CN109929015B

CN109929015B - Bacillus thuringiensis insecticidal gene cry79Aa1, expression protein and application thereof

Info

Publication number: CN109929015B
Application number: CN201910306777.3A
Authority: CN
Inventors: 李海涛; 刘荣梅; 高继国; 张�杰
Original assignee: Northeast Agricultural University
Current assignee: Northeast Agricultural University
Priority date: 2019-04-17
Filing date: 2019-04-17
Publication date: 2021-08-31
Anticipated expiration: 2039-04-17
Also published as: CN109929015A

Abstract

The invention relates to a bacillus thuringiensis insecticidal gene cry79Aa1, an expression protein and application thereof, belonging to the technical field of biological control. An insecticidal protein Cry79Aa separated from Bacillus thuringiensis LTS290 (the preservation number is CGMCC No.10232) has an amino acid sequence shown as SEQ ID No.2 and a gene for coding the insecticidal protein, and preferably, the nucleotide sequence of the gene is shown as SEQ ID No. 1. The gene has certain poisoning power on lepidoptera pests, is applied to transforming microorganisms and plants to enable the microorganisms and the plants to show toxicity on related pests, and overcomes and delays the generation of drug resistance of the pests on engineering bacteria and transgenic plants.

Description

Bacillus thuringiensis insecticidal gene cry79Aa1, expression protein and application thereof

Technical Field

The invention relates to the technical field of biological control, in particular to a Bt insecticidal gene with high toxicity to lepidoptera agricultural pests and a protein coded by the gene.

Background

Bacillus thuringiensis (Bt for short) is a gram-positive bacterium with wide distribution, is an entomopathogenic microorganism with strong toxicity to pests and no toxicity to natural enemies, and has no toxicity to higher animals and people. It is the microbial pesticide which is the most deeply researched and widely used at present and has activity on more than 16 pests of 3000 meshes. Bt forms Insecticidal Crystal Proteins (ICPs) during sporulation, also known as delta-endotoxins, whose shape, structure and size are closely related to its virulence [ Schnepf.E, Crickmore. N, Van Rie.J., Lereclus.D, Baum.J, Feitelson.J., Zeigler.D.R., dean.D.H.Bacillus thuringiensis and its pest viral crystal proteins, Microbiol.biol.Rev, 1998, 62(3):775- ]. Since the first ICPs gene of Bt was cloned by Schnepf et al in 1981 and its DNA base sequence and the amino acid sequence of its encoded protein were published in 1985, there are 312 cry model genes and 11 cyt model genes currently (4 months in 2019). At present, the prevention and control means of spraying chemical pesticide can naturally reduce the harm of pests to crops, but the chemical pesticide causes environmental pollution, and a large amount of chemical pesticide is sprayed for a long time, so that the drug resistance of the pests is enhanced, beneficial pests and other ecological systems are damaged, the environment is seriously polluted, the production cost is increased, and the ecological balance is damaged. The Bacillus thuringiensis insecticidal crystal protein is widely applied to pest control due to the advantages of good insecticidal effect, safety, high efficiency and the like. In addition to its direct use as a biopesticide, Bacillus thuringiensis, whose gene used was from Bt cry1Ac, has been approved in 1996 in the United states for the first transgenic insect-resistant plant worldwide. In the next few years, pest-resistant corn with cry1Ab gene transferred, pest-resistant potato with cry3Aa gene transferred and the like are disclosed. In China, insect-resistant cotton containing cry1Ac/cry1Ab genes has been widely grown since the official popularization of cotton in 1998. In the first 12 years of commercialization of transgenic crops (1996-2007), farmers increase the amount of transgenic crops grown year by year due to the sustained and stable income that can be gained. In 2017, 1800 million farmers in 27 countries plant 1.89 hundred million hectares of transgenic crops, and the commercialization of the transgenic crops brings economic and environmental benefits to farmers in industrialized countries and developing countries. Bacillus thuringiensis and gene discovery thereof have become important topics in sustainable development of agriculture.

