexpression
AU2017342921B2 (en) * 2016-10-10 2023-06-15 Monsanto Technology Llc Novel insect inhibitory proteins
AR113123A1 (es) * 2017-09-20 2020-01-29 Spogen Biotech Inc Proteínas de fusión, bacterias recombinantes y fragmentos del exosporio para promover la salud de las plantas
JP2021508235A (ja) 2017-11-16 2021-03-04 バイエル クロップサイエンス エルピーＢａｙｅｒ Ｃｒｏｐｓｃｉｅｎｃｅ Ｌｐ パエニバチルス（Ｐａｅｎｉｂａｃｉｌｌｕｓ）に基づく内生胞子ディスプレイプラットフォーム、生産物および方法
TWI728264B (zh) * 2018-09-10 2021-05-21 高雄醫學大學 控制蚊媒傳染疾病傳播之微生物製劑
CN111440814A (zh) * 2020-02-26 2020-07-24 中国农业科学院作物科学研究所 抗虫融合基因mCry1AbVip3A、其表达载体及应用
WO2023137458A1 (en) * 2022-01-14 2023-07-20 Syngenta Crop Protection Ag Compositions and methods for screening insecticidal proteins

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996023063A1 (en) * 1995-01-26 1996-08-01 Michigan State University Method of producing and purifying enzymes
US5800821A (en) * 1995-03-10 1998-09-01 New England Medical Center Hospitals, Inc. Bacterial spores as a heat stable vaccine delivery system

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030165538A1 (en) * 2000-06-26 2003-09-04 Maxygen Incorporated Methods and compositions for developing spore display systems for medicinal and industrial applications
US20020150594A1 (en) * 2000-06-26 2002-10-17 Maxygen, Inc. Methods and compositions for developing spore display systems for medicinal and industrial applications

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996023063A1 (en) * 1995-01-26 1996-08-01 Michigan State University Method of producing and purifying enzymes
US5800821A (en) * 1995-03-10 1998-09-01 New England Medical Center Hospitals, Inc. Bacterial spores as a heat stable vaccine delivery system

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
JOHNSON DONOVAN E ET AL: "Spore coat protein synergizes Bacillus thuringiensis crystal toxicity for the Indianmeal moth (Plodia interpunctella)" CURRENT MICROBIOLOGY, vol. 36, no. 5, May 1998 (1998-05), pages 278-282, XP002475744 ISSN: 0343-8651 *
KAUR SARVJEET: "Molecular approaches towards development of novel Bacillus thuringiensis biopesticides" WORLD JOURNAL OF MICROBIOLOGY AND BIOTECHNOLOGY, vol. 16, no. 8-9, 2000, pages 781-793, XP002475745 ISSN: 0959-3993 *
See also references of WO2006012366A2 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116514936A (zh) * 2023-06-29 2023-08-01 莱肯生物科技(海南)有限公司 一种抗虫蛋白及其制备方法和应用
CN116514936B (zh) * 2023-06-29 2023-09-29 莱肯生物科技(海南)有限公司 一种抗虫蛋白及其制备方法和应用

Also Published As

Publication number Publication date
WO2006012366A3 (en) 2006-09-28
WO2006012366A2 (en) 2006-02-02
EP1778714A4 (de) 2008-05-21

Similar Documents

Publication Publication Date Title
EP1778714A2 (de) Verfahren zur herstellung und verwendung von rekombinanten sporen des bacillus thuringiensis
US20030165538A1 (en) Methods and compositions for developing spore display systems for medicinal and industrial applications
CA2413045C (en) Expression system
US8129166B2 (en) Immunogenic minicells and methods of use
CA2339355A1 (en) Anthrax vaccine
US10604548B2 (en) Minicircle DNA vector vaccine platform for foot-and-mouth disease and methods thereof
US20060002956A1 (en) Minicells as vaccines
US20020150594A1 (en) Methods and compositions for developing spore display systems for medicinal and industrial applications
CN101784655A (zh) 可溶性重组二十面体病毒样颗粒的改良生成和体内装配
Pilehchian et al. Fusion of Clostridium perfringens type D and B epsilon and beta toxin genes and it’s cloning in E. coli
CN101843899B (zh) 耐甲氧西林金黄色葡萄球菌（mrsa）重组多亚单位基因工程疫苗及其制备方法
KR101765394B1 (ko) 돼지 유행성설사 바이러스의 에피토프 단백질, 이를 암호화하는 유전자를 포함하는 재조합 벡터, 이를 발현하는 형질전환체 및 이를 포함하는 돼지 유행성설사 바이러스 예방 또는 치료용 조성물
CN109929015B (zh) 苏云金芽胞杆菌杀虫基因cry79Aa1、表达蛋白及其应用
CN111925426A (zh) 一种产气荚膜梭菌α毒素突变体、表达系统、制备方法及应用
CN1083527A (zh) 重组昆虫痘病毒
WO2007050103A2 (en) Recombinant bacteria without selection marker
WO2018106578A1 (en) Oral e. coli vector-based vaccine for prevention of coccidiosis in poultry
CN110240657B (zh) 一种具有免疫保护性的副猪嗜血杆菌融合蛋白AfuA-OppA2
WO2010064861A2 (ko) 프로모터 변이체 및 이를 이용한 단백질 생산방법
CN110229234B (zh) 一种具有免疫保护性的副猪嗜血杆菌融合蛋白CdtB-OppA
CN109825530B (zh) 去除炭疽芽胞杆菌中pXO1质粒的方法
KR20200024804A (ko) 면역원성시스템 및 이를 포함한 동물 백신
Wang et al. Presenting a foreign antigen on live attenuated Edwardsiella tarda using twin-arginine translocation signal peptide as a multivalent vaccine
US20240148859A1 (en) MICROORGANISM DISPLAYING ANTIGENIC PROTEIN OF THE SARS-CoV2 CORONAVIRUS
CN112342159B (zh) 一种芽孢杆菌新菌株hsy204及其杀虫基因和应用

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20070219

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

RIN1 Information on inventor provided before grant (corrected)

Inventor name: GOLDMAN, STANLEY

Inventor name: LIBS, JOHN

DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20080421

17Q First examination report despatched

Effective date: 20080820

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20091020