Because the insect-resistant gene types of the current commercialized transgenic insect-resistant crops are single, the risk of reduction of pest refuge and increase of pest resistance to drugs exists when the transgenic insect-resistant crops are popularized and planted in a large area. There is therefore a need to continually isolate highly virulent or new genomes to avoid the risk of increased resistance in pests. Therefore, the screening, separation and cloning of new and high-toxicity Bt insecticidal genes can enrich insecticidal gene resources, provide new gene sources for transgenic crops and engineering strains, improve the insect-resistant effect of Bt transgenic products, reduce the resistance risk of pests to Bt toxic proteins, avoid the arrival of new ecological disasters, and have important economic, social and ecological benefits.

Disclosure of Invention

The invention separates bacillus thuringiensis strain LTS290 from the soil near Lagrange town of Wuchang city, Heilongjiang province, has insecticidal activity to lepidoptera pests such as diamond back moth, beet armyworm, cotton bollworm and the like, clones a new gene cry79Aa1 and crystal insecticidal protein thereof from the strain to be applied to transforming microorganisms and plants, leads the transformed microorganisms and plants to show toxicity to related pests, and overcomes and delays the generation of drug resistance of the pests to engineering bacteria and transgenic plants.

The bacillus thuringiensis insecticidal protein Cry79Aa1 has an amino acid sequence shown in SEQ ID NO. 2.

An insecticidal gene Cry79Aa1, encoding an insecticidal protein Cry79Aa 1.

The nucleotide sequence of the insecticidal gene cry79Aa1 is shown in SEQ ID NO. 1.

An expression vector, characterized by containing cry79Aa1 gene.

The expression vector is pEB-cry79Aa1, the framework vector is pET21b, and the structure of the expression vector is shown in figure 3.

A microbial transformant characterized by containing cry79Aa1 gene.

The application of the insecticidal gene cry79Aa1 in killing lepidoptera agricultural pests.

The application is that the insecticidal gene cry79Aa1 is transformed into plants to make the plants express resistance to agricultural pests, or the protein expressed by the insecticidal gene cry79Aa1 is used as the effective component of biological insecticide to kill agricultural pests.

The agricultural pest is beet armyworm.

The invention separates and obtains a Bacillus thuringiensis strain LTS290 from the soil near the Lagrange town of Wuchang city of Heilongjiang province, the preserving number is CGMCC No.10232, see the patent "Bacillus thuringiensis LTS290, insecticidal gene cry57Ab, expression protein and its application" (ZL2015100098273), the biological characteristic of the strain is that can produce the spore in the growth cycle, and produce the companion cell crystal with the effects of poisoning lepidoptera pest diamond back moth, beet armyworm, corn borer, cotton bollworm and inhibiting the effects of Fusarium at the same time; a positive clone of a new gene, namely pEB-cry79Aa1 (shown in figure 3), is obtained from the strain, the sequence analysis is carried out, the analysis is carried out on NCBI website by applying BLAST and biological software such as DNAMAN, etc., the coding frame of the gene consists of 2190 bases, and the number of coded amino acids is 729. The protein encoded by the gene has the highest amino acid homology with Cry19Bb1 protein, the consistency is 42 percent, the gene belongs to a first-grade new gene, and the gene is formally named Cry79Aa1 by the international delta-endotoxin naming committee.

The cry79Aa1 gene can transform microorganism and plant by conventional method of biotechnology, and shows toxicity to related lepidoptera beet armyworm, cotton bollworm and diamondback moth pests.

The gene is transformed into strain, and the protein obtained by expression can be prepared into biological pesticide for killing lepidoptera pests. Meanwhile, the plant can be transferred to construct an insect-resistant transgenic plant for controlling pests.

The Bt cry79Aa1 gene sequence and the gene expression product thereof which are separated and cloned in the invention can have certain poisoning power on lepidoptera agricultural pests such as asparagus caterpillar, cotton bollworm and diamond back moth, and cry79Aa1 can expand the insecticidal spectrum on the lepidoptera pests. By applying the method to transforming microorganisms and plants to enable the microorganisms and the plants to show toxicity to related pests, the generation of drug resistance of insects to engineering bacteria and transgenic plants can be overcome or delayed.

Drawings

FIG. 1 shows the results of PCR of the full length of cry79Aa1 gene,

FIG. 2 is an SDS-PAGE of proteins expressed in E.coli from cry79Aa1 gene,

wherein: m: high molecular weight protein Marker 1: empty vector component pEB; 2: the Cry57 protein component is prepared by the steps of,

FIG. 3 shows the structure of the recombinant vector pEB-cry79Aa 1.

Detailed Description

The present invention will be described in further detail with reference to examples.

The strain is preserved, and the laboratory of the applicant also can preserve and can release the strain to the outside.

Example 1 obtaining a novel Gene

Through whole genome sequencing, the genome of the strain BtLTS290 contains a cry gene with extremely high similarity to cry19Bb, and a full-length primer is designed

5cry79Aa f TTATTTCGGATAGTTATTGTTATA

cry79Aa r TTGGATTCATATCCTAAAAAGAATG，

PCR amplification was performed with pfuDNA polymerase using the following system.

Make up to 50 μ L of ultrapure water, mix well and centrifuge.

And (3) amplification circulation: denaturation at 94 ℃ for 1 min, annealing at 54 ℃ for 1 min, extension at 72 ℃ for 1 min, 25 cycles, and final extension at 72 ℃ for 10 min. As shown in fig. 1.

1.2 connection scheme

Make up the volume to 10. mu.L with ultrapure water, mix well, and attach for 4h at 16 ℃ or overnight at 4 ℃.

Designing a full-length primer of the cry79Aa1 gene, amplifying to obtain the full-length gene, connecting the full-length gene with a carrier pEB (public carrier which is stored in laboratories and can be released to the outside), transforming into a competent JM109, and screening out a positive recombinant plasmid containing the cry79Aa1 gene through resistance screening and PCR identification analysis. FIG. 1PCR identification results. The purified fragment was ligated with the vector pET21b to transform Escherichia coli JM109, to obtain a positive transformant. Sequencing analysis is carried out on the insert fragment to obtain a sequence SEQ ID NO.1, and the amino acid sequence of the insert fragment is shown as SEQ ID NO. 2. The correct size of the band of interest was obtained by PCR amplification, and the band of interest was purified and sequenced. Sequencing results show that the cry79Aa1 gene in the BtLTS290 strain has the size of 2190bp, encodes 729 amino acid residues, has the amino acid similarity with cry19Bb1 of 42 percent, and is formally named as cry79Aa1 by the international naming committee of Bt delta-endotoxin genes.

1.3 transformation protocol

1.3.1 E.coli transformation

1. Picking single colony to shake culture in 5ml LB overnight;

2. inoculating into LB liquid medium at 1%, culturing at 37 deg.C and 230rpm for 2-2.5hr (OD)₆₀₀＝0.5-0.6)；

Centrifuging at 4,000rpm at 3.4 deg.C for 10 min;

4. discard the supernatant and add pre-cooled 0.1M CaCl₂50ml of suspension cells are placed on ice for more than 30 min;

centrifuging at 4,000rpm at 5.4 deg.C for 10min, and recovering cells;

6. 0.1M CaCl precooled with 2-4ml ice₂Resuspend the cells, and divide into 200. mu.l/0.5 mL centrifuge tubes and store at 4 ℃ (one week possible).

7. 200. mu.l of competent cells were mixed well with 5. mu.L of the ligation product and ice-cooled for 30 min.

Heat shock at 8.42 deg.C for 1.5min, and ice bath for 3 min.

9. Adding 800. mu.l LB culture medium, culturing at 37 ℃ for 45 min.

10. 200 μ l of the plate was smeared and cultured at 37 ℃ with the corresponding antibiotic and IPTG, X-gal.

Example 2 Gene expression and Activity assay

2.1.1 plasmid DNA was extracted from the above clones and transferred to the recipient bacterium Rosetta (DE3) to obtain an expression strain.

After IPTG induction expression, SDS-PAGE protein electrophoresis detection is carried out.

The process of inducible expression is as follows:

1) activating the strain (37 deg.C, 12 hr);

2) inoculating 10% of the extract into LB medium (37 deg.C, 2 hr);

3) adding inducer IPTG, inducing at 150rpm and 18-22 deg.C for 4-20 h;

4) the cells were collected by centrifugation and suspended in 10mM Tris & Cl (pH 8.0);

5) breaking the thallus (complete ultrasonic breaking);

centrifuging at 12,000rpm for 10min 4 ℃;

collecting supernatant and precipitate, respectively 10-15 μ L, and performing electrophoresis detection.

The polyacrylamide gel was prepared as follows.

Loading: loading 10-15. mu.l, electrophoresis: constant pressure of 130-150V.

Dyeing and decoloring: taking out the gel after electrophoresis, washing with distilled water, placing into staining solution, shaking at 60rpm for staining for about 1hr, decolorizing in decolorizing solution for about 2hr until the background of the gel is transparent, and rinsing with clear water until the protein band is clear.

The recombinant plasmid pEB-cry79Aa1 (see FIG. 3) was transformed into E.coli Rosetta (DE3), expression was induced by IPTG, and gel electrophoresis was performed on SDS-PAGE (12%). The result shows that the cry79Aa1 gene can efficiently express about 84kDa protein in Escherichia coli through an expression vector pEB, and no specific target band is generated by an IPTG-induced empty pEB vector transferred into Rosetta (DE3) (FIG. 2).

2.2 determination of insecticidal Activity of protein encoded by cry79Aa1 Gene

The insecticidal activity of cry79Aa1 gene expression protein on lepidoptera pests is determined by diluting with water to different concentrations and specifically by measuring the insecticidal biological activity by a feed mixing method. Preparing expression protein samples with different concentration gradients, subpackaging the prepared expression protein samples in sterilized culture dishes, respectively stirring and uniformly mixing the expression protein samples with feed, selecting active primarily hatched larvae to be connected to the feed, repeating the treatment for 3 times, and repeating the agricultural pests of the plutella xylostella, the cotton bollworm and the beet armyworm for 30 test insects. The negative control was 10mmol/L Tris-Cl solution. The breeding conditions of the test insects comprise that the test insects are cultured in an illumination incubator with the relative humidity of 70-80% and the temperature of 27 ℃, the number of dead and live insects is investigated after 48 hours of breeding, and the death rate is calculated.

As shown in the table I, the preliminary insecticidal activity of the expressed Cry79Aa1 protein is determined, the concentration of beet armyworm and cotton bollworm is 100 mug/mL, the concentration of diamond back moth is 50 mug/mL, each treatment is repeated for 3 times, 10 mmol/LTris-Cl solution is used as a negative control, and the Cry79Aa1 protein has certain insecticidal activity to the beet armyworm. The insecticidal activity to diamondback moth and cotton bollworm is weaker. The specific results of the bioassay are shown in table one.

Table 1 Cry79Aa1 protein bioactivity results

Tab.1 The bioassay results of Cry79Aa1 proteins

The invention has the beneficial effects that: the Bt cry79Aa1 gene sequence and the gene expression product thereof which are separated and cloned can generate toxicity to lepidoptera, particularly have certain poisoning effect on asparagus caterpillar, can expand the insecticidal spectrum to lepidoptera pests, show the toxicity to related pests by being applied to transformed microorganisms and plants, and can overcome or delay the generation of drug resistance of insects to engineering bacteria and transgenic plants.

Sequence listing

<110> northeast university of agriculture

<120> Bacillus thuringiensis insecticidal gene cry79Aa, expression protein and application thereof

<141> 2019-04-17

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2190

<212> DNA

<213> Bacillus thuringiensis (Bacillus thuringiensis)

<400> 1

atgactaata attatccccg gtatccagta gctaataact cacaaacttc tatgcaaaat 60

acgaattata aggatcggat gaatatgtgg gattcaaata ctattaatta tagaaggatt 120

gattctagtc ctgaagctta tgtttcagcc aaatctgcaa tttccactgg gattagtatt 180

ttctctaaac tattaagtta tttaggccta ggacttgtgg cagactcaat taacataacg 240

atgtctcttg taaatacact ctggaatgag cagaataata tatgggacaa cttattaagg 300

catgtagagg atcttatgaa tcaaaaaata tcagatttag tattatctaa tgcaaatgta 360

gaattgaccg ctttaaaaag gagtttaaac gaatatgccg cctctttaga gaattggaaa 420

aaaaatcctg gtaatccaaa tgctatagag catatcaaat cacaatttac aattactcat 480

aatttttttg tggatcgtct ggctgttttc gcacatccag gctatgaagt attattatta 540

tctgtatatg tacaagcagc aaatcttcat ttactcttat taagagatgc aagcatctat 600

ggaaatcaat gggggctagc tcgaagcaat agtaattatt attatgggag gcaattgtat 660

tatacaaatg aatacacgaa tcattgtgtg aattggtatc acaatggttt aaatcgctta 720

agaggcacaa caggggcaca ttggttgaat tttaatcgat tccgtacaga aatgacatta 780

acagtattag atattattgc attatttcca acttatgatt atcgaaaata tccagcattc 840

acaaaagtag aattatctag ggtaatttat accgatccag taatttatga tgggttttca 900

caactaccta gtaataatgc tggtaatttc aatgattttg aaagagaagc aataggtatt 960

ccttctttaa ccaagtggtt aaagaaaatt gaaatatcta ctggagaaat tagatttgct 1020

acgaatccac atacaggtga ttgggtaaca aatgtatgga acggtaatac taatacgttc 1080

gcatttacag aatcatcatc tgaagtagtt gaaagccatg gaataatgac aaataatcgt 1140

acttctctaa atatgaataa ttttgataac tttagagtag atttacgttc gcattgtttt 1200

agtcaagggg cacctttcta cgatgttttt gggataggtc gctctcaatt ctttaatgga 1260

agaacaaaca taatctatga taacgaaatc ggaataacag atcgttataa tcgtcatcgt 1320

catcaaacta caacgataag tttgccagga gcaaattcgg aacaagcaac tgcaaatgat 1380

tatagtcata ggctagcgga tgtaagaaac ctcacagggg gacttcgtca aaatcctcca 1440

cagcagaata tgggacgttc ctctttaata ggacatgggt ggacacatgt aagtatgaaa 1500

cgcgagaata tattagaatt agataaaatt actcaaattc ctgcggtgaa aagtaatgga 1560

tggatgtttt ctggtgactt attaagaggt cctggtcata caggtggaga cttagtgact 1620

cttggtaatg gggatagata tacactaaat attattttcc cagcacaagc ttatcgcatt 1680

cgcgttcggt atgcttctaa tggcgacggc gagatgggta tcgatgtaaa tggggtagga 1740

tatacccgtt ttagtataaa gtgcactttt tctcataata attataataa tttaaattcc 1800

caagatttct gtttagtgga tacatctttt atttacaatg caacttatac aggatcaaag 1860

actatatggt tatacagtta ttcaacaaca cgagtgatta tagataaaat tgaatttata 1920

ccagttggga tttttgcaaa tcaatcattt gaagaaacag aaggatataa tcaaaactat 1980

agccattacg acccaaacat ggatactaca taccaaccaa actatgacaa tgggtatgaa 2040

caaaataact atgatagtta tgatcaaagt tgtaataata cttacgaatc caaccatgac 2100

tgtaattgta atcaagaata taccaacaac tataatcaaa actctggttg tacgtgcaac 2160

caaaagtata acaataacta tccgaaataa 2190

<210> 2

<211> 729

<212> PRT

<213> Bacillus thuringiensis (Bacillus thuringiensis)

<400> 2

Met Thr Asn Asn Tyr Pro Arg Tyr Pro Val Ala Asn Asn Ser Gln Thr

1 5 10 15

Ser Met Gln Asn Thr Asn Tyr Lys Asp Arg Met Asn Met Trp Asp Ser

20 25 30

Asn Thr Ile Asn Tyr Arg Arg Ile Asp Ser Ser Pro Glu Ala Tyr Val

35 40 45

Ser Ala Lys Ser Ala Ile Ser Thr Gly Ile Ser Ile Phe Ser Lys Leu

50 55 60

Leu Ser Tyr Leu Gly Leu Gly Leu Val Ala Asp Ser Ile Asn Ile Thr

65 70 75 80

Met Ser Leu Val Asn Thr Leu Trp Asn Glu Gln Asn Asn Ile Trp Asp

85 90 95

Asn Leu Leu Arg His Val Glu Asp Leu Met Asn Gln Lys Ile Ser Asp

100 105 110

Leu Val Leu Ser Asn Ala Asn Val Glu Leu Thr Ala Leu Lys Arg Ser

115 120 125

Leu Asn Glu Tyr Ala Ala Ser Leu Glu Asn Trp Lys Lys Asn Pro Gly

130 135 140

Asn Pro Asn Ala Ile Glu His Ile Lys Ser Gln Phe Thr Ile Thr His

145 150 155 160

Asn Phe Phe Val Asp Arg Leu Ala Val Phe Ala His Pro Gly Tyr Glu

165 170 175

Val Leu Leu Leu Ser Val Tyr Val Gln Ala Ala Asn Leu His Leu Leu

180 185 190

Leu Leu Arg Asp Ala Ser Ile Tyr Gly Asn Gln Trp Gly Leu Ala Arg

195 200 205

Ser Asn Ser Asn Tyr Tyr Tyr Gly Arg Gln Leu Tyr Tyr Thr Asn Glu

210 215 220

Tyr Thr Asn His Cys Val Asn Trp Tyr His Asn Gly Leu Asn Arg Leu

225 230 235 240

Arg Gly Thr Thr Gly Ala His Trp Leu Asn Phe Asn Arg Phe Arg Thr

245 250 255

Glu Met Thr Leu Thr Val Leu Asp Ile Ile Ala Leu Phe Pro Thr Tyr

260 265 270

Asp Tyr Arg Lys Tyr Pro Ala Phe Thr Lys Val Glu Leu Ser Arg Val

275 280 285

Ile Tyr Thr Asp Pro Val Ile Tyr Asp Gly Phe Ser Gln Leu Pro Ser

290 295 300

Asn Asn Ala Gly Asn Phe Asn Asp Phe Glu Arg Glu Ala Ile Gly Ile

305 310 315 320

Pro Ser Leu Thr Lys Trp Leu Lys Lys Ile Glu Ile Ser Thr Gly Glu

325 330 335

Ile Arg Phe Ala Thr Asn Pro His Thr Gly Asp Trp Val Thr Asn Val

340 345 350

Trp Asn Gly Asn Thr Asn Thr Phe Ala Phe Thr Glu Ser Ser Ser Glu

355 360 365

Val Val Glu Ser His Gly Ile Met Thr Asn Asn Arg Thr Ser Leu Asn

370 375 380

Met Asn Asn Phe Asp Asn Phe Arg Val Asp Leu Arg Ser His Cys Phe

385 390 395 400

Ser Gln Gly Ala Pro Phe Tyr Asp Val Phe Gly Ile Gly Arg Ser Gln

405 410 415

Phe Phe Asn Gly Arg Thr Asn Ile Ile Tyr Asp Asn Glu Ile Gly Ile

420 425 430

Thr Asp Arg Tyr Asn Arg His Arg His Gln Thr Thr Thr Ile Ser Leu

435 440 445

Pro Gly Ala Asn Ser Glu Gln Ala Thr Ala Asn Asp Tyr Ser His Arg

450 455 460

Leu Ala Asp Val Arg Asn Leu Thr Gly Gly Leu Arg Gln Asn Pro Pro

465 470 475 480

Gln Gln Asn Met Gly Arg Ser Ser Leu Ile Gly His Gly Trp Thr His

485 490 495

Val Ser Met Lys Arg Glu Asn Ile Leu Glu Leu Asp Lys Ile Thr Gln

500 505 510

Ile Pro Ala Val Lys Ser Asn Gly Trp Met Phe Ser Gly Asp Leu Leu

515 520 525

Arg Gly Pro Gly His Thr Gly Gly Asp Leu Val Thr Leu Gly Asn Gly

530 535 540

Asp Arg Tyr Thr Leu Asn Ile Ile Phe Pro Ala Gln Ala Tyr Arg Ile

545 550 555 560

Arg Val Arg Tyr Ala Ser Asn Gly Asp Gly Glu Met Gly Ile Asp Val

565 570 575

Asn Gly Val Gly Tyr Thr Arg Phe Ser Ile Lys Cys Thr Phe Ser His

580 585 590

Asn Asn Tyr Asn Asn Leu Asn Ser Gln Asp Phe Cys Leu Val Asp Thr

595 600 605

Ser Phe Ile Tyr Asn Ala Thr Tyr Thr Gly Ser Lys Thr Ile Trp Leu

610 615 620

Tyr Ser Tyr Ser Thr Thr Arg Val Ile Ile Asp Lys Ile Glu Phe Ile

625 630 635 640

Pro Val Gly Ile Phe Ala Asn Gln Ser Phe Glu Glu Thr Glu Gly Tyr

645 650 655

Asn Gln Asn Tyr Ser His Tyr Asp Pro Asn Met Asp Thr Thr Tyr Gln

660 665 670

Pro Asn Tyr Asp Asn Gly Tyr Glu Gln Asn Asn Tyr Asp Ser Tyr Asp

675 680 685

Gln Ser Cys Asn Asn Thr Tyr Glu Ser Asn His Asp Cys Asn Cys Asn

690 695 700

Gln Glu Tyr Thr Asn Asn Tyr Asn Gln Asn Ser Gly Cys Thr Cys Asn

705 710 715 720

Gln Lys Tyr Asn Asn Asn Tyr Pro Lys

725

Claims

1. The amino acid sequence of the insecticidal protein Cry79Aa1 is shown in SEQ ID NO. 2.

2. An insecticidal gene Cry79Aa1 encoding the insecticidal protein Cry79Aa1 of claim 1.

3. The insecticidal gene cry79Aa1 of claim 2, having a nucleotide sequence as shown in SEQ ID No. 1.

4. An expression vector comprising the cry79Aa1 gene of claim 2.

5. The expression vector of claim 4, wherein the backbone vector is pET21 b.

6. A transformant of a microorganism, which comprises cry79Aa1 gene of claim 2.

7. The use of the insecticidal gene cry79Aa1 of claim 2 for killing lepidopteran agricultural pests, said lepidopteran pests being beet armyworm, diamondback moth, and cotton bollworm.

8. The use according to claim 7, wherein the insecticidal gene cry79Aa1 is transformed into a plant to make the plant express resistance to agricultural pests, or the insecticidal gene cry79Aa1 is expressed as an effective component of a biopesticide to kill agricultural pests.

9. The use according to claim 7, wherein the agricultural pest is beet armyworm.